Echinops_telfairi Locus GRAMD3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi GRAMD3
Echinops_telfairi
GRAMD3
GeneScaffold_6145
SNORA61
79594..79712
85096
GTTCTCAATGACTGTATTTTGAAGTAGACTTCCAATATTAGGTTTCGTATTGGTTATTA
GTCTCAGTTGTTGGATATACAGCAAACCATAGGACCACCAAAATGTTTGTTTGAGGGGCA
GGGGAGGCTAACAATCGAATGAAGATAGCAACTTAAAAACCTGTGAATGGCTAAATGGAT
GCTTCAAATGGGAACTTAAAAGCCCAAAGCCAAAAAGAGCCTCCGTCTCTAACCTGGGAA
AGAGCCCGCGTGTCAAGTCCACGAACGGCTGGAAGAAGAGGAGTTGGGCGTGCCGTCATT
CAGTTGCTATGGGGTTTGGATGATTGCCTCTCCCTCGCAACCACTAAAGACAACTGCCTC
TCACTACCTTTGTTAATCCCACATCAAATATTGAGCAGACACATTGTTTAAGCAACAGGG
GACAGTCCCCAAGGAGACAGCATCCTGTTTGAATAATTTAGGCTGGGGCATCGGCCAGCC
CACGTGGTGCATTTGCACGATAGGTCTGACTCAGTCGTCTCCTTTCCTTGTGTCAAGGGC
TGGCGGCCCAATAGTTAAATCCCATCACTACAATCAGGGTTTTAAAAAAAAATGTTTAAT
GCACAACGTAGCAGGAGGTTAAATAGCTTGAGACTTGTTAGGCAAATATTTTCACCTGCT
TAGCCAATGAGCTTCCTCTCCCCGAAAGACGAGTTGAACAGGTTTCCTTTTTCTCGTCCG
CGGCCTGCTGGGTTGGGGCAAGCGGCTGTCACTTCGCTTGGGCCCTCCCCGTCCCTCCCT
CCGGGCCCTTCCACCCTCGGTCCGACCAATCGCGCCTCTTCGGCCGGGTCCAGGTTGGCG
GACCCCGGAGGCTGCCTGCGCTGGATGCGGCGCGGGGCGGAGGGGGCGGCGCGGCTCGCT
TGGCCTGCGCCCCGGACGGGGAGGACCGGGAGGCCGGCTGGGACAGGACAGACTGGCCGA
GTACGAAGGACTGGCTGAAGGTCCCTCCGGACACGGCCCTGATGACTGAGCTACAGCAAG
ATGTGGAGGACCCAAAGCCTGCAAAAGTTCTCGGGAAAAGAGAAAGCAAAGTTGGCTCGA
TCCAGTGAGTATTCTCAGCTGGGACCCATCCAAGGCAGTGGTGGAGCGCGCGCTGCCCAA
AGTCCTGGAGGGGCAGGGCGGGGGGGGGGGGGGGGGGGACGAGTTTTTGTATCGACACGG
TGTCTGGAACGTTTACGTGGACAACGCTGTGCTTGTGACTCTGGTTGTGGCGCCCATCTC
TCTTTTGCTCGGGCTCTTGGAGAAAGGCACAGCTGCGTTACAGGAGTGTGTGTCCTGTAG
CTTGCTATCTGGTGGCGATGTGAATTTGTGAGCCAAACACATCATCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGCGGATGCTGAGTGAGAT
GGGGCAGATCCAGATGATCATTCAGATAAAGTAAAATAGATCAAATACTGAGTTGTCACT
AACCCTTTGTAAGTTTAATATGCGTCAAAGGAGGAATCGCACATTAACCTGGAAACTCTT
CTGGTTAAAGGAGAAAGGACATATTTTGACTATAAAAATTAGCTTCCTGTAATAAAACTT
ATTGTCTTCCCTAGACTTCGTTAAGGTCTTTATTTAATCCATAAATATGATTATTTACAT
TTCATTATTCCCAAACACTCTAGCTTTAAAAGGTTAAGAATCAGTACTTGCTTCATATCT
CTGTAATATCCCATCACTGTAGTATTCTGAGTAGTTGGGGGCACTTAAAGGGTTCTGGTG
GTTACAAGTTGGGCTGCGATCCACTTGGTCCACAGTTGGAACCATAGCAGCTCCTCGGGA
GAAAGCCTGGGCTTCAAGAAACTCCGGTGAATAGAGAAACTCCGGTGAATAGTTTCCGTC
TCAGAAACCCACAGGGGTGGCAGTGAGCCAGCATTGGCTTCATGGCAGTGACTCTGTTTC
TCATTTATTGACAAGTAATACAGAAAATGACAAGTTTTTTTTTAATAGCAACAAATTCAT
CTCCTTTGTACACTATTATAGCATTTACTCATTTAAAAAAAGTCACAGTATGGCTCCGCA
CAGGATGTGAGCCTATTCCAGCTATGCATCTGTTGAAGTTTGGGCTGAAGGTTTAGATGT
TTATTAGCTACTTTGAGTTGTAGTTTCTAATACGTCTGTAATATTCTGTAAAATTGTAAA
TTTTACTTCTGTAAAATTCTCCCTGTGTTTTCGCTTTCCTTGGCTACTCTTTTAACCTCC
TCCCCCAACTTCCAACATTGTCCAGGTACATTGATGTTCTTTATTTCTTCTGACAGATAC
ACCACGATTGAGATAAAATTGATACAGGTATAACTCACTGCCATGGAGTCAGTCCTGACT
CATAGCAATCCCCTCTGGGTTCTGAGACAGTAACTGTTTACAGGAATAGAAAGCCCCATC
TTTCTCCTGAGATGGTTTTGAACTGACGACCATGGAGATCACAGCCAACGCTTAACCACT
ACAGGACCAGGGCTCCTCCCCATACAATGTTTTGTTTTCTCATCCAAGAATAAAATCCTG
ACTCTATGATACCAATTCCATTTCACAAAAAGATGACCTGTCTAATGACATCTGGGGTTG
CCATTTCACTGACTCATTACTTCATATACTTTATTTATCATATACCCTGGAGGATCACAA
GTAGATAAGGTGAATGGTCTTATCACCACTTTATAGATAGTGGAAGTAACAGGAGTGTTG
AGTGCCGGGGCAAGGCTAGAACTTTAAACTCCTGGTCTAGTGCTCATCCAAAGGCAATGT
TCAGTTCTAGTTTCACAAACCTAAGTGATTCTAGCCTACCCAACAATTACCAAGTGTTGA
AATGGTCACATTTTCTGTCATCTAAATACTTGCAATCCATTTGATTGACATAAATGTCGA
TTAGAGCATTTACACTGATTTTCTTAACTCAAAGCTCATTAGCCAACCCAGGTCACTTCT
GAATCATTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGTTTA
GATTTCTCTTGAAAAAGAACGAAAATATTATGTTTGATTTCTCCAGGACCCTACCATGAA
TCCCCCTGGCCCTTGCCTGGAAATGAGCACCCACCCTTCATATCTCTTCACTTGTTCTGC
CCAGGGAGGTTTCTCGGCAACGAGGATGACCCGATTGACTTCCCCTCTTGCTTCTCGGCA
TGGACATTAGTGCTCTGTTTTTCCTAGAGCCCGAAGATACTCAATATATCCTAGTACCTA
GGCATCTATCCAGATATAATCTAACTGGGTTTTCAAATCATATCTAATATGTTTTGCATA
GCTCTATAACTGTGAAGAATCTCAGAACTATGCTACTGCCTGTGTCCTTTACTCTTAAAA
TTCATTCACTGAAAACTTATCATATGACCTGGAAATTATTTTGAAACCTCTACTATGCAA
TGATATGAGTTAATAATTTACCCACATTGAAGAGCAGCACTGGGTTTTGTAGGAATATAA
TATCTTCACAAAGTCCCTGAATGGTACAAACAGTTGCACACTCCACTGCTAGCCCAAAGC
AGGAGGTTCACGTCCATCTAGGAAAGGACAGCCTTTCTCTGAAGGAAGTCCTGATGAGCC
GTGGACAGCCCTTGAGAACCCTCAAGAGCACAGCTCCACTCAAACCGACAGGAGCCGCCG
GAGTCAAAATTGACTGGGAAGCAACTGGTTTAATCCTTCACAACGTAAAAAAGCACTTTG
CTGTTTCATATCGCTTTCAACAAAAGGATTGCTGTTTGTTCGTTTTATCTTTGTAGGTCA
TGCATTGCTGACCTGAAAACAAGTGAAAAGCTCTTATTAATCTTGAAATCTCATCTGGCG
TCCACTTGTGAGAGGTCCCACTGTAAAGGGCATATTGTATTAGTTGCTCCATGTCGCTAG
TGCTGACAAACTATGAATTTATCTTAACTTTCACGATCACTGTACTGCTTTTGTAATTCA
CTGAGAACCAGCCCTTTGTTTTATCCTAACAACTTAGATGTGCTAGGTGCCTTTTGGACT
GCATAATGTGTGTGTGAGATTATTTGGGGTGATCTGGAAACATTTTTTTAAATGTTACCT
ATATAAATTAATGGTAATCATTTCTATACTCTGGGCCATTTCAACTTATAAGTTTTCACA
TCCGTGCTCTACTTTCAGATGGTGGGGGAAACTTGTAGACCTAAATTCAGAGTGTAGAAA
CTGTCTTGTAAGTATAGGCCATGTTTGAGTCTTAACATGTTCTAGTCACATCTTGTTTAT
GACCAAATATCTTATTTAGAATAGAATACCACTTGGAATGCCCAGAACATATTTTTCCCT
TTCTCAGTTTCTTCCTCCATAATACAGTGCTATAGTATATAAAGTTGGATAGATTTTTGA
CATTTTGTTAATGGATTTCTTTAGCTTGTTCATAATTGGATCAGAATCTTTTCTGGAAAT
TGCACAAAGACTCATAGCACCTTTGCTGAGTTCCATTCTAAAATCGCAAAATGGCAAATC
TTTGATCAGAACATAAGAAATAGATTTTGTTCTGAGATTGGCTTTTCCTTCAAAAAAAGA
CTCGGTGACTCCAGAAACTACATCAAAACCTAAGTGGGATTGGACATTGCAATGGCTATA
AACAATGCACTGCTCAATGCACTTTGAGAAATGCATGTGTAATAAGGTAGGTACTATTAT
CATCACCTTGTTACACAGAAGGACACAGAAACATGGTGGGTGGCCAGGGTCCTAACAGCT
GGTCAGGTATTGTAGTCAAAAAATCAAACACTGATGGGCTAATCGGAACCCAAATCCTCA
CCATAAAACAAAAGCAAAACACCTAAAACTCGCTGACATCGAGTCGATTCCCACAGGACA
GGGTTACACAGCCTCTGTGATTCTCAGAGACTGTAACTCTTTATGGGGGTAGAAAGTCCT
GCCGGGTTCTTGTGGAGACGCTGGTGGTTTTGAACTGCTGACTTTGCAGTTAGCAGTCCA
ACGCATAACCGCTGTGCCACCAGGGTCCTGAACCCAAATCCTAGCGGCACTAAATGCTGC
AACCCCAATGTGATGATGAAAGAGCACCAAGCCCGAAGACAATGTCTCCCCCTGAGTGGG
AGTAAGTCTTTCTCCCTTCACAGGTCTGCTTCCTCAACTAGGTCAGTTTCCAGTCTGACA
TTCTGACATTGAAGGGGTTTCTGATGCTCTGTAGATGAAAGAGCAGAGGGAGAACCCTTG
ACTGCCAGTTGGGGACTGGCACCTTTGCCACGTGGGGCCTGTGGGGCCCCAACTGCCGGA
CACTTCTCGTCCACTCTAGAAACCTGCTGATCGGGAGAGTTGTTTTTCAGTCTGCACTTT
ACCCAGCACCTTGCTCAGCAGTCACACACAGCTTCCTCTTTTTTCAAAAGCCTATTGGGT
TCTTCTTCGCGCAGGTGCAAAGTGTTACTGTGAAATAACGTGACAGTCTGTTGAGCACAC
AACCCAACAAAACTGTGACTGTTGGCTCTTGAGAAGTTGTCCCTGAAGCAACCCAAGAAC
TTCGTCCCCATCGTGTTGCCCCTGCGCAACATCGTTTTAGCATTCTTCTGGCAGAGCCCG
TTCGGAGTCAGTCTTTGAAGAAGGCTGGCAACTCTGCTTCCTTCGTGAGTGAGTTTTAAA
AGGCAGGCTGGAGTTATTTGAGGCGGAATTCGGTGAGTGTGCTGGACAAGGAAAACTTAG
GCTCTTCTGCAAAGGAGACCGTTCTTGGTCAAAGATGTGACTGTACAGTGATAAGGCTGA
GACAGTGGTAATGCTTACAAACCAGTTTCTACACTTTTTAATTGCGGTTTACGGTCTCCC
CTACTATCTGTACGTAGACCACAGCTGTAAAACTTTTGCAAGCGGCAATGGCGTAAAGCC
AAGAAACGATTGTCATTATAATTTATATAGAAAACTTTTTTAGTGTTCCCAGGCCCCCCC
CAAAAAACAATCTACTACATCATACTAAATAACACATGAAACCTAAAATGACACTAGCAT
CCAGGGTTCCCATACACAGTTCCAAGCTGACATGAGAACTTACAGATGAAACTCAACAAT
GATGAGGTCTGTCCAGGAAGTGAGCAGGTTACCACAAGTTAGGATCAGCAGACACTAAAG
ACACCGTCACTGGTCTACAGTCGTGCCTCTTGTCAGCCAGCAGCCAAAGATCTCTCTGGG
CCTCAGCCTGTCAGCCACATGGTCCTTGGTTTCTGCCTCTGTGGACCAGGAAGCTCACCT
GCCTCTCTGCCTTACAGTCTTGTAGTCTCCAAACTGCATCTCTTCTGTCTCATAAGTCTC
CATTGCTCTGTCCTGTGATCTCCATGTCTCAGTCTGGGTGTGGTACCTCTGGTCTCGGCC
TCCACCACTTTGGTCAGAGATCATGAACTTGCTCTGCTGGTAGCTCTTCCTTGGTGGTCC
TGGGATTCTTTCTCTGTTTCTGAGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTGAGCCATC
TGCACAAGTGTTCCTTGTTGCAGCCACCGTGTCAGTCCATCTTATCGAGGGCCCGCCTCG
TTTTCACTCCCCTTCTGTTGTACCAAACACGCTGCCCAGCTCCAGGGACTGACCACTCCT
GCGAGCTTGTCTAAAGCACACACGACTGAGTCTCACCATCCTTGCTCCGAAGGTGCGTTC
TGGCTGCACTTCTCCAAGACAGATTTCTTTGTTCTTTTGGCAGTCTGTGGTACCTTCGAT
GTGTTTTTGGCAGCACCAATCATTCAAATGCACCAATTCTCCTTTGTTCTTCCGTATTCA
GTGTCCAATTTTCACACGTGTATGAAGTAACAGAAAATACCATGGCCTGGGCCAGACACA
CCTTAGTCCTCAAAGCCACTGAGAACATACCTACACTATATTCTGGGCATTTTTAGAGAC
ATGTCAGAATTCTCACTGCACCTCAACAGCCTGACTTTGCCCTTTGGCTGCAGTGAACAG
GAGCAATTCTTTCTGGATTGACCATTGTAGAACTGTCCAAATCAGGGCATTTAACTTAAA
CCAGCTTCCTTAGCAGTAGAGTTGTAAGCTTCTCTGTTATAATTCAGGTCAGAAAATAAC
CATTTTGCACTGAACACAGAATACATGTAAAGGTTAAGAAGACCTTTTGTCCAAGGAAGT
CAGGGAAGGCCTAAGGCATGCTAGTTTTCCCGCTTCCGCCTAATAATTATACTAGCATCT
TGAAAAGAACTTCATATTCTTCATGGCACTTTTAGTTATATCAGTATTTTTTTAGCACAT
AGACTTTCACAAACATTTTCTGAGAAACTACTCTTTTTATGCATTTCACTATACAGGCCC
CTGGCAGCACAAAAGGCAGTTCACGTGCACCCAAAGGCAACAAGGGAGAAAGACTGGTGG
TTGGCTCCGTAAGATTGCAGTTATCCTTAGTTGCTATGGCGTCACTTCTAACTCACAGCG
ACCCTAAAGAACAGTAGAACTGCTCTCCAGGGTTCCCGAGGCTCTAAATGTTTGTACACA
TAGACAGGAGAGCAGCTGGTGGATTTAAACTGCTGACAGCAGTGGAATGCACAACCACTA
TGCCACCTGGGCTCCCGTTCCTGGTAGTAAAAAAATACTACACCCCATCCCCCAAGAAGG
CCCACTCAAGAAAATTAAAATATTTGCATTTTTTTCACCAATTTCAATAAAAGTAGTTTT
ATTTATTTAACCCCAAGGAGGGATTAAATATAAAAGTGTAACTTTTAGATCCCCTGTTTC
GTGAGGAAAGAACTAAATACCTTTCACACAGCATATTGTCGAAGATTTTTTTAAAAAATA
TAACCAGAAGGCAACGTTCTAACTTTCTAATCATTAATCTTGAAAGTAGGTCTCGGGTAG
AATCAGGTGATATTTAACGAGCCATGGTCCCGGGTAAAGCACCTGGTTGCTAATTGAAAG
GAACAAAATCAAAACCAAACCCACTGCCATGGAGTCGATATCGACTCACAGTGACCCCCT
AGGACAGGGTAGAGCTGCCTCTGTGAGTTTCCGAGACTGTCACTTCTTTACGATGCGAGT
AGAAAGCCTTCCGATTGAAAGAAAGGCTGTTCGAATTCACCAGTGCCGCCAAGAGAAATA
CCTGGGCCATCTTGCTCTGCTAAGATCACAGCCCAGGAGCGTCGTGAGGCAGTTCTGTCG
TGTTGTGCAGGGTCCTCAGGAGCCAGACTCCACTCAAGGGCTCACAACAGGTGACCTGTG
GGCTGTGGGCTGTTCAAAGCTGCTTCTGGGGGTGCTAAGAAGGGAAGCAGATTCTTTGGG
ACTGCCTCCAGGATTCGCTCAGGGTCCCTCTCTTTGACTGGTCTTTCACGTACCTGTACT
GTTATACTGGGGCTCAATCAACCACGAGCCGGCAGCTCCCAAAACGTTCTCTTCTTCCCA
ATGCCCTTCCTCCATACTGGAGAACCATAAAGTATAATGGTGACATACAGTGACATTTCT
AAAATGCCATTGTAGAGGATTTCTTAAAATATATATATTGCTGTCAGATCTATTCCTACT
CCGTCTGACAGAGACCTGCCCCCGGGGTTCATAAAGCTGTACGTCTGCACATCTTTCTCC
GAACTTCTTAGCCCGGAAATAGAAACTACTTTCCAAATGCAAGCTGAAGGCCTTGCCCCT
ACTTAGAAAAACCATATACAAAATGTTGGTGGAAAATTTTCATTGTCTTTGTATTCCGTT
TTTTTTTTTCCATGAATTTTTTAAAGAATTTATTAGAGAAGGCTTTGTATAAAATTATCT
TTTATAAACTCTAAGGAGAAGAGTTCCTTCAAGAAGATTTTCCTATGAATAAAACCTCCA
GAGTGGCACAGTGGGTTAAGCATTGGACAGCTAATTACAGGGTGGGTCATTCAAACCCAC
CAGCCACTCCATGGACGAAAGATAAGGCCATCGTTCCCCATGGAGATTTAGTCTCAGAAA
CTCTGGGGAGACGTTCTCTGTCCTAAAGGATTACTGTGAGTTGAAATCTATTTGATAGTA
GTAGGTTTATGTGAACCTTATTTTATTTTGTTTGGATTTGTTTGTTTTTTGGTTTTTTTA
CTTATTTTAAGCATTTTTATTATACATTAAACATTTTAATGTAGAGTTACATAAAGTTTA
CAATATACATTTTTAGCACATTATAAGCACACAGTCCAGTAACATTCTTTTATTTCAAGT
AACATTGGTAGTTAAATCACTTTTAAAAAGAGCTACATGTACATCACAATCAGTTCTAAT
ACTCCAACCCCCTTCCCACATTCATTGTTTGCTCCCCAAAATTCCCCTCATGCTCCTCAT
TGTCATTGATTCAATGCTGTGCGAAGGCTGTTAACTGCATATGGGTGGATAGAGCCCAGT
CTTTCTCTGGGAGCTGCTGGTGGTTTTCAACCATGCAGATTGCAGCTGAAGGCGTAACCA
TTACACCACCAGGGTTACTATACTGTGCAGATAGCTACCTTAAAAACAGCCGGGCCCAGA
AAAAAGCTCCAGTTTAGAAAAGTTCTTTCCTCAGTGCCTTTTAACCTAACCTGCCTGTTG
AATATTTAAACTCATATGAGAGGATGAGAATTGTTTTGTAAGAGCCGTTTCATAAGCTCA
ATAGAGCTGTGTTCTAAGGTCCTCTTAAAAGGAAAAGTGAGCGGTAATCTTCTGGCATTA
TGTATGATTTATAAACTGAGAAAACAGACGGGTCACATGTGACCCCTTGGGCTTCCAAGG
CTGATTACCACAAGGCAGGTGTCAAACATACCTCCACCCTGCACACTTCTTTAACCGTAT
TCTGACGTATTTCCTCCCACTGCACGTCTGTTCCCACCCATCCCCCTTCACCCCCCACAC
TCTACTTTTCTACTGGGTTTGATAATACATTGCAATGGCTACACAAAACTCACAGATGAT
ACAATTATGGGGTTTATTGGCTACAATTCAGGTGAGAAATGCTTAAGATACAGTTGTTTA
GTCAGGACAGTTTCTTCACTGTTGTGCCCATAAGCAGGCCACTCTTGGACCCTCAGCCTT
TGGCCTGGCCTCTGTCTTGCTCTGGCAATGTTACAAAACCCTTGTAAGGCTGCCAATAAG
TGCTCAAAGGGCATGCCACTCCCCCATAAGCCTAAGCCAAACTAACTCCTCCAGTAAATT
CCTAGAGGCACCCCATGAGCGACTCAGGCAACCGCCCCCAAACACTCAGCTTTTCTTGCT
CCTGGGCTAGGAAGTCCACCGCTCTCTCTAAAGCTCTGGCTCCCAGGTCTGCTCTTGCTG
CCCCTCTGTCACTGCTTGGTGTCAAAACTGCCTCTTGGATGGAAGAGGTTGAATGTGCAG
GAACTTCAGGGTCCAACCCTGGTGGTTCTTCTGTCTCGTCACTAGTGAAACCCTCCCTCC
TGCTTCTTAGAGGGCAGGATAGCACCCTGCCCAGAAGGATAGCCATCACAATTCACACTG
TTAACAATCACTCGTAGCTGAATCATATAAGTTAGTCAGTATCTCCCCCCAGACCCATCA
AGAAAAAGGTTCTTTGATGGAAGTAACAAAGTTGTGGCTAGAAGAGCCATATGAAATAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAATGGTCAGTCCTGATGAC
ACATCCAAAGTGCAGGACCCCATTCCAAACCCATTGCTGTCCTATTGATTAAGACTGGAC
ATGACCACATAGGACAGAGTAGGTCCCAGAGCGTCACTCAGACTGCCTTTAAACAAGCTG
CCACAACTTCCTCCCATGGGTTTGAATGCACCAACCTTTCAATTAATGAGTAAGTGCATT
AACCACCACACCACCACCACAAAGGATAGGATATATAACAAACAGACAAAATAAACCAAA
TCCACTGCTGTGAAATTTATTCCAATGCACAGCAACTCTATAGGACAGAGGAGAACTTCC
CCACAGAGTTTCCCCAACTATAAATCTCCTCTTTCTCCCTGAAGAGAAGCTGGTGGATTC
AAGCTGCCAGCCTTTGGATTAGCAGCCAAGTGTTCAACCCACTGCACCACTGCAAGAACT
TGTAAAGTACAAAATCCAAACCAAAACGGAACCCACGGCCATCAGATTGATTCCCACTTA
TAGCCGAGGCTATAGATCGTTACGGGAGCAGACCGCATGATCATCTCCCTCAAGCAGCTG
CTGGCCTTGAACCACCTATCTTATGGTTAGCCTGCCAAAATTTCGCCGACAGCACCACCA
CTTAATTCTGGGAAATCCAAATTCGACACATTAACATTTTCCATTCTGAGTTTTAATGGA
GTTATTATGAGAGTGGGTTTTGTTTCTTAAATGTGGTTCATCTCCTCATCTCGACTGTAA
ATATATTGAAAACAGGGAAAGGGGGTGCCCTGGGTGTTTGTTCTTCCCTTCTCTTGTATG
CTCAGGGGGTAAAGTTCAAATGTGCATGTGGTGCTATGTTTCATGCGTACAGGATCTATC
TCTTTTAGTGAAAAAAAAATAGACACGATACCCATTTGAAATTATTAGATGTGGCTTTAC
CCAAAGCTAGAAGGGTGAAGGTCTTCATTACTCTTACATTCTAAAACTCCTGCTCTGAGC
AATAGGTGCCCCTCTGAATTCAACCAGTTGCAGACCTGGTTTATGAAGCTGCTGTGCTGA
CTTTCATGGTCAGTGCCATCTTTATGCCCAAATGTCTGTTTTCATCGATCACATATGTGG
AGAGAAATGTCTTACAGTGGCTCTTCTACCCAAGCCTCTGTAACTCCCACCAAATGATTC
ATTGGGACTGTGAACATAGGGCCTGTGTAACACTAAGAGAGGGGATTGGTCAGTTTGGGT
TGCCTGGCTACAAGGAGAGGGTGGGGCGAGCCATCTTTGAAGCAGTAGCGGAGAAAAGAG
AAACCAAAAGAGCATGTCGGAGACCTCCATGGAAGTGGCGGAGGCCAGGCGGCTGGCTCC
AGATGCACCCAGACTCGGTGGGGCACCACTGAGCCTGTGGGTTACCTGTGATGCCTTAAT
AACATTCTCCAATCCCTCCTCAAGAGTGTCTTAAAAAGTAGTACCAAGGGGCAAATCAAT
GGGCACTATTAAGAGAAGATCTTTATGTCCCAGGGAGATTATCGATAGGCTTCGCTCCTG
TAAATTAACAAGGAAGTCCTCTCAGGAGAGCCATAGGCAGAAAAGCCCACATAGATCCAG
GGATGGAATTTGGGTTCTACTAAATTCAACTCTACTTAAGAACAGTAAGTTCTTACTCCA
TGGCCCTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGTCAACGT
TGTGTCTGCTGATACTCGGGTTTCTCTCAAGGCTGTCCGCTGGGTGCAAGCCAGAGTGGG
AGAGGGGTTGGCGGGAAGCAGCTGCAGCATCATGTGCGGGCAAGAGACAGGCATGTTTCC
ATCACCCCACCTGCAGTCATCGCCTTGGCCCATCTAGGCTGATGCGTCAGTTACAATTAT
AACTAGCTCCCTGTTGGCCCTTGAAGTTACTAGGGATTTCTTTTCTACATCCCTCATCAA
AACCTAATCTGACGCACGTATTGGGGATGGGGATGCCATATCTCTTTCTTCCTCTCCCTG
GAATAGCCAGAGAAGCTAGAGCCATAAGAGAAACTGGACACTGGCACCCGGGGAAAGCGC
AGTGGGCAGCTGTGGACTTTGTGCAGGCTGTGATGTCGCCTACATACTTTGTCTACGGAG
CCAGCGGTGTGCCTAGCGATGCTTTTGTCCATTCCATTTCTGAATATTGATATAAAATAC
TAATGTCTTCCCTGAAAAAAGAGCTAGATTTCTGGTTTTGTTTGATTATTTTAGAAATCA
TGGAAACAGTTATTCATTTTTCAGTCTTATATTGTTATACTTATTGAAAACAGCAAGAAC
AAGTCCTTTTAACATGGGGAGAAAGTGGGATGAGTCACGGAACACTGAGGGGTTTACAGT
GTGTAAGTTGAGAGAATGCATTTTTGAATGGAAAACTGATGATCTGTAAATCTTCACCTA
TTTCACAGTAAAAATACAAACAAACCGAGGGGGAAAAAATCCTTTTGGAGTAAGATAGTT
ACTCCCAAAGTCGTTATAGATGAAAGGAATGTTGGTTTGGTCTTGCTTCAAAGTAGACAG
GGATAGCAATGAAACAGGATTGACTGGGAGTAGATAAATCATTCAAGATGTGTGATGCAT
CGATAAGGGTTACTAATACCTGTCTACTTTGTATAATTTATATAATTTCCATAATAAGTA
CTTAATTTTTTCAAATCACTTGTGAAAATCAGTGGGTACCTTTAACTACTCAATCAACTA
TGCTGTCTTCAACATTCATCAAAAAAGGTAGATTAGTCCAGATTTTTCTAAGAAAATCCA
GCCGTAATCATGACTTGTTTCAGACATCACAACCATTGCGCTCATCAGCAGTGCCTACCT
TCCTTGGTCAGGTAGAAAATGCATACAAATGGAGTTCTATAACAAGAGCAGTGAGAGGGG
ACCTGGTATGGAGGTAGGGAAGTCAGACTCTTATTAAAATGCAGAAAATGGTAGGCATCT
CATATAGGGATGGCACTCCCAGAAACTGTCATTTGGCCACTCTTAGGCAGCCAGTTGTCA
TAGAACAGAGATTTCTCCTTGAGCCTTACCCATTTTGGAGAAAGTGTGAAGTAAAAAAAA
GCAATCCTGTTTTCTTCCAGTTTGTTTGAATCTTCAGTATCTAAGTATTGCCCTTTAAAC
ACGCACAAAGTAAAGCGAATGTAAGTGTTATGGCCCCTCCCCATTATGATACAATCGTTT
GGGCTGAGTAACTGAGGTAGACTCCACTGCCTTTCACCCAGTTTTATGGGAACGCATGGA
CTATCTTCCTCTTTACTCACATCCTTTGTGGGATGGAGTCACGTGTTCTCTGTCTGGAAG
AAGTTGAAGAGCAGGCTGCTGCTTCACAAAAACCATCTCTTACAAGTTTGGTTAGGATCA
CCAGTAAGTCATCCAACATCCACCAGAAAATTCTTCCCAAATCCAGGAATTCCAATACCT
TTGTCTGTTGTTATTCTGTCCGGCACAGCCCCAAAGGGTATGGGACTAGAAATATGCGCT
TGACGTCTAATGTGGGCTCAGTGAACATGGAGTGTTTAGGGTAATGAGCCTTCCTCAGGA
TACAGAGATGCAACAAGTGCTTTAGTTCCCTCTAAGGAGGGAAAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGG
ACTAAGAAGTTAAAACTCTACCAGTTTTACCCAATTGGGTTGGGCAGGGGGGAAGAATCT
TTGTATAGTGTGATGGAGTTCTAATAACCACAAGTTTCCTGATTTACGAAATAAGATAAT
ACTGATCTTATGTACCCATCTCAGAGGTGGACACCGGGCTTAAGCAGAATTACGGGGGCA
GGAGAACAACCCACAGGGCACGTGTAGACTCATCTGGGAAACCCTGTGGGAAGGATTGGC
GAGGGAGCAGGAAAAGGCAGAGAGGAGGTGCTTTTTGGAAGTAACACGTGTGCAGTGCAG
GTAGAGAGAAATGCATATTCCAAGAGGGAGAAATTAGTAACAGGAAACAAGGATGTCAGA
TGTAAAATGTACTGAAATCTTTTTAGACTTATTACTTACTTCCTTAGATAAGGTACCAGT
GATATATAAACCAGTTGCCATCAAGGCAGTTCCCCCCAGGAGGTCCCCTGTGCTCCACTG
GGCTTTCATTGCCTGATGTTTCAGATCACTAGACCTTTCTTTCCGCTGCCTCTGGATGGA
TTTGAACCATCAACCTTTCAGTTAGCAGCCAAGCACATTAGCCATAGTCACCATTCAGGT
CAAGTATAAGTGAGATGCCTTTCAACTAGGACAAATATCTGATTTCAACAGCAGTGAGGA
GTTCTTAATTCCATAGTTCCTCCATATATATGTGTGTGTATACATATATATTATAATAGT
AGATGATAAACAATATATAATATGCTATGTATAAATAGTATGGTGTACTTTCACATTTTT
AGACTAATATGTACTAATACAAATGTAATAATTAAAAATGAAGAGATACATTCTGAAGAA
AATAAAATACAGATTTCAAAACAAAAGAACAAGGGGGGTGGAATAATCGCCGTCAAGTCA
ACACCAACTAAGGAAACCATTACGACTATCTTTACTTTCTTAAGTAATTTACATGAATGT
TTTTTGAAACATCACTTAAAACTCAGTTGAAATAACTAAAAATGTGCCTTCTTTTTTCGG
TGGGAAGTATAGGATTACAGGAACTGGTCTTTACTTAAATGTGTCAAGTTCAGGCGGACG
TTGGCTAACCCTTTTAGGAAAAAAAATCATATTCTCTGAAGTACATGTTATTCTCTGGGA
TTTTTGTTTGTTTGTTTTTCTTTTCGAAGTGACAGTGTCTTTCTTTTCGGGAAGTTGAGG
AACATTAATTTTTTATTAGGAAAGGAATCCTGAGTTTGAATAATAAATGACATTTACGTA
AAGAGCCTTTTCATGTGTGCTAATGGCACCCATAACGTCAGATGGGTATTTTGATCGTGG
AGGGCAGGGGGATAGTGTGGCCCGAGAGCTAAGGGCGCAGCGCTGTGGCACCCAAAGCTG
CCCTCGCGCACATGGAATTCTGCACAGTGACATCAGAAGGCAGGCGGTTGAGGAAGTGAC
CATGGTTTGTTGATCAGGGAGGGTGTGGAGGAGGAACAAAGGAAAGACGGACTCTGGGGC
ACCTCTGTTCTATTCTGGACTCCTGTGACAACTCTTACTTCTGCTGCAGTGCCCATGTAC
TTTGGTCTTTAATCTCTCTGACTTTTTATCTTGTTTTTCCCTCCTCCCACCTGGAACCAA
AAGACAGTGTTTCCGGAAACGAATAGAGTCAGAGGAAGGAAAACGCTTTAGTCATCACAC
GCGGCAGCCAGGTGGCAGGAAGGTGCTCCGCTCTGGGATCACCAAGTCCAGATGCTCCCT
CACAGCAGCGGCCAGTCCAAGAGGCACAGCTTGCTCCCCGAGGGCAGGGCGGTTTCCTTA
AAACAAAAGTGAACATTGCTCCCCTCAAAGCTTGCTGCAAATGCTGTCTATTGAATTTTT
GAACCTTAAATATTATGGTGTTATTTTTGTAATCATTTTATTGGAGGCTTGTATAACTCT
TACCACAATCCATCCATCCATCCATTGTGTCAAGCATATTTGTACATTTGTTGCCATCAT
CATGTTCAAAGCATTTTCTTTCTACTTGAGCCCTTGGTATCAGTTCCTCATCTTTTCCCC
TCCCTCCCTTATGAACCCTTGATAATTTATAAAATATTACTACTTTTTCATGTCATATAT
TGACCAATATCTCCCATCACCCACTTTTCTGTTATCCATCCCCCTGGGGTGGGGTTATAG
GTAGATCACTGAGATCGATTCACCCTTTCTCCCCAATTTCCCCGTACCCTCCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTCAACCTGTGTGATCCCACATGGAAGAAGCACACCAGCCTAT
GCAACCACGAAATGTCAAAGGGATCAGGTATAAGGCATCATCAGAACAAAAAATCTTACC
ATAGTGAATGATGGGGGGAGTGCGGAATGGAGATCCAAAGCCCATTAGTAGGCCACTGGA
GATTCCCTTGCAGAGGGGTCCCGGGGAGGAGATGAGCCAGTCACGGTGCGATGTAACAAG
GATGAGAAATACAACTTTCCTCTAGTTCCTAAATGTTTCTCCCCGCTCCCACTACCATGA
CTCGAAATTGACCTTGCAAATCTAGCTAGACCAGAGGATGTACTCTGGTACAGATAGGAA
CTGAAAATACAGGGAATCCAGGGCAGATGAGCCCTACAGGACCAGTGGTGTGAGTGGTGA
AACAGAGAGGGTAAAGGGAGAATGGGTAGGAAAGAGGGAACCGATTACAAAGAACTATAT
GTGACCTCCTCCCTGGGGGACAGACAACCAAAAAGTGGGTGAAGGGAGACATCAGACAGG
GCAAGATATGACAAAATACCAATTTATAAACTATCAAGGGCTCATGAAGGAGGGGGGGAG
CGGGGAAGGAGGGGAAAAATGAGGACCTTATGCCAGGGGTTTAAGTGGAGAGAAAATGTT
TTGAGAATGATGTACAAATGCGCTTTACACAATTGATGTGTGTATGGATTGCGATAACAG
TTGTATGAGCCCCTAATAAAATGTTTTTTTAAAAAAATTAGGTGCCTTGGCTGATATTCA
GGTCGGCTTATACTTGAGGATATATGGTATCTCTTTGCCCTCCAATCAAACTGTGACCTT
ATTAATCCCACATGCTCCTATTGGCCAGGTTGGCACTATAAACCTCTATCTATCACAGTG
CACCCCTTGCCAACTTGGCAACTGTACACAATAATGTTGATTAAATCACTCTTACACCTA
ACATCATTCAATAAGCACATATAAGAAGATAAACTGACAATCACAAACCTCACTTTTGCA
ATTGATCATGTGGTTGTAACTGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATAAGGAACTCCCCAGGAGACCATAGGTGCAGAC
TGGGAGAAGGAAGGTACGTGACAGGAGTGGAGACTGTGGGAATTTGGGACACTTCTTCAT
GCAGCTTACTTGTCCCTTCAGGTCCTGCTCTAGCCCCATCTCGTACATACCACTTCCATT
TTACAGTAGAGTGTTGCTGTGCACGTACAACTTTATGACTCTGTGGGTCAGACAATACCC
AGTTCATGATGGGCAGCTCAGGCCTCATGGTGACCTGGTGGCCCATGGTGAGGCATTTTG
TCTCGATTAAGACCCAGTAACAGGCCAACAGCTGTTTTCAAATGGAAGTCGTTGTCTGCA
GAGGATGGCAGGACTTTACTCTAAAGTCCCAAGGGTCTGTGCTGCAATTCACCAATAGGG
GTCTGCCAAAGACTCCACACTGCATCTCTATCTGCAACTGACACCTCTAGCACCATCGGG
TCAGCTGGATCATATGGCCCCAGTGGCAAAGCAGCTTGCATGGCAGCCTGAACCTGTTGC
AGAGCCTTTTCTTGTTCTGGGCCCCACTCAAAACTGGAGGTCTCTCATGTCACTTGAAAA
ATAGGTCAAAGTAGAAAAATAGGTCAAAGTAGAACACCCAAGTGAGGGATATGTTGCCTC
CACAATCTGAAGAGGCCTGCTAGGCGTTGTACCTCCTGTTTAGTTGTGGGGGGTGGGGGG
GTGCAGATGCAATAGCTTATTCTTCACGTTAGTAGGAATGTCTCGACATGCCCCACACAC
TAGACCTTAGAAATGTTACTGAGCTGGAAGGAGTACTTGAATCTTCATTGGGTTGATTTC
CCAAACCCTTGAATGCAGACATTGTCCCAATAAATAAACCCTAACCTAGTGTGTCTATAA
ATTTCTTAATGTAGTGCTTGCCTAAAATAACAGCCATCAAAATGGAACCCAGAAAACGAT
AACAAAAGGTAGGGTGACACAAGAGAAGTGCAAACAACGCTGAGGGAGTGCCCAACCCAG
AGGCTCACACCTGGCTGGTAGCTGCATGTGAGCATGAGCAGCCAAGGCCCTCCCAGCCTC
CGGGTGATGTGCTGCCCCAGCACTGGGCTAGGCAGAATTGGGCAGTGCGAAGTGCAAGGG
CTCAGACAGGTGATTGGAGCACGGGGAGCAGGAGCTTGGCAGAGGCGAGCACCCCCACAC
AGTAGGGCATTTACAAGTGAAGTGGCCTGCCTTGCAGCTGTTGCTCTGGAAGTGAGCACG
GGGAGGGTGAGAATGGAAATTTGGAAAGGGCTTCCTCAGCCAAGTTGACATTAGCCCAGC
ACTGAGGAGTGCCGATCAATCCGCATCGTCCGTTCCCTTCCACTTCCTTCTGCATGGGTA
AAGCGAAGCGTTTTTCTCTCTTGTGCAGCTCCGAGGCTGAGAATGGTGTGGAGGAGAGAA
AGAAGGTCTGCAGGTCACCCACAGCCCTGTCCCCCACCCTCTCTGTCGAGGCTGAGACCC
AGGACCAGAGAAGACTCGTCAGCCAGCGGTAAGTCCTCTGTCCTCTGAGTATCTTCCTCC
TGTCTGCCTATTGGAGGAGTTGCTGGGGACAGTTGTTTTCCGTTTCATGGTTGTTGCAAG
GAGCATGTAGTTACTATAGACAAACAACGCCCCCACCCCAAAGATGGGGAGAGTCTGACA
CTGCTAATCTGTGCTGCTGTGGAGAATATACAGTGCAAGAGTATACACAGCAGCCCCATT
GTTTCGGCGCGTAGAATCCAGGGGCACTGATTATATTCTGGGAGTTTGCCACCATCCTCA
CCCCCTTTTCCTGAGCTGTTCCTCCCCCAGGAACGTGCGCTCACTGTCCCCTAAGGTTTC
TGTCTAATCTCCTCTGTGCTGCTGCTGTCTCTGTGATCCTGATAGACACTCTGCAGATGT
ATGCTCAGCAGACTTAAAAAAAAAAAACTAGTCAAGTAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGTGTGTAT
ACCTCCTGGTAGCTGCCTGCCCGATTCCTGTCCCTGGTGTGGTGTGAGGGATGATGGGCT
ACTGTGGATATAGGGCGGGGAGCGGAGGGGGTTGGGAGGGACTTATTACCATAATCCTCT
TGCTGTCAGAGGCACCATGACATGCCTTCTTCCCTGTGGAAAAGAGAAGTAGGGATATAA
AGTTGCTTTAGAAGAAAGTGGTTAACTAACTCATTCACTGCCACTGAGTAGATTCGGACT
CATTGAGACTCTATAGAACAGAGAACTTCCCCGGTAGGTTTTTGAAGCTGTAAATCTTAG
GAGCAGAAAGTCTCATCTTTCTCTAGGGAAGCAACTGGTGGATTCAAACTGCTGACCTTC
AGAACGCCTTTATTTATTTTACTCGTTTTATTAGGGGCTCATACAACTCCTATCACAATC
CATACATACATCAATTGTTCATTCATTGCCCTCATTATTCTCAAAACATTTCCTCTCCAC
TTAAGCCCCCGGCATTAGGTCCTCATTTTTCCCCTCCCTACCCGTTCCCCCTCCCTCATG
AGCCCATTTCTCCAAGAGTTGTTATCTGTCAGCATCCTTGCCTCACTCACTAGTTGATTC
TCCCCGCAGAAGCACAAAGCATGCCATTTCTTGAATAATCCACCACTGTGAACTGGTTAC
AGCAGGCGCTTTAAAAAACACGGTTGGTTTTCCCCAAGCCCAGGCTCCGGATGAGAAGAA
TGCACTTATCGGGGGCGTGTTCATGCAGAGTGAGAGCCGTGCCGCCCCGACGGGCCTTGG
GCTTGGTGTAATGATCAGTTGTCCTGTCTTGAAATCCGTCTTTTTAGTAAAGGGCCCTGC
AATTTCATGTTGCACTGCACCCCTGGTCCTGCTCACAGGCGCCCAGAAGTCTGTCTATAG
AAAAGAGTGCCTGTGACAAGCACTGAAATTGCCCCCCTGGGGGAGCCTAACAGAGGGAAT
GAGAGCCCAAGGGCAATCTCCAAGTGGCATTTCCCCCACTCCTGATTTCAAGATGAATAG
GTATTGATAGTGGCAACTCCTCAACTATTTTAAAAAAAAAAAAAGTTTTTTAAACACCCC
ATCCCCCTCTGGCTACCTCGGTCAGGCATCTTTCCCATTTTTTTCGGCACCTAAAAATTC
ATTCGAGTCCTGATGTCCCCTTTGAATGGGCACCTGAGGGTCAAGTGGCCCCTGCCCCCT
GTCCTCCCTTTCTGTACCACACTGTCTTTCCATCCTTGAGGAAAGAAGCTGGACAGGACC
TGGTTAAACAGAAACTGCTCTGTGGACGCCCTTCCAGGGGCTCCCAGGGAGCCTGCCGTA
CCTGCATCCCATGTAGGAAGTGAGGAGAACCCCAGAGGAAACAGAGAAATCAATGCTATC
TGAATATGCGCCCCACTCAGAGGTCAGGGCTATGCAGGCAGGCCCCTGATAGCGCGCTGC
TTTTGAAATTGCCCGTAGTAAATCCACCACACTTCGGTTTGGCCGTGTTGTCAGGAGAGA
GCAATCCCTGGAGAAGGACAGTGTGCTTCACAAAGTAGAGGGGAGGCGGGGAGGGAGAGG
AAGACCCCTCAGCAGGACGGATGGACAGCGGCTGCAACAATGGGCTCAAAATCAGAAAAC
TTGTGAGGAGGTTGCAGGCCAAGAAGTGGGTTGTTCTGTTTCTACACAGGGCCGTCGTGG
GTCAGAACAGGCTCGGTGGCAACAAGGACGACCGCTCCACCACCTAACTGCCCGTGGCTT
TTCACAAGGCGGGACCACTTGCCCAGGAATTCCTGCCGTGTGCATTCAGTAACTTGACTC
AGCACTGGGGCTAAATTCCAAGCAGCAAATTGTATAAAGAAATACTTGGATATGTGTAAA
GACACTTTGATTTTTAAGCAGGGGACGAACGTCACTCGTATTTTCTTTAAAATAATAAAA
AATAAGTGAGGCCCTAGCGTTCTGAAAGAATGGATACCTGTGGATNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTGTCAGGGCTGGGGTATGAATCTGCGTGGTTCTATGGACCATTCTCTT
CCCTTGCCCTCCTGCTAGCCTTACTGTCTACATGTCTTCTCCGAACTTCTAGGATTGCCC
TGTTTGTTAAAGTACACAATGCCTTTTTTATTATTTTATTTTAACATTTGATTTGTGCCC
AGGCTCCTTGGACAGAGACTGCCTTGTGTGCCCCAAGGCATTTCAACACAATGGCCTACT
CAAACTAATCCTTGTTAAATATTAATAGGATTCTGAAACAAAATTAGCCTTTGATGGAGC
TCTAGCTGCAATTCTGTTTCATAATTTGCGCCTAGGACGCCTCTTTACACTGATTAACAT
ACTTTTGAAATGATGTAATTTCTTTCACGACTCAGATTTTCTTTCTCCCTCCACAATTTG
CCGTTTTTTGCAGTGTGAGACGGGCCGCTGCAATCAGCCCAGCCTCTTAAGACATGTACT
ATGAGAACTGCCAGTAGAATATTTTGAAGGATCCTTGATGTCCAGAAGAGAGCAATGAAC
TCCCAGTCTTCTTGGGTTCTGCTATCATGATTCAGATGGTTAAAAATAGGAATGACGTAG
CGCACACACCATCCCGTCTTACAGCGTCCCTGCGCTGTGTCTCCTCAGGTCCAAATCCAG
CTTCGATGGCGCGTCATTGCCAGGAGAGAAGAACGACTGTAAAACAGAAAGCAAAACTGA
CGCCAAGACTGAAAGGAAAAAGTCTTCGTCCTCCAGTCAGGTAACTTGGGAATGGAAGGT
GCACTGTGTCCGAGGATGACAGAAGCACTGAGGCCAGTGGACAGAAAGAACCAAGCAGGC
AGCGTCCTGCTGGTCAGGACCAGTCCAGGATGCAGTTCCTCCAGTCAGCCTTTCATCAAT
CTTACATTTCATAAGCGACCTTTCCACACCTATTGGGACAGTGAGTTCTTAGACTCTGAT
CCTGAACTCTGGCAAGTACCCAGAGAGCAGGGACCAAACCAGAGTCTTGTACTGATCTAA
TAATTAACCGGGGCCCAGAGCCCCGGTGGCGTAGTGGGTAACACGCCGGAGGTCCACACC
TGGAAACCACTAGACGAGACTTTCTACTCCCGTAAAGAGTTAGGCTCCGAAGCTATGGCC
TTTCTGGTTGTGAACTGGGAGTGTTTCAGCTTCTGGAGGCCACTCTCCAATTCTGGCCCC
ATGGCCCCTGTATCTTAGCAATGTAAAAAACACCTGACTCACATCAAATTCCACTCACAC
TTTCCATCCACCTGACTCCTCTTCTGCCTCCAGCTGGAGCAAAATCCTCTGCTCCTAAAA
GGCTGGAGCCCGGGTGGCGTAGGGGTTGCATGTTTGGCAGTTCGAACCCAACAGCAAGCA
ACCTTAGGAACCTCCCAGGAGAAAGATGAGGCGTCCCACTCCCATGAAGAGTTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACGTCAGGTTCACAGGGTTATTGAGAGGA
CAATGTTTGTGAAAGCATTTTTCATAAACTGTAAATTTCCATCTGTGTATCTGTTGTCCG
TGTGGAAAGAGATGCCTTAACTGAGAAGTGATGGCACCCTTTCCGAGGCGTGGGTCTTTT
ACTGCCCTGCAGAGTTCATCTTTGGTGGGAAACCTTTCTGGCCTTCCTGAGCATCTCCCT
CTAAGGAAATGGCATCACAGTAGCCGTCGTCATTACCAGATGTAGTCCCAGAATATCGGT
CCTTTAGACGTGTGCTCTCTTATAAGCCTTACAGCTGTGAAGCAAGCATTGTTTTTGCCC
TCTCACACACAACGAGGAAACTGAGTTACGTGGCTGGGCCATGATTGCACATCAAGTAAG
AGATGCGCATTCTCCCTCACCATCATCAAGTCCAGGCCAACTCAAAGGGAGCCTATAGGG
CAGGGTAGAACTGCCCCCGTGGGTTTCCGAGACTGTACAGGCTTCTTCTTTTTCCCAGTA
AGAGGTACAACCAAGCCTTAAACTCAGATTTGTCCAAGTGTGAAGTTTTAATGACTGTAC
TCCTCTGCCTCCCTTGGGTCTTTGCTGCCCTGGGAACTACTCCCTGCCCTGTGGGACTAC
CTTGAATTTGAGCTGGTTTCCTATCAGGGACATTCTTGTTCAGCCCTGGGCCTCCACCAG
CTCTGTTGTCCGTGTAGCTGGATGTCCAATCATCACCTCCCCAGTCAAACTGGAGGATGC
ACCGCCCCCTCTCTGCCCTGCCTTCCACTGGTTTCCAGGAGTCCTTGGAGACTGTGTTCG
GAGAGAAGGGATTCCTGAGTATACTATTAAGGGGGAACGGGGAAAGTTGGTGATTCGAGT
TGAAATGAACATTTGGGATGTTTCAGAAACAAGTGAGAACAGTGATGCCTGTATTTTGTT
CTCCTTGTAGTACAAGGCCAATATGCACTTTCACAAGTTGTTTCTTGACGTCCCCACTGA
GGAACCACTGAGGCAAAGTAAGTTCTGACCTTTTTGACTTCTTTTCAGCTGCATGGTTTC
AAAGGTGCTATCTGCTTTGTGGGGAGAAGGAGGGCACAGGATTGAGTGACCCAGGAGAAC
AAGTTGCTGATGTCAACATAACGCCCTTTCACACAGTGCTCGCTCAGAGCATCAAGCTAG
AGTAGATGAGAAGGGCTGTGGATGAGAAACTCCATAGGAGCTGGAATAATTTAAGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNACAGAGAAGACTCCCCATCGCATTTCCAAATATTTCTGGAAACCGG
CTGCTACGTCTTTCTCTCATGGAATGGCTTGCTGGGACGTTGAACTACCAACTTAAGCCA
AATAGTTCACGTAGCTCCTGGACCACCTAGAAGAAGACTAAAAGGGAACACGAATGTCAG
TGGACAGACATGTGTTGGGTACCTGCAATCTCAAGGTATAGTGCTCAGACCCAAACACCA
GTTAAGCACCTACTCTGCCCTGCAGTAGTTCAGCAAGGGGCCTCTCTCAGCATCTTCAGA
GTTACTGAATTCCTGCCCTGCCCTCCAAAGAGGACGGTGTGCTCCTCCCCCGCTGTGACC
ACGTATTTCATAAGGAGCCATTAGGGAGAATCTCAGGAAGAGAGGGGCAGGGGTGAAACC
TCTTCCTAAAGAGAGGATATTTTTGGAAACGCCATTCTTGATCTTTGCCCTAGAATGATA
GACTTGCCTTTCCGTTTTGATTTTCCTAGGAAGTTGTTAAGATTTTGAATTAAAGAGCAA
ACTAGTCTTGGCTGCTCTCATCCACTAAAGAAGACTGAAGGGGGGGAGAGCAGTGCACTG
GCTCGCCCCATCTCTGTATGTGAACGTTTTCATTTAGTGGAAATTTTAAATTATGCCATA
CCTGTCTATGTTTCCCAGGCTTTACCTGTGCTCTACAGAAAGAAATACTGTACCAAGGCA
AGCTCTTTGTATCTGAAAACTGGATTTGTTTTCATTCGAAAGTCTTTGGAAAAGATACGA
AGGTGGGTATCAAGTTTGAAAACAAACTAACACTGACGAAATATTAACTTTTTTTCCCCT
GTAAGTTTGAAATTTTTAAACAAACTAAATTATTCAGATTGTAGATATTGTTTTTAAGTT
CTGTGTATACTAGAGTATACGCCCAAGTTTTTCAGCACATTTTTATCCAGTTTTTTGTGG
GTAAAATTAGGTGCCCTCGGCTTGATGTTCGGGGTGGGCTTATACCTTGAGTATACACAG
GTCATTTGGGCTTTCCTCCAGGAGGTTTTGGGTTTTTGATTGGTTTTGTGAAAGCGGTGG
TCTGGGGGACATTGTTTATATATTAATTGCAATTTCTGCCTTATTGGGTTGCTGCTCTGT
TCTCCTGGGGGGGAGTCTGCAAAACTGTCGAATTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATACGC
CAAGTTTATCAGCACATTTTTATCCAGTTTATGTGGTAAAATTAGATGCCTCGGCTGATG
TTCGGGGTGGCTTATACTTGAGTATACACAGTGCATTGGGCTTTCTCCAGGAGGTTTGGT
TTTGTTTTGTTTGTGAATGCGGTGGTCATGGGGACTATGTTATAGATAAATGCAATTCAT
CATTATAGTTTCATGCCGGTTCCCTGTGTGGTAGTCGCAAACGTGAACTCAACTCTCACT
ACCATCGAGTCGATTCTGACGGATTCTAAATGCCTCCAGGTGGCACTAATCCACCCCACC
CCACCCCCAGCGAACATCACGCCCTCACGCATCCCTCCTCCACATATACCTTTCCACAGC
CACAGTCCTCATTACTTTACCCAGCTGTCACCAGAGGACATTTTAAGTGGTTTACCTGGA
GAAGGGGCTATAATGTAAGTCGAAGACATACAGGAAAACCAAAACTATTTTTTGAAGAAA
TATTAACTTTTTTCCCCTGTCTGTTTGAAATGAGCTTGTACCACTGAAGACTCCAAGCCC
ACTTCAGTACTCGTATAACTTCCCTCCTGTTTCAGCCACTCAGACCAATACTTCGGTCCA
GGAGGTGAGGGATCTGGAGGGTTTTATTAAGGTGGTGAGCCTTCACAGTCTTTGTCTGTT
TGTTTGTTTTCTAATTTATAGAAACACATTCCATATAGTTACAGCGCCCATCTCAATGAA
TAAAATCCTTAGTCATACCTCATTAAACCCTCCCACCAATGTCGTGCACTTGCTTTTTCC
TCCCTCTACACGTTCCTATAGCTCCCCTCTCCCTGTTCCCGCCCCCATCCCTGGCCTCCT
CATTGTCCTCAAAGACTTATCTTTTGGTGTAAAACCCACATTTCTTTTACTCTATTTTCC
TTATAACGGATACATGTAAATATTTATAATAAACATTTCTCTTTATAAGATTGAATAACT
TTGCTAAGATAATGATCCCCTGTTTTGTCCGTGCCTGGTGGTGTTTCACAGAGCTGTCAC
TGTTTTTTATTGATGCGTTATATTCCGCTGCATGAAGGTCCTAGAGTTCCTTTATCCATT
CCTCTGGAATCAGGGTTTTTGGTTGTGTTGATGTTTTGCTATCATGGAAATTGTTCCAGT
AAACATAGGTGTGCATGTGTGAGAATAATAACTTCATCGTGCAAGTTAACATTAGAGGCA
TGCAGGGAAATAGGCCTATGGCTAAGCACTTAAGAACACTGGCACAAAGAGTACTTTGTA
CTAGCGCAAAGTGAGCCGCACTAGCGCATAGAAGGCCTAGTCTTCCGTAGTCACAGACCT
GCAATCCCGAGGAGACTCTGCTATGACATCTATTCATTGAAAACAGCGTTGCAGGAAGGG
CAGTGCATGAAGTGCTGAGCAATAGGAAGAACCTAAGGGAATTGATCGCCTTCCCTAGAC
ACCACCTCCTAAAATGAGTTCCTGTAGATACTGGTATAGAGGAAAAAAGATGGCTCCACC
CACTGATATCCTGGCTCATACAGGTCACAGAAAAAGCCTGAAAAGGCCCCTGCTTGGGGT
CCCCATGGACAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAAGCACCCTTACCAAATATTAAA
GGGAAATTCTTGATTTCTTTTAGGGTTGAAAAATCAGATTGGGTGTCATTCTTTTAAATC
AAGCCAGGTTCCTTTGTATTATTTCTCTTAAAAGCTTATTTGGATCCCACAGTTAATGTT
TGAATCCAGTAACTGTGAAGCAATTATGAATACAGTATTGTTTCACAGTTCTCGACTTCT
ACATATAAAGTTGGTCCAAAGAGTGGAGAGGAGGGCTGAATAGTACTGATCTCTAGTTTA
TCGTGAAGATAACTCTCAGGGATTCAAAGAGCGATTACTCCTCAGACCAGAGCAGCAGGG
GTAAAGATATTCATGAACAAATAATTAGTCTTGTGAAGAGATGAATAATCTACAAAAGTA
AGAGACTGAAAAATCTAAGGACAAAATTGAGAAGACTTATAATTCAGATCTGTTACAGTA
TTTTCTCACTGTCAACTGATGTAAATTAAACATAATCCACTTCGAACTGAAAGCACTTAA
AATTGTTCTAGGAAAAAGGAATTTCTAAGCAGCCTATCTCTGGAAAATATTAATAAAATG
TAGCTTTAATTCAATTAGGATCTTTTGCCCAGCTGTATTTCCAAATGTTTAAAAAGTTAG
CATATACATATATTACATCGAGGATCAAACTGAAAAGTGACTTACTCTTCACTACATGTC
TATTGTCTACTTATAATCTTTTCATTCATGAAGCAATTCATTGAGAACACCTTCTTCAGG
GTGTTCCATGTCTTGGATTATGAGGGGGGAAAAGTCCTAATTTACGACCCCTTGTCACTG
TGTTTTGTGTTCCTCCTTAGAAACAGCCGGAGACTCATTGTATAGCTTCTGTTTTGAGTG
TCTTACGTTTTTCATGGGTTTCCTTCCTCACCCCCCATTTATTGCCTCTCACCCTATAAC
ATTGTTGTGGGTGTTGTTCTCTGACAAAGTAGTTTTTGTTTTGTTTTGCTTTTGTAATGT
CTACCCTGGATTAGTATCTCATTATTCCTGCTATCCCTGATAAGAACTTTGAGATAGTAG
AACAATCCCATCTAATTAGCCCAAGTGTTAATGCAAAATTCAACATTAAAAGCTCGTTTT
TCATAAGACCCAAAGCAATCATATCAATGTGAACAGGGAGCAGGGGGCAGTGTGGAGATC
CAAAGCCCATCTGTAGACAATTGGACATCCCCTCACAGAAGGGTCACAAGAAAGGGATGA
GTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACAGAAGGGTCACAA
GAAAGGGATGAGTCAGCCAGGGTGCAGCATACTTACAAATGAAACACACATCCCTCTAGT
TCTTTAATGCTTCCTCCCCCCACTATCATGACCCAGTCTACCTTACAAATCTGGCTAGAC
CAGAGCATGTACACTTGTACAGATCACAGCTCTCAACACACAGAATCCAGGACAGATAAA
CCCCTCAGGAGCAGTAATGGAGTAGTGATACCATGGGGTACACGGAAGGTGGGGGGAGAA
AAGGGGAGGAAAGGGTAGCTGATCGCAATGACCCACATATAACACCCCCCTCTCCCAGGG
TTAGGAACAAGAGAAACATGGGTCAAAGGAGACAGTGGACGGTGTAAGATATGAAAATAA
TAACAGTTTATCATTTATCTAGGGTTCATGAGGGTGGGAGAAGGAGGGAATAAAGTGAGG
AGCTGATACCAAGGGCACGAGTAGAAAGAAAATGTTTTGAAAATGATGATGGCCACATGT
GTACAAACGTACTCAATACAATGGATGTGCAGATTGTTATAAGGGCTGTAGGAGCCCCCA
ATAAAATTATTTTTAAAATAAAATAAATGAATGAATGAATTAAGAAACCCGGGATTGATG
AGCCTATAGGATAGCAAGTGTCTCAGGGTTCCTGGGGACGGGGTTAAAGTGAGGATGGGG
TCATAAAGGGGAGCTGATATCAAGTTCAAGAAGGAAGAGAATATTTTGAAACTGACTGTG
GTAGCAATTATACAATACTTCTTGATGTAATGGAACTATGGAATAAAATATCTGAATTAG
CTCAAAATAAAATGGTTTTGAAAAAAATATTTTAAAAAGAATTGTGGAAGAAAACTCCAC
GAGGTGGGGAAAAAAACCTTCATTTTTCATCTGCCAATCTGCACTGTGACTGTGGAAGAC
CCTTTTCTTCTTTGGGGATGTTGATCTATTTCAGAATGTGTGCAACATTTGCCCAAAAAC
AAAGTCTCAAAGGCAGGAAGGGACAGAAGAGAAGTGCACATGGAAACAGAGACAGGACGG
AGGAAGAGGGCTGTCACACTGAGAGATGTCAAGTAATGGCGTGGAACAAAATGTGGACCA
ATTGTTAAATGGGAAACTAATTTGCTCTTTGAACTTCTCACCCAAACCATAAGAAAAATT
TTTTTCAAGTATCAAGAACTTCCATTATGTTTTGTGATATCTGATATACTCTTGTAACGT
ATTATATTGCGAAGAATCCACAATAGGAACAAGTAAGCTCAAATTCTATCTGCATAACTC
CTTCTATGTATGACCTTCAGCATAGTATGTACCTCTCTAAACAAATTTCCTTCTATGCCT
ACTTCATCAGATTGCCATCATTGAAATTACATTCTCATCTGGTAAATGAGAACTGGTAAT
GGGAGATGCTGCAGTTATCATTTTTGCTATTCATTATTTGAACCTGAAAAGAACTTAGCA
GTTCTTTTATTTCATGCATAATTATATGAAACACATGAAGAAATGAATGAAATTTTAATG
AGTGCCAGGCATTTTCCACAGAACATTTCAGTCGGCACACAATCACGGAAAGTAGATAAA
GTTAACGCTATTTCACAAACCGGAAAGCTGAGGCCTCAAAACATCCATGCCGTCTAGTCA
TAGCAACCCTGAACACAGAGCACAACTGCGCACATGGGTTCCCGAGGCTGTCAATCTTTA
CAGGAGTAGAAATCCTCTCATTTCTCTTGCAGAGCAGCTCGTGGGTTTGAACTTGGTGAC
CTTGCAGGTAGCAGTCCAATACCTAACCCACTATGCACCAGGGTCTCTTAAAATATAAGA
CCAGACCCAATATCATCAAGTCAGTTCTGACTCATAACGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNAGCTCAGTGGGAGGAGCTCAGTGACACACCCCCATGCACTCTGTAAGA
CTTAGGTATTTTTTGTGGAAACCGAAGCACTTTCGGCGAGCTTGGATTAGTTATCTATCT
TCATTCAAATTAAAGTGTAACACGAGAACTTAAAATACATTTCTATGAAACTGAACCAGA
GCTGACTCGATGATTCTGTTTCAGATCTCCATTCCGGCTTTCTCAGTCACCCTAATAAAG
AAAACCAAAACTGCCCTTCTGGTGCCAAATGCCCTGATTATAGCGACAGTCACTGACAGG
GTGAGTACCCGCAGAGCAAGACTGCCCTGGCTTTGTTCTCCTCCTCTGTGCCTCGTGGCC
TCTTGCCAAGGACGAACCCTAAACCATCAATGTCGTCAGCATCCCTAACAGTGAATTGGG
AAATTCTATAATAATGGAATACCCCAGTTAGTTGGCCTAGTAATTGTTTAGTGCCTCTGT
TCTACCTCATCGTTTGTTGCATAATGCCTATGTTTTTTTACTTATTTATTAAAAGGGATA
GGAATTATTAAGAAAATTGAAGTTAAACATGGCTAAGCAATTTGCCCAATGTCATCAAGT
TAGTTGGCATTCAAGCCAAAATTTGCAACCAGGTCTGTCTGATACCAAACCCCAAGATGT
TACCCCTCTGAAAGGCATTACTTGCTTTTACATTACATAGAGTTTTCTCACTGGCGAATG
AGAGGGACGATGACAAACTAAAGGAAAACCAAAAAACAAACCCACTGCGGTCGTCTGACT
CAGAGGACCCTATCCCACCCCACCCCCGGGAGCCGATTCTGACTCCTGGGACCCCGTCTA
CATCCCGTTTCTGTGGCTGTAAGTCTTTCTGAGAGAAGATCCCACCATTTTCACTCTTTG
ATCAGCTGGTGGGTTTGAACTGTCTCCCTTGGGGTAAGCGGAATGAGCACGCAAATTAAA
GAATGGACTGTCACTCATAAGTGCGCTCAACATCTCAGTGGACGTTTTCCTGCGTGAGTT
AGACTTTGCCCAGTGGCCAGCCGGTGAATCCATCAAACTGACACAGCTGGCTCCTGGAAA
GGGGAAAGGAGGGCTCTGTGGTCAAGGCCTCCCTGCGGTGATTCTGGAAAGAGCTTTCGA
AGATATAGTCTGACTTTTTAGGCTGACTCTGCGCTTCAAAGCTCTGAAAACAAAGAAACC
CAAACCGCAAAATGTTAAATACGATGTGGTTATTGTAGTTGTAAAACATGACTCCTTCAA
GACTTAATGGTGTTTTTAAAATGCATTGCCTTTTTCTCTTACAATAAGTATAACATGTTA
TAACTATTTGGAGGGCGGGGTGGAAGAATAGTCTGTGTCCTTTGAAAATGTAGAAATACA
GATAGACCTTGCTAAACTCTGAGCCTCTCTTACTGGCATGTCTCGGGGAGTAACTCTAAC
TAATCACTTCTGTGTTGCTTTTCAGTACATGTTTGTCTCCTTACTCTCCCGGGATTCGAC
TTACAAACTACTGAAGTCTGTGTGTGGGCACTTAGATGTGAGTATGACTTCTCCGAGCCT
CAGTTACTGTATCTCTTCGTATTTTTTGTGATTTCGTAGTTCATCGGATTTACTTTTTCA
CTTTATCCCACGAATTGCAGATTACAAGTGTCGGTAACAGCCCCAATCCCTCTTCTGCTG
AGAACAGTTTCCGGGCAGACCGCCCTTCATCTCTGCCTCTGGTGAGTTGCCTCCCTAACT
ATAGATGCAGAGAAATTTCACTTCTCCATACTTACAGAATGCAGGAGGAATGTCGACACA
CATACCACACACACACACACACACACACATAGACACAAAGAAAAAACCTCAACGCATTGC
CTTCGAGTCAGCTTCCCACTGGTGATGATTGTAAGGGGATATTCTTCAGAGGGAGGAAGG
TAGCACTATGCTACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACTGACCGAAGACAAACACTG
TATGATACGTATATACAGTGGAATACTGTTCGTCCGTAAAAGGAATGAAATACACGCTAC
AACATAGATGAACGTTGGAGGCATTCAGAGTAAAAACAGAACTAGACTCCAAACGCCGTC
TTCTTGGCGTGTATGGACATTTCTATAGAATGTCCAAAACAGGCGAATCCATGAGGACAG
AAAGGAGATGGGTGCTTGTCAGGCCTGGGAACGGGGAGAAGCGGGGACTGCTGGTGGGAC
GGAGCTTCTTTCTGGGATAAGGAAATGTTCCAGAATCAGCGAGTCGTGAAGAGTGTAAGG
CATTGTGAATATGCTAAATATCATTGAATCATATACTTTAAAATGGCTTCAATGGTGAGT
CTGCTTTCTTGCTTTTTAAATCTACCTTGAAATCCTAGTTTCACCTCTGGTCTCCGCTCA
GCTGGTGACGTCTCTCTAGCAAGCCCGGCACTGCTCTGCTTCTTCACCCAGGAAAACCCC
CACCCCAGTAGAGCTACGAGGATGACATGCAATCATGTGTGTCATGGTCTGCATGCTGCC
TTATAATGTGACGGGCACTTAATCAATTCTTATTATATGGAAGAGACTTTAATTGCTCAA
GTTTCCTTCCCCTATAAATTCTTGACTGAAATTGAAATGACGGAACACCAGCTAGTTCAC
GGGGAAAGTGAGTAATCTGTGCACAGGATGATCCTCTTCGTTTGGAAGGCAAGGGAAGTG
TGAAGAGTTCAGTCTGGCAGCACCTTCACCGGGGCGCTGTCATGACACTGCTGGGTCTCC
TTAGTTCTCAAGCAGTTTGCGAACCAGCAGCCTGCAAAGGGAAGCCTCTCTGCCTTTCCC
CCCACTCCTCAAGCTCCTCCTACTAAGTAAATATGATAATACCGACTCTATTCGACTTTC
TGTTGATCTTGTTTGAGGGAAGAAAAGGGTTAAAACTTTCCAAGTGTAATTTGCTAGTCA
TTTTTCCCATTCTGTTGACAATTTTCATGAAAACTATCCTCCTTTTTAGGAATACCTGTC
TCTCTGCCTGCGTATCCAAAGTTGCATTAAGAGGTTTCTGTCCACTCTTTCCTGGGATTG
CCAGTAGCAGCATTTTCTCATTCAAAGTGCTAATGAGGTGTCTCTAGCTGTTCAACGGAA
ACATCATTCACCGACATTCCAATTTTTTCAATTGTTCTTTTAAACAAATTGCTCAGCATT
GACAAAAGTCTCCCTGCCCAGAAAGTCTGACGTTCCGTCTACACACCTCTAAGGAGGCCT
GTGAGAACCGGGACTCGGTAGGAGTGCCTTGTTTTTCCGGATGTCATTGGTTTCCATTTT
TGATAGGGGACAATCTTATGACTTTTCTTTTTTTTAAAAGTTTTATTGACATGTAATTCG
CATACCAGACAATTAAACGGCTTAAATATACTTTAAAAAATGTGTACAATCATCACCACA
ATCAATTTTAGAACATTTTCTTCATTCTTATATTCATTACTATTAGCTCCCCATTACCTG
CCTACCTTCCCTGCCATAACCCTAAGAAACTATTAATCTAGTTATTGTCTTTATAGATTT
ACCTCTCCTGGATTCAGATAGAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTAGTGCTTTAACAGCAGACCGAGGCCCTGCCCTGCCTGCGCCATCCTCACAGTGTTG
TTATGTTGGGGCCATTGTTGCGACATTATGTCCTTCCACCTCACTGAGTTCTTCTTTTCC
ACTGATGCTCTACTGTACCAAGCAGGTCCTTTTCCAGGGGCTGGGCTCTTCGGATACCAT
GTCTAACAAGCCCACTCGTATAGGATATGTCTTTCCTGCACCTTATGGGTCCGATGCTCT
CAGTGGAAACGCCGGAGATTCCAGCAGTCTGACTGCTTACTGTGCGATCATTGGCCTCTT
TTCGTTTCACTATCTCTCTTCAGGATTTCAATGATGAATTCTCAGATTTGGATGGAGTGT
TTCAACAAAGAAGGAAGGACATAGAAGGATACAGCAGTTCTGGCTCTCAGACTCCTGAAT
CGGAGAACTCTCGAGGTCTGGAAAACATTGTATTTTGACTAAAACTTAAATCTTCCACAA
AACATCCCCAACCTATCCCTTTTAAAGCAAATGAACAGAACAAACAAAAAGCACTTATCT
AAGTAGTTACCATTTGGGAAAGAAAACTGGAGACAATAGTTTGAATGCTCAAGGGTAAGG
ATGTACTTATATGGTGAAAATCTATTTCTCTTTATATACATTTAACAGCTGTCTCTTAAA
TATTAAAGTGGTTGGGAGAAATATATATTTATATATAAATAATATATATATTTCCTTACC
TTTTATGTAAGTAATGGGATTAATTGTTATAGTTAAATCACCCCTGTAAATCAGTGGGGT
ACAGACTAACCTTATATTATTTAGCATTTATTTGCTTGAGCATTGGTTTTCAACACCCTA
CCACTGCAATCAGTCTTTAAGAATACCGATTTCTATTGTCAGGCATTATAACATATTAAA
GAATTGATTTGGCTTGAGGTTATTTGAGGAGCAGCCTTCCCTAGCCCTGTTTTGCCTTCA
TAGATTTCCATTTGACAGAGTCCCAGACGGTTCTGAATGTCTCCAAAGGAGAAACAAAGC
CAACTCGAGCGGACGCCCAGGTGACCAGAATGCCTGAAGGAAAAGCAAAGACCCTAACTG
TCCATGGTGAGGAAACTGGAATTGTTTTGGTGGTGGTATTTTGTTTTATTTCTGGATATC
TGTTTGTAAACTTTTATGGATCCTAATGGTTCAGTATCTGATTGCCTTCCTGTCTTGGGT
TTTTGAAAATTAATTAATTTATTCATTCAGCAAAGAGTATCCAACCCTTAAAGTTGGAAA
TGCAAAGGTGGATAACCTTCATGGGAGTCACTTTACTGTTTGTATACTGTGTTAGGCTGG
GTTGACTAGAGAAACAAATCCAGTGACACTCATCTATGTGTAAGAAAGAGCTTTCTATCA
AGAAGTAATTATAAATCCAGAAAACATCCCAGTCCAGTCCAACTCAAGTCCACAAGTAAG
TCCCTTTTCAGACTCACAGAGTCACAAGCAATGATGCAGAATGCAGGAATAGCACAGGTT
GGTGGGTGCAAAGTTGGGTGGATCCGATGGTGGTGGTAACTTCCCAAGACTTGGTAGTAA
TCAGGGTCAGTGAACAGGAAGGTGAAGGCAGAGAGAGAAGGGGAAGTTCCCAGGGCCTCC
TTATGAGAAGGCCACACCCACAAGGAGTCACCATCAGACTGTGACCTGATTGGTAGATTG
ACTACCACCCCTACACTGTTATATATCTTCAAGTTGACATGAAATTATGTAACTGCCACA
AATACTCTGAGATTATAATTCAAAAGTTACTGATAAAACTCAAGAGTATTGAATTGTTTC
CTACTTCCAAACTATTCTAATAATTAGCCATCTGTTATAATAATATGAGAACAAGAATGA
TGTCTATATTGTTCACCATTGACTCCAACACACTGCTTGGCACAAAGAAGATTCTCAGTA
AATGTTTACTACATGAATAGAGAAGGAATTGCCATTATTGGCTAAAAAATATAATTATCT
ACCTACCTATATATGTAAATATTGGCTAGTTGGAAGCTTTTAGTTAATACTTTGATTTTC
CTTACCTGGGGATGTCACTCTTTATATGAGTACTGCTGGGTGAGTAGGTGTGTTATGGTT
TTAAAACTGTCTCTGTTTATATGCCCAACAGGTCAGTCAGAAAGCATTGGGAATATTACC
ACAAAGTAAAGTCTCCGAAATGCCTGCCTCCTCCACCATATTCTTATAGTTTATGCAGTT
GTGTAAGTAAATGAACTGACTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCTTCCCTTTGAAACAGGTTACATTTTCCTGTTCACACCCCTCTCATCTAAGAAGGCAGT
GAGAAGGGAGGGTGGAAAAGGAAACTGATAAAGCCAAATCCAGCAGAAGTTCTGGGTTGA
TACTGTTAGTTAGGAAATAGCACTGTGAATTATGAGACATGTTTACCTTATTACTTATTT
TTCCACCTATCACATGTCCCTTGGATAGAGAGAGGCTGTAACTTTAAAATGTCATACCTT
TTCCTGAGAACTTAGGCACCAATTTGTTAAACTTCCTCATCAGCTTCTTGTCTGTAACCA
GTTACTCTTCTGAAAGGTCTGACCCCATTCTGAGCTGTTCCAAGGAGCATAGTCCCACTT
TCCAAATAAAACAGGATGCTTGTGCATCACAAGAGAACCAGGCTGCCTGTCGAGCAGAGA
GAGGCAGCCCCCTCTAGGAGAAATACCAGCTTGGTATTCAAACTTGGGTCTAACTTTGAA
CAATCCTATTAGAATGACCATTATTTGTAAAATGAAGGATTTGGGCTAGAGGACTTTCAG
TCCCCTCTTAGCTTTGTGACAGCAAGCTTTGAAACAAGACCTTTTCAAATTCAAGTTATT
TTAGAAAATGCCTTGCTTCCAAGTCACATCATTGGCTCTGAGCTTATTTTATTAACATCA
GGTCCTGGTCATTAACATGCTGAGACAGTCTTCGTTTTCATACCCGTCTAGTGTCTTTGC
ACTAATCATCTCGACCGTCTACATGAGATATAGAATTAATACTCTGGAAGAGCAGCTGGG
ATCGTTGACCTCCATTGTGAACGCCCCTGATACTGAGTAAGACAATCTCTCGGTGCTATC
ATTTCCCTCCTATGCACATCAGTATGATTTGACCTGAATTTAGCATGATTCTTAGCAAAC
ATTCCTTGAGGGCAGGTTCTGTAGGAGACATTTTGTTAAGGACCTACGCAGAGAGTTCCA
GAGGCGGGAGGGTAAAGAAACGAATGATGTGACCCGGCCCTGCACAATTCTTGGGTTGCA
AAAGTGTTGCCAATAATACGGCAAGAAGCAGGCCTTAATTGTATGATCTTGCTCTGCTAT
CCTAAGGCTTCGTCATGACCTTTTATTAAAATGTATTCAAATTACATGTTTATCAGAGAA
AAAATGGCACTTAGTAAAGGCATTCATTAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCACATTATTTTTAGAGCAGTGTTTATAATATAATTGATGTACCTTAAG
TAAATGATAGACATTAATTATTCATGTATCAGCATTGGTTCATCAATTGTAACCAATGTA
CAATAGTCATTTTTAAATTTCATTTCTTAGAGTATGTACTTTTTAAAAAACAATTGTGTT
AATATTAAAAGTAAATCCCAACAATGTCTAACATGTCTGATATAAACAACTATTCAGACC
TGAGCTTTTTCCTTTAAATCCATTTACATGAGGATTTGGATATATTGTCTAGAAATTGCA
ATAAAATAAATTGTCCCACATGAGAAAGCATACGTTTATCCCAGATCTGAAAGGTAAAGA
TATTTCTTTACATAGTATCTGCCATGTGCTATAAATTGTATTGGAATGGATACATACACA
TATGAATACATAAAATCTTGCCTCATTATAATATACTTAATCATAACTGTGTAAAATAGC
TATTGTTGTATTTTACAACTAAAAAAACTGAAGCTCAGAGAAGTAATTATTATAACATAT
TATAGCTTGCAATAGAATCAAGATTCAAATGCAGATCCATATGACTACAAAGATCCTGTC
TTTGTAGGATTCCCAGTCTACCAGTGTTTCTCAAACTTTTGTGTGCATATCATGGCCACT
TGAAGGGCTGTTAAAACTGATTACTGGGCCCCAGGGTCTCAATCTCTGATTCAGTAGATC
TGAGGTGCATTTCTATCAAGTTCCAAGGTGATAATTGATGGTGCCAAACTAAAGACCACA
CTTTGAGAGACACTGTGTAATACCATTTACCTTAGGTTTTCTAGAGATACAAAACCAGTG
GTAGGTAGGTAAGTAGATGATAGATTGATAGATGATAGATAGATAGATAGATAGATAGAT
AGATAGATAGATAGATAGATAGATAGATAGATAGGAGATAGGTAGATGATGAATAGCTAG
ACACACTCACACATAAAGAGATAACTATATACCATGAAAATGGCTCACACAGTTGTAGAA
GCAGGTAAGTCTAGTCTAGATTGAAGCCCATGCGTCAGGCAAAGTGACAGAGAGCACGGT
TCCCAAAATCCCTCACTCTCACACAAAAGGCCACCTCACCCCACCCCGCAAGGAGGTGTC
ATCAAGCTACCACTTGATTGACAGGTTTGTCTCCACCCCTAGCCACTAGGGTCTAAGTGA
CATAAAATCATCCAACTAACACAATCTTTGGGGTTCTAAGTCAGAGGAAGTTATACTTGT
AGAAAAAGTTTTGAAAAAGCAGCTACAGAAACGTCACACTGAATTGAATATTGATGAATT
AAATAAAAATGTCCCTAAACGTTTCCAAAGGTTTTTTGTGATAACTGATCTTGTGGGGGG
AAGAAATCTGTATATGATCAAGAAGAGCAATAATTTTTGCAAATGTGTACTATGCTGGGG
AAACAGAGGATGTTAATGGTTAGTAAATGGTGTCTCAGAAACCTTGTGCTTCGGAATAAT
TGTGTGATTTTCATTTGGAAGTCCAGCTACCAACATGCTCACTTAAATAAAAATAGCCTA
GGGGCTGATCACGTAAGAACTAGTCCCCTTCAACAGAAAAGTGGGTGAAGGAAGACATCG
GACAGTGTAAGACATGACAAAATAATAATAATTTATACATTATCATGGGTTCCTGAGGGA
GGAGGGGCAGGGAGAGAGGAGGGAAAATGAGGAGCTGATACCAAGGGCTCAAGTAGAAAG
AAAATGTTTTGAGAATGATGATGGCACAAATGTACAAATGTGCTTGACACAATGGATGGA
TATGTGGATTGTGATGAGTTGTCAATAAAATGATATTTTAAAAAAAAAGAACTAGTCCCC
TTAGCATTGAACCTGGAGTATGTGGATTACTACAGAGCTCTCTGGTGTTAACAAGTGACC
TATCTACTGTCTTCGGTTACAGCCTGGTTTTCTGTTCAAATACATTTTAAATATATTCCG
TCTGCTTCTTCCTTTGCCCTCCCTGCCTATGATAACTTCCCTCTTTGTTTTCACAGACAG
ACAGTACCATCTGGCCTGGGGTCACAAATGCCGTTAAATGTGGAGGTCCTTTGCCAAGAG
CTTACAACTAACATCATGAAATTGGAAAAGGTGATTGATGGGCTTCCTGTGCATGGAGAC
AATAGCAGCAATGCCTAACCTTCACCCTAGGTCAAGGTTTGCACACTCAAGTGCCTCTGG
TGTGCTGGTGGCAACCTAAATGCTCGGACTAGAGGGTTATATGATAAGCATATTGTTAAA
TGCCACCAAGTTGGTCTCTAACTCCTGACCACCCCATCTACAATGAACTTGGCCCCGTGT
GATTCTTAAGGTTTTTATTGGCTGATTTTTGGAAGAAGATTGTCTGGCTTTTCTTCCTAG
TCTGCTCTAGGGTGGAAGCTCAGTTCAGTATCGTAGCGACATTTGAGCTTCCACTGACAG
ATGGTGGCTCCGCTTGGCAGAGAATCAAACCCAGTGTCTCACAAGAAAGGCATGAATTCT
TCCCCTTATGAGAAACAGATTTTTTTTTTCCCACCAAGAAATAGGTCTGACTTCCTTGAA
ATAGATGTTCTGGTTGGTCACTCTTTCCTTTCTTAGTTAGAAGCATTTCTGTATCATAGT
CACTAGTGGCAGACAGCCACAGACCCTGGGGCCCAGTGTTGGGAGAGAGGAGGGAGTGGA
TTCAAACCCACTGACCCAACCAATCCTAACTCAACTCAGGCTGGTTTTTGCCGTACATAA
AATAGGGCATGCAATCTGGATTGCAACCCTGGTTGGTAAGAGGAAGTGGAATCCTATCAA
GATAACAGACTCAGTTACCTTGCCCACAGTGACACTCCTGGAAAGTTGGACCTGAAGTTA
GAACCCGGTCTGACTCCACAGTTGTCCTTGGACGCCCTCTGATTTACTGCTTCCCAGAAT
CCAGGCACAGGATTATAAGTAATGTTATCCTTGTTGATAAGATTACTGATGCACCTTTAC
CTCTGAGAGGATCTTCGACAGGGCACTTTGGCATGCTTATCCTCACACTTGTGTCACTTT
TAAAAGGTCAATTGAGAAGAAAACCACCACCCCCCCCCCCCAGTTCCCTTTCCCATCAGA
TCACAGCACTGGTCTGGGTGCTTGTGAAAGGAGGAAAAGGAACATTGAAGCTGGCCCTCA
GTGCTCTTGGAGCTCGGCTAGTTTCAAACAAGGTCACTGGGGGGGTGGGGGGGTGGAGGC
CAATTGAGAGTCAAGAAGGTGAAGGAGAGAAAGAACCATAAATGTCCCAAAAGTTACACT
GCGATAACATGTCTTATGTTCTTCTCCTTTCAAAGTCTGTTCCTTCAGAGTTGACAACCA
CTTTGTTTTCACCCTGCTCCTTAAGGCCACGTTTAGTGACTCATCTGCTACCACAAAGGC
CCAGAATTTAATAGCGTTACCTCATGGTACAAAGCCTGCTGTTGCCAATGGGGCGTGTGC
TCAGCTGCTAACAAGTTGGAAATTTGAGTCCACCTAGAGGTGGTAAGAAGAAATACCTGA
GGACCAGCTTCTAAGAAATCAGCCATTGAAACCCCCTTTCTAGCAGTGTGTTATCCTAGC
ACACTCCCATGGGATCACCATCGTGAGTCAAAAGCAACTCACTGGAAGTGGAACATAATA
GGGTAGTTGAATTGGGAAGACACATGAAATACAAATGAGTACAATTTACTCTGGTCTTGC
TGTAGTAAGTGCTCGCTGGCATCTAACAGCAGAAATATTGAGAACCACGGTATTCTCAAA
CTTCGGTTCTAAACCAAGTCATGAAGGAATCCTTATTGAATCATTGTGTCTATGGGCAAA
CCCGGAAAACCTTTTCTACTTTAAATTTAAAATCAACCTAGAGAAAGTAGAAGTTAACTG
CAAGAACCTTTGCTTTTGTCTTATGAGATGCTTACAACTGTTTGGCTTTCATGCTAGCCT
CCAGAATGGGTTGGTATTAACTTTCAAATCTGTTCAGTCTGACTCACAAATAGTATCCTT
TGGGTTGGAAGCACATGGGTGCCTTATTCTTGGGTTACATCCCATACCTCCACCAAACTC
AGCCCCAACTGACAGACAGGTGGCAACTGCTCTTGATGTACAATGGCTGGGGACCAGAGC
AGGACATCGCATATTATAATGAAGGAACAGAAACAGAAGGGCTTGTTCAGAACAGGCAGA
CAGCTGGACAAGTCTTATGCAAGTTTGACAGAGCTCAGCTGCTCAGCAAGAAAGGGCTGT
GGTACCAGTGGAGACCACCTTCGTCCCAAATCGGGATCAATTGAAGAATAGACTTGGGGC
CAAAATGCATATGCTGAAGCCCTAGAAACTTGTGAATTGCACATATTCTCATAATCTCTG
GTATGTTCGACTCTGTCATTACAACTACGGTGCCTGTCTTTCTCACTGAGAGTGTCCCCT
GCCCTCGCTGGCTCCCCATCTCACCAAATGTGATCTCCTCCTTGAGCGATTGCTCCCCTT
TGATGATGCGTCCAAGGCAAGCCAGCCAAGGTAGCCAGACAGGGATCTGTTGTGATCCAT
CGTGGGTTTTTTGTTTATTTTCAACTGATTCCCAAAAATTTAATCTATCTTCTTTTTTAA
AAAGTTTTATTGCCACTTAATCCACACATCATATAATTCACTGTTTCAGTTATATGTAGA
AGAGTTGTACAATCAACAGCATAATTTTAAAACATTTTCTTGGTTTCTTGTGCTCGTTGT
TATTAGCCTCCCATTCCCTACAACCTCCCCTCCCAAATGCCCTCCCAAAAAACATTAATC
CAGTTACTGTCTCTATAGATTTACCTACGCTGGATTTTATATAAAGAGAAACATACCCCC
CCAAAACTAACAATAATTATAAAGTTAAGCAAAAAAACCTCAATCAAAAAGAAAGTTAGA
ATATATTAAAAATTAGAGCAAAATTAAATGGGTCAAATGGGAGATCAAGTGATAAGATGT
TCATTTTTAACCTAACTACATCTTCAGTAATCCACTTCCCAATGCACTCTGTATTGCTGT
CAAGGGTATTCCTACCATGGGGCAATGGACAGAGGGGCTCCCCCAGAGACTTGATCCATG
TAGACCTCCTCTTCCCTTTTTTTGTTTTTTGCAAAACTAAAACAACTTTAAAACAAACAA
ACAAAAAACCATAGTGTTGAGAAAGGGGGCTGGAGCAGAGACCCAAAGGCCATCTGTAGG
CAATGGGACATCCCCTCACAGAGGGGTCACAGGGAAGGGATGAGTCCATCAGGGTGCAGT
ATGGCACCAGTGAAACACACAATACTCCTCTGGTTCCTTGAGGCTTCCTCACCCCCCACT
CTCATGACCCCAGTCCCGCCTTTCCCAGTGGACTAAACCAGAGCATGTGCACAGGTGCAG
AGAAGAGTTCCAGGAACGGGATTGGAATTAGCGATACCAGAGGTGTAGGGGGAAAGTGCG
AAGAGGGGGTTTGAAAGGGGTAGCTGATCGCAACGATTGACACATAACCACACACCACAC
ACGCACCCCTCCAGAGGGGTGACCAACAGAAGCTGTGTGGGAAGGGAGACAGTGGTCAGT
GTAAGCTATAAAAATAATAATGCTTTATCATTTACCAAGGGGTCATGAGGCGGTGGGGAG
GGAGAAGAGCTGATACCAAGGGCTCAATAGAAAGTAATTGTCTAGAAAATAATGATGGCA
ACATATGTACAAATATGCTTGATGCAATTGATGCATAGATTGGGGTTTTTTGGCATAGAT
TGTTATAAGAGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGATA
TACATTAACTACTCACTACCATATGACTCCACATGCTCTCTGTCAGATATCAAAGCTATT
CCCAACCCTGGACTATGGTCAGAGGTGGATTCACCTGAGGCTTAATCTATGTGTGGATAC
TGCAAATGGATTTGGGGCTTCCAATCTCATCCATAGCCTTCTACAAACCAGGTGTTCACA
ATTTAAGCTCTGATTTTCACCCCAGCTGAGGTCAACATGATTTCTTAAATGTACATATAG
AGGGTGTGATCGGTGCTTCGTGAACACGAGGCAGAGTACTTTTCTGTTGGTAGGAAAATG
GGTAGGCGCATCCTCCCACTGGGAAAAATTGCCTAACAATACTTACATAGAACCCAAGGA
GGAGAATATTCCTGGAAACTTTTGACCTACTTTCTATCCAGCCCTTGGTAATCCAGGCCA
TGTGCTGTAAAATACTGTGACTTTAGACTCTCTTCTTTTGTGGTGCCCAACATTCTTCGT
AGGCCACACCAGAAAGAACTAATGTGGAAACCTCACAAAGTGAACTGGGCTTTACCCCAA
AGCATATAGAACTGGTAGTCATTGGACTTTGGTCCAGATCTCTTGCTTTGAGGGTGCCCT
GTGGATGGTGAATACTATACAACCATATACTAATTATCTCAATGCCCACTGTGCTTTATT
ATGTTATGTATTAAACTGGTACACATGGTGATGCCCCTGTCGGTGAACATGATTGAAAGT
TTTGCCCTATCACCAACCCCCATTTTTTATTCAAATCGTGTCCGGTCACTGTACATTAGC
AATTCAAATATTGTGGTTCATAGCCAGCCTATACTTGTATAATTTCCTTTTCTAACTGTG
TTTTAAATTTTATACCATTGGCTAAATTAGTGACACTATCAATAGAAATCCTTCCCACCC
CAGGGAGATGATTGTTCATGTTTTCTAACATAAAATGACAATAATGTCTTTAAGGTGAAC
GAGAGACTTATTAATCATAGATACATGAATATATTTTGGGTTTCCACTTCATTCTAGCCC
CAGTCTTACAACAATTCGCTCTTATGACATGGCCCTGTTTGATGCTTGCCCTCATGAAGA
GATCACTGAAAATATAGGTGTTACAGCAAAGTGTGATGAAGAAACTAGATGATGCTCAGC
TATACAGAATAGCATCTGGGGTCTTAAAGGCTTGTCTTCAAACAAGCAACTATCTAAGTG
AGGCATCAACTAAGTCCATATGGAAGATAGACACCAACGATTGTGATCCAAAGATTAGAA
ATCATATCATCCAAACGCAGGCCGTTTCCTGGGCTCATTTTCAGAAGCAGGTCACCAGGC
CTTTTGCCTGCGGTGTCATAATCTGCAAGTTCTTCTGAACCCTATCAACTATTGCTGCCC
TTGCTGATATTAAAAATACCAATGGAATGGGTTCCAGCTTCACATCAATCCGCAAGCCAT
CATAATATAACAAACGGGCAGGAGGGTGACGGAGCACAGTACTTCCTAGGTGCTATGAAA
TGGAATCAACCTGATGGCAGTGGTTGTGGTAACTCTTTCTTCAAGGCAGAACAGATTCAT
TGCAAGCATTGTAGAGAAGTTGTTCTTGTTGGTTCCTGATGAGTGGGTTCCAACTTTGTA
CGTGATTCTAACCCGTTTCACTTACTAATAGGAACTTCTCTTTCATTATTTCAAGATACA
ACACAACTTACAAAAGCTGCTTGAGAATGGGGACTGAACAACCTTGTTGCTTAGGCCAAC
ACAATACCTCACACTTCCCTTTGAAGAAGGTGCTTCCTCAGGCGTTCTGGTGGAGTGCCC
CCTGCTGGTCAGAGGAGCTCATGAACAGGAATCCAAAACCACATTTGTACGTGGAGGTCT
CCAGCTCAGGGAGAGGCGGAAGAAGAATCTTGGTTCCTGTGCAATAAATGTTGACCTTCA
CTCCGAAGACACTGCTGCTGCCCGAAGAATGCAATTTCCTGGATGTGTCCCAGAACGTCC
CTGTGGATTATTATGGGTGATTATGGTTCAGCAGTAACAGAGTAGGTGACAACATACAAA
TTCCACTCCATGCATTTTCAGTCTTTGCTACCCATTGTTTCCTCCCCTGGAGCCTTGCTG
GTGCCATGGATTAAGGGTTAGCAGCTAACCACAAGCTCAGAGTGCTTCCAACCCACCAGG
AGCTTCTTGAGGGAAGATGAGGCAGTCTGTTCCCAGAACAGTTACAGCCTCAGAAACCCT
GAAGCACAGCTCTACTCTGCCCCGTAGTGTCGCTATGAGTTGGAAGTGACTCATTGGCAG
GGGCTTTGGTTTGGGGGTTTTTCTTTCTCGAGACCCCTCATAACTAACCTTCAGATTAAG
GGGCATTTCATGTACCTGTTAAGATCCAGCCTTTAAAGGAAATGCTGTAGGTGACTCTAA
TGAGCAGGCTTGCTTCAAACAAATAACTTCTACCTTTTTTTTCCCCACCTGCTTTTATTT
TATCGTCTAACTTGTCTCTGTATCTTAACTTCTCAATTCAGTATTGGCAAGAATATCAGT
GAATTAAACTGGTTTGGTTTAATTAAACCATTTGGTTTGGTTTGGTCTGAGTCCTACGAC
TACTTAGAGTGATTCTCACCCACCCCAGGTCAGGAATCTGTGACTCGGGACTGAAATACT
GAATTAAATGTATGTTGAAACCCAAACTAATCTTTACACCAAAAAAGTACCATAATGATT
TAATAAAGGATGAAGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1083, 37168..37287, 56688..56799, 59530..59596, 61098..61201, 68064..68159, 69325..69396, 69500..69580, 73043..73154, 73683..73805, 74851..74867, 74869..74877, 74879..74905, 74907..74941, 75951..76055, 78536..78629, 84055..84096
1001..1083, 37168..37287, 56688..56799, 59530..59596, 61098..61201, 68064..68159, 69325..69396, 69500..69580, 73043..73154, 73683..73805, 74851..74867, 74869..74877, 74879..74905, 74907..74941, 75951..76055, 78536..78629, 84055..84093
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved