Echinops_telfairi Locus ENSETEG00000010526
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000010526
Echinops_telfairi
ENSETEG00000010526
GeneScaffold_1510
SNORA11
6386..6514
7837
GCGCCAATTGCCAAATGCGCATGTGTACAGTGGACATCAAAGAAAGGGCTTATGCAGGG
ACAGTGGGCAGAGCTGTTGTGCCTCCCTCCGCCCTCCAGCAGACGCGCATGCGCACTGTT
GACCTTAGGTTGGGAGTGCTTTGGGAAAAGAGGCGGAGTCCACAGCTGCCGCGCTGGCAA
GTCTTCCTGGAGAAAGGAGGGTGTGGCTGCGCAAGATTCAGAGTTTGGAGCAGTGGTTCT
CAACCTTCCTAATGCCACGACCCTTTAATACAGTTCCTCATGTTGTGATGACCCCCAACC
ATAAAATTATTTTCGTTGCTACTTCATAACTATTTGTGCTACTGTTAGGAATCCTCATGT
AAATATCTGATATGCAGAATGTATTTTCATTGTTACAAATTGAACATGATTACAGCATAG
TGATTCATCACAAAAGCAATAGGGCAATTATGTATTGTGAAATATCTATTTCTAATTACA
AATAAATGAAATTTTGTCTTGAAGCATGGGTGTAGCATGGGGTAACAAATCTTTCATGCT
GGGTACTCATAGTTGGGTGTATCTGCATTGTGGGTGGAACCCGCCTTGGAGAACGAATAG
AGGAGAGGTGGTCTCAGTTTCCTAAAGACTATTTGAAAATATGTGTCTTGCCGGGTGAAT
CCTAAGGCCGATCTCCTTGTGAAGGGGGGTCGCAAACTCCACCAGGGTTTGAGGAAACCA
CCTGCCTTTTAGCCGGGGGTTCTTCAATTTCCTCTGTGTATTGTGAACCAGAAGTCCTAA
GATCGGGGAAGGAACGAAGAGAAGGGAAGTTAAAGATACCTCGAAGTTTTTGTGAAACCT
CCCCAAAGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGATGTAGC
CCTTCTCTCTCAGGCTTAGCTCTTGCCAGGCAACTTCAGATATGTCTGACACAAACAAGA
GTGGTTCTGGTCTAACTCACTTCCCAGGTAAGCCCTCAGTCTGTCCTCTTCCCAACTTCT
TTTCTTTTGTAGTCCCTCTTGCTGTCCCAGATCCCTTGGCCCCTCCCATCCCATCTTTGT
CCTTCTCCACCCACTTTCCTGGCCTGCCGGCCTGCTTCCCCACTCCCCTTCTACCGGTGT
AGCCAGTGGCCCACCCATCTTTAGCCGTCACTTCCTGTCCAGAGGAGGCTTTAATGAGCT
GAGGTGATCTGAAAGCATTGCTGATGTGTTAGTACAAGTTAGAGAAGTGTGACTCTGGAA
TTTTGGAGCCATTTGACTTGTTCAGGGTGATGAGAAGGCCTCCCTCCTTCCTCCTCTTGC
AGGCTGGAGCTCCAGAAGAAGATGGTAGCTTGGTGATGCAGACTCTACTGGCAGTGACCC
AGAACTTGGAGGTCTCAGAGGCACCCAAGACCGTAAATGCACCAGAAGTCTTAGGAGGTC
TGAAGGTTTCAAGCATTCCAGGGGTTTCAAAGGCCTCAGAGTTCTCCAAAGAAACACTGA
TCCCAAAGGCCAAAAGGGTCTCAAAGGCCCAAAAGGCTCCTGAGGCATTTGCCACCCAGG
CATCACCCACCACTCAGCAAACTGATATCCAGGTCCTGACAGCTGAAAACAACAGTCCAG
CAACTGACATCAAGATGCAAAATGCTGATCCGCAGGCTGTGCCAGTGCATGCTACTGAGA
CCAAAAAAGTGGGTTCTGTGCCTGATACCCAGGTCAATACAAAGGCCCTGGAGACTGAAG
CTTCTGTTTCTCAGATTCCTACAGATGAACCTGGGCCTGAGGGTGCAGCTGCTGAGACAC
AGGAGAATCAGGATGTTCGACCAAAAGTCAAGGCCAAGAAGGCTCTAAAGGTAAGAGTGC
TGCAATTACTACCACTGCCTTACCACTTCTGACCTCTCAGTTGGTTAATTTATTCTATAA
AAAGTTATCAATTTCCTTGTGCTCATCAAAGTTTTAAAGAATACTGAATGTGATGTGTTT
TCTATCTTCAGAGAATATGCAAAGCTGTGGTTTATATAATTCAGTTTATATTTACCTAGA
ACCAATTATGTGTTAGGCTTTGAGCTAGATATACCACATAGACTTTCTCACTTAATCTTG
AAAGTAATTCTTGCCATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTAAGACACGTAGAGGCAAGGCTCACCGTAGAGCTGCAAACTCCAATCATTTCA
GAACCGGGAAGCACCACTGTCTCGGGATGTAGACCTTATGCAAGAGAAGAGTAAGAATTA
TGACCTCTTTTCTCTACCTTATTTCACTCTTACCTACCTCTTCTTTGCTATCCTCATAAA
TATCCTGTCAATATATATATTCATCTTTCTATTTTTCTACCTTTTGCCCCAGGCAAATGA
TTTGGTGAAATACCTTCTGGCTAAAGACCAAACAAAGATCCCTATCAAGCGCTCAGGTAG
AGTCCTACTAATCCCTCCCCCACGCTGTATTCTCCTTTGCCCTCTCTTCCATGTGCAAGG
GATAATCTTTGTTCTTATGTTCTAATGCTATCTTCCCAAAGTTCTAATTTGTCAGTGCTA
GCATCTCTATATTTATTATTTCAGAACTCTGGCTTTGCCAGCCATAATAGGGTTGGGAAA
GGGGTCTATAGCTTGGGCATGGGGGCCTCTTGGCTTGGCTTTTCTTTAGCCCAGGTGCTG
ATAACACTCTCCCCTTGCAGACATGCTGAAGGACATCATCAAAGAATACACCGATGTGTA
CCCTGAAATCATTGAACGAGCAGGATATTCCTTGGAGAAGGTGAAGGGGCAGCCATGGGA
AATGGGCACAGTGGGAAATCCTTGAATTAACAAAGGTAGAGGTGTTCCTTCTGGGAGAGA
CTACAGAGACAGATCCAGCTCATTTGCTGTGCAGATGGGCATACTGGCTTTTGGAGGGGT
ATAGGTGAGCCATGGTCACACAGCAAGTTAGTGGTAGAGCACACCTATGACCCACACACT
CACTAGTCTGCTCTGTCACTGCTGATATGTCTGTATACATGAGTGGCTCAAAGTTGTACA
TCTATATATGTTACTGTGTCACTACTAGTGCTTATATGTATCATCTCACTGATTCTCTCT
CTGTCTCTCTCACTCTCTCACTCTGTCTCTCTCTCTCTCTCTCTCTCTCAGACACACACA
CACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGGCTT
CTGTGGAAATTCCTGTGCTAGAAACCTCTTTTCCATGTTGAAACTGCCTCTACTCACATC
TGGGCAGTGCCCTGATTATGTGTGTCCCTGTGTTCTTTCTTTCTCTGATATCAGGATCCA
TCACTCTCTCTTTGGGGATGTGAAGAAGCTCATTACTGATGAATTTGTGAAACAAAAGTA
AGTGACTTTTTTATTTTATTGGTGCCATCCATATATGTGTCATATTTCAGAACTGAGTGT
TAAAGCCATGGTTTGTGTGTGTGTGTGTGTATATACATGGGTAGTAGTTTAATGGGGCTA
TGACTTAATACATGCACTCTCACAATGAATCTTTAAGAACAATTCTACAAGAAGAGATTA
TCATCACCAGTAATATGTATGTGGGGAAGTTCAGGCTCAGGTGAACTCATTTGCTCAGGG
TTGCAGGTAGTAAATGGAAGAGTTATGTTTACAACCTAGCCTCAAAGCTTTGCTTCTTTT
TATGATGCCAGCCAAGGCATTGAAGACATGCCATAAAGAAATATCATAGAATAATAGCTT
TAGGCTATTCAGGTGTAATGCTAAAATTGATTTCTATCTCTCATTTTATTTTCATGACAG
CCCTGAAGTGTGCTGGTAACCCATCCTTATTTTATATCTAAGGAGCGTGGATCTCAGAGG
GGAAAGTACCTCGGCATGGCCCATAGCTAGTGATGGAACCCTCTAGGCTTGGATGCCAGC
TCTCCTGGTTTGGGGGCCAGGGTCTGCTCCATCTTTGGTCCTTGTGCAATGTATGTGTAT
TCCCCTAGGAATCTGTACAACAGGAAAACAATGCAGAATACCCATGGAATACATGGCTTT
TGCTTTACTGTGTCTTCCCTTTATGTTGGTTTCTATGGTGGACCTTTCTAGGGCTTGGCC
AAGCCAAGGATGAGACCCTTGCAGTGGGGGTGTGCTGAAAATTGGGGACTTAAAGAATGG
TTCTTTTGTGTATAACACACCCAACAGGAATCTCAATTCATTGTGATAGGGAGCACACAA
CTTGTAGCCTCCTTAAGAATAAATGCCCTACGTATATCTCCATTGCAACTCCAAGTGGCT
TTTGGGTAAGGATAACAGTAAGAAATTCAGTATTGGAGGGAACACTGCAATATTTAGTTG
GGGAAGTTGCCACCTAGAACCTGTCCAGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACATGTAGTAAA
ATGCTTATCACATAGTAAGTGCTCAGTATACTGAGTACAAACCTTCTAATGGTTATTATA
TATTCATTTCAGGTACAAAAGAAGGATCCCAAGAAGAGGATGGCGCAGCTCAGTACCGAG
AGGCTATGGAAGCAGATTTGAAGGCTGCAGCTGAGGCTGCCACTGAAATATTGCCAAGGC
CAGGGCTGAGATTAGAGCTCAAATGGGTATTGGGCTTGGCTCTGAGAATGCTGCTGGATC
CTGCAACTGGGATGAAGCAGATATTGGACCCTGGGCTAAAGCCCGGATCCAGGCAGGAGC
TGAAGCTAAAACAAAAACCCAAGAGAGTGGTGGTACCAGTGCTGGCGCCAGCACAACTGG
CTTCAGTGCCAGTGCAAGCCTGACCTCCACCCTCACATTTAACCTTTTCTCTGGACTTAG
TGGGAGCTGGCACCAACAACAGCTCTGGTGCCTGTAGTTTCTCCTACAAATGAGATTTCA
GGTATCTACCTTATCTTACATATGAGAAAACCAGGGAGGGGGTAAGGAATTGGGTTGTTT
ACAGTATGGCCAGGGTTTGGGGGATGAGAAAAGATGTGGAATATTATATCTATTTTTTTG
TTTGGTGGGATATAATTGACTTTTTTAATTTTCTTTTTACTTGTGTTTTCAGGATATTGC
TAATCCCAGCAATTCTTTACTCTTTCAAGCCAGGGTGTGTTCTCAGAAACATTACTCAGC
AAAGCACTCTAGGCAGTCACTATCATTTGAAGCTGACCATCCTCCATTAAAATCTATTTG
CTGTTTCCTGAGTTTATTTGCATTTTTTTTGATGGACTGGCCACATTTTTGATACCAGGT
TTTAAAAAAAAACTTGGATAAAACCTTTTTTACCTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1043, 1045..1046, 1382..1540, 1577..1909, 2279..2486, 2589..2620, 2623..2688, 2812..2875, 3140..3219, 4319..4413, 4514..4593, 4694..4736, 5574..5636, 6731..6845, 7032..7058, 7064..7126, 7132..7311, 7314..7316, 7318..7380, 7382..7432
1001..1043, 1045..1046, 1382..1540, 1577..1909, 2279..2486, 2589..2620, 2623..2688, 2812..2875, 3140..3219, 4319..4413, 4514..4593, 4694..4736, 5574..5636, 6731..6845, 7032..7058, 7064..7126, 7132..7311, 7314..7316, 7318..7380, 7382..7429
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved