Echinops_telfairi Locus KIAA1586
snOPY snoRNA Orthological Gene Database
Echinops_telfairi KIAA1586
Echinops_telfairi
KIAA1586
GeneScaffold_5102
SNORA73
34522..34728
38181
GAAAAGGAGGAAGGCAAAGAGGGGTGAGAGAGAGAGAGACATTTAATGTTTTACTTATA
AAAAATGCCATACCCATAGAAAGGCATCATTAGGCTGTTACTTGATTGAGGGGTGAGATT
CCACCCCTAACTTCATCAAATTGATATAAAATCTAATCATCATGCGGCCTTTGCAATAGT
AGTACCCCAGCTACACCAAACAGTGCTACCAAAATCAAGGAACTCAGTATTTCTAATAAC
TTGCCATGCCCCTGATTTCTAACTAGAAAGCCCAGTTTGCATCCCTCCCTTGGAGGGTAC
TATACAAAGCCCTCCACATTAGTTTCCACCTGTCACTATCTTCAGGTAAGTGAATTCTAT
AAACCACGGCCTTGGTGACACCAGGCCTTTGTGTTACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTCATCTGTATGCGGAGTAAATTATCAGAGAAGCTGGATAATAT
AAAAAAGGATGTGGCATCGGGACTGAGGAAGGCTTATTGACAACTTGTAATATAAAGATG
ACACAGCTTTGCTCACTCAGAGTGAGGAGGACTTGAAGCAGTTGCTGATGAAGACCAAGG
ATTCTAGCCTTCAGTATGGATTACAACTCAATGTAAAGAAAACCCCAATCCTTACAGCTG
AACGAATGAATAGGTAACATCATGAGAAATGGAGAAAAGGTTGACGTTTTCCAGGATTTT
GTCTTGCTTGCATCCACAATCAATACTCTTGGAGGCAGCCATGCTATTTTCAGTTGCCTT
ATATGAATATGAAGCTTGGACATTGAATAAGAAAGACTGAAGAAGAAGTGATGCATTTAA
ATTGTGGTGCTGGAGAAGACTATTGGAAGTACTACGGACTGTTGGAGGACCACAGGAGCA
GCGGTGCTCTCAGTTAGGCCGTTGGACACCCTGGGTTGGAGATACTAGAATCTGCCCTTT
CAGCTAGGCCTTTGGCATCTGAGTCAACAATGAATGAAAATGAAGATGGCATTCAGTTTG
TGAGAGAAGGACCATGGTGATCTGTTCTTGAATACATTGATTTGGTCTGTAGGGATGACA
AGCAGCCATAGCCCTTATCATAGTGACATGAGACATGAATATGAGCACATTTGGAAAATT
TAAAATGAAGGCATACAGACAGGAATCAAGTGGAGACAAAGAAGCTAGTACTACAACTGG
GAACAGTAAATACAAAGATACAAGGAAATACCTGGGATACAGTTAAATCATGGGTACAGG
GATATGAGTGTAATTACAATGGGTCAATATCAGCCTATGGGATCAAGCTAGAAGATAATG
GACTTAGTGATTGTGTATATTCTCCCAGTTGGTTCAATTATGAGAGAATGTTACCAAAAC
TAAGGTACTGGAAAGATTCTCTTCAAACAGTAAGTGCTAATAGGATACTCAATAATCAAA
GATAAAAAATGACAGTTCAATTTAGGTTCCCCCCACCCTGCCCCCAATATTAGTTGGCAT
GTGAGCTAACTCAAGAAAAGGAAAATGTGACTTTCGGTCTGTTGTGAGAAGTGTTGAAAT
CAAGACTTAATAAAAACGAATAAGATTGTGTATTTTTGTGTACCATTAATCATTATGCAC
AAGAACAAGTCAAATATTTTGTAATGCCAACCAAACACAGAAGCGCCAAGGAGGATCTGG
AAAAATTCTTTCTTGAGCAATTCAGAGTTGCTTTTCAACTTTCTCAGCAACTCTCTGATA
TGTTAACAACAAATGAACTAACACAAGATTTACGGAATCTTCTTAGTTTTCAGACTGATA
TGTTTTGACGTCAAAGTCGAATCAGTTCAAAAAAAAAAAAAAGAGGAATTTGTATGTGTG
TATGTTTAGTTTACTGTGGATGCAAATAACAAAGGAAAATAATTGCCTGGTACTTGATCC
CGTTATTAGAAAATTTGTAACTGAACCCACTTGAGTGAGTGAATCTATTTTTTTCAATTA
TACATTTTATTAAATCTATATGTAAATCAAATATTTATGATGAAAAAGACATTCAGTTAA
ATTGAGATGTGCTGAAGGTATAAAATAAAAAATACATTTTGGATTCTAAAGACAATGAAA
GCTATCATATTTTTTAAAAATAATTTTATTGGGGGCTCATACAACTCTTGTCACAATCCA
TACATCCATCGATTGTGTAAAGCACGTTTGTACATTTGTTGCCCTCATCATTCTCAAAAC
ATTTGCTTTCTGCTTGATCCCTTGGTATCAGCTCCTCATTTTCCCCTCCCTCCCCGCTCC
CCCTCCCTCATGAACCCTTGATAATTTAAAAATTATTATTACTTTGTCATATCGTACACT
GTCCGATGCCTCCCTTCACTCACTTTTCTGTTGTCCACCCCCTAGGGAGGAGGTTATATG
TAGATCTTTGTAATCAGTTCCCCCTTTCCATCCCACCCTCCCTCTACCCTCCCAGTATCA
CCACTCTCGGCACTGGTCCTGAAGGGATCATCTGTCCCGGATTCCCTGTGTTTCCAGTGC
CTATCTGTACCAGTGTACATACTCTGCTCTACCCAGATTTGTAAGGTAAAACTGGGATCA
TGATGGGGCGGGGACGGGGGGCGTGGTGGGAGGGAGGAAGCATTTAGGAGCTAGAGGAAA
GTTGTATGTTTAATCATTGCTACACTGCACACTGATTGGCTCGTCTCCTCCCTGCGACCC
TTCTGTAAGGGTATGTCCAGTGCCTGCAGATGGGTTGTGGGTTTCCAATCTGCACTCCCC
CTCATTCACAATGATTTGATTTTTTGTTCTTTGATGCCTGATACCTAATCCATTCGACAT
CTTGTGATCGCACAGGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGA
CGGCCGCTTGTTTACCTTCAAGTCTTTAAGACCTCAGATGCTATACCATTTGATAACTAG
GCACCATCAACTTTCTTCACCACATTTGTTTATGCACCCATTTGTCTTCAGCGATCGTGT
CAGGAAGATGAGCTTCATGGAATGCCAGTTTAATAGAACAAAGTATTCTTGCATTGAGGG
ATTACTTGAGTGGAGACCCAATGTCCATCTGCTACCTTAATACTGAATCTATAAATATAT
GCACATAGATCTATTTCCCCATCCTCCTATATAAATATGTTTACATATGCACATGCTTTT
ATTTCGACCTCTATAAATGCCCTTTGCCTCCTAGTTCTTTCCTCTATTTCCTTTTACTTT
CCTCTTGTCCCACTATCATGCTCAGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAAGC
AAAACAACAACAAGCCAATGACAAACAACAACACACAAAGAAAAGCTTGTAGTTAGTTCA
AAGACTGTTTGTTGGCCTTTTGCAGTGTTTTCCAGTTGAGTCTGATGGGGTGCCAAACCC
TGGTGCCAAAGTCTATTTTTTAAAATTGTTTTATTAGGGGCTCATACAACTCTTATCATA
ATCCATACATCAATTGTGTAAAGCACATTTGTACATTCATTGCCCTCATCATTCTCAAAA
CATTTGCTCTCCACTTAAGCCCCTAGGATCAGGTCCTCAATTTTTTTCTTCCTCCCTCCC
CGCTCCCCCCTCCCTCATGAACCCTTGATAATTTAAAAATTATTACATTGTCATATCTTG
CGCTGTCCGACATCTCCCTTCGCCCACTTTTCTGTTGTCTGTCTCCCAGGGAGGAGGTCA
CATGTAGATCCTTGTAATCGGTTCCCTCTTTCCAACCCACCCTACCTCTACCCTCCCAGT
ATCACCACTCACACCACTGGTCCTTAAGGGATCATCCGTCCTGGATTCCCTGTGTTTCCA
CTTCCTATCTGTACAAGTGTTCATCTTCTGGTCTAGCCAGACTTGCAAGGTAGAATTCGG
ATCATGATAGTGGCGGGGTGGTGGGGGCGAGGAAGCATTTAGGAACTAGAGGAAAGTTGT
ATTTTTCATCGTTGCTACATTGCACCCTGACTAGCTCATCTCCTCCCTGAAGCCCTTCTG
TAAGGGGATGTCCAGTGGCCTACAAATGGACTTTGGGTCTCCACTCCGCACTCCCCACCT
CATTCACTATGGTAAGATTTTTTGTTCTGATGATGCCTGATACCTGGATCCCTTCAACAC
CTCGTGATCACACCAGCTGGTGTGCTTCTTCCATGTGGGCTTTGCTGCTTCTGAGCTAGA
TGGCCGCTTGTTTACCTTCAAGCCTTTAAGACCCCAGACGCTATATCTTTTGATAGCCGG
GCACCATCACCTTTCTTCACCACATTTGCTTATTCACCTGATTTGTCTTCAGCGGTTGTG
TCAGGAAGGTGAGCATCATCGAATGCCAATTTAATAGAAGAAAATATTCTTGCATTGAGG
GAGCACCTTAGTGGAGGCCCAATGTCCATCTGCTACCTTAATACTGAATCTATAAATATA
TGCACATAGATCTATTTCCTCATCCTCATATATAAATATATTTGCATATGTACATGCCTC
TATTTAGACCTCTATAAATGCCCTTTGCCTCCTAGCTCTTTCCTCTGTTTCCTTTTACTT
TCCTCTTATCCCACTATCATGCTCAGTCTTCATTTGGGTTTAAGTAATTCCTCTTGGTTA
CCCTCTATCCCACCCTACAAGGCCTCCTACAGACTCCTCACCACAGATGCGGATCACTTG
TTTTTCCCTTGTCCCTGGGTTTATTAACACCACTACCTTTCTCCCCCTCCTCCTCCTCTC
CCATGTCCCCCCACAGCTGTCGGTCCTGTTTTCTCCTCCAGATTGTTCATCCACACTATC
TTATTTAGAGATGCCTGCAGAGATAATAACATGCAGGAAAAAAAACAGGGCAAAACCAAG
CAACAATATGCAACAAAACAACAGCAACAAACCAGTAACAAAAAAAACCAAAACAAAGCA
CAACAAGGAAGAAAAGCTTGTAGTTAGTTCAAGGATTGTTTGTTGAACTTTAGGAGTGTT
TTCCAGTCCAGTCTGTTGGGGCACCACGCCCTGGCCCCAAAGTCCACCTTCAACATTTCC
TGGGGACCTCGCCGCTCCATTCCCTTGATGTTCTGTGGCACCCTCATAGTGTTTTGCCTC
GGTGTGGTGCGATCAGATCGGGTGCAATTCCCACACTGTGTCTCCGGTGTTGTCCCCTGT
AGGGCTATGGATCAGTGAGGTACATCGTGTCTCATAGTGGGGCCAGCCATGTGGTCCTCT
CTGTGGAATGGCTGCTCTAATTGGGAACATCATCCTCAAGGCCTGGTGGGCCAGGATGTG
CTCCACTCTCCTCCTCCCGCTTCATCTGCTCCCGTGTGCTCTGATCAGATATGTCCCGTC
CCAGAGCTGCAGAATCAATGCCGTCCTTCGAAATAAATTCTTCTTGAGGGAGGGGCAGGT
GTCCACGTAGTAGTTGGAATTGGGGCCGGCCCCCCAGACCTCTCCACTGGTTCCCTACTC
CACAGTGGCATGTTGCATTCACATCTTGGAGCACTGGTTTGAAGTCTGGTCCCTCTTTCC
CTGTAGAGATATAAACAATACCCTCCCCTTGGATGGGTTAGTGCCCTGTTCCCCTGCTAC
CCATTTCCTTTTTCCCCTACCCCGCCTCATTTTTATTTGGCTACCATATGTATCCCTGGA
TTTCATCTGGCCCTGCCACACTACCCGTTCCTCACCCCAGGGAAGCTATCATATTAACCA
TATTGATAATATCTTGAAATACTATTCTGGGGATATTAAGTTAAATAAAGTATTTTTTTT
AATACCATGGATACCAAAGATAATCCAGTCTGTCTTGGAAGAAGTATGAATAGAATGCTC
CTCAGAGGCAAGGAGAGACCAGTCCCTGTAGAAGGGTGTCATGTTTGGTGACTTAGAGGG
GCAGTGAAAACCTGAAAGGCCCCCCAGAAGACAGAACGACACTATGGTGGCAACAATAAG
CTCAAGCACAGCAACAATTGTGAGGAGGCACAAGAGGCAGCAGTGTTCATTTTTATTATG
CATAGGGTTGCTATGCGTCAGAACAGACTCAATAGCACCTACCAACTTAACAAGAACATA
TCACACATTGGGCTTCTACTCCAGTACTCCCTCAATGCAAGAACACTTTGTTCTATTAAC
TTGGCATTCCATGATGCTCACCTTCCTGATACAATCGCTGAAGACAAAGTGGGTGCATAA
GCAAATGTGGTGAAGAAAGTTGATGGTGCCTGGTTATCAAAAAACATAGCATCTGGGGTC
TTAAAGGCTTGAAGATAAACAAATGGCTATCTAGCTGAGAAGCAACAAAGCCCACATGGA
AGAAGCACACCAGCCTGTGTGATCATGAGGTGTCGATAGGATCAGGTATCAGGCATCAAA
GAACCAAAAAATCAAATCATTGTGAATGAGGAGGTAGTGCGGAGTGGAGACCCAAAGCCC
ATCTGTAGGCAATTGAACATGCCTTTACAGAAGGGTCTTGGGGAGGAGATGAGCCAGTCA
GAGTGCAGTATAGCACTGATGAAACATACAACTTTCCTCTAGTTCTTTAATGCTTCCTCC
CACCCACTATCATGACCCCAATTCTATTTTACAAATCTGTCTAGACCAGAGGGTGTATAC
GGGTACAGATCACAGCTGGAAACACAGGGAATCCAGGACAGATTACTTCTCAGGACCGAT
AATGAAAGTAGCCATACCAGGAGGGTAAGCAGAAGGTGGGAGGAGAAAGAGGGAACTGAT
CACAATGATCTACCTATAACCCCCTCCCTGGGGGATGGATAACAGAAAAGTGGACGAAGG
GAGACATCAGTCAGTATTAGACATGAAATAATAATAATAATTTTTAAATTATCAAGGGTT
CACGAGGGAGGGAGGCAGAGAGAGGGGGAAATAAGGAGCTGATACTAAGGACTCAAATAG
AAACAAAATGTTTTGAGAATGATGATGGCAACAAATGTACACATGTGCTTGACACAATGG
ATAGATGTATGGCTTGTGACAATGGGTGTACAAGCCCCCAATAGAATGATTAAAAAATAA
TAAAGAGAATGTGTCACCAGCACTGAAACCAGTTACTGACACATTTCTGCTCTGGAAACA
CCTTCTTTCAGAGCAACTGTAGTTGTAGCCTTCATGATTACTTTTTCTCTCTCATTTTTT
AGGATCAGGGATATCCTTAAGCCCAGTTTATATCCTAAGAGAGCTAGTTTCAAGATTCCC
AGAAAGCCCTCTAAGATACCTTGTGGTGTGCCAAAGGCCAATACAAAAGGTAGATCTCCT
GGTATTAGTCCGAAGGATGGGAGAAGAGTGATGGTGGGAAAGTGGCTATCTACATAGATA
GGTAGGTAGGCATCCTGGAAACTCAGGGATCATTTCTTGGGAACTTTCAAAATGGCTGAA
ATTATTAACCCTATAATTCCCTGACCCCAGCATTTTTCTGACTCCGTGTCCTTTGGAAAG
CATCCATTCCGTGCTACATTTGTGCTCTGCTACACCTGACCCACTGAGATCTCATCTTCC
ATTCTTCACTTCCATGATCCTCCTCAGTGATTTAGAGTTAAAAACACTACCATAGAGAAG
GTTTGGAACTCATGTTGATTGTATGGCTAGATGTCTTCCTAACCCATTATGGTGGTAATA
ACCAAAGGACTACTCTTAGAATCTGCCTCCCACCTCTGGTCAGCAATGAGTCACAGAGCT
CATAAACCGAATGGAAGGAAATCCTGGAAGGATGTTGAAGGTAACCATGTCTACTCTATT
GCAGTTCTTTTTAATGCAGTGGTTCTCAACCTGTGGGTCACAACGCCTTTGGGTGTCAAA
CAACCCTTTCACAGGGGTTGCCCAATTCATAATAGTAGGAAAATTACAGTTATGAAGTAC
CAAGGAAATTATTTTATGTTTTGGGGGGTCACCACAACATGAGGAACTGTATTAAAGGGT
CACGGCATTAGGAAGATTGAGACCCTCTCTTTTAATGCGTCTAGAACCATGGGACTAGCC
GTGGGTTTGAATGAGAAGCCAATGGAGTCACCTGCATTTGGCACAATTGTTCTTGTAGGC
CTCCTTCCTGACCCATTGGGTGTATAATCTCTCCTTCTGTTTCTATCTTCACCAAATTCA
TACTTTAGTTCCTTCCTCTTAAAGTCACGTGGACTGGTAAATTGATCTTTGGACCCCCCT
CAAGGTTGTGACCTGCAGTTCCCCGAGGGGAAGATTTTCAGTAACTTTCACTGGACTACA
TCCAAGGCAATAATAATTACAATGAGGAAGAAGAGCAGGAGAGGACTTATCATTTATTGA
GACTTACTAAGGCTCAAACAGCTTGTGTGCATTTAAAATTTTTTCTCTTGAAAAACCCTT
AGTTCACAGATGAGAAAACTGAGGCTCACTAAGGTTAAATGACTTGACAAGATCACACTA
GTAGACAGAGATATAATTTCTACCAGGGTGCATTTGAGTCCCCAGTCCGTTCTTTAAATG
TGTGTCCCCTGTGAAAGTGTCAGCATTGCCTACAAGGGTAATTGCTCAATGAAGTGTTCT
TCCATGTCTGCCTTTCTTTCAATGTTGCCAACCTCCTCTTGCTGGACCTATCCTGGTAGC
CATGCGTCTAGCTACCATTGTACCCCAGGTCCCCAGCTTTCACCTGGACCCATGGGGGTT
TGATGATCTGGTTACTCCATAACTACCAGTTATGGGCCATAGGTTATAGTCCCTAAAAAG
AAGCATTAATGTCTTGTCACATAGCCTAGGCACATAAGACTTTATTCTACACATGTTCAA
GAGTATCACAAATGATACCCAGGAGATACAGAAACCCTGTATGGTTTCCTACTGACACCC
ATTTAGGCTGGGGGGGCTGATGGCATACATGTGGTGTAGTTTGGCTGTCCACATCTTTGC
AAATACTTAGCCCAGGACTACTAACTTAACCAGCTGGAAATGAAGGATCTAGACTTCCAG
TCATCTTGTAGGGTTTAGCAAGACCAATACCACAGATGGATGAGTCTGTCACAGAATGAT
CAAGAGAGCACATGAGAGACATTTCCCGTCATTGTATCACATGACTACATTTGATGAACA
CAATCGATCATGCTCTGCATCATGAATCACTCAGTGACTCGTCTGCTGTAGGCATGTCTA
TGAGTAGCTCTCGCACTTGTGACATGACTAGTCAGTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTGTATATGTG
CTGACATCATCATTTCCAAGACATTTCTTTATACTTGAGTTCTTGGTATCAACTCCTCTT
TTTTCCCTCCTCCACTACTCTCCCTTCCTCATGACCCCTTGATAAATTAGAAATTATTAT
TGCTTTCTTATCTCACACCATCCACTGTCTCCTTCATCGATGTTTCTGTTGTTCATCCCC
CTGGGGGGTGGTTATATGTCTATCCTTGCCATTGGTTCTCCCTCCCCCCCACCACCTCTT
CCCCCTACCCTCATGGTATAGCTACTCCCATTACTGTTCCTGGGGAGTTTATCTGTCCTG
GATTCCATGTATCAAGACCTCTTATCTGTACCAGTGTACATGCTCCTGTCTAGCCAGATA
AAAATTCAATCCTTATTTGTCTTTGTGGGTTGACAGGTTAAGGCCAACAGCAGCAAATTA
TGTACTACAGCATTGCAGGGTGTACATAAATGATAAGCCATAAAACAGAGTGGTCATAAG
TGTGGCCGGCAAACAACTATGGCCTAAGTTGGGGTCTCCCTGCAGATGGGTAACAGGGAT
TGTGTAGCTTGATGGTTAAACAGAAGTTTTGAGATCTGTTCAATCAGAGTTTGAATCCTG
GTTTTGCCTCTTCTTAATTATATGACACTTCGGTCTCAATTTCCTTCTGTAGCATAGGGA
TGGTAAAAATTGTTGCCCCCTAACAAACCCAGGGACAAGGGAACAACAAGTGATCCAAAT
CGGTGGTGAGGAGGGTGTGCGAGGCCTGGTAGGGCATGATCAAGGGTAATGTAACCAATA
GGAACTGCTGAAACCCTGGTGGGGACTGGCCATGATAGTGGGACAGGAGGAAAGTCAAGG
GAAATAGAGGAAAGAGCTGGGAGGCAAAGGGCATTTATAGAGATCTAGATAAAGACATGA
ACATATGCAAATATATTTATATAAGAGGATGGGGAAATAGATCTATGTGCATATATTAAT
AGATTTAGTATTAAGGTAGCAGATGGACATTGGGCCTCCACTCAAGTACTCCCTCAATGC
AAGAATACATTCTTCTATTAAATTTGCTTTCTATGATGCTCACCTTCCTGACACAACCAC
TGAAGACAAAGCAAGTGAATAAGCAAATGTGGTGAAAAAAGCTGATGGTGCCCACTTATC
AAAAGATATAGCGTCTGGGGTCTTAAAAGCCATCTAGCTCAGAAGCAACAAAGCCCACAT
GGAAGAAGCACACCAGCCTGTGCGATCATGAGGTGTAGAAGGGATCAGGTATAAGGCATC
ATCAGAACAAAAAATCTTACCATAGTGAATGATGGGGGGAGTGCGGAGTGGTAACCCAAA
GCCCATTAGTAGGCCACTGGAGATCCCCTTGCAGAGGGGTCTCGGGGAGGAGATGAGCCA
CTCAGGGTGCGATGTAACAACGATGGGAAATACAACTTTCCTCTAGTTCCTAAATGTTTC
CTCCTCGCTCCCACTATCATGACACGAATTCTGCCTTGCAAGTCTGGCTATACCAGAGGA
TGTACACTGGTACAGATAGGAACTGGAAATACAGGGAATCCAGGGCGAATGATCCCTTCA
GGACCAGTGCTGTGAGTGGCGAGACTGGGAGCGAAGAGGGAGAGTGGGTTGGAAAGGGGG
AACCGATTTCAAGGACCTCCTCCCTGGGGGACGGACAACAGAAAAGTGTGTGAAGGGAGA
TGTTGGACAAAGCAAGATATGACAAAATAATAATTTATAAATTATCAAGGATTCATGGGG
GGATGGGGAGGGAGAGGGGAGTGAGGAGCTGATGCCAGGGGTTTAAGTGGAGAGCAAATG
TTTTGAGAATGATGAGGACAATGAATGTACAAATGTGCTTTACACAATTGATGTATGTAC
GGATTGTTATCAGAGTTGTATGAGCCCTTAAAAAACAATTTAAAAAAATTCTTGCCCCTC
TCATCAGCGAGCTGTGCAGATTCTCAGACTGAACTCATATAAACCATCCCAATCTGACCT
AGCTTGATTCCTTAATGTTTACAAGTAAGAGTGCAGGATCTGCAATTAGACAGGCTAGCT
CCGACAGCCAGCTCTTGTGAGCTATGTGACTTTTGGCGAATTACGTTTCTCACCTGTGAA
TTTGAGGCAACAATAAAGTTGTTGGGAGAATTAAATAACACATGAAATAGTGCTTAGCAT
AGCTCCTGGCACATAATTAGCACCCAATAAGTACTAGTTTTTACTATAATTGCAATAAGT
ACTATTATTATTACTGTGTGTTCAGGAAGTCATCAGGCTCATCATACTCAGTGAAGAAAG
GCTCCAAGCTCTATCTTTACTTTTCTTTTAGTCAAAAATTTTTATTGTGAATTCATTGGG
AATGAACATGCCAGACCATCATTTTTGCCTTGAATAACTCAACTTAGCAAACCTCCCCAT
GGCTTGCCCTATCCCCTTGCTCTCTACTCTCCCCCACCATCTCCCTTTTTTAGGATATTG
TCTACCTCTTCCCTCAAGTTCTACTTTCCTGTTCTTTCATGGTAAAATACACTTCCTTAA
ATGTACCCTGTTCATCATGTGGAAGTACCCAACTCTGTTGTGCTGAGTACATTCACAGCA
TGCTACAACCATCAGGGCCATGTTGCCAGCCCTCTTTCATCATTCTTCCAGAGCCCAGAA
TCCTAGTGGTGTAGTAGTTTACATGGTGGGCTGCTAACCCAAAGGTTGATGGTTTGAAGC
TACTCAGTGGCACCTTGTAAGAATGGTCTGTAGACCTGCTTCTGAAAGACCAACCAAAAC
CATACTCATTGTCATGAAGTCGATTCCAACTCATGGCCATCCTATAGGACAGGGTAGAAT
TGCTCCTGGGGGTATCTGAAAACGTAACTCTTTACAGGAGTAGAATGCCTCATCTTACCC
TGCAGAGTGACTGGTACTTTCGAACTGCTCACTTTGTGGTTATCACTCCAACAAGAGCCT
TGGAAACAGAGTGCACTTCTACTCTGCAACACAGGGGGTTGTCATGAGTTAGAATTGATG
CAAGAGCAGCTGGTATTTCGGTTTTAATGGCATGTGTAAGGAGAAACAAATGCAGTGACA
CTCATCTATGTATAAGACCAAGTTTCAGATCAGGATGTAATTATATTTCAAGAAAGTGTC
CCAGCTCAGTCCAACTCAAATCTGTATGTTCCATACTTGTCCATAAGTCCTTCTTCCAAC
GCACACAGTTATAAGCAATGATGTGGAACGTATGAAGCTCATAGGCCAGTGGGTGAAGAG
TTCTGTGGATCCAAGGTCTGGGGAAACATGGCAGGGCTCCAGTAGCTCTCCGGGAGGCCA
AGTCAGCAGGAATGTGAAGAGGAGAGGGGTTCCCTGGGGCCTCATTATGGGAAGGCCACA
CCCCCAAAGAAGTACCACCAGGTTGTGACCAGACTGAAAGTTAGATTCCATCCCTACACT
TTTGTACATGTTCAACTTGACAGAAAATCATCTAACCACCACAACTAATGACATAACACT
GAACATGTTTTCATAGCCTTTTTCTTTTTACAATTTGTATATATTCTTTGGAAAACAATA
TTAAGAATTAAAAAATATATTAAGACCTTTGCTCATTTTTATTTATTTTTTTTTTAAAAA
ATCATTTTATTAGGGGCTCATACAACTCTTATCACAATCCATACACACATCAATTGTGTA
AAGCGCATTTGTACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCATTTGCTTATTCACCCGCTTTGTCTTCAGCGGTTGTGTCGGGAAGGTGCCT
TTGCTCGTTTTTAAAGTAAGCTAGTTGTCATCTTTTTTCCCCCTGTGATTCCCTCTGATA
TCCCAGCTCCACTATTCTGTCTCACCACCCTGTGTCCGGTTACAATCTGGCTCCTTCTCT
AGCTTAAACTCCATGGAGATAAAGAGAGTCTGGTTTTTTTCACCATTATATCATCTCCTC
AGTGCCTACGATCACGTGCCCCCCAAATGTGTCAAAGCAATGTGTCCAATTTCAAGTGTC
TTTCTCATGAGACATATACTAAATTAGCTTGGAATTAGATTTTTCAAAGATCAGCTGCCA
AATCTGTGTTTAATTTGATCCCAACACCCTTTCCATGGTTAATTTGATCTATGATGTTTC
AACTTTTTGATGAAACAAAAATTAGATCATGTCATTACTCTAATTCAAAAGTCTTTGACT
GGCTTGCTATGGCCTACGGGAAACTGTCCACTTGTGTTAGCATGGCCCTCAGTGACAGTG
GATTTCAAGTTTTTTTGAGTGTCACCCATAGTACGGAATACATTTTGTATTACAACCCGG
TGTCAACTTACATAAATATGTGTATACATAACAACAAAATTCCATCAAAATCATTCTTCC
GTTTAGTACATGCACTGTCTTATATGTCCTATTCTATTAATAACAGTAGCATCAACGCCA
CCAACAAATATATTGCCATTAAGTCAATTCTGACTCATGTGTGTCAGGTTGAACTGAGTT
TTCCGTGGCTGATTTCTCAGAAGTAGATCAACGGGCCTTTCTTTTGAGATGGCGTTCAGT
GGAATTGAACCTCTAACCTTTCCATTAGCAGCCGAGCACATTAACTGTTTGTATTCCTCA
GGGACTCTAATTCTATTACAGTCGACATCATTTGATATAATGTTGGTTAGGAGCTACCCA
ATTGACTTCACAGTATACTTCATGGCATGGGTTTCAGACCATTGTATGAAAAACACTGCT
CTGTGCTTTGGTTTCCACTTCCAGACCCTTCAACCACTTTTGTCTCTCATGAACCATTCC
ATCTTACCATAATTCATATGGTTCCCATCATGAGATCAATTAACACAGTGGCTGCAATAA
TGGGCTCAAACAATAGCAATGACTCTGAGAATGGTGCCAGACGACAGCTTTGTTTTTCTT
GTACATAGGGTCACTATGAGTCAGAATTGACTCAATTGCAGCTAACAACAACCACATGGT
AGTAAATCTGGAGGCAGTGGGTGCTGCAAATGGCTAATGCAATTAGCTGTTAATGGCAAG
GTTGATGGTTCAAGACCACCCAGAGGTACCTTGAAAGAAAGTCTTGGTGACCAACTTCTG
AAAAATTAGTTACTGAGGAACTTCCAGAATTCTTTCCAACTTGGTCTTTTTTTCCCCCCC
TGAATGCTTCCTCACTGGTCTTCCCCCTTTGTTCTCCAATTTATTCCAACAACAGAGTGA
TCTTGTTGTAACCAAAGCTAGATGCTCACTTAGTCTCGGTGTAAGAGGCAAAATCGTAGA
AGCTCTATACGACATGGTCCTTCAGTTACTTCTCTGACTTCATTCACCATATAGTAGTCA
CAATGATCACTTCTCTGTCCCTCGAGTAGAGTGGTTCTCAACCTGTGGGTCGCGACTCTC
TTGGGGTCGAAGGACCCTTTCACAGGGGTGGCCCGATTCATAACAGTAGCAAAATTACAG
TTATGAAGTAGCAACGAAAATAATTTTATGGTTGGGGGGGCGGTCACCACCACATGAGGA
ACTGTATTAAAGGTTTGCGGCATTAGGAAGGTTGAGAACCCCTGCTCTAGTACAACAATT
TCAGAACCATCGCACCTGTAAACCCCTTCCTCCTCCATTTTGAATGTTCGTCTCCCAGAT
TGTTTTTAAAAACAGTTTTACTGGGTCATAATCTACATATCATACCATTCAATGGTTCAA
TCATATCAAGAAGGGTTGTCCAATCATTATCACAATCAAGTTTAAAGCATTTTTTCTTTC
TTGTATACATTATTATTAGCTCTCCATCCACACACACCCCTTCCAATTCCCCCGCCATAT
CCTCAAGGAACCATAATCCAGTTACTGTTTCCATAGATTCACCCGTCTAGGATTTCATAT
ACCGAGAAACATACTAAAGCAAAAAACAGAGAAAGAAGCATGCTAACAATAACAAAATAA
AATAGAAAAAGCTTCAGTCACCACATGTTTGCTTCATCACTTTCTTTTGGTTATTGCTCA
AATATCATCTCCTTAATGAGACCTTTCTCACATCTGTTTTTACCTCACCTTTTCAAATAC
TCATACCCTTCCTCTTCTTCAGTACTGTATTCTTGTTAGAATTTATGATGATTTTCCAGA
CTACATATTTGACCTTTTTGCCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTATAGGACGAATAAGCGGCATTTCATAAATAATAATATTTATGAAATGATT
TCTAAAATGCATTTTTGGAAACCCAGAGGATGACTTTCTGGACTATGTCCTTGTTGAGGC
TGGATCTGGAAAAAATTCCTGGACCAGTATATGTCTTACAGTAATATAGAATACAGCTCA
AACAGGCATGTGCATACCTATGCTTATTGCAGCAGCTTCTATAACTGCAAAAACATGGAA
AAACAACCAAAATATCTCCTTATAGAGGAATAGATTTAAAAACACTAGTACATTAATTCA
ATGGAATATAATATGCATCAATAAAAAACAATGACACGAGCTGCTCACCTGGCTCCCTCC
ACCTCCACCTCCACCTCCACCTAAATGAGGAGGGGAAAAAAAAACAATGACACACAGGCG
GTGTGGGGGGGAGGTAGGCATGCTCCCTGTGAATAGATGGTTCTGTCTCCCACTCACCAG
GTACAGTCTGAGGTGCTGGACCTGTTGTTGCCTGAGACCTAGAGCCAAACCGGATGCTGC
TATGAGTTCCACAGGTGGTCACTGGGCACCGTCCTCCAAACCCTCATTCCTGCTTACTGA
GGGAGTGCAGGCCTCTGACCTCCTGGGAGAACAAACCCTCATGACTGTGGACACCATCTG
CTGGGAAGGTCTGGAGCCCAATCTAGAGCACCATTTCCTGGGTGGTCTTTGTGTGAGGTT
GTCATGGGTTCTTAGTTTACATTTTGAAACCCAAATAAAAGGATTTTATTCACCTGAAAA
AAAATGACACTCTTTCTTAAACACTGCAAGACATAGACAAAGCAAGAGAGCATCATGCTT
ATCAAACTTAGTCAATCTTATAAAGATAAATGTTCAATAACACCATCATTATAAGAAAGA
ACAAAAAAGAACAGAATAAGAAATTTAATTTCTAAACGCAAAAATAAGACTTTGAAGACT
ACAAGGAGGCCAGGGAAAGGGGTAGAGGCAGGGTAAGGAGATGGGAGGGGTAGGAAATTA
TAGAGGGAGGGAGGGGGCAAAAAGGGAAGAGGACCACATCTTTGGGGGCGTTATTTTCAT
TTTTCATTAATATTTAAATCATTTTATTTGGGGCTTATACAACTCTTATCACAATCCATA
CATACATCAATTGTATAAAGCATTTTTGTACAATCATTACCCTCATTCTCAAAACATTTG
CTCTCCATGTAAGCCCCTGGCATCAGCAACTCATTTCCCCCGTCTTCCCGCTCCCCGCTC
CCTCATGAACCCTTGATAATTTATAAATTATTAGCTTGTCATATCTTGCACTGTCCGATG
TCTCTCTTCACCCACTTTTCTGTGGTCCGTCCCCTAAGGAGGAGGTTATATGTAGATCCC
TGTACTCGGTTCCCCTTCTCTACCTCACCCTCCCGGTATCGTCATTCTCACCACTGGTCC
TGAGGGATCATCCGTCCTGGATTCCCTGTGTTTCCAGTTCCTATCTGTACCAGTATACAT
CCTCTGGTCTAGCCAGATCTGTAAGGTAGAGCTGGGATCATGATAGTGGGTGGGGAGGAA
GCTTTAGGAACTAGAGGAAAGTTGTATGATTCATCATTGCTACATCACACCCTGACTGGC
TCGTCTCCTCCCCGCCACCCTTCTGTAAAGGGATGTCCAGTTGCCTACAGATGGGCTTTG
GGTCAACACTCCACACTCCCCCTCATTCACAATGATATGATTTTTTGTTCTGATGATGCC
TGATACCTAATCCCTCTGACAACTCGTGATCGCACAGGCTGGTGTGCTTCTTCCATGTGG
GCTTTGTTGCTTCTGAGCTAGATGGCCACTTGTTTACCTTCAAGCCTTTAAGACCTCAGA
TGCTATATCTGTTGAGAGCCGGGCTCCATCAGCTTTCTTCAACACATTTGATTATGCACC
CATTTGTCTTCAACGATTGTATCGGGGAGGTGAGCACACAATGATATTATTTTTTGTTCT
TTGAGGCCTGATAACTGATCCCTTCAGCACCTCCTGATCACACAGGCTGGTGTGCTCCTT
CCATGTGGGCTTTGTTGCTTCTCAGTTAGATGGCTGAATGTTTACCTTCAAGCCTTTACG
ACCCCAGATGCTATATCTTTTGATAGCTGGGCTCCATCCGCTTTCTTTACCACATTTGCT
TATTCACCTGCTTTATCTTCAGCGGTTGTGTCGGGCAGGTGAGCATCATAGAATGTCAGT
TCTAATCAAGCAAAGTATTCTTGCATTTGAGGGAGTACTTGAGTGGAGGCCCAATGTCCA
TCTGCTACCTTTATCACTACACCTATAAATATATTTCCTCCACCTCATACATGAAATATA
TTTAGCATATGTACATGCCTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAC
ATATAACCTCCTCCCTGGGGGACGGACAGTGGAGAAGTGGGTGAAGGGAGACATTGAACG
GTGTAAGATATGACAAAATAATTCATAAATTATCAATGATTAATGGGGGATGAAGGAGCG
GGGAGGGAGAGGGAGAAATGAGGCGCTGATACCAGTGGCTGAAGTCGAAAGCAAATGTTT
TGAGAATGATGAGGGAAACAAATGTCCAAAGTACTTGACACAATATATGTATGGATGGAT
GGATTGTGATAAGAGTTGTATGAGTCCCCAATAAAATGATTTAAAAATAAAAATATGATC
CATAAAACTCTTGTGTTGGGAAGCAAAGCTTCGTCCCTCTCCTCTGGAATCAGGAAGAAT
AATTCTACCTTACATTTGTTTCACATTTTATATTCTTCACATTGCTTTAGTATTCATGAT
TACATTTGAGCTTTTGTAAAAGAGGATGTTGAAATGATAGCTTCATTGTACAAACAAAAT
GAATATCCATTAAGGGAATGCCATTGATCAGTGCAAGAACCAGACCAGACCCCCAAATTA
CTAACTTCCACATTTTTGGTCTTTTCAGTATAACGAAATGGCATGAAAGCTCTGGCAAGC
TGGGTAGCCTGAGAATTAATTTGTCAAATGGGCCTTGCTTGGAAAGACTTTCTGGCTATG
GGTTGTGTCTCAGTTATCTAGTGCAGCCATAGCAGAAGTGTCACAAATGGATGGCTTCAA
CAAACTGAAATATATTTTCTCGCAGTTTAGGAACTAACAGTACAAATTCGGGGTGCTAGT
TCTAGGAAAAGATTTTCTCTGTTTTCTGAGGGAAGGACCCCCGGCGACATTAAATGTCTG
TTAGCCTCTTGTCCCCAGGAGAACTCTTTGTGTCTTGGCACCAATCTTCCGCTGGGTCTA
GCAAGTTCTCAGCATAGGTACTCCCACTTCTCAGCATTGCTCCCAAGTTTTATTTCTTTG
TTATAGTCAGGTCATCCCTTTCTCCCCTTATCTATCCTTTTCTCTCTTTTAGAATACTTT
TACTGGGGGCTCTTACATCTTTTACCACAATCCATTCATCCAGTGTGTGGAGCACATTTG
TACATATGCTGCCATCATCATTTTCAAAGCATTCTCTTCCCACTTGAGCTCCTGATATCA
ACTCGCATTCTCTTCTTGAGCTTGAGCTCCTGATATCAACTCGCCATTTCTTCCCCGCCC
TCCCTCACGCACCCTTGATACATTGTAGATTATTATTTTCATATCTTACATCGTCCTCCG
TCCTCTGTTGTCCCTCACCCACTTTTCCTTTGTTCATCCCCCTGAGAGGGGGTTATACGT
TGATCTTTGTGATCGATTCTCCCTTTCTTCCCCCACTCTCCCCTAATCCTCCTGGTATCT
CTACTCTTATTGTTGGCACTTGGGGGTTTATCTGTCCTGGATTTTTATGCAGTTTTTGTG
GTAAAATTAGGTGCCTTGGCTGATATTCGGGTCGGCTTATACTCTAGTATATACAGTAAA
TCTGTGTATGAACTAGGGAGCCTTGGTGGCATAATGGTTACGAGCTTGGCTACTAACTAC
AGGGTCAGTAGTTCAAAACCACCAGCTTCTTCTTGGGAGAAAGATGAGGCTTTCTATGGC
TATAAGGGTTACAGTCTGAGAAACCCTCATAGCCGTTCTAGTTGGGTTGCTATGAGTCAG
AATCTACTCAGTGGCTTTGATTTTTTTTCTTTCTGGATGTATGAACTAGTATGCTAGAAT
ACGATTTAACTTCCCCTCATATAATGTTCATACAAAGAAATGCATTTCCTTCTGTGTACT
ACTTAGCATCACCATATTTCAGTACTACATTACCAGTACTCTATCTTGTTTCTTGTCTTC
CTACATTCCAGACTACCGTGTGTGATTAATTTTGCAACAGAGCTATGGCAGTTAGCTTGG
TTTTGTTTTTTGTTTTTCTTTTGTCCTCATTGCATAGCCACACCCTCTGGATCTGTGTAT
GTGTCTTTTGTTTCTGATAATCCTGTGCCGCCTACAAGACTGTTCTCCTCAGAGGAAGAC
ATGCCAGTCCCATAAGAACAGCCCTGATCGTAACTGCTAATTGCAAACTGGACTTGAGTA
ATTTGTATGATTTGCTCTCTTTCATTTCAGGAAGGACCATCGAGACCTGTTCTTGAATAC
GTTGATTTGGTCTGCAGTGATGACAAAGAGCCCACGACTTCTCATAGTAGTGTAAGTACC
TTTGATCTCTGTTTCGAGACTTGTCACTTACATGTCATGGGGTGCTGACTGTGGCTGGGA
CTGACCATGCAAACGAATGGTGAATTTTTAGACATTTTGCAAGTTGGTTGTTAAAAGTAG
TCATTATTAAGAGCTAAAGCTTTAAACTTCCAAGTACATAAGTGGACAGTTAAGGTAATA
CATCCTTAAAACTCATCACTTATTTACAAATATTTGATCTTATGGTTAGCGATGTCTACA
GTGGAAGCATTTACATAATAGTAATTGGAAAATATTAAAAATCAGGATTTAGTTTATTTG
TTGCTTGCCCAGGCTAGTGTTTCCCCAGGTGGAGGGGCTGGAAGGATCCAAGCAGGTTGT
AAAAGCAGACACTTACCCTTCATCCTGGACTATGGGCTATGGTACAAAAGTTCTCATTGC
AAGGGGGAGCAGAGCAATTTGGGTTTTTGCCTTAAAGATTTAAGAAAGTCATGGAGCCAA
TGTAAACCCACGTTTGACTTAAAAGTGTGCTGTGCTTCAAATTGTACATTGTGTACCATA
GGAAAAGTTGATGAAATAATCTTATGGCATTCAAATACTGTTTAATGATCCAGCAAGGAC
ATTGTTCTCATTATTGATACATGAGTGAATTCTGATACTTGTCTTTATTGTTTTGCTTTC
CTTTTACACATTCTTATAGATGAAAATAACATTCATGTAGTAAATATATTTGTTCACAAA
TGATAGAAGTTTCTTTGCTAAATTGAGAACTATTCAAACATTTATTGATAGTCAATTTTG
GTGACACTGCTGTTGGCTATAAGGAACTATGGTCCTCTGGGGTAAATGATGGACTGCTAA
TCGCAAGTTAAGCAGTTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
AACTTTAGTTAGGGTCACTGTGAGTCGGAATCAACTCAATGGCATTGGGTGTGGTTATTT
TTTGTTGTTGTTGGCTATCAATGATTTAAAAACTGACACTGGGTGTTTTGTTTTGTTTTT
AAAGAAAAATGGAAAGTTACATGGAAGCAATATATATATATAAATTGCAAAGCAAGGGAT
TATACTTTAAAATTTGTTATTTTTCTTAAAATCATCAATAGAACATTTTACATTAGTCTT
AAGTGTTATGATTTTTACTTATATAATGTAAAATTATTTTTCAGATTCTGTTTCCTAAAA
TGCCAAAATGACAGGGTGATTTATTCAGTTTATTAAATATGAAGAAGGTGAAAACAGACA
GAGAAAGTAATGATAGGAACAAAAGTCACTGTGGATCCTCTTAAGCCCATGGGACCAAAT
TCTGACTATGTTAATGAACCCGTCATTGAAGAACAGCCATCATGCTCATCAGAGAGAGAA
ATAGATAACCTCGTGCTTCCAGATTATTGGAATGAAAAACAAGCAGTCATGTTTACAGAG
CAGTACAAATGGCTTGAAATAAAAGAAGGTAAATTAGGATGCAAAAATTGTTCAGCAGTT
CACCATTTGGGCTCAAAAGCAGAAAAGCCTGCCCATGTGTCCGAGGAATGGACTGCATAG
TCAATAACCCTAATGGTGGTAATAAAACTACGAGGCCAGCATCTCTGCGAAAAAAAATTA
GGGAGCATGATATTTCTAAAGCCCATGGTAAAATTCAGGATTTGTTAAAGGATTCTGCTA
ATGACTCAATTTCCAATTTAGTGCATACGCAAAATAATAAAAATATTGACACCACTATAA
AAGTTTTCAATACAGTTTACAGTTTAGTACAGTGATTCTCAACCTGTGGGCCGCAACCTC
TCTGGGGGTCCAACAACCCTTTCCCAGGGGTCACTGAAGACCATCGGAAAACGCATATTT
CCAATGGCCTTAGGAACCAAGATACGGCTCTACTATCTGTCTCCAGGTGGGTCCGCCCAC
ATGCAGATACGCCCACATCTGAGTACCCGGAGTGGTGATATCCATTGAACCAACCCGGAT
TCACAATACACCCCCGGTACAAATACAGGTGTATGTGACAGTGTTGGTGCCCATAATGTA
CTTATGCGGACCAGTCACACATGTGTAGAGAGCAGCTACTGTGCAAAGAGCAGCTGCTGC
GCTGAAAAAAGTTAAAAGCATCGACTGTGTTGAAAGCAGCAGAATTGGAAGTAAAATGGC
ACTTCATGAGTTGTATGAGCCCCCAATAAAATGATTCTTTTAATAAAAATAAATAAATAA
ATAAAGACACTTCATGAATTATAATTACTGGGTGAATGTAAAATCATGTACTATAAAATC
ATCAACTACTGCAAAAGTGTATATATATATATATATATATATATATATATATATACCATG
GGAACTTAATCTGGTGTTGATTGGTCTTTTTATATTCAGCTATGGTTAATGTGAATACTG
TATAGTATTCACTTGTATAGTAACAGGTATGTAAAAAAAAACAGTGGTAAATCATAGGAA
ACTTAATGAACTGTATTGACTGAACTATGCCATGTATTATCTTTTGTATTATTAAAGCTA
TTGTTATATATTATTTTCATTAGCAAACTATCCCATGACAATGGATCGGGTAGAGAAGAA
TGTTAAGAAAATATAGGGAGGATATTTTACAGTATGGTTTTACCTTAATAATTACAGCAG
GAATTGAGAAACCCTAATGTGTTATTTGTTGTGAAGTTTTATCAGCCAAATGTATGAAGC
CGAGCTAAACTAAAATGCCATTTTGATAGCAAGTATCCGAGCTTTGCTGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGTTTGTGGTGTTTGCACAGATGGTGCACCAGCTATGCTAGCATATG
GATCTGGATTTCGTTTGGTACTGAATGAGTACCAAAAGTCATCAGAACTCACTGTATGAT
TCACCAGCGAATATTAGCAATGAAGATGCTGCCACAAGAGTTACAAGAAGTAATGAAAAG
TGTCATAAGTTCTGTCAATTTTGTAAAAGCGAGCAGTTTAAACAGTCAACTATTTTCGCA
ACTGTGCAACGAATTGGATGCATTGAACAATGCTCTGCTATGAGAGGAAATGTTTTAGAA
TGTGTTTTTGAGCTGGGTGATGAACTCAAAATGTTTTTTTTAATCAGAAAGCAAGACCGC
AGTTCGAAGCACTTTTCAGTGATAAAAGTGAACTGCAGAAAAGAGCTTACTTAGTTGCCA
TCTTTGCCATCTTGAATGAGTTCAATTGATCACTGCAAGGACCAATGCAACATGCCTCGA
TTTGTCTGAAAAGATCCTATCATTCCAAATGAAACTTCAGCTTTGGCAAAAAAATGGTAT
GAAAATAAAATTTACATCATGCCCACCTTTTCTGCTTTCTTTGAGGAACATGACATTGAA
CCAGACAAAACAATTACGATGTCCAACGTGGATACTCCCGAGTGATCACTCTCCCCGGGC
TCTGTCCAGGTGGCATAGAGGAGCACAGGGCTCAGTGCCCCATGATGTACAGTCCTTTGC
CACAACGTTGGAGATCAAGCCAGGCCTTGAGTCTGCACCTGCATATTCCTACAGCTTTTC
AGAGTCCCGTGGACAGTGACTGAGGAGACAAACCATGCAGGGAACAGGTAAAGAAAAAAA
AGGATTGCGATGAACATTTCTGTGAAAGAACACTTGCACATGCTTGCAGCTGAAATTTCA
TTGTGCTTTCCAAATCTACCTGACACCCCATTTACACTTGCCAGAAGCCCGTTCACTGTC
AAAGTTGAAGCTGTACCTGAGATGCACAAGAGGAGTTCATTGAACTTATTAACAGCAATG
CAGCGAGAACGGATTTCTCTACCATGCCAGTTACAAAATTCTGGATTAAGTGTTTGCACT
CATATCCTGTTCTGTCACTGTGCTTTAATTATGTTCAATTTATAGCAATGAAAATACATC
CTGCATGTCAGATATTTACATTATGATTCATAACGACCAAAATTACACTTATGAAGTAGC
AACGAAAATTATTTTATGGTTCATAAGCACATGAGGAACTGTATTAAAGGGTCACGGCAT
TAGGAAGGTTGAGAAGCACTGGTTTAGTAAAACATAATAGACCTTTATCTGATGTTGAGT
GGGCAATAGAACCACAAGAAAAAAATGGGGAGGTCAATTGTTTAAATACAAGAATAGCAG
AACATATTGCAAAAGAAATGAAGATATTTAAGATTATAGAAGCGAATACCAAGGTGTGTG
TCCCAATTGCTGAGGCAGCTTCAGTTTCAAAGAATAGCACCTTACCAATTATGTTATTTG
TTGCTCTGAAAGAATTGGTTGCAACTACAGCACAGTGTATTTTCAGTACACTATTGGCTG
CTTTAAATGATTGTGGCTTTACTAATGAATATTTTAAGGTAATTTAATTGGGTTTTGTTC
TGGTGGTGCTAATACAATGCTGGGAAGAAAGTCTGGTAGCCACAAAGTTGTTAGAAAATT
TTCCTGAAACTGTCATTTGGGACTGTTGAAATCATCGATTGCAATTGTCACTAGATTATT
CATTATCTGAAATAAATCAAGTTAATCATTTAAAAATATTTTTGGACAAAATTTATGCTA
TTTACCACCAATCTCATAAAAGCCAAACTAGGCTTTTAAGAACTGTAGATAAAGAACTTG
AAATAGAAATTACTAAGATCGGTCAAGTAATGGGGCCAAGATGGGTGGCATGTAGTCTAT
CGGCTGCTACTGTGGTGTGGCATGCATATCCTGTACTATACAGACATTTTTCCCATTCTT
ACTCAGGTTTGGCAAAGAGATTAGCTAACAGTAACTTTTTGCAAGACCTTCCTTTAACAA
TTGACATCCTTGAAGAATTTTCACTCCTTTCCACTGACTTGCACTCAAGAGCAACCAACA
TTCAGAAAGCACAAAAACTAATCAAACGCACCACAAGAGCTTTGGGAAAGTTTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACTGTTGCAA
TAAATAGTGCTGAAACTGAAAGGAGTTTCAATTTAATGAACACAGTTTGTACAAAGGTAA
AGAATAGCTTAACAATAGATCACATATCAGATCTAATGGCAATAAACTTAATGGGGAAAG
AGCAGATTGGGATGCAACTCCATTTGTAAGATCTTGGTCAAATTGCAAATCAACAAAGCC
TTGTTATCAGAAACAATTAGCTATTTGGAGTTTACAATAAAGATTATTATATGTATTTTT
AAATCAATTATCAATGATGTGCTACACAGCCTTTATATAAGGGAACTTGGAAAAGTGGAA
TTCGAAGATAATTCTTGCATGAACTTTTTGAAGCACTTGGTGCACACACATTTTGGGACG
TGATGAGATGCTGGTTGTTAAAACTTTTTCGTCACACTGTTTAAAAGACATTCTTGATAA
TGACTTTTTCAAAATTGTAGCAAGAATGGCTCATAATTAAGTGACTTTGAGGAGTCTTGT
TCAAGCTTTCCAACGATTTCCCTTTTGATCTGTGGTATTTCAGTAACTGTGAAAGGGTAG
CATGACTCGGTTAAATTCCAAGCCCTAGAGGAGACGTCAAAGGAAACGAAATAAACATGG
CAAGCTTTTGGCTCCTGATCCTCTCATTTCCGTTGCTGCACTAGCTAATCATGGAACCAC
TTAATCATTCATAGCTATGAAGCATTTGAAATGAGGCCAGTAGAGCTAAGAAAGTGAATT
TTAAATGTTACTTAATCTTAATTAAACATACTGAAGCAGTGTAAAGTGTTTTTATCTAAC
TGGGCATTATGATAGTCTTATTAGAAATGCATTTCCCTTTAATTGTTGAACTGCGTAAGA
TGTGATTGCTGCACTGTAGTATACCTGTCAAACCCTTGTGTTATTTCTGTTGTTGGGTGC
TGTGGAGTCGGTTCTGACTCACAGCAAACCGATGAACAACAGACTGAAACACTGCCCGGA
ACTGCAACATCGTCACAATTATGTTGTTTTCCAGTGTTCCATAAAAACACGTCAGTAATC
CAATGTATGTCAACAGATTGATTCAGTGCAATTTGTTTCCTTAAGAACCGGCATACCAGT
GTTTGAATATGCAGATAATAGGAAAGGAATCAGTGATATTCAGTAAATCATAATTAGTAA
TTAAAATACTTATTTTAATTTTAATTAAATTATTTTTCTAGTGTAGACATGAATGTGAAC
GCACTTTTTAATTTAAAATAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1084, 30570..30650, 31904..31927, 31931..32020, 32022..32276, 32280..32285, 32288..32488, 35189..35500, 35503..35553, 35558..35605, 35609..36051, 36305..36696, 36948..37078, 37081..37178, 37181..37181
1001..1084, 30570..30650, 31904..31927, 31931..32020, 32022..32276, 32280..32285, 32288..32488, 35189..35500, 35503..35553, 35558..35605, 35609..36051, 36305..36696, 36948..37078, 37081..37176
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved