Echinops_telfairi Locus EEF2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi EEF2
Echinops_telfairi
EEF2
GeneScaffold_6458
SNORD37
3579..3643
8838
AGGAATAACAACGCAAGTTCCTTGAAAATAGCTCCTGTGTGTCAGCCAGGTGTCAATGT
CTCTCCCTAAGAACAGTAAGGGGTTACTGAGGACCCCCATTTCACAGAAGAGGAAACTGA
GGCATGGGGATGAAAGCGCACTGTGGTGGTGGGGCCCCCGGTGATAGACATCGCTGTATC
CACAGCACTGAGAACCACACAGCGAGTTACACACACACACACACACACACACACACACAC
ACACGGCAGTCCAGTTCTAGTCCGACGTGAAACGACCTTATAGGACAGAATAGAACTGCC
CCAGGGGGTTTCTGAGGCTGTAATTCCTTAGGGAAGCAGGCAGCCACATCTTGGCTCCAG
AGGTGAGTCTGTACACCGAGCTTCCCGTGCCAACCGGGGCTTTGTTTCTGCCACATAGCA
CGTAATTAACCTGTATTTGTTGAATAAAAGAACGACGGGTGGTTTTTTAAACGCCTTTTA
ATTTAGAAATAACGACGGATTTACCAGGAGCTGCAAAAACAGTCCACAAAAGGACCTAGT
ACCGCGGTATCATCTTACATAATAAGACCAAAAGCAGAATATGGATTTAACAGTCCAGAT
CCGCACAGGCGGTGAAGGGCGTTTCTAGTAGTTGGCCTTTTGCAAACAAATAGAGTCGCT
GTTATTATTCTCTTCAGCGCCAGCGAACCTGAATGCTGCCTCCCGGCGGCTTGTAACCCT
CTGTCGGGCGACCCCCAGCCCCGGGCAATCTGGACTCTCAAGGCCAATCCAAGGGAAGCC
AGCAGAGCCGGCGCCACAAGGGTTAACCGGAGGGCCGCGGCGTCGCGCCTGCGCGCTGCG
TCGCCCCGCCCCCGCAGCGTCAGCTGACCCGCCCAACCGGCGTCCTCCTATAAAAGGAAG
AGCGTTGACGTCAGCGTTCTCTTCCGCCGTCGTCGCCGCCATCCTTGGCGCGACTCGCAT
CGCTCCTTTCTGCCTGGGAGAATCCACCGCCATCCGCCACCATGGTGAGTGCGGTCGCCC
GGCAGACGGCCTAGGACGGAGGCCGGGTCTCCGCAGGGCCGACGAGGCTGGTCCTGGGGC
TCGAAGGCCGCCCGGAACTAGGGGGCGGGGGGACATGACGGGCGGCCTTGGAGTGGCGGG
CGCGGGGCTGGGGACGCGGCCGCCGCCATGTCTGCCCAGCCGAGGGGAGCCCCCTCCGCT
TCCGGGGCTCCGCTCGCGGGAGCTCGGGCCTGGCGGGGTCCGGGCGGAGCCGGCCGGCGG
GGCTGGTGATGTGGCAGGCGCTGTAATGGCGGGCGCCGCGGCGGAGAGGGGGGCGCCGTG
CCGGGCCCGCGCGCCATGAGTCTGAGCTCTGCCGGCCGCCGCGGGGCCGTAGGCGGCGGA
GAAATAGCGGGGGGAGCTCCAGGGGACGGGAGGTGCTCCCACTCTCTTCAATTGTAGGGG
ATTCCTCAACGGCGAGGAGCTATCCTTTTGGCCGCCGGGTGGAGTCGGGAGGAGGGGGCT
GCGGAGGGCATGTTTGGGGTTGGAGGTGGTCTCGGTCCTCCACTCTGACGGGAGGGTGAC
CTTGGGGAAGCTAAAAGGCTATTTGGTGAAGGAGCACGGTGCCTGGGTGTCAGCATTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCCCGGCCTGCTCCTGG
CTGCAGGCCTGGCTGTGGGATCGATCAACGACCCAGGGCCAAGCCGCTTCCTGGAACAGC
AAACCCACTCCCCCACCCCCCACCCCCGCAGGTGAACTTCACCGTCGATCAGATCCGGGC
CATCATGGACAAGAAGGCCAACATCCGTAACATGTCGGTCATCGCCCACGTGGACCACGG
CAAGTCCACGCTGACCGACTCCTTGGTATGCAAGGCGGGCATCATCGCGTCAGCTCGTGC
TGGGGAGACACGCTTCACGGACACGCGCAAGGACGAGCAGGAGCGCTGCATCACCATCAA
GTCCACGTGAGGCCCCACCCCTTCCCTGGAGGCCACTCCTACCACTGCCACTTGGAGCCA
GGGCTCCTGGTTCCATGGGCAGAAACCCTGTTCCCTTCCTTTAGCTATAGAGAGGGGCTT
CACATGGGTTGGGGCAGTCCTTCCAGTGGGCAGTTAGGTCCTCCTGGGGACGTTCGTCTG
TAGTCCCTGGTCAAGCTCTGGGTTGTCCCTTTTAGGACAGAGGTAGGCTACTCCAAGCAC
CCGAGTTGAGCCATACTGAGGGCCAATCTCCCTAAGAGTGGGTCCTTTTGGGGGTCCTGA
GTCTGGTGGTGGCAGTACCTGGGGTGAAGCAGTGTGGTGCTGCCTGGATTGGAGTGCTGG
GATGGTGAGGCTGTGACTCGAGTGTGACATCAAGCTGTGGAGCAGCTGGGTGGCACTCTG
TCATCTGAGTGGTCTCAGCTGCGACTCTCTCACAGCGCTCTCTCTCTTCTACAGCTGTCA
AGATGACTAACTCATCAGCAACAAGACGGTCGGTTTTATAATTATCAGTGAGAGCCATGT
CGTGCGCTCGTCATGACGCTCTGTGACTGTCGTGTGTAACGACGCTGCACATCACATACG
TATAAAGCGCTGCTCGCGGTTCATCCCTGAACTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCCCGTGCTGATGATGAACAAAG
ATGGACCGGGCCCTGCTGGAGCTGCAGCTGGAGCCTGAGGAGCTGTACCAGACCTTCCAG
CGCATTGTGGAGAACGTCAACGTCATCATCTCCACTTACGGCGAGGGCGAGAGCGGCCCC
ATGGGCAACATCATGGTGCGGAGCTCTGGGCCCAGCAGGATTGGGGTGGCCCGGGGGCTC
GTAAGGTGCCTCCGGCGGGTGAGGGCTGCACCAGTGCATACCCATGATGACTGACATTTC
TTCACTTTGACCTGATGTTTGTTGAAGAAACATGATGTCTGAGGTTCCCAGAGCCCATTG
GGTCTGGGGGCGGCAGTCCCTGCCTATGTGACAGCCCCACTCTCATTCCCTCCCAGATTG
ACCCCGTCCTGGGTACTGTTGGCTTCGGCTCCGGACTCCACGGCTGGGCCTTTACCCTGA
AGCAGTTTGCAGAGATGTATGTGGCCAAGTTTGCCGCCAAGGGTGAGGGCCAGCTGGGGC
CTGCTGAGCGGGCCAAGAAAGTGGAGGACATGATGAAGAAGCTCTGGGGTGACCGGTATG
TGTGGGGCATGTGGGTCAGCGTCTTATGGGTGGCACTTGCTGGGGCTGTCTTGTCTTGAG
AATGACATCCACATTTCATTCATGGGTGGTGGTATCATCCCAGACCCTCAAACCTGATTA
GGGTGGGCTTTCTCTGTCAGGTATTTCGACCCCACCAATGGCAAGTTCAGCAAGTCTCCC
AGCAGTCCTGATGGCAAGAAGCTGCCCCGGACGTTCTGCCAGCTCATCCTGGACCCCATC
TTCAAGGTGTGTGTACTGCCCGTGACGCCCTCTGCCCCGATGGCAACCCACATGCGGTGA
CGGCGGGGCAGGATGGGGTGGGTGGAGGGTTCTGGACCAAAAATGGGTGTCATGTGACGA
GGTTAAGGTAAGGTGGGAGATCTTGTAGAATGGTCCCAAGGTAGGCACAGGCTTGAGCTA
GACCTTTGTAAACTCCCCAAACCAGAGCAGGCTTTCGCCTGCATTCTGAGAGCAGTCAGA
CTCTTGTCCTGCGGGACCTGGTCTCAGCACATCTCACTCCTACTCGGCCCTTTCAGGTGT
TCGACGCCATCATGAGCTTTAAGAAAGAGGAGACGGCTAAGCTGATTGACAAGCTGGACA
TCAAGCTGGACAGCGAGGACAAGGACAAGGAGGGCAAGCCCCTCTTGAAGGTGCGTGACC
AGCAGTTGCCGAGTGGTCCCTGGCTGTGGTCAGCAGAGATGCACCCCTGCCCTGAGTGGT
GACCCTGGCCTACTCACACAGGCTGTGATGCGGCGCTGGCTGCCAGCTGGGGACGCGCTG
CTGCAGATGATCACCATCCACCTGCCCTCCCCCGTGACGGCCCAGAAGTACCGCTGCGAG
CTGCTCTATGAGGGGCCCCCCGACGATGAGGCTGCCATGGGTGAGGGCCAGGATGAGAGG
GGGCCCTGTAGAGAATGTGGGGAGCATGGACTCTGGGGCCCAGCCCTCTGTGGCCCCCTG
TGCTGCTCCGGCTTCTGCGCCTGCAAGGAATGATCTTTCTCTCTTCAGGTATTAAAAGCT
GTGACCCCAAAGGTCCCCTCATGATGTACATTTCCAAGATGGTGCCAACCTCCGACAAGG
GTCGCTTCTACGCCTTTGGCCGTGTCTTCTCTGGACTGGTGTCCACCGGCCTTAAGGTCC
GGATCATGGGGCCCAACTACACCCCAGGCAAGAAGGAAGACCTCTACCTGAAGCCCATCC
AGAGGTGGGCACTGCCCAGTCCCCTGAGGAGTTGGTTGCAACCCATGCCAAACTTGGTGG
GTGTGGTCAGCCATGGCTCCCATTTCTAGTCCCTTGGGTCCCAGGGGTGCCCTGCTGTGT
CCTGTTTGCTCTGCAGGCCCTTGTGTGTTGGGACCCAGATGCTTTCTCTGTGGCTTGCAC
CCAGATTTCAGGCACCTTCTAATGGGCTCCCCTTCTGCTTCTCCCATCAGGACGATTCTG
ATGATGGGCCGCTACGTGGAGCCCATTGAGGATGTGCCCTGCGGGAACATTGTGGGTCTA
GTGGGCGTCGACCAATTCTTGGTGAAGACTGGCACCATCACCACCTTTGAGCATGCCCAC
AACATGCGTGTCATGAAGTTCAGCGTGAGCCCTGTGGTCAGGGTGGCCGTGGAAGCCAAG
AACCCCGCTGACCTGCCCAAGCTGGTAGAGGGCCTGAAGCGGCTGGCCAAGTCTGACCCC
ATGGTGCAGGTGTGCCCAGGGACTGAGGGCATGGGGCATGGTGTGTATGGGGGCTGGCAG
GGTTTCCTCTATGGGGTCCCTTGACCTGCTCATCTTGTCCAAAATGTACCTGCTCCATTT
GTTGAGGACCCTGGGTTTTCCCCACGGCTGCTGAGAGCTAGCCTGTCCCAAGAGGTGAGA
TCCTAGGGCCCTGGGGGTCCAGTATTGATTGGTGGGCGGGGCTTTGCAGTGCATTATCGA
GGAGTCGGGCGAGCACATCATTGCAGGGGCTGGTGAGCTGCACCTGGAGATCTGCCTCAA
GGACCTGGAGGAGGACCACGCCTGCATCCCCATGAAGGTCAGCCCCCCTCTCCTACAGCA
GGGAGCCCACCTAGCCCTTGAAAGTTCTGGTGGGAAGAAGATGGGCATACCCCCATGGTC
TGGTTCGCTGGGATCAGCCTCACCCTGCTGGGCGTGGCCTCGGCATGGTTCTCCAGCCCC
CAGTACAGGGTGGGATATATGCTCCTGACCTGCTTGTCAGACCACCCCTCAAACTGGTCC
TGGGAGCTAAGCGTCAACAGCATCCAGGGGTTTCTCTGCCCTTGCTCTCTGAACGTACAT
GCAGTGGCCCCCTGGCCAGACCCTGCAGCCCCTCAGCTGTAGGGGAGTGGGTGCCAGTGG
AAAGGGCCTTGTAACAGTTCTTGGCAGGGGACTGACTTGAGAGTCCTGGATACTTAGATG
CCTGGGAAGTCCCCACCCACCTGGGCAAGTTTCTTAGCTGTGGGCCCCTGCCACCAGCTT
CCCGAGCACTTGCAAGAGAAGCTGTTATGAGATACTCGTCGACGCCCGCCCCGGATGACC
ATCCCCCACTTTACACACTTTACACAGAAATCAGACCCGGTTGTCTCCTACCGCGAGACC
GTCAGCGAGGAGTCTAGCGTGCTCTGCCTGTCTAAGTCCCCCAACAAGCACAACCGGCTG
TACATGAAGGCACGGCCCTTTCCTGACGGTCTGGCCGAGGACATCGACAAGGGCGAGGTG
TCCGCGCGCCAGGAGCTCAAGCAGCGTGCTCGATACCTGGCCGAGAAGTACGAGTGGGAT
GTGGCCGAGGCCCGCAAGATCTGGTGCTTTGGGCCTGATGGTACTGGCCCCAACGTCCTG
ACCGATATCACCAAGGGAGTGCAGTATCTCAATGAGATCAAGGACAGCGTGGTGGCCGGC
TTCCAGTGGGCCACCAAGGAGGTGAGCTAGAGGGAGGGCGGGCGGGGCGGGCTTGGGGTT
GGACTGTGTCTTGAGTCTCGGTGTCTTGTAAGGAGGGTTCTTGGGGTTGCTGGCTGAGTT
GTCGGGCAGGGTGAGGTGACTCATCCCTGACCACACTCCTCAGGAGTCAGCCCGTCTCCA
GAGTTCTGACTGCATTTCCCCTTCCCTGCAGGGTGCGCTGTGCGAGGAGAACATGAGGGG
TGTGCGCTTTGACGTCCATGACGTGACCCTGCACGCCGATGCCATCCACCGTGGGGGCGG
CCAGATCATCCCCACTGCCCGGCGCTGCCTCTACGCCAGTGTGCTGACAGCCCAGCCACG
CCTCATGGAGCCCATCTACCTTGTGGAGATCCAGGTGAAGGCACTACCCGTTACCTTCTG
CCACCCCCCCAGCACTCCCCCCTGCCCCCACAGTTCTGAGCACCCCCTCTTCCTGACAGT
GTCCGGAGCAAGTGGTTGGGGGCATCTATGGCGTTCTGAACAGGAAGCGGGGCCACGTGT
TCGAGGAGTCCCAGGTGGCAGGCACCCCCATGTTTGTTGTGAAGGCCTACCTGCCAGTCA
ACGAGTCCTTCGGTGAGTGCCCACCTTGGCCGGGTCACACTGTCAGGGTCCCACAGTCTA
ACCAGAGAGGTGGGTGTGATAGACAACTCGGGAGGTGATGGGAAGGTGGCCTAGGCTAAA
AGGGAGGGAATAATTTCTATTCTGCGGGAAGAGCAAGGGTAGGTACTGTAACCACAGCAG
GGAAGGGGGGGTGGTGGTGGTGGGCAGAAGCCCAGTTGAGCAGGGCCACTGGGTCCCCAG
CACTTAGCCCCATCCCCTCCTGCAGGCTTCACAGCCGACCTGCGGTCCAACACTGGCGGC
CAGGCCTTCCCGCAGTGCGTGTTCGACCACTGGCAGATCCTGCCCGGGGACCCCTTCGAC
AACACCAGCCGGCCCTGCCAGGTGGTGGCCGAGACGCGCAAGCGCAAAGGCCTAAAGGAG
GGCATCCCGGCCTTGGACAACTTCCTGGACAAATTGTAGGTGGCCTCATGGTGGCCACCG
GCAGGCCCCGGGTGGGACTGGGCCAGCACCGACAGCAACACCTTGTCACCCTGGCCCTAG
GGCGGGGCGGGGCCTGCTCGGTGCCACCCTCTGCATTCACACTCAATGCCATCTCCCGGT
ATTTATTTCAGGGGCCGCGGGGTGAACGGCTTCTTGGCAGGACTTAATTGGCCGGTGGGG
AGGTGGGACATGGGACACCCTGACACCCCGCCCCCCAATTTCTTAAGAAGGAAACTCAAA
CGTCCAAAATATATATATATAAAGTGAAAACATTGGGAAGTTTATCTGGGCGACAGGCCC
TCCTTGGACAGCCAGCCACCAGAGGCAGGGAGGGAGTTATGTGTGGGCTTATGGGGTGCA
CCTCCAGCTGTGTCAGTGCCATTGGGTGTAATAAATTCGGAATGGTGGTGACCCTCTGTC
GCCTGCTCTGCTCATTCTTCCACTTCTGCCTCCTCCAGGAGGCCAAGTTCCTTTCACGGC
TCTCCCAGGTGTAAGACCGAACCACAAAGGCCACCTTCACCTCTTGAAACTGACGTGTGC
TTGGGATGGGGGGTGCACATTGGGCCAGAGTGGCTAGTAGACCACCTAGGAGGACCCCAG
ACACTCCGAGTGCTGCAGCAGCTCCCTGACAAGGGTAAGTGGGCCTTAGGGGCACCACTT
CCTGAACACCCAGCTTTCCCTGAGAAGGAGCATCAGAGCTTCCAGTACCAAGTTCATGAC
CACTGACACTTGGACTACAGGCCACAAACGCCTTTTAGAAACACCACTGCACGCAAGCAG
TAATCAACACTGAGGAGGGACGAGGCTCTGGTGTCCAGTATTGAGTGCAAGCCAGGGGTT
CCTGGCTCTGGTTCTAACCTAAAGCCATGCACAGCATAGTGACAGCAGGGGACCTCAACA
GAGGCAAAAAGGAAAAACCACAGGGCACAGATGAAGCAAGAAGGATCGTTTTCAGTCCAG
GAGCTGAAAAAGGGTAGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2011..2225, 2976..3157, 3282..3357, 3359..3494, 3716..3894, 4040..4145, 4436..4549, 4641..4779, 4908..5103, 5330..5588, 5809..5916, 6447..6800, 6991..7173, 7259..7391, 7645..7838
1001..1003, 2011..2225, 2976..3157, 3282..3357, 3359..3494, 3716..3894, 4040..4145, 4436..4549, 4641..4779, 4908..5103, 5330..5588, 5809..5916, 6447..6800, 6991..7173, 7259..7391, 7645..7835
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved