Echinops_telfairi Locus CCDC123
snOPY snoRNA Orthological Gene Database
Echinops_telfairi CCDC123
Echinops_telfairi
CCDC123
GeneScaffold_2875
SNORA42
53214..53347
86942
ACGCTAGATGATAGCGGAGCAGGTTCTGCCCAAAGCCCCACATCCCACTCAAAGTCGGG
GCTTCGGGGGCTAGATCCCAGTTCTGACTGGATCCTTGGAAAGGCTGGGAAGGATCATGA
AACACCACTCCACGTACCTGTCTCACATTCTCGTCACCTCAGTTCAGACGTGCGCGGCTC
CGACTCAGCCGACCCAGCTCTCTCCCGGAGCGGTTCCGGGGGCAGACGCGGGCTCCGGCC
TCGTCCTCGCTCGGCTCCGCCTCCGAGAGCGCCGATAGGCCGTGGCATCGGGAATGGACA
TCTGAACGGGCCAATAAGAGCGCGGAACGTCTGGCCTGTTTCCGCCCTGGTGAAGATTTG
AATGGGACCCGCTGGTTGTCAGGAGCGACGGCCATGGCAGTACCCTTGGCTTTGATTGGT
TGACGAGAAAACCGAGCCAATGACGGGCGTGGCTGTTGCAAAGTCAGATGCGAAGACAGG
AGCGTCCGCGGCCGGGCCAGACTAGCGGGAATCTTTCTCAGGAAGCGGCCGCGGCGAGGC
CTTCGCCGGCTGTCAGGATGCCGCTGAGCTTTCGGAGAAGCCGCAAGAGCCACTTTGTAA
GTGCGTGGACGCTCGCCTGCCCCGCGCTTCGACGCCGTGGGGCCCCGAGTTAGCGGGCAA
GGGCCTTGGGGATTGGACTGAGACGGAGGCGTTGCTCGTTTGGGAAGGCCTAGTAGTTTG
TGTTCTATAGAATCCTCTCCCGAGGGTTGGCCCCCATCGGACAGGGTTCACCCGGTCTTC
CCTCCTACATTCGCTCACGTGCCGGGGAGCTCGTTCTTGGTTCTGCCCTCCCCAACCCAC
CAGGGACGCCCCATCAGAAAGTCCTATCGGTTCTATCCCCACGGACGGGCGTCTCAGAAC
GGGTCGATGCCACATTGACCTCCAGCTTGCCACCAAGACTGTTGCAGCAGTTTCCCGGCT
TCCACTCTTGCTCTTCCCGGAGTCCCTTCTCCACATAACAGGCGGCCAAAGGGATTCTTT
CTTCCTCCAACGGGATGTTTTCCCCTTAACTTTCTACTGTGAACTGGGTGAAGGTTTTTG
ACATTTCATCCATATTTTGCTTCATCGCAACCCCTTCAAGGTAGCATCACGTATCCCACA
CCCTCCCTGTGTTTCCTGTTTCCGTTCCTAACCCTTCTGCACTTTGGCCCCGGGAAAAGG
CTGCTCTTTTGATCTCAGATGGCTGTTAAATTTAAGTGTTTGTGCATCTGGAGTTCTATT
GCTCCCCTTAGAGATCTGTCTTTTGGCTGAAAATTGAGCCATGGGGGCAGAGGGTGAGTT
CATTTCCAGACCTGAAGGGTGAGTAAGGGCCACAGTCTGTACTTGACCAGTAAGCCTGAT
CTCTTTTATGATCAGTTTTCTCCCACTCCATCCAGGTTTGGGATCCCTTTCGGGGCAGCT
GGCAGTGGTAGCCAGGCATCATCTAGCTCTTTCCGTCTTGGGGTGGTGGAGACTGATGTT
TGTGTCGTCCATTAGTCCATAGTCTCATTGATTCCCTCTGTCTTTGATTTGCATCACTCT
TATTTCAAAGAGATTCTTTTAAAACTTAAAATCGTATCCTCTCATTAGATCCCAATGCAG
TACCCCCCTGTCCCTCCAAGACCAGGCTTCTCTATTCCTTCTGCCTGGAATGCTTCCCTC
CTAATCTTTCCGAGTGCTCATACTCCCAACCTTGTTCTCTGTCCACACGTCCTGTCTTTC
CTATTTGCCGGTAGTATTCCGACTCCCAACAATCTGCTGACACTGCCCCTTGCCCAACCC
TGGAATCCACAATTGGTTGAGCCAGCTGACTTTTCACTGAGTGTAGCGGCCCTCGCTTTT
GGGAGTGGAAGCAGGAGGGCTGTGGCTAGCAGATGCAGATAGTGGTATGAGGAATGTGTA
GCATACTCTGGCATCCCTCATCTAAAGAAATAAAACAAGTCATCTTTTTAAAGGGCCTAC
TTTTACTGAGGGTCAGCCTCTGGGAATCCAAAGGTGAATAAAACTCTTCCTGCCTGTGGG
CATCTCCCCGGAAGTGGACATGTCAACTTAACAAATGGCTGGAGGGGGGCACTCCCAAGA
GGGATAACTAGAGTAGAAGGGGATGGTGGTGGCAGTGCCCAGGGCAAGGGGTTGCCCTCA
CCCTCACCATGACTTCCACTGGCTATCATTGTTTTGCAGAAGTATATGCCCATGGCCTCC
TTCCCTGCAGCCAGCATCGCACCGAAGCCAGCGGTGCCACGCACACCTCCTCCCCGCAGC
CCCAACCCCTCTACAGAGAGACCGAGGTGAGTGTCAGATGAGTGGGCACCGGGATCGCCT
CTGTCAGAGGTCCCGGGGCCTGTGCTCTGCTACCAAGCTCTGCACCCTGGGATCTGCTCA
TACTCTGACAAGTCGATAAAATCACGTCCTTAGAAATATTTATTACACTTGTATCGTGAG
ACACTTAATATCATTTCTCTGTGGGATAATGGACTTCCTTCTCTTTACACTACATAGTGT
CCTCACATTTCATACCTAGATGCAGTCACTACTACTACAAAAAAATGTAAAAGCACTAGA
CTCAAAGCCAGATTCACTGCCATCGAGTTAATGCCAACAATTCATAACAACCTTCTAGGT
CAGCATAGAACTGCCCCTGTGGGTTTCTGAGACTAACTCTACAGGAGTAGAGATCCTCAT
CTTTCTCCCAAGAGCCAGCTGGTGGTTTCAAACTGCTGCCCCATGCGTAACCCACTGCAG
CACCCGGGCTCACCTGCTTTAGGGAAGGAAGGAAGGAAGGAGGAGCATGTTCACTTGCCA
GGGCTTTGGGTTCCCTACCCGCTGGTACTTACAGCGTAGTTGATAACTGCATTCTTTCAT
ACTTAGCCCTGACCTCAGCCTTCAGGATTTAAGGCCCAGGAGAATTTTAGCCTGTTTTTA
ATCGAGAAAGCAGTCTGCCTTGACTAGTAATAGTCAATGAGGACTAAGTTCATTCAAAGG
TGATGTTTTTTAAAAGTGTTCTTTGAAATTAGAATATTGTGTTAAACTGCTGCTACGTCA
GCATTTACATTAGATTATAACCCTGTGGTAATCATCTCTTTGAGAAGAATTAATAATCAG
ACTACTCCAAGGAGTTGGGGATGGATGATCCCCAAATGCCCAACTCTTCAATGGTGCTAT
TCAGCTTCATTGAGGATGATTTCCTCACATTTCTGGGTTCTTCAAATTGCTGCAGAAACT
CAAAAAAGTTTCAGGAATGTCTCACTTTGTGGTAGGTGCTGTCCAGTCCAAAATCTGAAG
GTCAGGCAGGGGTGAGCCAGATGCTGGGGCCAGAAGACCGGCTCCATTCCTGGCTCTTGT
TGGTGATGAGGCCACACCCCCTGCTTCTCAGTGGGCTCATTTTATATTCAGCAGGATAGC
ATTGCAGGGAATCTAGGTCATAATTACTCACAGGTGAATCTTATCAGTCTTCTCCCCCTG
TTCCCCCCTTCTCCCCCTACACACACCTTTTTATCAGACCCATGCAGGGTAAGGCCGCTT
GGTAGGCGTTACATTGAGTGGAATCAAATTAACAGATAACCCTTCACTTTTTTAATGATA
CCCACGTAGCAGGTTGTATTAGGCTAGGTGGACTAGAGAAACAAATCTAGTCACATTGAT
ACATGTGTAAGTGAGAGCTTCTTTTTTTAAAAATTTTTTTTATAGGAGGCTCGTACAACT
CTTATCACAATCCATCCATCCATCCATTGTGTCAACATATCATCATTCTCAAAACATTTG
TTTTCTACTTGAGTCCTTTGTGAGAGCTTTATATCAAGAAGTAATTACGTTTCAATAAAA
CATCCCAGCCCAGTCCAACTCAGTTCCTTAAGTCCAATACTAGACCATCCGTCCCTCTTC
AGACTCACAAAGCCACATGCAATGATGCAGAATGCAGGCACATCGCCAGCTCTTAACAGA
AAGGTGAAGGTAGAGTGGGCGAATTCCCCAGAATATTCCTTATGAGATGGCCCCGGCCAC
CAGGAGACACCGTCAGCCTGTGACCTGATTGAAAAGCTAGACTCCACCCTTGCACTATTT
TCAAGTCGCCTGAAATTATGTTACTATCACACAGGTCATCATATGCGATTATAGATCAGA
ACAAATAAAACATCATTTCATGGCAAGCATGCTGTAGACTCATTAGAAAGTCTCTCTCTA
GTCTCTTTGGCATGTAAACTTTTCAACCTCAAAATAATCAACTTGACTTTGGCTAATATG
GCATATTTCTACATTTTTTAATTTCTGAAAAGTAACATTTAATCCAGTCTTGATTTGTTC
ACTTTTTCTCCCCAGTTCAATCTTTAATCTCATTCCACTTCATGTCATAGAGTAAGAACC
TTACACCAGTTTACCTCCTTTTCCTTCCTCCCATCTGGCTGTCATACATTTTATTTCTAT
GTTTTACGCTCCGCAGTACACGTACATTGCTACTGTTTTTGCTTGAGACCGTCATTTATT
TATTGTTAATCTTAGGTTGTAATTTATTTATCATAAACTAAACCTATTTAAAATGCATAC
TTTGATGACTTTTGGGCATACGTTTACATCAATGAAGCGATCACCACAATTAGAATAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTGATGATTTTTTTAAGAGT
ACAGTATAGTGCTCCTAGTACCGATGAAAGCATGGTAGTCTTTATTTTATGAGCTTACCT
ATTTTTTAACTAAAATTTTGCCCTCTCAAAATATATGTCAGTTTGGTTGGGCCATGATTC
TCAGAGGTTTGGCAGTTATTAACGGTAGAATCACCCACCCTGATGTGATCAGCCTATCTG
TTGTAAGGGGTTTAGGCAGGATGCAACACCCTTACTCAGGTCACAGCTCTGACCTGGTGT
AAGGGGAGTTTCCTGGTGAGGCCTGTGTCACCTTCCATCTGAAAGGTGAGAGAAGTGCGC
AGAGGAAGGACTCAGTACCACCAAGAAAGAAGAGTTAGGAGCAGACCTCCTCCTTACAAC
CCAGGTTCCCTGTGCTAAGAACTTCCTAGACCCAGGAGAAGATTGATGCCAAGACACATG
GAAATCTCCAAGGAACACTGGGTCTATGATGTCGGAAGGAGACAAGGACAGTCCTCCAAA
ACCATCAGAGGAAGCTTCTCTCTAAAACTGGTACCTTGAATTTAGACTTCTAGAATCCTA
AACTGTGAGGTAATACATTTCCGTTTGTTACAGCCATCTGCTGTGAGATGTCTGCTGCAG
TGCATGAAAACCCCCCTGCCATTGTGTTGCTTGCTGCTCATAACGACCAACTAGGTCGGA
GTAGAACTGCCCCATAAGGCTTCCAAGACTAAATCTTTCTACCACTAAGCAACTAATGGG
TTCAAGCTGCCCACCTTTTGGTTTGTAGCCCATTGTGCCATCGGGGCACCTCTGTTATTC
TAAATCACAAACACATGACCTGGGATAGTTGCAGTGCAGGGGTTGAAGAATAACTCAAGG
CAGTAATCTTGTGGAGTCTTGTATTTTCATCTGATCCAGGAATTTGAAAGCTCCAGTCTT
TGTAACTTTTTTAAGATGTCTATCTCTTGTTTTGTTCTTGAATGGTTTTCCTGATTTCCT
TTAGGTTGTTTCCTCGGTATCTCTGAGCAGCTGTAGTACGAATAGTTGGAAAGGTCTGTA
GGGACACTCCATTATCTGTCCTTCTGTAGGGACATTTCCTGCCCTCTTGTTTTGCCCATC
GACACAAGCAGTGCTTTCCTGTCCCTTTGTTTTATAATTGCCTTGTGTTTAATAATTAAT
TCCTTATTTATGACAATCGGTAAGGAGAGCGGCTTCCCCTTCTCTTGAGATTGTTCTCTC
CTACCGCTCTCCTTCTGGGGCCTCACAGGAAATCCCTTCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTAAAGATTTACAGTCTTAAAAACCCAAAAGGAGCAGCC
TTGCTCTGCCTGTGGGAGTCCCTATGAGTCAGAGTCAGCTTGATGGCAGTGGGTGGTAAT
CTGGAAAAAGAGCCCTGGCAGCACAGTGGGGTAAGCATTGGACTGATAGCCACTAGGTCA
GCAGTTCAAATCCATCAGCCATTCTTTTTATTTTGTTTTGTTTTACATGCCTCTGTCCTT
TTTTTTTTATTGTTTTATTAGGGGCTCATACAACTCTTATGACAATGCATACATACATCA
ATTGTGTAAAGCACATTTGTACATTCATCGCCTTCATCATTCTCAAAATATTTGCTCTCC
GCTTAAGCCCCTGGCATCAGCTCCACATTTTTCCCCTCCCTTCCTGCTCCCCCCTCCCTC
ATGAACCCTTGATGATTTATAAATTATTATTTTGTCATATCTTGCCCTGTCCGACGTCTC
CCATCACCCACTTTTCTGTTGTATCCCCAGGGAGGAAGTCACATGTGGATCCTTGTAAAT
GGTTCCCTTAATCAGCCATTCTGAGCAAGAATAACAAAGCAGTCCGCTCCTATAACGACT
TCCAGTCTCAGAAACCTTATGGGTCAGTTCACTCTGTCCTTTAGGGTCACTGTGAGTCGG
AATTAACTCGAAAGACGTGGGGCAGGGAGGGTTGGGCTGTGTGTCTGTGTGTGTGTGTGT
GTGTATAGAGTCACCTAACATAGCAGACCAACCCCTGCAAAGGTGGTCAACCTGCAACTT
TTAAAATACTGTCCAGTCCAATATATCCCACATGTTCCCCCCCACTGCGGTCTTTATCTT
TAACACATCAGTTTCTTATTTTTTTAATTGTTGTTGGTTGGGATGTCAGAATAATACTGG
TTTTGTAGCTGAGTTGAGAAATTCTCTTTTCTGTTCTGTTTTTGGGAGAGATACATGTAG
AATTAATATTATTTCTTCCTTGAAAAGTTTAATCGAGTCCACCAGTGAAGCTATTTTTGT
GTATAGTGTTTCTTTGTGGTAAGGTTTTAAATGACAATTTCCGTGAGTAAACTTTAATAT
ATGTTTCTCAAGGAATTTGTCACTTTTACCCAAGTAGTCGACTCTGTGACATAAAGTTGC
TCATAATATTATTTCGTTATCCTCCACATGCTTGATTCAGGTCTTTTAAGTGATCTCCTC
AGTCTCTCTGTAACTTTTTGACCATTTGGAATACAGTTAAAATAACTATTTAAATACCCT
TGACTCATTCAAGGACTCTGGTGGCGTAGTGGTTATGCTTTGGGCTGCAATTCGAAAGGT
TGGCAGTGGGAACCTTTGTACCAGTCACTGTATGAGAGGAAGACTGGGCTTTCTAGTCCT
CTAAGCAGTTACAGCTCCAGAAACCCATAGGGGTGTTGCTATGGGTCAACATCGACTCCG
TGGCAGTAAGTTTGGTGTTTTGGTTTTTTAGTGGTGGAGCTGTGAAGGGCTTGGCCGCAG
ACCAAAAGAATGGCAGTGTGAATCCTGCCAACGGCTCTGAAGGAGAACTACCTACTGACC
TGCTCTGGTAAAGATGCAGTTTAGAAGACCCTGTGGAGGTGGAGGTGAAGGAGGGGCATG
TGCGTCAATGCTGCTGGATACCCCCCTCACACACCGCCTCCCCGCCCCGGCTGCCACCAA
CGCAGCTGTAAGGGCTCCTCCTAAAGCTGTGCCATTGGCATCTCTGCTGGGGTCCAGCCG
GTTGGCCTGCCCTGCGTGGCAGTGAGGCAGAAGACCATGGCTCCAAAGGCTTTTCCACCT
TGAAGAGGGAGGAACTACATGCCATCAGGGAGAGAGGCTGGGGAACATGACGGCAGTGAA
TTGGTGAAGGAAGAGGATGTGGATGATGGAGGGCAGACACAGAATAGCAACGGGGGAAAA
GACAGACGCAGTGCATTCCGGGAAAGCCAGCAGGGTGGCCCAGGAGGGGACGAGGCAGGG
GCTGCAGCAGAAGCAGCAGGAAGATGCAGTTGCCAAGCAGGGGAAGGGCACCAGGTCGCA
GGATGCCAGGAAAAGGAGGAGGAACTCCGGGCCAGATTTCTCAATGACGGGGGCCAAAGG
GGGCCTCGAGTGGGCAGGTGACGGAGGGGGGTGGCACCTGACTAGAGAAGTTCTGGTGAA
TTGTTGGTCCAAGCAGAGAAGCTAGAGCGATCTAAAGGGAAAAGGTCAAAACCACCATGA
TGCTTGATCTTGCTAGTGCAGCCTTGAGGATGCCCCGCCTGAATTCAGAGACCATCGCAG
GGACAGATTTGCAGCATTGACCACTGATGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTGCTTGTTTACCTGCAAGCCTTTAAGACCCCAGATGCTATATTTTTT
GATAGCGGGGCACCATCAGCTTTCTTCACCATTTGCTTATGCACACATTTGTCTTCAGCG
ATCCTGTCAGGAAGGTGTGCATCATGGAATGCCAAATAATAGAACAAAGTGTTCTTGCAT
TGAGGAAGTACTTGAATGGAGGTCTAATGTCCATCTGCTGCCTTAATACGAATATATGCA
TGTAGATCTACTTCCCCACCATCCTATATAAATATATTTACATATGTACATGCCTGTATT
TAGACCTCTATAACTACCCTATAAATACTCCTAGTTTTTGCCTCTATTTCCTTTTACTTT
CCTCTTGTCTCACTATCATGCTCTGCCTTCATTTGGGTTTCAGTAATTCCTCTTGGTTAC
ATTGCCCTTGCTGAATCCCTACCGGGCCTCTCACACCCTCCTTGCCACTAATTTTGGATC
ACTTGTTATTCCCTTGTCCTTGGGTTGGTGAACACCACCTCCTTTCCCCCACCTCTCCCC
TCTCCCATGTCCCCCCAGAAACCATTGGTCCCGTTATTTTCTTTTCCAGACTGTGTCATC
AGCCTGTCTTTATCTAGATAGATCTGCAGATAATGATATGTACCAAAAAACACGGCATAG
CAAGACAAAGTGATAAAAGAGAACACAACGATGACAACAAAAAAGAAAACCAATGACTCA
GAGAAAACTGAATTAATTAAAAAGAAAAAAGAAGGAAAAAGAAAAAAAATTTTTAAAGAA
AAACCTGTAAATCAAGGTCTGATTTTTGACCTCTAGGTATATCCTCCAGTCAAGTCTGAT
GGGGTGCCACGCTCTGACCTCAAAGTCTGTCCTTTGCACTCCCTCGGGAGCTCCCTCCTC
TGCTCCACCCCCCCCTCACCCCTCACCCCCACCCCCCCATTGTTCTGCCTCATACCTTTA
GTGGTTTGCCTCGGTGTCGCTGGGTCAGCCAGAGCCAGTCCTGACACTGAGTCTCCAGTG
TTGTCCCCTTAGGGCCCTGGGCCAGTGAGGGACAGCGTGTCTCATAGTGGGATTAGCCGT
ATGGTCTACTCTGTGCATTGGCTGTTCAGAGCGGGGATATCGTCCTCCAGGCCTGGTGGG
CCAGGATGTGCTTCACTCTCTCTTCCTCCCCATTCATTTGCTCCGGTGTGCTCTGATCAG
ACATGTCCCTCTCCCCTAGCTGCAGCTTCAGTGCCGTCCTTTAAAGTAAATTCTTCTGGG
TGAATCTCTATCTTGATGAATGGTGAGCACTTCTGTATTCCTGAAATCTCCTTGAACTTT
GCTCTCGGGTGCACTTAAGTTCCTTGGTTGGTTCTCAGCAGGTCCCAGAGCAGTGCTGAC
AGATGCAAGATGTTCTGAGTGCTCTGAATTTGACTTTTTCCAGGCTGGAGGGCGGATGCA
GGCACTGCTACTGGCTGTGGGGGAGGGTCTGGCACTATTCTCTACTCCTTTTGAGTGGCT
CTTTCCTCCACTGTGCGTAATGTGCTCACACTCATGTGCTGAGGAGTGCTTTGGTGAACA
CTCCAGGGGGAGCGTCTGTAGGTCCCAGGGTTCTCTCTGTGCAGCAATCTCCACGGTCTT
TTGGGGTTCTCAGCTGACTTCCCACAAGTCAAACGACCACCTGGCCCCATCTCGGCTCCC
CATCCCTGCTCTATGACCTGGAAATGCTGCCATGAGCCAATTCTGACACTCAGGGACTCT
GTCGGACAGAGTAGAACTGCTCTCTTGGGTTTCCAAGGCTGTAAAAGAGGAGATAGCCTT
GTCCCTTCTATCAGGTAGCTGCTGGGGTTCGAACTTATTTGACCTTGTAGATAGCCACCC
CAACCACGCATTCCACCGCCAGGGCACCTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGAACAGAAGGTAAGCCCTGGATTCATTGGGTTCACAGTCACTGAATGTTCGTATCT
CAACTGTCCTCATGGAATGCTTCTGTCTGTAGGGTCTGCTCTGGCCGCAGCCATCCTGGC
AACCACATTGACTGGACAGATCGTGGCCCTTCCTCAGCCTTGCCAGAGATCCCTGTCGGA
GAGTGACATGACATATGTTGGAAAGGACAGCGTCATTGAGCCCTATGCCACCACCGCAGA
GCTACGGCCTCGGTAGGGACTGTCTCACTGGCTTTTCTTCTCTCAGGGGAAGGAGAGGGG
CTGCCTGGCTGTGTGCGTTTATGCTTAGAGTCTTTTGTTTTTGTAGGTAATAGCTTTTAC
TTACATTAAATCGGGACTGTAATGCATGCTTTACAAAGTTGTACTATTCAACTATTTTTG
TACTTCCATTTTGTAGATTTATAAGCAAATCTTTGAAATGGAGGGAGGTTGAGTTCTTTG
CCCAATAGCTCACTACCAAGATATAGCAAGCTCAAATGCTTCCTCCCTGCCCCCCTCCCC
CCACTATCATGATCCCAATTCTACCTTGCAAGTCAAGCTAGACCAGAGGATGTACACTGG
TACAGATAGGAACTGGAAGCACAGGGAATCTAAGGTGGATGATCCCTTCAGGACCAGTGG
TGTGAGTGGCAATACCCGGAGGGTGGGGTGGGAAGGGGGAACCGATTACAAGGATCTACG
TGCGACCTCCTCCCTGGGGGACAGACAACAGAAAAGTGGGTGAAGGGAGACATCAGACAG
TGCAAGGTATGACAAAATAATAACTTATAAATTATCAAGGGTTCATGAGGGAGAGGGGAG
CGAGGGGGGTGAGGTGAGGAGCTGATGCCAGGGGCTTAGGTGGAGAGAAAATGTTTTGAG
AATGATGAGGGCAATGATTGTACAAATGTGCTTTACACAATTGATCTATGTATGGATTGT
GATAAGAGTTGTATGAGCCCCTAATAAAATGATTTTTAAAAAAAAGAAAAATCAAGTGCT
AGAATGTAATAAAAATTTAATTATAAAGAAAAGAAATAACAAGCTCAAGATTAAAGCAAA
CCAACAAGAAACAAACTCACTGCCATTGAGTTGATTCTGACTCCCAGCCACCCTGTAGGA
CAGCGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGAGCACATTTGTACATTCATTGCCCTCATCATTCTCAA
AACATCTGCTCTCCACGTAAGTCCCTGGCATCAGCTTCTCATTTTTCCCCCTCCCTCCCC
CAATCCTGGATTTCATATGCCAAAAACCAGAAAAACATATAACACAATTTTAAGAGGGTG
ACCCCCAATGACATAACACCCCTGAGATACACCCTAATATGAACAAACAAAAATACCGAA
AATGTTGAAAACTAGATAAGGTCAAGCATGCCTGAGGGGAAATCACCTGACAGAGCTCGA
AGTGTGCAAGTTTGTCCCTCGGATCTTCTGTACTCACCTCTCCAGTGCACTCTGTGTGGT
CGCCACTGTCCCCCACCTCAATCATGGACAGAGGCGATTCCCTACGTAGTTCCCACAAAT
GTCCCCACAGCCTTCTGCAAACCGCATTCTCACGATTTAGGCTATGATACTAATCCCGCC
TTCAATTTGGGATTATCTGATCTACAATCCTTCAGTGACTAATGATGGTGTGCTTCTTCC
ATGTGGACTTAGTTGACATCTCACTTAAATGCCTGCTTGTTTGGCAACATCTATTTTATC
TGGGCACCATCTAATTTCTTCGCCACATTTTCCTCTAGCACCCATATCTCCTGTGTTCCC
TTCCTGAGTGCAAGTATCAAGTAGGGCCTTGATGTAAGAACGCATTTTTCTTAAGGTAGG
TGACTCAACATTAAGCATTGGTACATAGCTACACAGAGGAAGGAAACGTTTCAACAGTGT
GACTAACAATAACCCACTGTCATTGAGTCTATTCTGACTCATAGCAACCCCGTATAGGGT
TTTGAAGCCTGTGAATCTTTATGGGAGCTGCAGCCTCCTTTTAGTACTGAGGAGAGATTG
GTGGGTGTGAACCACTGACCTTGTGGTTTGTAGTCCAATGCTTATCCAGCAGTACTGTCT
TTCACCCTTAGAGCTGCTGGTGGTTTCGAACTGCCAACCATGTGGATCATAATCCAACTC
ATAACTACTACACCACCAAGGAGCCAAATCTGTTTTGAGGCCTGTTTAATATCATATTCC
AAATGTCATACACAGATTTCCTGTTTTTTCTCTCTTTTTTTTAGCCTTCCCCCCTCTTTG
TAGCTATACACAAATTTCTATTGAGTATAAAGGCTCATCTATGTATACACTTAAATAAGA
TTATGGAAGTCAGTATCTAGTCCTTATAAACCTCTCACGTGGATCTATCTGCCTCTCATT
TCTATGCTATGAATTTAGGAAGTTAGAAACAGACCTTTGTATTTAAAAATGTGTGCAAAC
CGACATAAGATTTATAGTCAATAGAACGACAAGCTCTGGGCATTTAGGAGAAAAAGCGAA
TCTTGAACTGGGGTGCGTGCACTGGGATCTGCGTAGATAGTGATGAGGCCACTAACACAC
AATTGCCAGCTGCAGGGTTGTAACTCTCCATGCAAACCTGTGGGAAAATGCCCGGCTAAG
CCAGAAAAGCCGATGCCCACCATAAGGTTTAAAGTGTAGGAAATATGACCCGTGTAGTGA
GAGGTTGGGGAAGTGGAGTATGCTGGGGCCGTGTGGGATGCATATAGACTTGCAGTTTGT
GGTTTGACTCAGCCGTTCGCTACGTGGTGGGTTGGTTTTGTTTCGTAGGACCACGTGCTG
CTTGTGCCAAGCGGGTTGTTGTAAAACAACATCACCATGCCCGGTGCTGCGCCATCCTCC
TCCTCCTCGTGTGTGAGCCATTGTTGCAGCCTTGGTGTCTGTCCACCTTGTCGAGGGCCT
TCCTCTTTTTCGCTGCCCCCCGACGTTACCAAGCCTGCTGTCCTGCTCCAGGGACTGGCC
TTTCCTGCTAACATGTCCGAAGTATGAGAAAACTTAGATGTTCTTTCCAGGATTATTTAT
AACAGTGCAGACCTGAAGAAACTTAAGCTAAGGGAAAGGCTGACTAAACTGGTACATCCA
CTCGATTCCTACCTCTGAACCTGTTGATTATGAATGAAGTCTTGGTAATGAGCAGGTAAA
CTGTGTATCGGGCAGGTGAACTAATCAGAAAGGCAGGAAAATGGAAAGCAATGCCTAGAG
TCTGCCGAGAGATCCAACAGGAGAAGGGGACTCATCTTTTTGCATGTATTTTTTTGTATG
CAGTGATCATACTTTTACGGTGGAGATGGGGGCAAATGCATTTAACATGTGCCTTCTTAC
CCATGGGAAGTCTTAAAGAGTTTGCTTCTGTGCCTGCCCTTCCATGTTGTCATATAGAAC
AACTTGGCAGAATGTGATGGAACGGGGAACTTCTTTGCCATCCTTTGAAACAACACTGGG
CGACAGGGAGGAAGAGGACAATGACACGCACCTGTCATCCAGCCCCAAGGAGGTGGGGGA
CAGCAGCACTTGGAAAGAGGCGGCAGAGCTCAAGGATGCGCTGTATGCAGCACCGCACAG
AGATCAGGTGACTGTCAATGCTGGGTTTTTCTTTTGCCCTGATGTGGCACTCCACTGTGT
GGAGTGTACAGAGGGTTCCAAGAGTTTTGCCCTGATGTGGCACTCCACTGTGTGGAGTGT
ACAGAGGGTTCCAAGAGTTTGTGGGAAAATGCCGCTGTCTTTCCCCTAATTGTTCTACAG
GCATGGTGAGGCTCCCTCATATTCGTAAGGGTTTTCCGTTGTCCTTTTGACAGACTTTGA
TTTGTTTGTTAAAGCAGTTCAAATTCATTTCCCCTGCTGATTAGGCTCACATTTAAGTGT
TTGTCTTTTAACTTTCAAAGAAGGGAAATCTCTTCATATTCTTGATGTCCATTATCTTCC
AGGGTGAGTAACTTTGTTTCCTTTGACCCCAAACTTAATGTTTCTGTTGCTCTTCCAGGA
TCAGTCTGCAGAGCACAACCTTTCTTCAAGCCGGGCCTCCTCAGAGGGATGCTATACTTT
GTCTCTTAGTGCTAGTAACATTTGGATGGTGGGAGGCTTCTTCTGTTCTATCAGGAAATG
AGGTTTTCGGTGGACACACGTAGACAGCAAACATGGTTGTCTGGATGCAGGTCCTCATGG
GACTGGCCAGCAGTCCCTGTTCCCTTGGGAACTAAGACACCAGTGCCAGAACCATGGCGG
GCAGCGCTGGGGCTGGGGCTGGGCCGGGCAGCTGGGCCCTGCCAGGCTGTCACAGATGGG
GTGTCGTGTTCATCATCTCAGCATAATTTGAGTGGCATTGCCTTTGCCACCCAGGCTTTT
CCCTAGAGGCCCTGAGGTCTCATTCCTTCCTGCCAAATCAGTCCTCTTTTCAAACACACG
TGTTACGGTGAATTGGGTGAATTACAGAGTAGGTCATCACTTGGACATTCAACAATTCAG
GCACATGCAGTTTCTTCTCCCTGAAAGCCCCTCTGTGTGAGATTAGCACCCATTCCTCCC
TGTGTCCTGTCTCCATTCCTCCTCCTCTCCCCACCCTCTTGAGCCATGCCCTTGGGTGAA
TGCTGCCCCTGGATCCCAAAGGGTCCACCATGCTAGGGTGTGGGCACCTGTGCCTCACCG
TGGGTGGTGGTGACTGAAGCTGCTTGAGCAGAGCGGTCGCAGGGGCAGGTGCGAAATAAG
ACATTGGCGTTTGTGAAGAGGACATTTTAAAAAAACTGATCACATACCTGCTTTTTCAGC
TTCTTATTTTTATTTTTTATTAACAATAAAGGTTCCATTGTCACATGCAGTGGACAGTGA
GGAAGATGAAAATATTTCAGAGCAAGATGGGTTTCCAGACACCTCTGTCACACCCCGGTG
TCCACCAGAAGAAGGTGAGACCCAGGGTAAGCTTCTAAAGATGCCGAAGTATCGTCACCT
GGTAATAAATGTGGCTGAATTTCTGGGCAGAGGCCACCAGCAGATCTCGAACTGTGGCTG
TCTAATTATGACAAGAAATGTGCCAGAACTTTATTCTCCTCCTAGTAAGCTCTGCACGGT
GCTTACCCGCGTGCAAGGTGGGCTTCAAAATGTAAGGTGCTGCCTTTGGCATGCTTTTGT
CTCCTGCATCAGCAGCCCAGGAGGGGGGCTTATGCTCAGCTCTCCGAAGCCTTCTAGGCT
GGCTTCCTGCGGCTCCCCGGGGCCAGTTGCTGCCCGACACACCGTGGTGTTCTGCTGAGC
TGCTGAGAAGGGAGGAAGGGAGTTAGGAAGTTCCGCTTTGCTCCCTGTACACTGTCCCCG
GGGCCTCGCCCCGCAGGGGCCCTTCGGGCACCGTTTTATTGGCATATTTTTGAAACCATT
CTGTGAGTGCTTGATTTGGCAGGAAGATTTCCACGCCTTATAGTGAAGGTTGCTGTTGGT
TGTCAACAAGTCGGCTCTGATTTGGGGTGACCCCACGTGGCAGAGGTAGAGCTGCTTCAT
TGCGTTTGCAGTGCCAGCCTTCTGAGTGGTGTAGTTGAGCTGCGAAGGGCCCAGTGTTTA
GCCCACAGTGCCACACGACTCCGTGCATTTGAACCACAACCAATCCGCTGCATGAGTGAT
TCGACTCATCTGACCTGTAGTCAGTACACTGCCTGGTGTTCTGACTGTGACTCTCACAGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGACCCACGTGGCAGAGTA
GAGCTGCTCATGGGTTTGCAGTGCCAGCCTTCTGAGTAGTGGAGTTGAGCTGCGAAAGGG
CCCAGTGTTTAGCCCACAGTGCCACAAGGACTCCTTGCAATTTGAAACCCACAACCAAAC
CCGCTGCCATTGAGTTGATTTCGACTCATCCTGACCCTGTAGGTCAGAGTACAACTGCCC
TGAGTGTTTCCTGGACTGTGACTCTTCACAGAAGTCGAAAAGCTGGTCTTTTTCCCTCCC
ACACCAGGGCTCCTGGTGCTTTGAAAGGAGAATGTGGGGTTTTGGTGGTGGTGGTGGTGG
TGTTATTTTCATTTATTCTCACAAAGGGAATGTTTAATGTAGAGAATAACAGTTTTTGGA
GTTGCTGCGCCATTGTGTCCACTAATGGTGTGTGAGATGTGTGCCCAAGCCATTGGTTGG
ATTGTGCACTGTTGTCAGAAAGCAGCAAGATTAGCAGTTCAAAACCACCAGCTGCTGCTC
TGTGGGAGAAAGAAGGGGCTTTCTTCAACTATAAAGAGTTACAGCCTCAGAAGCCCACGG
AGCAGTTCTACTCTGTTCTATAGGGTCTCTATGAGTGGGCATGACTCATGGCAGTGAGTT
TGTGTTTGTGTGTGTTTTAATCAGAAAGCAGCACCCCCGCTTACTCCAGCAGCTCTCCAG
CGCCCTCTACCAGCAGAGTTTATCACCAACCCAATGGCCTGCCCCAGCCTCAGAAGCCAC
CTATGAAGGGTGGGATTTGTTGCTTAGGGACAATAAAGTAATAGCTAGCACGCTGGTAGA
CATGCCTGTAGAGCCCAAGTGGTGGCTGGGAGGCAGTGTGGCTCCTTCAGGGGCTCCGAG
TTTGTGGTGAGCATTAGAAGCATCAAGATGCTTGTGGGTGTTGGAGAAGAATCTTGAATA
TATCATGGACTGCCAGAAGAAGAAACACATCTTTTCTTGGAAGAAGTACAGTCAGAATGT
TACTTAGAAACAAAGACAATGAGACTCTGTCTTACATTCTTTGGATATATGATCAGAAGG
GAGAAGTTCCTGGAGAAAGATGTCATTCATGGAATAATAGAGGGCCATAAAAAGAGAGAG
AGAAAGGCCATCAATGAGATAGATTGATATCATGACTGCAACAATGGACTTACATACAGC
AATCACAGTGAGAATGGTTCAAGAGCAGTTCACGTTTCCTTCTGTACGTAGCATCTGTTT
GGGAACTAGCTCGAGGGTACCTTTAGCGATGACAGTAAGGTGTGGCAACCGGACTAATGG
GACACATCCAATGTCTTGGCAGGGTTCAGTAACTCCGTAGTCTTACAAAATTTAGTACTA
GAAAAAAATTTACAAAATATAAACTACTTTCACAGGATTTCATTTCACAACAATCTAGAT
TATCTCTGTTGTTAATATTCCTTGAAATGCATGCTAATTTATTGATGATTTGATATTACA
ACTTTTCCACATCTATGTTCAAGTTAAATGCACATTAGAAACATAAAGATTAAAATTTGT
TACATAAAGAAAACTTTTAGTACTATTAAAGTTTTTCCAGTCATGTAATTATAATGATTT
CTTTGTTGTTCTTGTACTATATATAGACTCTACTTGCTTTTGATATTTAAATTACACCAA
TATTTCATCCGTTTAGTAGAGTTGTTTGAATACTTATGCATTCATTATATATCTATTGTT
TTCCTTCAGGAGTTTTAGAGTCTAATAAAATTATCACAGCATTTTCAGCAGGAAAAAAAA
AAAAAAAAGATGCTTGTGGGACCTGAATTGCAAATAGGTGGAAAATTAGTAACGGAGCAG
AATAACTTTTATCTCTATGCTGAGGCATTTTTTTCAAGGAACAGCACCGTGGGAGTGGGG
CTTCCCTGCAGAGTGGGAACCCTCTGGGGAGGGGAATGGCAGGGTGGAGGGGGGGAGGAG
CCCAGAGTCCCTCTGAGGAGTTGGGTCTTGGCTCTGTCATCATGGGAGCCACCGTGATTG
ATGCCCAGCTGAGGAAGGAAAGAGACGGACAACCCAGTGTAGTGCCCTGCCTCCCCCTGG
GCCCATCTTGCCATGTGACCTTAAACCATCCACCTACCCGGGGAGTGGGTGGGGCTGATT
ATCATCTATAGTCGGCAACTTCCTGCGATTTACTTTTCTGAGATGTCAAAGTTCTGCATT
TGTTTTAAAAGTTCTTTTTATCTTCCACCCCCACTGCCCCTTCTCTTTAACCAGATGGCA
AACACTCAGTTCTGAATCTAAAGGTAAGATAATTTTTAAAAACCATTTTCTCAAGAGATA
AAATATCCATCCTCATTTTTAAACAGCACCCATGATTTGTGGGAAAAACACGAGATGCGG
CTTCGAAAATTTTGTGGAAAATTCCATTATCTTTCATTCCATTTTCCCACGACCTTTGTG
AAGCTGCTTTGTATCTTGCATTTCTCACTAAAGGGCTCCTTTCCTCTGGGGAGGTAACAA
GCGCTTGCATCATTAGCACAGAGGATAGACCATTATAATGACTAATTTGCTGGCAAGGGA
GAGTTCCACCTGAGGTTCATATTGTGCTATGCCACAGATAGTGAGAAATTAGACTGGCCG
GTGCACAGGCTGTTATACAGCATAACTAGACAGGAGAGCAACGGTCCAAGGTTGCTCTAC
TTTAACACGGTACAGGGTGGGTTTTCTTGCAATTCCCAGTTCTTCTCAAACTCTTCAAAG
GGAGGTAGCTCCAGCCAGGTCTGCAGGAAGGCCCTTCCTTCATGATTTACAGTGCATTTG
TAAGATGCACAGAGCAAACGAAGAACTACAAGAACCAAACCGAGGGGGGAGACCCTTGTG
CTGGAATAGTTAGTCAGCGGTATCCTGGCTGCGTGTGGGAGCCTGCTGTCAGAAGCTGCC
AAGCCTCTGTAACCTGTCGCTTTCATGTTTTGTCTTTCCTAGGATGCAAAGACCCCGTTA
TATGAAAAGCCTCCACCATCCCCAGGTAGCTGTCTTCTGAATTTCCTGATGACTGAAAAG
CTTATTTTTTTAGAGACAATCTGGAATAATCAGAAAATGAAAGTCTCTTTTCCCTCTCCT
TGGACACCGATTCCCTCTGTCCTCTGTTATAGGAAGTAGGAAAGAGTTCTTGAACTTCCA
TCTCTGCCTCAAAAGACAGAGCCCAAACTCTGGGTGGTGGACTCTGTTGATATGTTCGGA
TGCTGGGTGGGTGGATGAACTTGTGGGTGTGTTAAATATTGGGTGGGCGGGTAGATGGGC
CTGTGAGATGTGCTCAGATGTTGAGAGGGAGGGTTGGGGAGCTATGAATGTGTTCAGATA
CTGAGGGGTGCTGCGGGAACTGTGGGATATTCTTAGATGTTGAGTGGGTGCTGGGTGGGC
CTGTAGTATGCATTCACATAGTAGGTGGGTGGCTGGAACTGTAGGATGTGCTTGGATGCT
GGGTGGGTGATGGGTAGGCCTGTAGGATATACTCAGGTGCTGGGTGGCTGGAAGACCCTG
TTGATGTGTTCAGGCACAGCACAGTTGTGTGGGTGACCTGAGAGATGTGCTCAGGTGCTG
AGTGGTGACTGAAAGGCTTGTGAGTGGGGGTCTTCAGATGTAAATGCAGTGGGGGGTGCT
TCCTATATGGACAGGTGACTAGGTAACTGGAGGGTGGGTAGTTGCATATGAGAGCTTGCT
CACGGGATGAAGGCAGAAAGTCCTGGAGATGCTCTCTGGAGTCTATGCCCTATGTAGTTT
GGGGAGTCTCAGTAGCTTCAAAGTGGATCTTATATTTTTAACTGAATGTCACACCACTAA
CCTGAAATCCTATTAGCTGTCAACACTGTGTTCTCTGTGTTGGACTGACGTTCTCTGTGG
GTGAGGAGGAATCAGCTTGGCGGCAGTTGTTTCTCTCTTTTTGAGTATTCTATACAGGAG
CCCTGGTGGCATAGTGGTTACACATTGGGCTGCTAACCTCACGGCCTGCAGTTTGAACCC
ATCAGCCATTCCCCCAAAGAAAGACAGGGCTTACTCTCGTAAAGAATTACAGTCTCGGCA
GCACAGGGGCACTTCCGCCTGTCCTCCAGGCTCACTGTGAGTCCGCATCACTCGATGGCA
GTGAGGAAGATGGGGCTTCTGTTTCTGAAGTGATTTCTAGTCTTGAAAGCCCACAGGGAC
ACTTCTGCCCTGTCCTCCAGGCTCACTGAGTCAGCCTCACTCGATGGCAGTGAGTGTGCG
GGAGCCCTCGGGGGTAGCACCAAAGGTCAGCACCTCAGGAAAAAGATGAGGCTTCTGTTT
CTGAAGTGATTTCTAGTCTTGAAAGCCCACAGGGAGGGGTAGTTCTGCCCTGTCCTGCGG
GCCACTGTGAGTCAGAATAAGTTTGATGGCAATGAGCTTGGTTTTTTCACTGCTGGAAAT
TTTCTGGGTCTCCTAGGTTAATGCTTCACCCTGCTGCTCAGCCCATCCTTTGCATTGTAT
TTATCCATGAAACAGTGGTTTCCACGGCTTTCTTTCTCCAGGGATCTTAACTGCACTCAT
TCCCCAGTCTTGTCCATCGTGTTACAACTGCCTTTCCTCAGTTCTTTGACTTAGGTGCTT
CCTGTAACTCGATGTTCTTGGTGTTGTGTCTCCTTGGTCCTTGAGCCCTGGTCCCCCTCT
TTTGCAAAGTTGCAGGCTACTTAGGGGGGCGGGGGGTGGGGCACCAGCAAGCTGCTAGGT
ATAATCTGCCTTTCCAGTGATTGATGGACGGTCAGATGTCTGGCCAGCAGCAGAATGGGC
CCCGTCTTCCGTATGTGTTTGTCTAGCTCCTTACCTTAAGGTCTGTGTGAATTGTCTGGC
GAGGGACACCATCCCTACTGTTCGCTGCCTGCCCAGTGATGTGGGCCCCTCGCTGTGCTC
ACAAGCACTTCATGGGTTCCTCCCAGGTTACTTCCTGTCCCTGGGAAGTAGTGCTGACTT
CTCTCTAGTGGTGAGAGACTTAGCAATACAAAACAGATCTTGACTTGTTCTTCTGTCCGT
GCCCATCCAGTCCGTCATCAAACCTTGCCAGGTTTTAGCAGTCAACCTTCCCGTTGTTCC
TTCCATGCTGCCTCCACTCCACAGCTACCTCAGGAGCCCCCTGGTTGGCCTCGCTTCCCT
GCGGTGTCCGCATTGCAGTGCTCTTTCTTCACCGGGAGGGGTGTTGGATCTGTTTGGGGC
CTCTTGCCATTTCACATACTGTCCAGGGCCTTTTCATTCCCAACCGCTCTGCACTAAAGC
TGTGCTAGCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCCATACAGAGAGTTCTTTAAAAAGCCTAAT
GCTCAAGGCTAATACTCTATTCGTTTGTAGTATGAGGTGGGGGTGCCAGCCCCTCATCAC
TTAATTATGGACTCAGTAAGCACAAATGTACGGTTGAGATATATAAATATTATATTAAAG
TTATCAAGTGCATGAGAGATAGAAGAGAGTCAAATAATGGAGTCAGACACATTACATGGT
AGCATTGCTCACCTCAACCCCCTTGGTGGTCCATGTGGAGAGAGGAGGAAGGGAAAGAGG
ACAAGGGGAAAGGGAAACGGGAGGAGAGGGAGCCGAGGAGAGGTCAAGGGAGGACCTGAG
GGGGCGAGCCAGGAGAGAGTCTCTCTATTGCTAACCCAGGCCTATATACCTTTGGGGGCG
TGCAAGCCCACTAATTACAGGTAAAGACATACGTCATAGGAAGGGGTTACACTATAGGTT
ATACAGTAATGGAAGGGGGTGGTCTAGGGGCATACACACAATAGGAAGAGGAGGGATTGG
GGGTATACATGTGACAAGATGGGCGGATCCCAGATTTAGGATGGCAGTTTAACTTTGACC
TGTTCTCTGGCTCTCCATAGGAACCATGATCAGTAGGGTGTGAATTCCACCTACAGGAAC
CAAATCAATGACTGCAGGCCTGTCCATTGTCCTTAACAGCAGGGAGCGGGGGCCACCCTC
AGGGAGGATGCCTGCTAGCATCTGACCCCCCCCCCCCCCACATTAATTAAGTGAAACTAT
TGTTTGGTTTTTAACATCGGGATATTTTTGATTTAAAGTTTAAAGATGATCATAGGACAT
AGTTTTCATGGCTTCATCCAGGGAAGACCCCCCAGTCTTTCTTCATTATGTATGATGTGG
ACTGTTGTGTTTTCGTACATACTGTCGGGTTTCATATATGGTCTTTCAGAATCATATTAT
AGAATTTCTCTTCCATTCCAATCTTACTTAGGGTTGGATTTTACCAAGTGGGGTTTATGA
ACCCATGGAAGTGACCATGTGGTTGTTTTCCATTGTTGTGTTGCTATGGTGCATTATGTC
CAATGATTTCCTAATGTTGATCCTTGCCTGCATTCCTGGAATAAACCCACGGAAGGGTTT
GGTTTTGTTTGTTTTTTCAGTGTGCCTCCTTTAGTGTTGTTAGATTCTGTTCACTAGTAT
TTTGCTGAGAATTTTGGCAAGTATATTTATACTAGGGGCATTCTGGTGGCACTGTGATTA
AAGCACTCGACTGCTACCAGAAGTCAACAGTTTGAACCCCCAGGTGCTTCGTGGGGAAAA
GATGTGGTCATTGTTTTCTGTAAAGGTTTACATCTTTGGGTTTCCGTCTCTGGGCCAGTT
CTCTTCTGTCTCATACGGTCGCTGAAAGTTAGAAATGACTGGACGACAACAGATTTTGGT
TTGGGGTTATTCATAAGAGACATTGTTTTTGTATATGCTTCCTAGGATGATTTAAGTAGT
ATTCTTTCCCAACTTTTGGGAGATTTTGAACACATTGGGGTCAATTCTTCTATAAATGTT
TGATAGGATTTCCCAAGTAAGATTTTTTTATTGGGAGGTTTTTAATTCACTGATTTGAAC
TCTTCCCTTGGTATGGATCTGTTAGGCTTTCTCTTTTCCTCTTGAGTCCGTTTGGGTGGG
TTGTGTACATCTAAGAAATGTTACCCTTGCATTTAGAGTATCTAATTTGTTTTCATAAAA
TTGTTCATACTCTGTCATAATTATCTTTGTTTCTCTTGGGTCATTTGTGTTGTTACCTCT
TTTATTTTTGTTGTTTTGCTATTTGCATATTTTCTCTTTGGTATTGTGATAAAACTGAAA
ACTCACTGCCAAGCTAGTTGATGCAGACTCACAGCGACCCTCTAGCCCAGGGTAGAACTG
GTCCTGTGAGTTTCCAGGATGGAAACTCTGTGTAGGAGCACAAAGCCCCCTCTTTCTCCT
GAGGGACAGCCCAGTGGTTTCAAACTGCTAGACTTTGCATTAGCAGTCCAGTGTGTAACC
TCTGTACCCCCAGAGCGCCTGTAGTGTTGTGATGGTTTTGTCGATTTTCAAAGAACCACT
TTCTGGTTTTATTGATTCTGTTTTTTTCTCCTATTTCTGCTCTGGTTGAGCTTTGTTACT
TTCTTTCTTACTGGATTAGACTTAGTTGGCTGTTCTCATTCTAGTTCCTGGAGTTGTCAG
TGGTAGGGCTGTTGGATTTGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
CCGTCCCATATTCTAATTTATAATAATGTCATCTCTGGATCACAGAAGCTGATGTGCCTT
CACACAAGTCCCGAGTGAACTTAGTTGATGCCTTGCTTAGATGGCTCCTTGTTTTTAGTA
CAAGCCTTTAAGACCCCAGACACTATTCCAATTGATAGCCGGGCACCATCTGCCTTCTTC
ACCGCACTTTGCTTTAGCACCCGTAATTTCAGACTTTTTAAATGTGCATTCACTTGCTTT
GTGATCTAACATGTTTTCTGACCTGGAGAGTGATCAGTACGCATTAGAGTAGAACACATA
TAGTGATGTTTTAGGGTAGAGGAGCTCTTTATATATTGCAACATTTTGCCCCTTTTTCTA
TATGTAATATTTTCTGTTTGTTGGTATTTCAGTTAAATTTGTAAGATACCTTTTTTAGCT
TCTATCCTTAGTATCCCTTTTAACTCTTAAGATTGCATATTTACTAATACTTTATACCTT
TTTCTATTTGTATAAGACAATGCTGACTATTCAGTGTTGAAAGAACTTTGTAACCTTTAT
TCAGTTATGTTTATATATTTACCAGTCATTGCTTCTGTGAGCCTAAAAAGAAAAAAAAAA
GGGGTAGATGATTATCAATTTATGTAAAATCTTGGTAAATTTGAAGTAATTTCTTATCAT
AGTGACTTATTTGTTTTTCAGAAGTAGCTGTGCCTGAATTACTGTCTCTAAGAAAACACG
CTAAAGAACTGGTGGATGAAAACAATGGCTTGAAAATGACTGTCCATCATTTGAATGTGG
AACTGAGTAGATACCAAACTAAATTCAGGCCTTTATCCAAAGATGAGGTAATGTTTCCAA
TTGAGAAAAGTCTCACGTTCATGTTTTTCTGGTCTTGACAGTCTCACAGGTTCTTATTTG
CATAATTTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTACGTGAACTTGTGTCAGAAGAAACACCTCGTT
TTTAGGTCCCCAAATCTCTGGAAATAGGGATTGTGCGGTAATGTCTACAATGGCTTAATG
CATTCTCAATATTGACTAAATAATGAGTGATCAGGTGAAGTCACTAGAAAGTTACATCAG
GGTCATTGCCTCTGTTCTGATGTAATAGCTACTACCAGGGTTGTCAACAACGAGCAAACA
GGACAGAATAAATACAGAAGTCAACTGCTTAAATAAGTGTCAGGCAGAAGGCAGCAGTCT
ACATTCACTCCCTGGGAGACATTACGACTACAATCCTGATGGAGCTATGCTAATGCAGCC
AAAGCCCTGGAGCTGGAGGAGCTCCATGGAGACCCACGCCAGCTCTGAGATGCTTCTACC
ACCACTGGATCCACAAAACTTTCCACCCACTGGCCTGTGATCTTCCTGCATTCGGCATCA
TTGTATGTGTCTTGTGAGTTTGAAGAGGAATTTATAGATTGGTTTCGGATATATAGATTA
ATATCGGACTTATGGACTTGATCTGGGCTGGGATGTTTTCTCAATATTCAATTGCTCTTG
TATATAAAGTTCTTTCTTATACACATATGAGTGTCTCTGGATTTGTTTCTCTTGTCTACC
CAGACTAACAGACCAGGGCTCCTTGACCCACCATAAACCAGGTCAAAAACAAGCCTCAAA
AGCTTCCAGCCAATCCATAAGTTATTTAACAGCCTGCAAAGAGAGAGAGAGAGAGAAATC
AGCACTTCGTAAAGGATGCTGATAACAATTCAGACATGTAACATGCAAAAGCCCAGCATC
AAATCCAAAAGTATCTGTTCCAGGTGAAAGGAGATGAAAGAGACTTGACTACCACATGCA
ACATGTGAGTCTAGGGTGGATACAAAATTGGAAAAATTTAAATATAATGTCAAGACAAAA
AAAAGTATTTTTATCAGAGTTGCTTTCTTAATTTTCACAGTCATACTGTGGTTAAGTAAA
AAGAATGTTAGTCCCCTTTTTGGAAGTATATACTGAAATATGTAAGAGAAAAGAGATAGC
ATACCTGAAAATCATTCTCAAATATTTCAGGAAAAGATTTCTCATACAAACTATATAATA
CATACAAAGAGACTTTAAAAAGTCCATGAAAGAATGGTATTGAAAGAACATGGACTTTTT
CTAGGACCTATTTGTACCCCCTTGTCTATACATATAGATACATAGATATACTTCACTGAT
AGCTCATCTACATTAAGAACAACTAAGGGTTAACATTTGTGATAGTGTGATAAGTTTATC
GTGCCAACTCGGCCTCCATAAGAACATGCGGATGGAGTTGAATCAGGTCACAGGTTGATT
GGAGGGCGACCAAGATAAACAAAGATGGCTGGCATCCAGTGTCTCCCTTCCCAGTGATCT
GGGCCAGTGTGCAGCTGCTTGAGCTAGTGTGCTGCGTTACTGTTGGCCAAGTCAACCTGT
GGATCTTGTTACTAGAGCTTGAGACTCCTTCGAGATCAGCTTCGCCAAGCTGCTGGTGTG
AACATTTGCCTAAACTTGAAGGCTGGTGGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNGATGAGCTCACTGCCCGCCTCCAGGTAAGTTGCCACGTGTCTTTGACAAAGT
TTATTAAACGTGTTTCAGACTCTGAAGAAATAGTTTGGTGGTGGGTATGCCCAACATATG
AGAGTAAGTGAAAAATATCACAATAAATCGAATAAACCTTTATTAAGCAAACATATCGGA
ATGTGAACCTGTCGTTCCTTGAAACACCCTCGATGTGGGTCTCCACACTCCTGTAGGCAG
TGCTCCGTCTCGGTGACCTTTCACAGGGAATTCTGTGTTCTGCGATTGACAAGTCCAAAC
GGTGGTTTGGGCATCTGTCAAATCACATTCTGTTTAAGCGGAGGTTTTTGGTTTTGTGTT
TTGAGAAAAAGAACTGCGAGACTTTTTGAGTGGATGGATGTCCCAGTGAAGTTCTCTCTT
GGAGAGGGAGCGCTGTCACGATGGAAAACATTCTTCAATGTGACTCTCAGGGTCCCTTCT
CCAATGCACTTTTCCATTTTCTTAGTATGGCCGCGTAAGAGGCCCCTGTGACTTCCTGTT
TCCTTCAGAAATCCGTCACAATGACTCCTTTATAGAATCCCCCAAACCAGTCACCATCGC
CCTCTGAGTTGCCCTCTGCCTTGAACTTATTAACAGCCCAGCAGAATTCTTCTGAAGCCA
CTGTTGGGATTGGACTTTTTATTATTATTATTTTTTGATCATTTTATTGGGGGATCTTAA
AGCTCTTATAACAATCCATACATCTAGTATGTCAAGTACATTTGTACATATGTTGCCATC
ATCCTTTTCAAGACGTTTTCTTTATACTTGAACCCTTGTATCAACTCCTTATTTTTTTTC
CTCCCTCCTCCACCCTCCCACCCTCATGAACCCTTGATAAATTATAAATTATTATTATTT
TCATATATTCCACTGACCGATGTCTCCCTTCGCCCATGTTTCTATTGTTTGTCACCCTGG
GGGGAAGGGGTTATACGTCAGTCATTGTGATCGGTTCCCCCTTTTGCCCCCCAACCTTCC
CCCTACCCTCCTGGTATCGCTACTCCATTATTGTTGCTGGGGGGTTATCTGTCCTGGCTT
CTGTGTTTCAAGAGCTCTTATCTGTACCAGCGGCGTATATGCTCTGGTCTTCAGATTTAT
AAGGTGGAATTGGGGTCATGATAGTGGGGGTGGGGAAGCATTAAAGAACTAGAAGAATGC
TCTATGTTTTGTCAGTGCTATACTGCACCCTGGCTGGCTCTTTTCTTCCTTGTGACCCTT
CTGTGAAGGGATGTCCAATTGTCTACAGATAGGCTTTGGGTCTTCTGATGCCTGATCCTA
TCAACACTTCATGATCACACAGGCTGGTGTGCCTCTTTCATGTGGGCTTTGTTGCTTCTC
AGCTAGGTGGCCGCTTGTTTTTCTTCAAGCTCTTAAGACCCCAGATACTATATCTTTTGA
TAGTCGGGCACCATCAGCTTTCTTCACCACTTTTGCATATGCATTGATCACATCAGGAAG
GTGAGCATCAGAGAATGCCAGGTTGTTAGAACAAAGTGTTCTTGCATTGAGGGAGGACTT
GAGTAGAGGCCTTATTGAGCCATTGTTTTTTTTCCTTTTCTTTTCTTTTTTTTAAACATT
TTAGTAGGGGCTCATACAACTGTTATCGCAATCCATACACACATCAGTTGTGTAAAGCAC
ATTTGTACATCGTTTCTCAAAACATTTTCTCTCCACTTAAACCCCTGACATTAGGTCCTC
ATTTTTCCCCTCCCTCCCCGCTCCCCACTCCCTCATGAGCCCTTGATAGTTTATAAATGG
GTATTTTGTCATATCTTGCCCTGTCCTACGTCTCCCTTCACCCACTTTTCGGTTGTCTGT
CCCCCAGGGAGGAGGTCACACACAGTTCCATGTAATTGGTTCCCTCTTTCCTACCCGTTC
TCCCTTTACCCTCCCTGTTTTGCCATTCACACCACTGGTCCTCTAGGGCTCATCTGTCCT
GGATTCCCTGTATTTTCAGTTCCTATCTGTACCAGTGTACCTCCTCTGGTCTAGCCAGGC
TTGCAAGATTGAATTCGAGTCATGGTAGTGGGAGAGGGGAGGAAACATTTAGGAACTAGA
GGAAAGTTGTATTTCTCATCATTGTTACATCGCACCCTGACTGGCTCATCTCCTCCCCGA
GACCCCTCTGCAAGGGGATCCCCAGTGGCCTACTAATGGGCTTTGGATCTCCACTCCGCA
CTCCCCTCATCATTCACTATGGTAAGATTTTTTGTTCTGATGATGCCTTACACCTGATCC
CTTCGACACCTCGTGGTTGCATAGGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGCTTC
TGAGCTTGATGGCTGCTTTTTTGAAAGCACCCTCACAAGACCACTGAGACAACTTGCTGC
AGCTCTCCATTGATCTCCGAGACAGGTTTAAATACATCTTGTCGGGAATAAACTTGCGCA
TTGATGAACTGGAACCACCGTAGCAATGCTTTTTGATTTAGCCTCATAAAATATATGTCC
AATGTCCAAATGTTTGTGTTAAAGAAAGAAGAGAAAGGAGAGCCACCGGCAAGGCAGGCA
GGCAGAAAAGGGAGAGGAGGAGAGCTTACCTGGCTGTGTTGCTTTCAGTTAAACATAAAT
GTCTGATAACTGGGTAAAGAACATTGAGGTGCATAGGTTTGGATTCGTGGCAGGTCCGAT
CCCATGGGCCTTTCACAGTGTCCCATGCTAAAGCAAATGGTCACCCCAAACCATTGCCTG
GCTTTATCCAGTGGGCTTAAGACACTGAAGCGTGTTGCACAGTGAAAGAAAAGAAAGAAC
ATTGAGAAGTATTCCAGAAAAGTCATCTAAGAGTCTCACTGGAGGCCAGCGCAAGGCACT
GGAAGTAGCCAGAGGCTGGCTGAGGGAAGTCTGGGGCCTAACAGCACCCAGCAGAAACAC
CTCTTAGCAACGGGGCCCTGGCATGGAGCCCTGCGCTGGGCTATTGGCTGGCAGTGCCGT
GTTGACTGATGGCTTGCCACCCTAGTTCTCCACCACCAAAAGGGCTTTATTTATTGTTAT
TTCTTTTCCCCGGCCCCAAGGAGAATCTTTAATTAAAGATGGTGTCTCTTACTTTTGTCT
TAAATACCAACGGGAAAATTAGTGTCTATAGTCATCTCTGCTGCTTTCCTCGGACTACTT
TTTTTGTTGACATTGACACATTTATTGTTTTACTGTCATATTGGCATAAAATTCAGTTCA
AAAGTTCATTTACATCAAAACAAGTTGTACAATCAGACTTAGAACATTTTCTTCATTCTT
CTTTTAAAATCATTTTATTGGGGGCTCGTACAACTCTTTTCACAACCCATACATCCATCC
ATTGTGTCAAGCACATTTGTACATTCATTGCCCTCATCATTCTCAGAACATTTGCTCTCC
ACTTGAGCCCCCAGCATCAGCTCCTCATTTTTTCCCCTCCCTTCCCATTCCCCCATCCCT
CATAAACCCTTGATAATGTATAAATAATTATTATTTTGTCATATCTTACACTGTCCGATG
TCTCCCTTCACCAACTTTTCTGTTCTCCATCTCCCAGGCAGGAGGTTATATGTAGATCCT
TATAATCTGTTCCCCCTTTCTCCCTCACCTTTCCTCTACCCTCCCCACTGGTCTTGAAGG
GATCATTTATCCTGGATTCCCTGTGTTCCCAGTTTTTTTCTGTACCAGTGTACATCCTCT
GGTCTAGCCAGATTTGTATGGTAGAATTGGGATCATGATAGTGGGTGGGGAGGAAGCATT
TAGGAGCTAGAAGAAAGTTGTGTTTCATTGTTGCTACACTGTGCCCTGACTGGCTCGTCT
CCTCCCTGTGCTCGATCCTTCTGTAAGGGGGTGTCCAGTTGCCTGCAGATGGGCTTTGAG
TCTCCACTCTGCACTCCCTGCCTCATTCACAATAATATGATTTTTTTTGTTCTTTGATGC
CTGATACCCGATCCCTTCAAAACCTTGTGGTCACACAGGCTGGTGTGCTTCTTCCCTGTG
GGCTTTGTTGCTTCTGAGCTAGATGGCTGCTTGTTTACCCTCTGACTACTTTTTAAAAAT
AGTTTTATTGGCATGTACTTTATCATACAAGTTAACCATTCAGTCATATTTTTAAAATGT
GCATTTATGACCATAATCAATTTCAGAACATTTTTTCCTCATACTCGTTGCTAGCTTTCC
TACTTATTTTGAGGGAGAACCATGAGAATTGGCTTAATGGCAGTGAGTGAGTGAGTGAGT
CAGTGAGTGAGTCAGTGAGTGAGTGAGTGAATGAGTAAGAGAGAGAGAGAGAGAGGATAT
AACAGAAATAGGAACTAAAAACTTGGGCTTCTCTGCGAGGAGACCTGGTGAGTAGTGGTT
ACGAGTTGGGCTATGACCCGCAAGGTTAACAGATTGGAAACACCGGCTGCTCCTCTGGAG
AAAGACGGGGCTTTGATCTCCCATAAAGAGTTACAGCCTCAGAAACCCGCAGGGGCAGTT
CTGCTCTGTCCTATTGGGTCACTAGAGTTGGCAATGACTGTGGCAGTGAGTTTGGGTTTG
GTTTGGGGGCTCTTCAGTCCCATGTTGTTGGTGTTGTCACGGCCTCTTACCTGTCTTCTA
ACTAGGCACAAGCTCCCTGAGGGCAGGCACATCTTGATGGTACCTATAGCTTCAGGCTGC
TGTTAAGTGATGTTTTGTTAAATGTTGTTAGTGTTTGATCTGTGTCATAATGGCAGTAGT
AGAACTGACACAGTGTAGGCGTGTGTTACACTCTGTGTACATATTTTCAGGAGGAAATGA
AGATATTTCGGATGCGAGTTCAAGAAGTGGTGAAAGAGAATGAAGAATTGCACCAAGTGA
TAAATAAGAGTAGTCCGGTTACCAGTAAGGAATGGCAAGTGCTGTTGTGTTTTTGGTATT
TTGCTCATTAAAAAAAGATAAAGAAGAATAAAGTTTATTAAGTAATCATACACTTTGTTT
TTAACTAAAGTATTTTAAGTGAGAGTTTGTAAGACATACATGCACTAAAATCCTAGTAAA
TTATTTTTAACTTGTACTTGAAAGGTCACTTTAAAGATTCTCGTTTCTTAAACCTGCAGC
TTCTCTGCCTTCTCAGGTGGCATTTTTCTGTTTGTTTTCTGAAAATTATCCAAAACTCCC
CCCCAAAAAGGAAGAAGAGGGAGGAAAGGCCCTACTTTCCAATCCACCTTCCTGCAGTGT
CCCCGAAGCCTGTGTGTACTGGGGGTGACATCTGCCCTCTCTGCTCCAGCTCCCTGGCCT
GTGTGTCATTTGGAGGGGCAGGTGGCCTGCACAGTGGACGGTTCCTGGCTGGCCTCCCTG
AGGCCACAGGCTGGCTTCTGCAGCCCCACTTCACAGGCCACTGCCAGCCCATGAGACTGC
TAGCACTGGTGCTGCCCACAAGCCTCCTGACCACCTGGCCCTGGCCAGATGTGTAGCTGC
CAGACCTGTTCTCGGCACTCAGGAGCACTGACTTCACAGTTTACTACAAAGTGTCCTCCT
CCTTCCATGTCTCCATGAACTTCTCTTGGTGACCTCTAAACTCTGCATTTCTTTTCCTGC
CTGACCAGTTGGGTGACCTTGGACTTGATGGAATGTGATATAAAATGGGAGGGAGGGAGG
GAGGGAAAGGAGGAACGAGGAACACTGGCAGAGGGGAGGGGACGGAATCTAAACTGTAAA
GTAGATCAAATCCGGGCTGCCCTGGGTGGGGTAGGGGTGAGGAGGCCAGTCTGGGCACAG
AGAAGGCAGCTTCCAGGCCTCTGGGAGCAAGTGAAGGGACCGCTGTAGCTTGGCTCCTGA
CATCTTTTTCATCTACTCCTTGTGCCTTGCATTCTTAGCTGCATGGTCAAACCGGAGTTG
GCTGGTTTACATTGTGTTGGGGCGGTTAATGTTTGGACTGATGTCACTTGAGCGCATTGG
AGACGATGGTTGTGCAGGTCGAGCGGCGGGGTTTCCTTAGCATCCGCTGTGAGCAACAGG
TTTGTTCATGGTGAGCTCAGCCAAGGATGGTAATAACTGCTTTTCAGCAGTTATGCTGCT
AATGACAAGTAGATCTTTTAAAATTACAATGAGAACTTTTTCAAGTTTTTAAAACAATAC
TTCAGGAAACCCAGTGGGTGGAGGGGATTGGAAGTATATATCGATGAAACAAGATTGGCC
ACTGGATAATTGTTTAAACTGAGTGTTGTGTTTTGGTTTTTTTTATCCAGTCTGCCTGCT
ATGGTGTACATTAGAAATTTCACATCTTAAAAATATATTGAAATAATTCATAACTCAGCC
TTCATAACTAGCTTTTCCTTCAATTTAATGTAAATTAGCAAAAGTTGCTTATATAAATAA
TATATCCAACGGAGACATGTCCCACTACTCATTACTTGCAAGGTATTAACTGCTATCCTT
TAGGCTCCTGAGTGTTTCTTTAATCAATCAGAATTGCAATAACTTACCTTTATGAATGAA
TTGTAGGCATCAGCTTCAGACTCAGGCAGAACTGGTTTTAGAGGAAAACAAGTTGTTGAT
GGAGCAGCTGGAGATTCAGCAGCAGAAAGCCCAGGCCGCCAGCCAGGAGCATCTGCAGGA
AGGTGAGAGCTCTCCCCACGGAGTGACTGCAGTGCAGGGGGGTGACTGCCACTGGGGCAT
GCCGTCTCACACAGGGCCTTCCTCTTCTCTGCGCCTCTGGTCCCCAGCATGGGCTCTTCT
CCAGGGACTGCTCCCTCCTCGTAACATGCCCAAAGCACATGACACGAAGTCTGCCCTCCT
CCTTTCTTCTTTTTTTTTTTTTTATTTCCAAGATGTATTTATTGGATTATGTAAACAATG
AAACAAATTTGATATATTTTTTTTTTTAAAGTTTGTGTATGTAATCTTTTTTTTTTTTTT
TTTAACATTTTATTAGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAATTGT
GTAAAGCGCATTTGTACATCGTTTCTCAAAACATTAACTCTCCATTTAAACCCCCGACAT
TAGGTCGTCACTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAT
AGAATTCGAGTCATGGTAGTGGGAGCGGGGAGGAAACCTTTAGGAACTAGAGGAAGGTTG
CATTTCTCATCATTGTTACATCGCACCCTGACTGGCTCATCTCCTCCCCGAGACCCCTCT
GCAAGGGGATCTCCAGTGGCCTACTAATGGGCTTTGGATCTCCACTCCACACTCCCCCCA
TCATTCACTATGGTAAGATTTTTTGTTCTGATGATGCCTTACACCTGATCCCTTCGACAC
CTCGTGGTTGCATAGGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTTGA
TGGCCGCTTGATTACCTTCAAGCCTTTAAGACCCCAGACACTATACTTTTTGATAGCCGG
GCACCATCAGCTTTCTTCACCACATTTGCTTATGCTCCCATTTGTCTTCAGTGATCCGTT
CGACACCCCGTGATCACACAGGCTGATATGTTGTTCCATGTGGGCTTTGTTGCTTCTGAG
CTAGATGGCCGCTTGTTTACCTTCAAGCTTTTAAGACCCCAGACGCTATCTCTTTTGATA
GCCGGGCACCATCAGCTTTCTTCACCGCATTTGCTTATTCACCCGCTTTGTCTTCAGCGG
TTGTATCGGGAAGGTGAGCATCATAGAATGCCAATTTACTAGAAGAAAGTATTCTTGTGT
TGTGCCCTCCTCCTTTCTAAAGCGCATTCTGACTGCACTGCTAAGCAGATGTGTTCTTAC
TTCTAGCAGTTCAATTTTCTTCCCCAACACCATCGATTCTTCTCCAATCTCCCTTATTCA
GTATTTAACTTTCATATGTATGTGAGGCCATTAAAAATACCCTGGCTTGGGTCAGGCTGT
GGTGCAATGATGGGTAAACATTGGACTGTGAACCTCAAGGTCGGAAGTTCAAACACACTG
CTCCTTGGCAGAAAGATGAAGCTGTCTGCTCCCATAAAGATCGATAGCCTCGGAAACCCT
ATAGAGGTCACTTTCAGTGGGAATCAGTTCAGTGACAGCGTTTTGATGTTGTTGTTTTGG
GGTTTTGAGTCAGGCGCACCTTAGCTCTCATAGTGGCATCTTTGTTTTTTAATACTTTAA
GGAGTTATTTGCAGCACATCTGCCCAGTGCAGTGTGTCATTTGATTGTGGATGGCCATGG
ATGGTGGATCCAAGTAAACTGCAATTCTTGACAACTTCAGTTTTTTCTCCCCTTACATGG
TGCTGTGATCGGTCCGGGAAGAAGTTCTTCTTTCCTGTGCTGTTGACGTGTTATGCACGC
TGAGGGCTCGTCTTTGATCTTCATCAGTAAGCGTTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCTCTTGCACGATTATATG
GCAGGCAGTTATTTTTCTGTGTCCTCCTTCCCTCTTCCTGTGATGCGTCCGGCATCGTTT
ACTATTTTGCCTTCACTGTTGCAACTGGAGGCTGACATTGCTTCTTCAGTTCGTCAGCCT
GAGGAACGCCAAGCCTGTTCCTCCCTTTGGCTTTCTAGCTCCAGGCCTGCACGTGTCGTT
CTGTCACTTTGCTTTCTCTTTTCAAGCTCTCCTTTGAACTTTTCTGCTCAGCTCTTTGAT
TTGAGCTTTTCTTCCATTTGCTTTATTTACTTTGTTTCAGAGTCTCTTCTGATATCCATT
TGGGGCTTTTCTTTCTTTCCTGTCTTTTGAATGCCTTTCTTCATCCTGGTGTCATCCCAT
AGTTCAGCTCATCTTGGGTCATTAGGGTTCAGTCAAATATATTTTGAGATGGTTTCTAAA
TTCAGGTGGAATATGCTCAAGATAATAGCTTGGCTCTCCTGGGCTTGTTTCAATTTTCTT
CATTTTCATCCTCAACTTGTATGTGAGTCTTTTTTGCAGTTGGCCCCTTGTCTTGCTCTG
ATGATATTGGACTTCTTTATAACTTCTTTCCAAGAAGTTGTAGATTCGGTTCCTTAGTAT
TTCATTTTGTGGTGTCCAAATAGTCACTGCTTATGTTGTTGGAAAACAGGTATTTCCAAT
GAGTAAGTTGTTGGTCTTGCTAAATTTTATCATACACTCTTGGGTGTCGTCTCTTTTACC
AATGGTGTATTTTCCAACTAGTGAACCATCTTCATTGTTTCCAGCTTTCTCCTTCCAGTC
AGCCGTAATTATGAATGCATCTCCATTGCATGCTTGATCAATTTCAGACTGACTGTAGAC
GCTGGCAAGAATCTTTAGCGTCTTCATCTTGGGCATTAGTGGTTGGTATGTAGATGTACA
TAATAGTCATATTATTGTACAGTCTTCCTTGTATGTGTATGAATATTACCCTATCCTTGA
CTTAATAGAAGACCAGCAGTTTCGAAGCACAGGCCTTTTTGATGATCTCTAAAGGATCAT
TTTTGTAAGCTGGCTCTCTGTAGTAGTAGCTAGTTAATCGCATCTTTGGTAACAAGTTTT
TATGTATGCTTTTACTTTTTCAGTTTCCAAACTAACTAAACAGCTCATCCTCCTGGAGAC
TAAATCCCAGAGTCAAGAAAAGGAACTAATGGAAAACAAGGAGCAATTGAAAATCCTGCA
CAACAAATGCCAAGAACTGAAAAAGCACTTGGATGACAAAATTGCAATGAAAGTCCATAC
TTCAATTGTGAATGAATTAAAAAGGTAGGCAGTAATAGCTTTCGAGTCTTTCATGAATCA
CCATGCATGTTGTCCTAGGTAGAGGGGAGAGATGCTGAGGAGTCTCCTTCTGAGCCCTTC
TAGCTACCTGAGCACAGGTGTCCAATTTGGAAAATGAGAAATAGTTTGTCAAATATGGCT
GCCCTTGAGGTTGACATTTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
GTGTGTGTGGTTCTCCTGTTGTTCTAATGTTCATTGAGTATAGAACCAAACATAATTTAA
AGTAGTCCAACTAGAAACTTAGTTATCTAATAACAGGGGCCTGCAGAAGTGAAAGGTTAC
AACTATAGAGTACGATACAGCCACAATACAGGCATAAAAAAGGTCACAAGTGAATCCTCA
TGACCCAGGAAAATATCTTTTCTCTCATTTTAAAAAATGTATTACAGTAAAATAGTTATT
ACAAAAAGTTTGCCCTTTTAACTATCTTCAAATATACCATTCAGTGATATTGATCATATT
CACCATGAATTGCTGCCGTCAGCACTAACCATTTCCAGAACTGGTCCATCATCCCAGACA
GAAACTTGGCTCTTCCAGCAGTAGCTCTGCTCCCTCCTACCCTGGCAACCAGTGGGAATC
TTCCCCATCTGTACTTTTTCTTAGTCTGGACATGTCCTATATCTGTCCTTTTGCATCTGT
TTTGTTTCATTCATCATAAAGTTTTCAAGGTTCATCCATGTTCATCTTTAGTATATGACT
GAATAATTCTTCATTGTGTTCATGTACTACATTTTGTCCATTCATCTATTGGTGGGCACT
TGGATTGTTTCCATCTTTTCACATTTATGAATAATTCTATAATAGGCATTAGTATATGCA
TGCCTGTTTTGAGTTCTTTCTTTCAAGTTCCTGCTTCCCAGGAGTGGAATAACTAGGTCA
TTGGTAATTTTGCATGCTCACCTGCAATACCTGAGGGTCCCGATGACTCCACATTCTTAC
CACGACCCATAATGTCCATTTCTTTTTTATAATGGCCATCCTAGTGCGTGTGAAGTGGTA
CTTGGCTGTGGTTGGGTTTTCCACTTCCCTAGTGAGTACCAGTAGCCAAGCATCTTTTCT
TGTGCTTACTGTCTCATCCCTTTGAGGAAATTATTTAGTCCTTTGCCCATTTGCTAATTG
GATTGCTTGTCTTTTTGCTGTTACAGACTATAAATCCTTTGTCTGTTCTGGCTACTAAGC
CTTATCAGCTATATGATCCCAGGTAGTCCCCAGCTCTGCAGGTTCTCTCCTCCACTTCGT
CCACGAACCCTGAGATGCGCACGGGTGCTTGCTTTTCCTGAGATCCAGTGATCTTTTTTG
TCTTTTATTGCTTGTGCTTTGGTGTGGTATCCATTGTCAGAACCTAGGGCTCAAGGCGTA
CCTCAGTGTTTTCTCTAGGGAGTTTATGATCTTACTTCTTATATAGGCCATTGATCCATT
TTTAGATTTGTGGTAATTATATAAAAACTGGTTTGCTTTTTCAGTGTTCTTCACATGTAC
AGTTCAACAGCATTAGTTTCTCATGTTGTTCAAGCTTCACCATTATTTGTTTCCATATTT
TCCCATCACCTTTAGCAGCAGCTCAGTCTCCTTTTTCCCTCCTTCCCTGTTGCTCCTGGT
AACCACAAATAATCAATAGTAGCTCTTCATCAGGGAGGGAGTAAATGCAAATTGTTTTCT
AAAATTTTTGAACCTTTCAAAAGCAGATAAAGCTGTGGACTCATTTTTTTTCAATTGTTT
TACTAGGGGCTCATACAATTCTTATCACAATCCAGACATACATCAATTGTGTAAAGCACA
TTTGTACATTCATTGCCCTCATCATTCTCAAAACATTTGCTCTCCACTTAAGCCCCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCACTCCCCCCTCCCTCATGAG
CGTTGATAATTTATAAATTATTATTTTGTCATATCTGCCCTGTCCACATCTCCCTTCACC
CACTTTTCTGCTGTCCGTTCCCCAGGGAGGAGGTCACATGTAGATCCTTGTCATTGGTAC
CCTCTTTCCAACCCACTCTCCCTCTACCCTCCCAGTATCACCACTCACACCACTGGCCCT
GAAGGGATCATCCTCCCTGGATTCCCTGTGTTTCCAGTTCCTATCTGTATCAGTGTACAT
CCTCTGGTCTAGCCAGACTTGCAAGGTAGAATTCGGATCATGATAGTAGGTGGTGGTGGT
GGGGAAGCATTTAGAAACTAGAGGAAAGTTGTATTTTTCATCGTTGCTACATCGCACCCT
GACTGGCTTATCTCCTCCCTCTGCAAGGGGATGTTGTGGACTCATTTTATAGGTTGCAAT
TAAATTGCATAATGAGGTGTCTGGAAACAGAATGGCTATAACTTTTAACTAGTATATGGA
AAGAAAGACTGGCTAAAAAGAAATCTCCAAACACAAGAAAAGAGAGGAAAACAAAAGGTG
GAACAAGAAGGCAACAATTCCTACTGCCATCAAGCCCATCCCATCTCTTGGAAAGGAAGG
TTATAGGATGGCCGAGAGCAGCCCCACATTTACCCCACTGTGGCACTGGGGTCCTGTAGA
TAGTGGCATCTATTGGTGGTACTCTTCGGTAAGTATTGAATGGCTAACGGTAAGGTTGGC
AGTTCAAACCCACCAGCCACTTGGCCGGAGAAAGATGAGGCTATCTGCTTCCATAAGAAT
GTACAGCCTCACAAATCCTGTGTGGGTGCTGGGAGTCAGAGTCAACTCTATGACCAGTGT
TGTTTTGTTTTGATGTTGTTGTCTAAAGCAGAAAGGTCAAAAGTGAAAGGGTAGAAAAAG
TACACCATTCAGATACAAACTAAATTACCAAATTAGTGGTGGAATGTTATATTAATATCT
CTAGCAGGATAGAGGGTAAGGTTAAAAAAATGACTTGGCAAAGAGGACCAATTCATAGAT
GTAAAAGGCTTAATATACCAAGTAGAAGGTAAAATGTGTATGCATCTATAAAGAACTTAA
ATGAATTGTTTTTAATCAAGTCCTTGAAAAATATAATCCACCAAAACTGACTCAAAAAGA
ACAATACCCAAATGTTCTTTTAGTCGTTAAAGAAACTGAATCCCAAGATCATCTCTTTGA
GAAAACTACAGACCTAGAGGTTTCTAACAAGAAACAAAGAAATCTAATCTTAAACTACCC
TAGAAAATAGAAAACGAGGGATACTCCCTAATTCATTCTGTGAGGCTGATGAAACCTCAA
AACCGAAACCCAAAGTTACTGTTACATTTCTGAGATGAACCTAAATAAAATAACTTGAAA
GAAAAGTATGCGGAATCAATGTGAACTTTCTTAATGCTAACGGGTATCTATGTCCCTATT
TTCAAATTTTCACTTGAATAGCATGTAGTATTTCGGGGAGTATAGTTTAAACGTACGTAA
ACAAATCCATACTTCAGGTATACTGTGCATCCTGTTTTCACTCAAGTTTCCAAGCTGCTG
TTCATGTTAAGACAGGCGTGCGGTTTATTCTTTTTACACTGCTCCCTGCTGGTCCTCTAC
CCGTGAACGGCAGCACTTGGTTTACTCCATCGGTGGAAGTTTAGGTGATTTTTACGTTTG
TCTGTCAGCAGTGCTGCAGTCAGCTTTCTTGCGTGTGTCAGCTTTTGCAAATCTGTGGAA
ATTTCCCTGCATACATACCCAGATGGGGCGGGGGGAGGGGGGGCACTTTCCAGGTTCTGA
TACTGTCCTCTGACTGCCCGTCACCAACATAGCGCTTTCCCAGTATCCTCTGGTCAGTAA
AGCACAAAAGCCAATGAAGAAGAAAGGTAAAAGATGGACTTAATTCATCTTAATTATTGA
CTTTATTCTGTGCCATCCTGATTGTTGCCTGAGTTCCCTCTGTGCTGTCACGACTGGAGG
ACTGTGGCTCCCAGCAGTACGTGAACTGGGGAGCAATGGAAATGGCTTGGATAATTGCTG
GTTGCGTGTCCAGAGCTTCAGTGGAGTGTGAACTCACTGAAAGAAGTGAGGTGCCCCCCC
CCCAACCCAAGCAGCCTGAGGTGTGTTGTCCGCCAGGGGTAACCCTCCTGTGGTGCCCAG
AGAGACCCCCCCTCTCTGTGTCTGTGGTCCCATCTATGGAATGGTGGTCATTTCATGAAA
ATCTGCTAAGAGAACCAATCCAAACATTTCATTTCCTCTACATTATTTTGCTAAATTATA
CATTGAAATTACTTGCCCTCATTTTGGGCGCCGGGGGAGGTTCTTTTATCATGAAAACAA
AAGTATAGTAAAATTTGTTTTAGCATTGGGATTTTTTTTTGACAGTCATAGAAATTGAGC
TGTCTTACATTCTTCCTGGGAGTAATTAGGATCACTATGAATTAGAACCAACTCAATAGC
ATCTTACCATGACAACAAAATATATGTGCATAAACATAAACAAATATTACACGTGGAAGA
AGGGCTCAGAGGGCAGTGCGTGCTCTCCTGCCCTCGAGCTCATCCCGGGCACGGACAGGT
CTTCAGGTCTTCCAAATGCTCCGCGAGCGGCCAGGGGCTGGGATGCTTACCACCTGCGGG
CAGTGGCTGTCATGTGTAAAGCTCAGTGTACTGGATACATGCCTTGTGGTGTTTTTCTCC
TTCAGCCAGTTGCAGAAGGAAGAAGAGAAAGGAAGTGCTGAGATGGACGAGTTGGTGGAA
AAGTTAACAGTCCTGCAAATACAGAAAAAGAGCCTGCTTTTAGAGAAGAACAATTTGACA
GTTAAAGCCAAAGCACTAGAAGCTGAACTTGAAATTGCACAGAAAAGAAATAGGTTTATT
ACTGTTTATTTCTTAAGCTTATTTTTTGTATCCTTTCCCCCCTTTAAATTAATTAACCAA
TTTTATTATTACAGTTATTTATTGTAATATGGGAGTTGACATTTCAGATCATAACTTTGT
ATTCAACAACTAAACTACTAATCAAACACACATCCCCCCCTTCCTCAGTCCCAAGACTAC
TAACTTCCATTTTACCCATCTTAAGCTTATTTTTAACATCTTAATAATCTTTATAAAAAA
GGCAACTGGTGGATCTTCTATTTAGTTTTTTTATCTTTTATTTTTTGATAGTACTTCAGG
ACATTTGTCATTGAGATTGTGGAGATAGCAAACGAACATGTAGTGAAAGCTTTTCTGTTG
GGCTGCGTTTCTCAAGTGTACAGATGAGGCTGTTGGGAATCCTAAGGAGCAGCTCTGCTC
GATCCTGTTGGGCCCCTGTGAGCGGGAACTGGCTCCATGGCCATGGAGTGGGACAGCTCC
AGCATTACTGACGGTTGGGGTGATAACCCTAAGACTCTGAAATTCTAAAAGTGCTTCTCT
AACCATTTCCCATAAATCTGCTTTGGGAATTGCAGGGTCTCTTTTTCAATAGCATCTTTT
AGAATAAGAATCAAAAACTTACACAAGGGGGCTTCAAAAAGTTCACGGAAAAGTGCCAGT
ATCTTTGAATTACATATTTCCACCAGTTTTGTGAAGCCCCTTCATATAATTAACCCATTA
ATTGACTAAGCACATGTGACCTCTATTGACTTGATTCAGAGTCAATAATTGTGCTTGGCT
TACAATGCAATCCGATGGCCTCTTCTCTCCTTAATAGAAGATGCAGGTTGCTGAAGAGTA
TGGACTTTAGGTGCTAACTAACACCCTCGGTACTTTTGTAATACAGATATTCACTGTACC
TCAGCCAGTCAAGCGAATGAAGGGTTTTTTCCTTATTCTACTTTATAGGCGATCTCAGAA
GAAAATGGATGTCCTCAGAAAGCAGGTGGAACAAGCCTTGGAGAATGAGCTATCTGCTCA
CCAATACTTGGCCAATCTTGTTGGACTTGCTGAGAATATCACTCAGGAACGGGACAAGCT
CATGCATTTGGTAAGGTTTCTCAGAGTTATTACAAGTAACGTAAAAGTTACTATGCAAAC
AACTATTATCACAGGTTACCAAAATTTTGCCTTTTAATCATGGGGAGCAGGAGAAACATT
TTGAGCTTGGTGAGTAACTCAAACTTTTAAAATAATGACAAATTGTATTTAAAAAGCTAT
GAGAATGAAATTGGTTTACTTTGCTAAGTAGAACAGTAGTCATCGAGGTGTGTTAGTCTA
GGTACATTAGAAAACAAATCCACAGAAACTCATGAATAAGAGAGAGTTTTAAATAAAGGG
TAAGTGCACATCAAGAAAACATCCCAACCCAGTGCTGCCCAAGCCCACAAGTCCAACATT
AACCTATATGTCCAACACCAATCCACAAAGTCCTCCTCCATCTCACAAAACACACACTAT
GATGCCGGCTGCAGGAGGAAAGCCAAATCAGTGAAAGGGTAATCATCTCAGCGCTGGCAG
GAGTCTCCACACGGCTCTCCAGCACCCAGGGGTGCGATCAGGGTAATTCCATGTGGCTTC
TCCTCAGGGATGTCTTGCAGGAAGTGAGCCTTGCAGCTGAAGCAGGAACTGGCTAAGGCA
GCTGCACCCTGGTCCGACCATCATATAGGCAAGAGACCAGAAACTAGAAAGGGGAGGCTC
ACTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAATCATTTAAGAA
CTAGAGAAAAAGTTGTATGTTTCCATACTTGCTACACCTGCACCTGACTGGACTAGTCTT
CTCCCCTGAGACCCTTCTGTAAGAGAGATGTCCAGCTGGCCTACAGATGGGCTTTGGAGT
CCCCCACTCTGCACTCCCCCCTCATTCACAATGATATGATTTTTTTGTTCTTTGATGCCC
TGATACCTAATCGCTTTGGCACCTCATGATCACACAGGCTGCTGTGCTTCTTCCATGTAG
GCTTGGTTGTTTCTCAGCTAGATGGCCCGCTTGTTTATCTTCAAGCCTTTAAGACCCCAG
ACTCTATATCTTTTGATAGCCTGGTGCCATCAGCTTTCTTCACCGTATTTGCATATGTAC
TTGCTTTGTGTGGTTGTGTCGGGAAGGTGAGCCTCTCAGAGTGCCAGATTATACGACAAA
GTATTCTTGTATTGCGGGAGTACTTGTGTAGGGGCCCAATGTCCATCTGCTTCCTTAATA
CTAAACCTATAAATATATATACATAGATATATTTCCCCTTTGTCATATATAAATATATTT
ACATATGTATATGCCTGTATTTAGAGCTCTATAAATGCCCTTTGCCTCCTAGTTCTTTCC
TCTATTTCTTTTTACTTTCCTTTGTCCCACTATCATGTCCAGCCTTCATTTGGGTTTCAG
TAATTCCTCTTGGTTACATTGCCATTGATCAAGCCCTACCAGACTTCCTACACCTTCCTC
GCCATCGATTTTTGGCCACTTGTTGTTCCCTTGCCCCCGAGTTTGTTAACACCCACTTCC
TTCCCCCCCACCTCCCCCTCTCCCATGTCCCCCCAGAACTGTCATCCCGTTGTTCTCTCT
TCCAGCTTGTTTATCCCGAAAATTTAAAAATTTTTATGAGGTCCCATTTATTTTATCATT
TGTTGTTTGTGTTTTTGTCGTTGTATGAATAATTTCATTGTTGACTCTACTTGTTTAAAA
AGTTTGCCTCTTCTTATTGGCCTAAGAATTTTTATGATTTTAATTTGCACTTTTAGGTCC
TTAATCCATTTTTAATCCATTTGTTTTTAATATGAATCTTGTTTCATCTTTATCAAAATG
GAAACCCAATTTTTCCCAGCACTATTTATTGACAAGGCTCTTCTTTTACCATCCAGTGGA
CTTAAGATCCTTGTCAAAGATCCATTGATCATGGATGTCTGGGTTGATTTTTACACTCTC
AGTCCTGTTCCCTTGGTCTATATGCCTATTATTATAAGGATACCAGGCTGTTTTTATTAT
TTTAGATGTGTAATATGTTTTAAAGTTAGGAAAGGTGAGTCGTCCTACTTTGTTCTTCTC
TATCAGCATTATTTTAGCTATTTGGAGCCTCTTGCCATAAGAAATTGAGGATTTTTTTCT
ATTTATTTAAACAAGCCTTGTAATTCTGATCTGGATAGCATTAACTCTGTAGATCACCTT
AGGTGGTGTGTTAGTCTGGGTAAACTAGGAAAACAAATCCACAGAAACTGATATGTACAA
CAGAGAGTTTTCTATAAAGGGTAAGGGCACATCAAGAAAACATCCCAACCCAGTGTTGTC
CAAGTCCATGAAGTCCAACATTAGCCCAAATGTTCGACACTGATCTACAAAGTCCTCTTT
AATCTCAAAAAAGACATGCAATGACACTGACTGTAGGAGGAAAGCCGAATCAGTGAGCGT
GTAAGCATCTCAGCGCTAGCAGGGGTCTCCACATGGGTGCTCCAGCACTCAAGGCTGCAT
TGAGGTAGGTCCATGTGGCTTCTCAGGGTTATCTTGCAGGAAGTGAGCCTTGCCAGCTGA
AGCAGGGAACTGGCTAAGGCAGCAGCACTCGGTCTGACCATCAGAGAGCAAGAGACCTAG
GAACTAGAAAGGCAAGGCTCACCGAGCCATTTATCTCTCAGCCCTTCAATTGATCCCACA
TCTGTTCACCAGCCAGGTTGGCAAATAAACCTTAACTATTTCAGGTGGTAACAACATTAA
GCCTTCTAATTCATGAGCATGGAACAACTTTACATCTAGTTAAATCTTCCTGAATTTCTT
TCAACGGTGTTTTATATAGTTTCTGTTATTTGTGTGCTTCACCTCCCTGGTTAGACTTAT
CCCTACGTATTTTGCTCTTAGGTGCCATTGTAAATGGCATTGTTTCCCTACTTAGTCTTT
CAGATTTTTCATTGTTGGTGTAGAGAAACCCAGCTGATTTCTCTTGTTGACCTTATAGCC
TCATTTTGCTAAATTTCTCTATTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTTTTGGTTTTTTTTGATAGCTTTTATTTATTTGTCTATGGT
GTGGCTAGGAGTTCTAATAAATATTCAGTAGAAGTAGTGATTGTGGTAAAGTAGAGAGGC
AGTGAATAAGAAGAAGGCCCTCAACAAGGTGGATTGCCACAACGGTTATAATAATGGGCT
CAAGCATGGGAACAATTGTGAGGATAGCCCAGGACCAGCAGTGTTTCCTTCTGTTGTCCC
TATGTTGTCGCTGAGTCCAAACTGATGGGATAGCACTGAGCAACGACCACAAGCAGGTGT
GGATACCCTTGTCATACTCCCGATTTCTTTTTTTTTTTAAAACATTTTATTAGGGGCTCA
TACAACTGTTATCCCAATCCATACACACATCAATTATGTAAAGCGCATTTGTACATCATT
TCTCAAAACATTTTCTCTCCACTTAAACCCCCGACATTAGGTCCTCCATACTCCCGATTT
CAAAGGGAAAGTTCTCCGTCTTTTCCATTGAGTGTAATAAGGGCAATGGATGCCCTGAAT
CATAATGAGGAGTTTCCCTGCTATTCTAGTCTTCGTTCATCAAGAGTGTGGTGGATTTTA
TCAAATGCGCTCTCTGCATCCATAGAGATGGTCGTGTGGTTCTTACCCTTTGTTCTTTTG
ATACAGTACGTTATACTGATTGATTTTTACAATGTAGAACCATTCCTGCATATCTGCAGT
AAATCCTATGTGGTCATCTATAGGCATAAGAGCTATTGGCTTGAAGGTGTGTCTGGTTTG
GTTATTTTTCCATCTGGATAATAATCTAAATTATTGGTCTTCGAGACAGAACCCTCTTGG
ACATATTGTCTGCCATGTTTGGCATGGAGAATGGCATTATACATTAATATATTTCATATA
CATATTTCATTATCTTGAACTTTGTAATCATCAAATTAGTCAAGTTAAAAAGTACATTAC
TGTTCTTTTTACCCTCCTACTTAGGCTAAATTTTTTGAAAGTGAGAAGCATGGCCTTTTC
GACACAATAGTGAAAGGCAATATTCGCCTGGGAAAATTGGAGGAAAAAGTCAAGGTAAGT
AGACATGATTTAGCCTCAGAGCTGCCATTTTCAAATGGGAATGAAGACCTAGTGGGTGCA
CTGTTCTACCTTTAAGAAAGTAACACATTTTGCAGGATTACCTCACTGTCATCTACAAAA
CAAAACTGTACGGTTTCATTGGCAGAAATTAGCATCTCTCGACTCATTTAACGAACAATT
GTTAGGTTTCTGGGATGGTTTACCTCGGTTCTTGCATCTCAACGCTGAAAGAAGTCAAGT
GGCAAAAGCACTTTTGTAAATCCAAGTAGCTTTTATGAGGGAAAGGGAAGTTTCAGGCAT
TACAGCTTCAGACAATACCTGGTGTGTTTGTTTTTTCTGGGGGGGGGGGGGCGCGTGGCA
AAGTTCACCACTGAAGTGGAGGGAGGGTAGGGGTGGAAAGAGGGAACCGATTACAAGGAT
CTACATATAACCTCTTCCCTGGGGGATGGACAACTGAAAAGTGGGTGAAGGGTAGCATCA
GACAGTGTAAGATATGACAAAATAATAATAATTTATAAATGATCAAGGGTTCATGAGGGA
GGGGGGAGGGAGGGGAAAATGACCTGATACCAAAGGCTCAAGCAGAAAGCAAATGTTTTG
AGAATGATGATGGCAACAAATGTACAAATGTGCTTGACACAATGGATGGATTGTGATAAG
AGTTGTAGGAGCCCCCAATAAAATGATTTTAAAAAAAAGAAAAAAATAACTATCCAAAGA
AACATTAATTAACAGACATGCTGAAAAAAAAAGTTCACCACTGAAAATGACCGCTTCAGG
GGAGTGCGAAAAATCCCATGGAAAAATGGCCGATGAGGAGTCCACAGAGCCAAATGAGTG
CCTGAACTGAGAAAGGAAGACAAGCTCGGGATAGAGTGTGGTCCCGAAGGCCTGCTCGCA
CACAGGAGAGCTCCTGCACTCTGACGTGCAAGGGAGCCACCTGAAAAAGGGTGGCCAGAG
AGCGTGAGAGTTTGAGCCCTGAGTGTGCTTTGGGGCGTGTATGCACCCCTGCGCTCCACC
CTGTGAGAGAGGAGTGACTTGCCTCAGACTGCTACTTGTGCCCTCTTAGCCTCACCGGCT
GGGCGGTGTGGTTGAGTGTATTAGCCAATCAATATTGGCTAAATTCAGGTGCTCTATGTG
ATGTCATGTCACTAGGTGGCCTTTGCCTGCACATGCTCTGTTCTGGATTTTCCCACAGGT
GTCTAATAGCTGCCTGATTCCTTTCCAACCCATTTACTGTTGCATTTGGTGGAGACAAGC
CCCCTTTATCTCTAATCTATCTGTCACAGTGAGTAGTCCCCACCAAAAAACAGCATGTTG
ATGTACAACTTTTATCACAATCCATACACACATCAATTGTGTAAAGCACATTTGTACATT
CATTGACCTCATCATTCTCCAAACATCAGCTCTCCACCCAAGCTCCTGGCATCAGCTTCT
CATTTTTCCCCTCCCTCCCCGCTACCCCCCCCCATGAACCCTTGATCATTTACAAATGAT
TATTTTGTCATATTTTGCACTGTCTGACGTCTCCCTTCACCCACAAAGAAATATTTCTAT
GGGGAGTTGTTGTGAAGACTTGTGGGAAACAGAAAGCTTTCTCCTAAGTCATCTCCCTCA
AATATATGTTAGACTTAGGACACTGCTACCAGCTAATGGTAAGTGATTGTCAAGTTACCT
CCCTTAAGGCAGTCAGCTGCCAGACTACAGTCTGTCCCAGGGGTAGGCCTGCTCCCTGCT
GCTAAGGACAATGGGCTACTTCTCTCTAAAAGCTTGCGACCATTAGATTGGTTCCTGTAG
GTGGGGTTCACACCCTGCTGATAATGGTTGCTCTGGAGATCCGGAGAACATATCAGACTT
GCTCAGAGACATCCAAAGTTAGGCTGGCATCCTGAATCTAGGATCTGCCCATCTTGCCAC
ATGTGTACCCCCAATCGCTCCTCTTCCTATTGCGTGCATACCCCTAGATCACCCCCCTCC
CATTACTGTATTACCAATAGCAAAACCCTTTCCTGTGACGTATGTCTTCACCTGTAATTA
AGGGGCTTGCATGTCCCCAGAAAACATAAAAGCCTTGGTTAGCATTAAATATCTCTCTCT
CCACATGGACTGCCAAGTGACATATGAAATGTGTCTGACTCCATTATTTCAATCTCTCTT
CTATCTCTCATGCTCTCTATGACTTTACTTATTATTGCTGTACAGTTGCACCTACCAGAC
CCGTGATGATGTGTTAGGGGCAGAATTACCCTGACAGACTGTAACCATGAGGGCCACATC
AGACAGTTCATAGCACTGCACCATTATGGCTGCCCTTCTCCTTTGGGCCACCTGCCTGTG
GTAAACTCCATTCTCTATGCAGACTGCAGGCTCCACCAGCCAGCACAGTTTTTGTTGGGG
CTGTGGCAGAAAGAGAAGCAGTTTGGCCTGGTGGAATCCAGCCCCATAGTCCTTAGGACA
AAGAATATGGGATACAGAGGCTTATCAAAAGGAAGAGAGCTAGTTTATTTTACAGTGAGT
ATATATAGTGGTAAGGCTGCAAACCTTTATCAGGCATATACATCAATAGAGAGGGCAAAA
TGTGAATCTGAAATCTCAGTTTCTTAGAGAATACCTCAAAGCAAGTGTCTGACAGGTGAG
TGAAAAATGGTTTCAATAGTGTAAGGTAGTCAAGAAGCGCCAGAGACCAAATCAGTCGAA
TTTGGGCAAACAGGCTTTACTGGGGAGAAAAACCCAGCCTGGGCAAAGTCCCATGGTCCA
CAGTGTCCAGGCCGAGGGAGTCGCACTCTAGACTACAGGAGTGGTGTTTATATAGCCGGG
GAACATGTGACTGGGCTGCCTTGAGTCCATATAAGGTAAAGTAGTCAGGGATTGGAAGAT
ACCGGTATGTCCGGGTTTCTGGAATGTAAGGTGTCTTCCTGGTGCCGGGTGTATTCGTGC
CGGGTGCAGAGCAGCGGGCACTGAGCCAAACGGGCCATGCCGGGTACACAGTGGCGGGTT
GAGAACAAAGCGGGCCATTAGCCAGCTCTGGTCAGCTCCGCAGGTGTGTGCAAGGCCACT
TGCTGCTAGTTGTTTCAGCCAGGTCTGGTCAGCTTTGCACGGGTGGGGAAGATTCAAGGT
CACTTACAGCTAGAAGCTGGCCTGATATTGATCCGGCCATACAAACAGCTCCTTAAGAAC
AGTAAACAGAGCAGTAGTTGATGCTTTTAGTGATCTTCTTAACTGTGTGGGCAAGAAACT
AGGCATTTGTAGGAAGCAACTTATTTTGTAGATACTGTATGTGAAGAACATGTTTGCTGG
AGAAGAATGTATCTGGACTTCACTATAAGTACTGGGCAACTCAGAGACAAAGGAGAAGCT
GACCCCTAGCATGATAGGGACAAAAGGAGCTTGACTGCTTTTAAAGATAGACATTGTTCA
GATGAGTAGTGAGGAGCCAGGCGCCTCATATAAAGACAGCTGTAGATCCACATCTTCAAG
GAGGGCAGATGTGGAGAGAACTCTGTAAAGAAAGCTGTTAGGGTTTATCTCTATCTCAGA
ACTGTGGAAGTCTTTCACAAGAGCAGGTCTTCCTGGTCCCTTAGTCACGAGTGTAGAGAT
TAAGTGCTTACACTTTCATCCAGGCTCTGAGTTTCCCACAGCCTGGGTGAAGGGCAGGCA
GAGAACCTGTGGATTTGGGAAAGGAAGGTACTGTGGGGACATGAGTGGACGGCATCCAGT
AGTGAAGGTAAGATTCATGGTCTCTGGGTTCAAATGCAAGTGTATATAGAACAGTAATTA
AGGCATGTGATAGTAGAGAAATGGATTGATGGTATTTAAATATAGTGTATATGATATACT
ATTATATATATTTATAATATATATAGTGAATAGTGTAAATAATACAAATTTTAGATGTAT
GAAAAGCATTATAGGTCTTGATTTTCAGTTGGTACAAACAGGTGCTATCTAAGGGGCTGT
CAGGTTTCCAGGATGTTCTGCCACAAGGAAGATCCCTAAACTACCCTGATGTAGATTCTG
GACCTGCCCAGGACAGGTCACTTCCCTCCAAATAAATTCCAACTAAATTCAGGGAAGATC
CCTTAGCGCTCTGACGTGGTGATGTTTGCACCACCGTCGAGGCTTTGTGAACTAGAGCAG
CTCACCTGGTTCTCTTCCATGTGGCCTCCATTGCTCTGAGAAAGTGGTACCCGTATGAAA
CCACGTTCAGAACTCTGGGGCTTGTCCTGTGGCTTCTGTGCTTGGCAATGATTTAATTTA
GCCATGTGTCATCTAGATTTGTATTAGCTTCTACAATGTCTTCTGAGTCCTAGAAGATGT
CTTAGATTTTTAAGAATTTCATGTTGTGTGACTTAAATCCATATCACACAATGTTCACTA
GCTGTTTAGTACATTTAAAGTAAGCAAGCTTATAATGAACTTAATCTTAAAGTACACAAA
GTTGCTATAATGAGCAACAAGCTGGGTTAATAAAGATATCTAAACTTAGACCCATTCTCA
TAAAACTGAAGGAACACCAAAGTAAAGAGAAGAACTTGAAAGTGGCCAGAGGAAAAAGTT
AGTGTTTTCACCCATTTTTTTTTCCCCACAAGATTGAAATTTTAAATATCCAATCCAGTA
TTTGGTAAAGACTTAGAGCAGTGAGAAGCTTTCTGCATTATTGCTAGGCTACAAATTAGT
TGACATCTTCAGTATTCCGTTCACATAGATCACAGCCAGCCATTCGTTTCTTGGATATAT
ATTTTTCTAGACAGGAACTTAACATGTGTGCAGATCACATAAGAATGATAAAAAAAAAAA
AAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAACCTTCCTAATGCCACCACCCTTT
AATACAGTTACTCACTGTTGTGGTGACCCCAACCATAAAATTATTTTTGTTGCTACTCCA
TAACTGTAATTTTGCTACTGTTATGAATCGGGGGAACCCTGTGAAATGGTCGTTCAACCC
CCAAAGGGGTTGCAACCCACAGGTTGAGAACCACTGCTCTAGTCTACCCGGACTAACATA
CCAGTTCAGGGTGAACCCATCTGCTTCAGAATAGACTGCTCCACAGGGTTTTCATGGCTG
TGACCTTTTGCGAGCAGATCACCAGGCCTTTCTTCTGAGGCACCCCTGGGTATATTTTTA
CTTACAAGCTTTTAGTTAGTAGGCTAGTAGACAAAAGCTTAACCATGTGTGCTACGTAGA
GAAAGCAAATGGAAGGGTGTGTATGGGGTAGAGGTGCCATCATCGACTGAGGCTGCAGCA
GTATGCCTTCCTTTACTCACTTGGTGCCTCCTCCCCCAGGGCTACAAGAAGCAGGCAGCA
CTGAAGGTGGGCAACAGCAACCACCGTCTGGCGGAGCAGCAGGAGGACTTTGCTAGCAAG
ACAGCCCAATACCACCGGGAGATGCAGCACCTCCACTGGATGCTACGGGACAAGCAGGAA
GTCCTGGACGAGGCATTGCAGCAGAACAGGTATCACATAGCCAGAGTAACAGCTAATCTG
GATTGGTATTTTTGTAGTAACCCCCGTGGGGCCCGTTTTGTTTCTTTGATTACTTCTTGT
TTTCACGTTATAGTTTCATCTGAACTGAATTTTGTACTTGATGTTCTTTTCATTTTTTAA
AATTCTTTTTCGAACGTTTATTTTTGTTTGGATATTGAACGTCCTCAATCAAGCCAGTCT
TCCAATGGCCCTCCCTTTTGCCATCCCTCCAGTTTTAAAAAATTTTATTCCATTTTCTTG
GAGATTTTATTAGGTTTCTGTTAGTTTTTAAATTTCTGGCAATTTCTTTTAATTTCCAAG
ACTTCCATTTAACTTATTATCTTTCCTTCTTATAAGAGCATCATGATACGATAAAAAAAC
AAACTCACTGCCGTTGAGCCCATTCTGCCTCGTGGGCCCCCGCATAGGACAGGTAGAACT
GCCCTGTGGGTTCCCAAGGCGGTCAGCCTCTACGGGAGCAGAATGCCTCACCTTTGCCCG
CCAGAGGGGCTCGTGGTTCCAAACGGCGGCCCTTGAGGTCAGCTGTCCAGTGTGTAATCC
CATGCGCCATCAGGGCTCCTAATGATAAAATAATAGATGCAATAGAGTCTCTGTGACGAG
AAGATGTTATATCCATTGCATCTTTGTTTTTTAAACATTTGCTAGAAGAAAGTATTGTCC
GTGTAGTAAACAATGTGGAGCAGTCCCACAGCTTGGTGAAGATTACCCTCCTGGTTACTT
TGGTTTCAGTTAAGTTGGCATTTTCATGTGGCTCTGTTCTCTCAGCTAGACCAAAATATA
AATATTGTGCATACAGAAGACTCAGAATCATGCTCAGATTATTTTCTCAAAACTTAATTG
CTGTTGTATTTCATTTCCCGTTCCTTGAAATTTAAGCAACACCCCCGCACTTCTTAAATA
TTCATTTGAGACAAATGCAATAGATAGCATTAATATGAAATCCTATGTTTGAGGAAAATG
TAAAGTTATTTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNTGATATTCATGTGGTAGTCCATTGGAAAAATTAT
TTCTTGGATTTTCATTGCTCTTCTTTCCTCTGAACAGGAGAAAGCATTGGTCACACCTCA
GGTGGCTGTTCTGAGCTCTGAGGACCCCGAGTACATCACTTCTCACTGAAGTAGGATGGA
GACTTTGTGGACCATGTTATGCCAATTGACCTTGGTGTCCCCTAAGACTATGGTCCTAAG
TCCCCAGACCCAGCAACTCATCCCTCAAGGTTATTATGTCCAAGAATTTTCCATAAATTT
GTCCCCTGTGTGCTCCACCACATCCATGGATACACTTGCAGCAGAGGGAAATACTCGTGT
ACAAATTATCTGTCAGGCCTCTCTGTAGATATCTATGTGGGTATATACCCCTTGTCTGTT
TTATATGCATCGACACATAGTTCTCCATTATTGCAGAATTGTGTATATAACAGTATTTTC
CTTTGTTGCCTTTAACTTTCGCACTCCAGTGCCAAGCTTCTTCTTATGGCATTTTGCTCT
GTCTCCACATTTGAAATCTCTTTTAAAAAACAAGTGATATACCAGCCCCCTCCAGAGGGA
AGAAGAACAGAAACCATGGGGAAAGGGAGACCGCGGTCAGTGTGAGATATGAAATAATAA
CAGCTTATAACCAGTCAAGGGGCCACGAGGGGGTGGGAGGGGAATAAACAAAAGAGGAGC
TGTACCAAAGGCTCAATCGAAAGTAAGTGTCTAGAAAAGAACGATGGCAACGTCAGGGTC
TCGAGTGGGCACTGCCTCGGTTCATGGCCGCGCACCAGAAAGATTCACACCGAAGCCTCG
TTTTGATCCAAGTGGGTTTTCATGAAGGACAGAAGAAGTTTCAGGTTTTATAGTCACTGA
ACACAGGCAGCCTCATGGGACTGCACACTCACACATGGTGGCCTGAGGCCAGAGAGAGAC
CAAGGCCCAGCTAAGCAGAAAGCGGAGAAGCAGCAGAAAGGAAAGGGGCGGTGGGCTCCA
GGTTCCAGCCTGTAAGGCCTTCAGCTGGGAGTTGTGGTCAATGGTACCTCTTGACTCCAT
TGGCGGAGTTAAGCCCTTCTGGCCTAGTTTGGGCCAACCCAGGTGTACCGCCTACCTAGG
TGTACCGCCCACCTGGCTTGGGGGCCTGAATTTGTAGCACACCCTTTAGCCTTCATTGAA
TTCCCACCTCCTGTGGGGGTCCTTTAGATATGGAGAGGAACACCCCCCTATTCTGCTACC
GAACAGCAACATATGTACAAATATGCCTGATACAATTAATATATACATTGTAATAAGAGT
TGTAAGAGCCCCCCCCAGTGAAATGATCTTTTAATTAAAACAAAACAAAACAAAAACAAG
TGATAACACTCCAAGTCCTGTGAATTAGATGCGTTTTGGGTTTTTTCACTCCAAATCAAT
CTATCAGTACCAGTGTCTAGGGTATAAAACGGTTTTCCAGTTTGTCACTTGCCCAGTCTC
TAAAAGAACTCTCCTTGAAATGTGTAAATAACTTTATATCTGCTGCTATGAAATTGATCC
CTACCTGCCTCAACTCTTGAACCACCAAAATAAAGCAGATGGAGAAATACTTGCAGGTGA
CCTGTCTAATCAGCTAATGCCTGCAGCCACCGACTTGGAGGTGGGTCTTTAAAATACCAG
CAGGGTCAACCATCGTGGGCAGGCTTCAGCAGTGCTTTAAACTAAGACAAAAAGAAAGGT
GGTCATCTGCTTCCAAATACTAGCTAAGGAAAGCCTTATGAATCACAGCAGAACATTGGC
CACTCACTGCTATGGACACATCTCCAGGAAGAATCAATCACATGAGGAGGATATAATGTT
TTGTGAAGTCAGGGCCAGCTGACTCAGCATGCTGGTAAGCATGAGACTGATGCAGGACTG
GACAACTATTTCCTCCCATTGTACATGAATCAGAGTCACTCAATGGCAACTCAACCCCCT
GGTCTACCCAAACGAGAGTATCCTACACTTTTTATGGAAAGGCACAAGACTTAGAATAAC
CAAGATTTTTTTAAGAGACTGAAGTGGGAGGAATTAGTCTGCCCAATTCCAAGAGTTCTT
ATATAGACTGGATGAAATCGTCAGAGGGTGGACACACAGATCAGTGGAACAGAAGACAGA
CCCCAGAAGTAGACCCCTACAGATACAGCTAGCTGGTTTGATTACAAAGGTGCAAGAACA
TTTAGTAGGGGAAAGAGCATTTTCAACACCTAACGTCTTTGTTGTGACAGGCATGTGTGT
TAAGTGATGTCACATGCATAGCTACAAACCGAGTGGCCAGTTCTGCTCATGGGAAGTATG
TGACAGTATAGCAGTATGTTTCATGACATCAAAATGCAGCTATCTCTTTATGTTTCCCTT
CAGCCAAATGCTGCTCCCTGCCAGCTGAGTCAGACTCTTATCGAGCATGGTCACCGGAAG
TTCTCATCACCATCAATAGCCCAAGACTAAGCTTCCTTACCAGGATGGGAAGTTTTAGAA
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATCCATTTTTTCTTGTTA
TACCTTGGAAAGTATACCTCTCTATTTATAGTGATCTACCTTGAAATTGACCAAAGATTT
GTACCATAAAATAATCTAGTGGAGGGAGGGTGGGTTGGAAAGGGGGAACTGATTACAAGG
ATGTCATATAACCTCCTCCCTGGGGGACAGACAACAGAAAAGTTGGTGAAGGGAGACGTT
GGACAGTGCAAGATATGACAAAATAATAATTTATAAATTATCAAGGGCTCATGAGGGAAG
GGGGAGCGGGGAGGGAGGGGGAAAATAAGGAGCTGATGCCAGAGGCTTAAGTGAAGAGTA
AATGTTTTGAGAATGATGAGAGCAATGAATGTACAAATGTACTTTACACAATTGATGTGT
GTATGGATTGTGATAAGAGTTGTATGAGCCCCTATAAAATGATTTAAAAAATAATAATTT
TAATGTAAAATAAATGAATATATTTTACTTACTGTAAAAAAAATCTATAGTTAGATCTCT
ATCTGCATTTCCCCCAACATACAACAAATACATTATTAGAACGATACAATTATTTATCAT
TCTGTTTACATGGTGTGACTGTCTTTTATTATTAGAAATAGATATGGAAATGAAAAAAAT
CATTTTATATCATTATTTTGTCCTGAAAAATCAAAATTACTAGTTTTTTGCTATTGGAAG
TAAACTTTTTTAGTTTTTCTTAACAGAAAATGGCTGTATTTTGACCTCACCTTTGAAAGA
TCATTTCTGCTATGTATAAAATTCTACCTTGACAATAATTTTCTCTCAGCACACTTTACT
CTCTTCTGAAATTCATTATTGCTGTTGAGAAATCTTTTGTTTGTCTTTTCTCTCTAGAGC
TTTTAATTATGAATTTCTTTTTATTTATCCTATTTGGTGTAAGTTATGCTTTGTGATTTT
ATCTTCCATTAGTTTTAGAAAACTGCCATCTCTTCAAATACAGTATATCTTTTCCTTCTG
TAATAGATATATCTGGTCAGCATTCTGGGTAATTTCTTCTTTTTGATATTCTTGTTTGTT
AACTCTTTTTTCAGCTGTGTTGAATGTGCTATTTAACTTAACAGTTATTTTTTATATTTC
AAGAACTGTATTTTTCATTTTCGGCAATTCTGTTTTGTTCTCTTGAAAATCTGCTTACTT
GGTTTTTTAAGTTCTTGGTTTACGTATGTGTAATCCATTCTTTATTTCTTTTACATTTTA
TTCACAGCTGTTTCGTTTTCTAGTTGTGATACATCTTGTTTTGGTGACTTGCTCTGGTTT
GCTTCGTGTGTAATTTTTTTGTACAATAATTTCTTATTAGGAGCTCATATTTGAATGAAT
TTAATCTGTAGAACTTTGAAGGCTTTTTTGAGGATATTTTTTTCCAGGTTGCTGAAGAAT
GTTTGTAACTTGGAGCTACTTTCATTTTGTTATTATTATTAATAGATTATAGCAGTGACT
TTAAGATACACCTTTATAGGGCTCATTTCTTCGATTATAATCACCACAATGTAACATCAT
GAATCTCACTTCCTCTTTATCCATTCTTCTGCTTTGCTAATCCTTCTGAGCTTTGTCCTT
GGGTAAATGCTGCCCTTTGACCTCAAATGGTTGGTTATTTGAAGGTGTGTATGAGTACCT
TCCTAGTGTTACCCTTCCTTTATAGACCTGCTTATTGTTTGGCTGGAAGTTGAGCCATGA
GGATCAGTTCCTTTCCAGGCTTGAAGGGTGGACTAAGGGCCTTAGTCTCGGGGGATTCAC
CAGTCTCTATCTGACTAGTCCGTCCAGTCTTTTTTATGATTTTGAGTTTTGGTCTAAATA
TTTTTCTCCCACTCTGTCTAGGACCTATTTGATCCCTTTCAGAGCAATGGGTAGTGGTAG
CCAAGCACCATCAGTTCAAGGTCATAGACTTGTGGTCCATTAGTCCATTAGAATCATTGT
TCCCATGTGTCTTCAATTTTCCCCATTCCTGTCTTCAGGCTGGGAGAGGTCTGTTAGATG
ACCACTCGTGAGACTTAAGACTTAAGGTGTTACTCACCAAAGGAGGATATACAACATTGT
CTTTGTGGACGACACCAGGCCAATTAACCTTGGTCCAATCGAGGTAATTTCTTCCACTCA
GTGTTTTGGTTTACTAATCTCTCTGTTCAGCCCTGCGGTGTGGTGGGTTAGAAGTTGAGC
TGCTAAACACACCAGGCCAGCAATTTGAAACCACCCACTACTCTGAGAGAGGCTGAGGCT
TCCTGCGCCTGTCAGGAGTTACAGCCTGGAACCCACAGGCCACATTCTCCCCTGTCCTCT
GGAGTCACGGTGAGTCAGACTCAACTCAATGGCAGTGAGTTTGGTTCAGGAACCCCTCTC
CTCAGCTGTGCCCAATGTGCTGTTTAAGCCATCATTACAGTTTGCTCCTGATTATCTCAG
AAATACGATTTTACTCTTGGTTCACTTCAGTCAGGGTCTGGGGTTTTTGATTGTGGAAAA
TAATATAGATTCCATGATCCATGATTAAGTGACCAGATTTTAACATTGGTAAAGCGGGAC
ACTATTGATGAAACTCATATCCAGGCGAAATAGCCACATGGCAGCCGAAAACCGTATACC
CTAGCTCGTCGTGCATTCTTCCAAAAATCAGGATTTTTGAAAAGGCCGCGGGACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNCTTATGATTCTAAGTCCACTTGCTCATTTGGTTG
CTAATGTTTTCCAGAATCATCTAGTAGTATCTGTGAAGGAGCTGGTCTCCCCTTGCCACC
TGGGCAAAGCCTGATCGTCCTGGACTGAGACCTAATGTTGTCTCTGTTTCCCTGGGGGCT
CTCTTGCCTCTTGCAGTGATGGCTGGTCTCCCGGTCTGCCCGTGGCCCTGAGAGGACTTG
GATACTTCTGCCTGCCCTGCTTTCCCAGCATCCAAGATTTTGGCTAGCACAGAGTTGTTC
TCAGAAAACACTGCTTCGCTGCCCTTTCCATTTCTTTCAGGCCTCAGCTCCCTCTGGGTT
CCTGTCCTCCTGGTAGGTGGTCTAGGCCACTCTTCTCGTGCCCTCACCTCCTGCTCCTTA
CAGATATGCCCACTCTGCCCCAACTCACTGGCATGTCTGCTTCCATCGGGCCATGTGGGT
GAGCACTTCTGAAAAACCCATGTTGTCAGGTCACAGCACAGTCAAGGGACATGGGAGAGG
GCCTCCAGGCCCATGCCAGCCTGGTCATAGGGCAGTAGCATCTGCCTGGCTTAAATCAGC
CACTCTGACCACCGTTATTTTATAGTCATAAAATAACAAGAGAGCAAAGATTATGAGCAC
GCAGCAAAGCAAGAGACAGTAGAAGTAAGAAATGGTTTTTCATCTGTGCCTTTGTATCCC
CCCCTCCAAAAGGACCTGTATATTCCACTTCCGCATGAACACTTTTGCCTCAAACCCGAG
CTCCGTGCACTCTGAACTCTGAGTTCATGGCGCTCTCTGCCCCTGAAGTGCTCTTAAATG
TTGTGGGAATTGTACCACTGAACTCTCCCCCGCTCTGTTTACGTCTCGCAGAGCAATGGA
AGGGGAGCTGGAGGTCGTGTGGGAGTCCACCTCCAAGGAAAACCGGAGAATCCGAGAGCT
TCTCCAGGCCACGCTGGAGAGACAGGGCCCGAGGGACAGCAGCAGAGCCGGTGCGGCCCC
CTGCCTTGATGACGGCACTCCGGAGACGTGCTGGATGGCGACAGCTTCAGCTACATGACC
TGAAATCTCCAAAGCCCGGCCCGAGGCCGCAGGAGCCCTTGGGCTAGGCTCCGCAGCCTC
CCACAGGAACGGGCGGGCAGCGCCTCCTGCCCCAGGCACACGCCCACAGCAGAGCAGGGA
AAGCGCAGACCATCACCTGGTATGGCTACAGTGCTCAGCACGTNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 2643..2648, 2651..2662, 2664..2749, 12596..12596, 12598..12755, 16281..16470, 17695..17797, 20898..20926, 21606..21648, 24016..24234, 47628..47770, 47955..48005, 48106..48189, 55334..55441, 57037..57145, 60767..60947, 65669..65836, 66792..66933, 71028..71117, 77043..77212, 86175..86325, 86328..86357, 86360..86386
1001..1039, 2643..2648, 2651..2662, 2664..2749, 12596..12596, 12598..12755, 16281..16470, 17695..17797, 20898..20926, 21606..21648, 24016..24234, 47628..47770, 47955..48005, 48106..48189, 55334..55441, 57037..57145, 60767..60947, 65669..65836, 66792..66933, 71028..71117, 77043..77212, 86175..86325, 86328..86357, 86360..86386
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved