Echinops_telfairi Locus SF3B3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SF3B3
Echinops_telfairi
SF3B3
GeneScaffold_8803
SNORD111, SNORD111
4129..4207, 21600..21690
63943
AAGTGCAGTATAGTACTCAACTTTTTAAAACACCTTTTATTGTGAATTGGGTGAAGTGT
TACATTCAACAATTTAGACGCATTTTATTTCACATTTCCATTCCTCCATTTCTGACCTTT
GTGAACTTTGGCCTTGGGTAAACACTGCCTGCCCTTTTGATCAAAAATGGTTGATTATTC
TAAGGTGGAAGTACCTCACTAGTGTTATTCCCCTTATAGACCTATCAATTTGTTTGAAAA
TTGAGACAAGTAACCTAATTTTTGATTAAAGAAGAGAAAAATGCAGTACAAATAAATGTT
TTTGTTTGCAGTATAAATGGATGCTTGCTACATCTGGAAGGTTGCTATATATAGCATGCT
AAAATTGATTACCCCAGAGAGCAAAACTTGGTTGGAGAAAGTGATGGATTTTTGCATTCT
GAGCTATGTGAATTATAGATTCAAATAGAATTATAGATTTAATATCTAACCACCAAAGGC
AAATAGGTAGCACAGATCCCAGCTCCTTTATATTCCCTTTACTTGTTAAAGGACCTGGTC
AAGTGATTTGATTTCCGAGTGTCAATTTCCTTATCTATAAAAATACACAATAATAATAGG
ACAATAATATTTAACAACAATAAGGGGTGGGGGATGGAGGGGATAAAGTGGAGCTGATAT
TAAAGAGTTCAAGAAGAAAAAATGTTTTGAAACTGATTGTAGTAGCAATTGTACAGTTAT
GCTCCACTCATTTGAATTATGGAATGAGACATCTGTAAGAGCTCCCAATAAAATGATTAA
TTAAAAAAATTAAAATAAGTATCTTAGCGTTATTGTGAATGTAAAGACCAGCTTATAGCT
TAGTAGCTGTGTGTTGTTCCTCAGTAGGCCTTATTAGTGTGTGTTAAAATACCACTTTTT
CTGCTTTCATATTCCCCTAGCTTGCTTTGAATCAGAGTTGTTTGTAGAACCAAGGCCTGA
GTTGTGGACTAAGGTGGCTCACTTTTGCTGCCAACGCCACCATGTTCCTGTACAACTTGA
CCTTGCAGCGAGCCACTGGCATCAGTTTTGCCATTCATGGCAACTTTTCTGGTAAGTTCT
AAAGTTATTTTCTCTATGAATTGAAGCAGTGTTTTGTTTATCTCTTATATTAGAAATACT
TTTTTCCCCCTATTATAGACCGACTAAAAACAATAGTTGGTGAATGTGAGTGAAACAACA
GCTTGTCTCAGCTATCAGATTTGTTGTGAAATCGAGGTGTACTATCTGCTACCTTGTAGC
AGGCACATTTCCTAGTTCATTGGTATTCCATATGAAATTTCTTAAGTCCCAGGGTTAGGC
CAGGTTGTGTGCATGTTGCTGTGAGACATAGGAGATAATATAATGCAAGACATGGTCCTT
GTTCTTGAATATGACATCAGGCTGGATAAAGGGTTTAAAGGTGTTTCTCCTGCTATTAAA
GGAGGAGAAGGGTTTTTAAGAAGGGGAGTGAGTTTGGGCTTGGTGCTGGAAGGGAGAATA
GGACTTATTTGGAGCGAGAATGGAAAATGATGTTTAGGTAAGGGATCGCACTTGGATGGT
GGCAGATCATTTGCTAATGTTCACCTCCTTTGTGCCATGCATCATGAGCTGGAATGGTGT
GGTGGGGGGTGTTTGGAAAGATGAATTAAGGTCAGGTGGTAGGGAGTTTTAATTAACAGC
TTAAGGCAGTGGTTCTCAAGCTACCTTTTAATACAGTTCCTCATGTTGTGGTGAACCCCC
CCCCAACCATAAAATGATTTTCGTTGCTATTTCATAACTGTAATTTTGCTACTGTAATGA
ATCGGGCCACCTTTGTGAAAGGGTCGTTCAACTCCCCTCCCCAAAGGGATCGCGACCCAT
AGGTTGAGAACCACTGGCTTAAGGAAAGAAGCATTAGACAAGTGAGAATTAGAGAAAACG
GTTTACTAAAGTGCATAAAAGCCCTGTTGGTACAGTGCATTAAACATGGGGATGCTAACT
GAAAGGTCAGTGGTCTAAACCCCTCCAGTGGGGAAAGAAGGCAGTCCTCTTCCATAAAGA
TTTGAAACTAGGCAGCGCTAGAGAACATTTCTTCCTTATCCTATCTATAGGACCACTGTG
AGGCTAAATTGTTTCCATTGGCGATGGCTAATATATATGACTTTACCATTTGCAGGTTTA
GTTCCATATAACACCAAAGGGGCAAAAATTTGGAGAGTATATGAAATTTGCCAAGGCTCA
AACCTGAATGCCTACCTATTGTGTGATAACTGCACAGGAGCCTTGCCCTCTGAGCACGCT
CATTCTTTGTTTTCTTTGAACATCATGACTATTATTAAGCGTCTGCGAGTTCACTCTGAT
TTAGTTATTCCTCCCTACATTTTATGAAGGAAATTGTATCCAGTTTTGGTGTACATGAAT
TTGACTATATAACAATTGATTCTGTGCTGCATTTTGAATAGGGATTCTTGGGAGAGAGTT
TTCTGGTTTAAAACATCTTTATTTTACATATTTTCATATATGTGTAAAACATTTATTTGA
CCCATGAGCCATTGAGAGAGCAGTGTCATTTGTAATATGCTTTATAGTTTCCATGGCTCT
TGATGGTACTTGGTATTATCTGAATCCTAGAAGACTTTTGGAAAGTAAGGTGGCAGGCTA
AGTGGTGGTGTTTTATAAATGAGATAGATTGGGACGGGTCAAACCAAAACTCCATACCAT
TTGAGTCGATTCCAACTCAGTGCCCCTTCATTGTCCAGAGGAGAACTGCTCCTTTGGGTT
TCTCTGACTGGATCTTTATGGAGCAGATAGCCTCATAAGATAGCCTTATCTCTCTGAGAG
CCACTGGTGGGTTTGAACTGTTAGCCACAGTGCTACTAGGGCTCCTCTGGGATGGGCTGG
TGTAGGAAAGTCAGATACGCTGCAGGTGTGGTGACATTGCATGATAGAGTTCTGGACTCA
GTGGGAATAGAAAGAAGGGAAAGGAGTTTTCAGCCTGGATGGCAGAGAAAATGACAGGTA
AGTTGATAGTGGGGGAGGACAATTTTACTTATTTTGGATAGTTTAATGTTAACAACTCAT
CTAGGTACAATTATGTAACATGCAGAGACAGACGGGGACAAAATTGGCCATTAGCCATTT
GGAGGTGTTGACTGCAGTTATGAAAACAAGTGAATTTAGAAATGAACTGTTAGATGTCAG
CTTTAGAATTTGTGACACTACCTGAAACTGCACAAAAAGTGTCGAAGTTTGGGGAAACTT
GTACTTTATAAAGCTAAACGTTGTACAATACCATTTTAGATAGTTCCCAATTATTCCAAT
TAATGGCAAATCTTGAGAAAAGTAAAAGGAATAATGGAATAGAATTTTAATGAAAATAAG
ATGTAGAAATAATTTTTAAAAGGCTTCTTTAGTGCCAAGGTGTCCTGGTGGCACCTAGTG
GGAGGTATTAGACTGCTAACCGTGAAGTACTGAATGTGAATATTGAGCTCCCAACTTATT
TCTATTTATTGTTAGTGGTGTCTTGTACCCATCTAAGCTACATTGTAGATTAGTTACGGT
TGCTTATGACTTCTTTGGTGATCTAGGAACCAAACAACAGGAAATTGTTGTTTCTCGTGG
GAAGATATTGGAGCTGCTTCGTCCTGACCCCAACACTGGCAAAGTACACACTCTCCTAAC
TGTGGAAGTATTTGGCGTTATCCGATCGCTGATGGCCTTTAGGCTGACAGGTGGCACCAA
AGACTACATTGTGGTTGGCAGCGACTCAGGTCGGATTGTTATCTTGGAGTATCAGCCATC
CAAGAACATGTTTGAGAAAATTCACCAAGAAACTTTTGGCAAGAGTGGATGCCGCCGTAT
TGTTCCTGGCCAGTTTTTAGCTGTGGATCCCAAAGGACGAGCTGTTATGATCAGTGAGTG
ACTTGCTCTGTTGAGTGTATCTGCCTGTTCCAGAAACCCAGTTTAGGAGTGCTTCCTTAG
GATGGGCAGTTGGGTATCATATGAACAACCTCCATGATTTAAAGTTGCATTTTCCTTTTA
AAACAGTGGGAAAAGAAATCTTTTATAAGTTGAGCAAAAAATTGTTCATCCCCCAAAAGA
CTACAATGAAATGCTCTTTCATTATCAGTGTGGATATGGTTGCTTTCCTCGGCCTGAAGT
GATGATTAACATTCATGTCTCTTCTCTGATAAATGTCTTGAAGATAATGTTGTGATCTGA
CCAGGCCTTTAAAGGGCAGCCTTCTCTGTGTATCCGCATGTCATTTACTCTCATTCAAAG
AATAACTAGCAGTTTGAGAGGCGATTTGTAGTTTCTGAAAATCATTAAATTCTCATGCCA
CATTAAAACACTTTCAGTGTTTGTGATAGTAGATTCCAATTAGGAATAGAGGGGCAATGT
GGTGTTTCTCTATTCTAATGATAGTAAAGACATGAGTTAAAATATTTAGGAGAGTTAGTT
CTGGCTATTCTGTGTGGGTGTGGGTGTTAATCATGGTACTCTGAGCACCTCCTGTTCTCT
CCTTTGAGTGCAGGTGCCATTGAGAAACAGAAATTGGTGTATATTTTGAATAGAGATGCT
GCAGCCCGGCTTACCATCTCCTCTCCTCTGGAGGCCCACAAAGCGAACACCTTAGTGTAT
CATGTGGTTGGAGTAGACGTGGGATTTGAAAATCCAATGTTTGCTTGTCTTGAAATGGAT
TATGAGGTAATGGGGTCATATTTCTTTTTATCTTGGAGGTTTTTCCAAACACATCTATGC
TTTCATAGGATTGTCTTCTTCATTTTGTATATCTAGTAACTATCTTACTAGCAGTGCTTT
GCTGTTTTTCTCTTTTTTTTGCTTTGCTTTGCTGTTTTTCAAATCCCTTGTTGAAATTCT
TTGAAATGGTATGCTCTGAGTTGAACAATCTCCCTATAGAAACAATATTTACTGAGACAG
AAATGATATATTTACTGATAAAAGTTGCATAAGAAGGCGGTAACGTTGTATTTGGAGATG
TGTTTCACATGGAGGGAGTGAAAGCCAGAGCATACCAGGCTTTTACCTGGAATACAAGGA
AGTGAGTGTCTTCAGGTAATGGGAACTCTGAATCCAGAACTAAGAGACCTGGGCTCTTGT
TGCAGTTCTGCCAAAACCTACCTGATTGTGAACTTTGGCAAACCACTTGACATCTGTGTA
TCCTCGTATGTCTAAGGGAAAGTTTCTGAAGTCCTTCTGTTTCCACCTCTCAAGAGTTCT
TTGATTTTGTTGTATTGATTAGTGTTTGTGCCATGGTGGTCTTTTGCAGGAAGCTGACAA
TGATCCAACGGGTGAAGCAGCCGCTAATACTCAGCAGACCCTTACTTTCTATGAGCTAGA
CCTCGGTTTAAACCACGTGGTTCGAAAATACAGTGAACCTTTGGAGGAACACGGCAACTT
CCTTATTACAGGTACTTTTTTCATGTTGATTTGTAGCCTCCTATTTGGTCCATTTTATGG
CCAACCATAAGAGGATTTATTTAATAGGCTTTGAAAATTAATATATATGTAAACACGTGT
GTTTGTCAGGGTTCCAGCTCCCAGCAGTTGAATGGGTCCTTAAGAGTGGCTTTGTAATCA
TAGAAAATATGACAGCGGGGCACAGGGGCCCCTTGTCCCTATGTCAGGATCAAGAGAGCA
AATATATTTTTCTTTTTCAAATATATTTTTCAGTGGGAATGTATATTTATTCATGGGGTT
TACAAATCTTTCAACAGGCATACATTTAATAGAGTGAATGGGTAATATAATAAGTTGGTA
ATAGAATGAGTCAGTGGCTTAATCTTATATGAGCCCTTCCCAAGGGAACAATCTGATTCT
AATCAGAAGAAAGTTAGCTGCTCTTTAGGGTGGGGACAGACAATAGAATCTGCTTGCTCT
TAGCAACATAACCTTCAGGCATATAGTGATGGCTCCTTTATGGAGGGCTATTGTAGGGAC
TACTTTCTGTCATGAGAATGTGTATTAGGATTAATTTTTATCTCATAGCCTTGAGGGTTG
CCCCCTACCGGAGTCTGCTTTCCAGCATGGTAATTATGAGCATAGAGAATATGACTGTTC
ACATTCTCATCCAGTCCCTCTTTTTCCCTCTTATTTAGTCTGTGGTAAATTAGTAACTCT
TAGATTCTAACGGGGACAGGAAAGAAAGCATCCGGAGACCAGTCAGCTTGTAATATTGAT
TCTTTTTTGTTTTTAAATCATTTTACTGGGGGCTTGTATGGCTTTTATCACAATCCGTAA
ATCCATCCATTGTGTCAAGCACATTTGTACATTTGTTGTCATCATCATTTTCAAAACATT
TTCTTTCTACTTGAGCCCTTGCTATCAGCTCATTTTCTAACCTTCCCCCATCCTCCCTCA
TGAACTCTTGATAATTTATTAAAAAGTTTTTCATGTCTTTACACTGATTGTCTGTTGTCT
GTCCCCCTGGGCGGGGATTATTAATATTGATTCTTAGCTATTGCTATGATAGTATGACTG
GAGTCAATCTTTCCTTCTTTTTAAGAAAACCCAAACCTGTCTTTTGAAAACAAGAGAGAA
AACAAGATCAAACAGTAGGTCGGTGAATTTGAAAACTTTGATGAAATTTGAAAATGGTTA
CTAAAACTGACCCAAGAGATTAAGAGCTCAAATAGACATTAAAAATAAAGACAAAAACAT
TACAAATACATTAAAGAAACTGATGTCCTTAGAAGATTTCTTACCCTCCAAAGAATTAGG
TCCAGAATTAGAGGAAAGCCTTTATCATGTTGTAAAAGGTATTTTTTAAAAGCACATTTT
TCTAGATTAGAAATTGAAAGCTACTAAATTGTTTTGTGACTCTAATTTCATTATCCAAAT
AGAGGAAAGGCAGTAGCAAAAGTTTACAAACTAGTTCTATTTATGATTACAGATACAAAA
AAGATACATTTTAGCAAATCAAATCTGAACACTATTTTATTTAGCTCCTCATAGCTAAGT
AAGGCTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
TGATATATTTTGAAGGGCTTCTTTTTAAACCTAAGTTCTTTAAATACCTCAGTTGAACAA
GTCTAAAACTGAATAGTTTGGGTGGAGTGTTATGGAGTGTAGTATGCAAATATTTATTCA
TAGCCTGAAATGATGATTCTTCAAATTTCATGTCTCTTCTCTGACATGTTTCTCTGGAGA
TAATTCTTGCCTTACTGATCTGATCAGGCTGTAGCATGGAATTGTGGCCTATGAGTACTA
GCACCTGCCTACCCTTATCAGCAATTGTGTTAGTCTGGGTAGGCTAGAGAAAAAAATTCA
TAGACACTCATTTTTTATAAGATAGAGTTTTATGTGTAAGGTAAGTGTACATTAAGAAAG
CATCCCAACCCAGTGCTGTCCATGTCCATATGTCCGACATCGATCGATAAAGTCCTCCTC
AATCTCTCAAAACATGCAGTGACGCGCCGAATGCAGCAGGAAAGCCCTATCAGTGAGTGT
GTAAGCATCTCAGTGCTGGTAGGGGTCTCCACTCTTCTCCAGCACCCAGGGCTGCATCAG
GGTAGGTCCGTGTGGCTTCTCCTCAGGGATGTCTCACAGGAAATGAGCCTTGCCAGCTGA
GACAGAGAACTAGGTAAGGCAGTTGCACCCTGGTCCGACCATCAGAGAGCAAGAGACAAG
ACAGGTGAGGCTTACAGAGCCATTTATCTCCTCCCCTTCAATCAATCTCATGTGTTTATT
GACCAGGTTTGCACAATAAACCTTAACTATCACAATCTTTCTAAACTCTCATGTTCTTAT
AATGACTGTCAGTCCATTTCTAGCCACTCAGATGTTACAGATCCTTCTATTTGTGTTGTC
CTCCACCACTTTCAAGTACTGAGGGTTTTCCTCCCCCTTTTCTGGATCCCGTTTTATGTA
GGGCTAGTATGACCTAGTAGACATTTAAAAATGTTACTAGTGTGTCTGTCTGACCATCTA
TAATTTCATCAGTCAGGAGGAAAATCTAAATCAATAGTCTAAGGGGTATAGCTGGTGAGT
TCAAAGTATCTGCCTTGTGGTTAACAGCCTAACTTGTGGGGAGCAGCCTCCACAACCAAA
TGGGTCCTAAGAGGCAGTTGTGTAATTGGAGGGTAATTAAAGAAACAACAGATAAAGCAT
GCAAGGGCTCACCGCTTTCATGCAAACCAGAATCAGAGTGTGGAAATGTATTCTCTTTAT
AGGCTTTCTCTTAATGTTGGACATGCATGCCATGTCATACACATATTTAACGGGAGGGGC
TTGTATTAGAGGCATACATGTAACATGAAGGGGACGAGCTAGGGGGCACACATGCAACAG
GAAGGGGACATATTAGGGACATACACAAGGCAGGAAGGCACATACATAACAAGATGGGTG
GGTTTTAGAGTTAAGATGGCTTAACCTTGATCATCTCTTAGCTGGCTTGACCTTCAGTGT
TCTAGAGCTCTTCTCCAGGGGAGCAATCTGATCCTTATCAGAAGGGAGTGGGCTGTACTT
AGGGTGGGGCGGTCTGATCCCTCATGATGGCAGATATCCTTTAACCTTCAAGCATATAGT
AGCCACTGTGCTTGCAAGCTGCATCTTAAAATAGGCATTATTACTGGGGACATCGTGGGG
GTTGACTTTTACTTTGGAGAATGTGACTGGGATGCGGCCTTCCTCCATCAGAATCTGCCT
GCCAGACTCCTGAAATATGAGTGTAGAGAATTTGTCCACAGGCACACTTCACTCATAATC
CATTATATCCTCAGGGTTCCTTTTAAGACCATTAAATAGTGTAAATTAATTATTTTACAA
CGTCTTGCTTTTCTGTTGAGATTTTGCCAGTATCTACTGCTGTCTGTACAAACCTCCAAT
GCTCATTTACTCAGAATTAAAGTGAGGGTAATGGCTGGGATTGAGTGGTTGTCTTTTATT
TTTGCCCTGACGCCCTCTACTGGACTGTCAACCAAGTTGAGCTTTTTCCTTTTTGTGAAT
ACGTATTTGTTTTCCCTACATTACCTCATTTGTATATTTCTCCTTACTATGGTGTATATC
TATATTGTCGCACTTCTTAATATGTTGCCTTTTATTACTTATAATTATTTTCTTCAATTT
TTCATTTTTTATATACAAGGGATTTCTGTTAAACAAAAGTTATAAAATCCACACAAAACA
AAATGATGCATTTCTTCCATGCATATAGGTAACTATTCTTTGCCAATGTGTGTATGTAAG
TAGTTATAAAAAACTACAATCATGCATTATACCATTTTGTGATTGGTTTTATTTTATACA
GTGAATATTACCCTTTTTTACATGAGTATTTTCTGTACTGAAAAACATCTGTAGTACTTT
TTAAAAGCGTTAATGTAAAAAAAAAACAAAACAAAAAAAAAGCGTTAATGTTCATGTAAT
ATTAGTTATATTTATAGGTAGCTATTTACTTAGATAGCTTTTATTTATTTTCCATTGACT
TCTCTAAGGATCTACTACTTTAATAAAAGTTTGTACTGATTTAAGCTTTATTTTTTTTTC
TTTTCCGTTTTTGGATTTTTTTAATCATTTTTTTTTCTTTTTTTTTTCCTTTTTTAACAT
TTTATTAGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAGTTGTGTAAAGCG
CATTTGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACATCAAT
TGTGTAAAGCGCATTTGTACATCGTTTCTCAAAAACATTTTCTCTCTATTTAAACCCCCG
ACATTAGGTCCTCACTTTTCCCCTCCCCCCTCCCGCATGAGCCCCTTGATAGTTTATAAA
TGGGTATTTTGTCTGATTTAAGCTTTTATAGCAGTGTAGGTGCTGTTGTCTCTGGATGTT
GTGTTAGTCCCGATAGACTAGAGAAACCAGTCCCAGGAGACTCATATGTATAGGAAAGAG
CTTTATATTAAAGAGCAATTGTATATTTAAGAAAACAGCCCAGTCCAGATCAAGTCTATA
AGTCCAATATTAGCCCATATGTCCGATACTGGTTCATAAATTCCACTTCAAACTCAAATT
CAGCACATGCAATGATGCTGAATGCAGGAAGATCACAGGCCAATGGGTGGAAAGTCTAGG
GAAGCATATCCGGGGCTTTGACTGCCATCCGTGTGACTCCATGTGTCAACAGGAAGGTGT
AACAGAGAGTGTGTCCCACCTCCAGAGAGGAAGAGAGGAAAACTCCCAGAATCCTCATGA
GATAAAAAAGATAGGTTTTTTTAAATTTGCCAAGCATTATGTCTTGTGTATTGAAATTGG
ATTTTTTTTAATTTGCCAAACATTGTGTCTTCTGAATTGCTTAAACACTTCTATGCCCAT
TTTTTTCTAACCCTCCACCCTCTGCCATCTAGTCAATTTTAATTTAATTACTCAATAGAA
CCAAGTAGAACTGCCCCTTTGGGTTTCTGAGGCTGTAAATCTTTAAAACCTGCTTGTTTT
ACTTATACCCTACCACCTAAACCTCTCGGAACTATTTTGAAACAAATCCCAGATACCATA
GTTTATTGCTACATCTAAAAACCCAGTACATATCAATTATTCAGCCAGTAATCCAATATC
TCCATAGTCTTAATATTTTTAAGCTGATTTGTCAAATCAGGATCTCAACAAGGCACACAC
ATTTGCGTTTGAGTTCAGCAGTCTGGGTTCTCATGGCTGCATGTTTTATTTTATGCGTGT
TGTCCTCTAATGGTGGCGATTTAGGCTGTTTGCACTTCTTGTGCTAGGATAAGTAATGAA
TATCTTCGTAGGCGCTTCTTTGTCCTTGCTCAACAAAGTTGTGAAAAAGAAATGGGATGT
ATTTCTGTACATCCCACCAGCTGTGCTCCAGAAAGGTGGCATTAGGTTGCATTCCCACGG
CAAGTGCATGAGCATTTTTACTCTCGTGACATGGCAAAGGGCAAATGAAATTATCTTAAA
AATTAGTGAGATAGACAGCAGTTCAGGGAATAGAAAGATGGATGCAGGGTTTGAATATGC
CTATGACAGTAAAAAATGCCAGAGGTCTGGAAATGTGTAGCGAGGTTGCAGGCTTCTTCA
TAATTGCGTGCTCCTCAGGAGGGGTTAATAAGCTGTCTTTGTAAAGCTGCAACTAGAAGC
AGCCACTACAGGCATACGTGCTACATTATCTTCTTGCTCATGCAATTGTAGTATCGTTGC
TAATGTATACATCCTGATTTTCTGATAAATTGGCTGGATGGGCTTACGAATACTGCAGAA
TCATTTAGTTCTGGGGAGGAATGTAGTGAATTTCTCTTTGGAGTGCTTATCTATTAGACA
TTGCTCTAAATACTTTCTTTGATTAGTTTAGGTTCCCCAGAAAGGAGAGCGTAGAATAAG
TACTTAGGCTTAGGTAGATTATTGGGTAACAGTTGCAGTAATAAATAGAGGAGTTGAGGG
ATCATGGGGAGAGAGCCCTGAAGAAAATGCTTTGTTTATGGGAAACAAAGTACTTGAGTT
CTATCAGCCCTACTGAGAGGCTACAGAAGGCCTCAGATTTGTCCACCCGAAGGTAGGAAC
CCACAGACCCATAGCTCCTTTGTCCCCTTAATAAACAGTTAACTTGCTGCACTTTCTTCT
GTTTAGGTAATGTCCCACGAGGTAGGAATAAGTCTTAAAGCATAGAGAGTACAAAGTACC
CATGAGATGCCCATGACAGTGAGATGAATTGAGCCCTTGTCCAATTACTCCTTGTTGTTG
AAGTTGGAGAGGCGAATGAGCTCTGATTTGGGGCATCAGAATAACTAATTTTAATCCTTA
TAACAACCTATCTCTAGCAAGCAGAGTGTGTTCCAGGCACTATTAATACATACTGTTCTT
TAAGAGACAGTGCCATTATTTATACTTTAGGAAACTGGGTCACAGCATTTAAGAAATTTG
AGATCACATAATTAGGTCTAAATTATACCCAGACAATTTAGGTCCAAAGTCCTTGCTTTT
GTGACATCATCGTCATTTGGGGAACATCTTTATTAAGATGGAGCCCAGGCAAGCTTTCCT
GTGATAGAGCTAGTAAGCGGAATCCAATGTATAAAGAAAGTAGTACATATGATGGTTTAG
TTGGCTACCATTTATTGAGTACTTTAGAGTGTTTTACACAAGGACTTTTAGTCATTTTAT
CCTTCCAAAATGTACATGAAGTAGTATGCATAGTGCTGGGTATTGGAGGCCTGGTTTATT
GCTTAAATGATGCACCTGAATAGAGATTAGGTGTTTTTATTTTAATTGACCTGCTTCCCA
AAAACTCATATATTGCTTAAGTTGGTATGCTGATTATCAGTTTATGATCTGATCTTGTTG
GAGATTATTTACAAATTGCTTTCTGTTTGTGATTTGCTTTTCAGTCAAGCCACTAAGCAG
AGAGCATGAGTGGAAAAAGGCTAATTGATTTTGTTAGTTGCAGAGATAGTTGGATCTATT
TGTTTGGGGGGTAATATTATAATGTCATTATTTTTGTAGTCTTTGCTTATCTTTGATTAC
CTTATTTTGCACACACTGCTTACTAGGTACCAGACACTGTCTTAAGTATTTGACCTGTTT
CAACTAATTAATACTATGGGAAGGTATCATTATTTCTAGTTTATTAGGAGGCAAGTAAGA
TATATAGGTTAACTGATGAGTCTAAAGATCAGTGGCTAGTTAAGGGGCAAAGGTGGGATT
TGAACCCAAGCTTGTCTAGACCAAGAAGCAGTACATTTAGCAACTGTGATGCTAATCCTT
CCACTGTATGTTGCACTGTTTGAATATACAGTATTCATCGTTTCTTCATTTTTGTTCTTA
AAAGGAGCCCTGGTGTCAATATGAGTTAGATGTTGGGCTTCTAACCTGCCAAGTTGGTGG
TTTACACCCATCAACCGCTTTGTAGAAGAAAGATAGGGCTTACTGAACTCCTACTAAAGA
TTTAGTCTTTGGCAACTCTGAATAGGTCACTGTGAGTCGGGAATCAACTCGGTGGCAGTG
GGATTTAGTACTTTAAAAAAAGGAGAAATTCCAACTCAGAAGGAAAGATTTATACCATAG
TTGCTAGTTCGAAACTGTGTTATAATTCAGATTAAATATTTGTATATTTGTAATATGCTT
TATGAGCATTGTGTTGGTATCAAATGTCTTCAGAATGTTTTGACTTAAATTCTTTCTCGG
CAGTTACTTGTATCAAATCGCACATCTTGGAGACGATGATGAAGAGCCTGAGTTTTCATC
TGCTATGCCTCTGGAAGAGGGAGACACATTCTTCTTCCAGCCAAGACCACTCAAAAACCT
TGTTCTGGTGGATGAACTGGACAGCCTCTCTCCCATTCTGTTTTGCCAGGTTTGGACCTT
TCTACTAATTACACATTGAGTAGTGCTAACTGCTTTTGAATTTAAAACTTAATGACATTA
ACATTTTCTTCTCCCAGTTGAAATCTGGTTTATTAAATTGTTAGCATGTTTGTGAACTTT
CCAGAGTATAATGATGAAACAACTAGTGTTTAGAAGTTTGGCAGCTAAAAACTGTTGCAT
AAGTCCTTAAACTTCTTTAAATTATAAAGCTCCTCTTTAATGTAAAAAATTAACATGTAG
AAGGTGAAAGCTTGAGCGTTTGAACTTTTCATTGAGGCCGTTGATAGTAACTTCCTGTGA
CTGCTTCTGGTCATTTTCTCTGTGTCCTTAAGCATATATTATGTTTGTGTGGTATCTTTA
ATATAAATCATTCAGTACGTACACTGAGTACTTTCCTGAAATTGGCCTCGTATTCCTATC
TATAGCTGTATTTCTTTCATTTTAACACTCCACCCTTCTTTCAAATACTTCAGACGCACT
GGGATCCGTCAGTAACTTTTTAGTCACTTCCTTGAGGAGGATCCTTAGGTGGCACAGGAT
GAAGATTGTATATCAGTCGTGTCCTCTAGGGACTTCTCCCTGGCATGCGCCCTGGATTGC
TGGGGCTGCAGTCATTACTGGGACCACTCTGTCTAGTTGTTCACTCTTCTGAGGGAACAG
GTGCTTGTTCACTGTGCTCAGGAAATGAGTCACTGTTCAGATACCCGCTGGGATCACTAA
CCAGTCTAACATGAATTGTTTTCATTCTTCCTTTCTTGGAACGGGGTTTTTGCCCTGAGA
GCAGTAGGAAAAAGTATGAGTAATTCCTTTATTTGATTATAGTGGATTCCTCTCATTAGT
ACAATTTGAGGAAATAATTAGGTTAATAATTTGTATCTCAAGAACTAAAGGGTAGGCACA
TATTAACTTTGGTGCAGGGTAAGAGTTAGCAAAATTAATAGGCAGTTGATTGTACTGTAA
AGCAGGTAGTTGTCAGCTTAAGGACTAATACGTGGTTTCCCTGGTTTGGGGATTGGCCAG
CTACATCAGGGGAGTATCTGTAGATAACCTCAATAGGGCAATTGTAGTCAATTTTTAGTT
AATCAATAGGTCTAAAAACATGGTGAAGTATGGTGATGCGTTATTTAATGTCCCCGATTC
TGTGCAGTAGGACATTGTGTGGATACCATATTATGTATAGTCTCTAGATTATGAATAAGT
TCTGTTTCTAAATCTGTCCCTTTAAAAAAAAATCATTGGGGGTTCATACAGCTCTTATCA
CAATCCATACATATATCCCTTGTGTCAAGCACATCTGTACATATGTTGCCATCATCATTT
TCAAACATTTTCTTACTACTTGAGCCCTTGGTATCAGCTCTTTTTTCACCCTTCCCTCCC
CCGCCCTCTAAATCTGTCTTAAGTTGAATTTGTAGGTAGATCTACATTAATAGGTACAGG
TTGCAGCTAACATCAATTAGTCTGATGTTTATCATAATACATAATGTACTTTTCTATACA
AGGAAAACATTAAGCACTTCCAGTTACATTAAAGCATCTTTCAGATAATAATACAATAAT
TTGATGCATATCTCAAAGTAATACCTGTTTGTTATTGTGAATCATTGTATGTACCTCAAA
ATTTGAACGTAGCTATAGGTTTTATGGATGTAGGGACCATGTATATGTATGTGGTTGATT
GCTTACCAAGGGGGCATTATATAGTGCATGACTAATATGGGTAAATGCTACTTAGATGTA
CCTTCAAACTTCAAAGTGCTCTGACTAAATGTGGAGTCTGCTGGTGACAAAGACAAACAA
TAGGTAATAGTAAGGGCCCCAGTGGTGTGGTAGTTCTGAGTTGGGCTGTTACCCCAAGAT
CAGCTGTTCTAACCCACCAACTGCTTCTGAAGGAAATATGCACCTCTCTGGTCTTGCAAA
GATTTACAGCTTCAACGATAGGTTCAATAAACTAAGGGTTTGACCCGTGAGGATAGAGTT
AGGTGTGAAAAACAGCACATGTAGACATTTTTTCCCTTTCTCCTGCAGATAGCTGACCTG
GCCAATGAAGACACTCCACAGTTGTATGTGGCTTGTGGTAGAGGACCTCGGTCATCCCTG
CGAGTCTTGAGACATGGACTTGAGGTAAGACTGGAATGTCCACGTCAGCTCCCTAGTTTA
GGGAAAGCATTGAGAAGAGCGCCTGTGGCTCTGATACATTTTATGTTTCTCTGAAGGAAA
AATTCTTTTGTTACTCCTCTATATAAGTTCTTGACACTTTGAGTTTTATAGTTTTAATTC
TTATATTTAGGAAATTGTTCATCTTGAGTTAACTTTTATATATGTTACAAGGTATGGATC
CATCAGCATTTGTTAGAAACTTTTCCCCTCATTGAGTGAACTTGATTGACATCTTTTGTG
AAAGTCATTTGACCATAGATGGTTTGTTTCTGGACTCTGTATATCAACTCTTAGTGTCAG
GACAGCATTGTTCTGATTACATTTTGAAATCTGTGAGTCCTTTTACTTTGTTTTAGTAGA
TTTTCTTGTCTGTTTGGGATCCCTTGAAATTTTATATGAACTTGAGGGATGGCTTTTCCA
TTTTTTGAGGGGGGGGGATTTGTTGAAATCTTTATAGGGGTTTGCATTGAAGCTTTAGAT
CATTTTGGGTAGTATAGATGTTAACTGTATTAAATAAATTTAATAATAAAATTTAATTTT
AAAATTAAAGATGAATTAAATAGATGTTTTATCTTGTAGTAGTTTTATATTTGCTGAAAA
GTTAACAAAGTGCACATATGCCCAGGACCCAATATTCTCTTTTTTTGTCTTAAATATTTT
GTTCACCCTGGTATTAGAGGGATTATATAATCTAAAGACCACGAGAGTCTAATAAGAAAA
ACAAACATTTTCTCAAATTACCTTGTGGCTAGGTGCCCCAAGAGATGATGACATAATTCT
TTGGGAGTTTTAGAAAGTGGGATACCTTGCTGTTCACCAAGAAGATACAGGAACATTTTT
TCTAAAGGTGCAGCATTTAATGAATGAAATTGATTTAATGGCAGTTAAATTGACCCATAA
AGTGAAATAGAATTTGGATGTGGAAACTAGGAAAAGAGAGTGGTAACTTAAGAGTGCCTA
TTTCTTACCCACATGCTTACTCTTCTGCCCAAAGGAGACGCGTACATGTTTGACTATAAA
AACGGTTCCCCCCAAAAAACCAACTGTACCACACAAGTATTTCATGACTTCTCACTAAAA
AAGTTAGTCTCAGAAAGCCACAGGGTAGTTCTATCTTTTTCTGTAGAGTCTCTATGAGTT
GAAATCTACTTGATGGCAAGGAGTTTTTTTGTTTTTATGATGGGCAGTTCTTCAAAGCAT
AATGCTGAAGGCAGTTAGTTTGTACTAGTTAAGCTATTGTTTAGTTTTAAGATTACTTCA
GGAGGTATTTTTGTTTTGAGGTTTAAAGATTCTCTCAGGTCAATGGCTCCAGGAAGTATG
GAGTCTGTGAATATTTAAAATGTCATTCTGTAGTCTTTCACCTTTGATCAAGATTTTTCT
ATGGAGTTTGTGATCAAAATGTTCAGTCATGGTAGCTGGACAGCATCCATTTCTTGTGGT
CATGGGGCAAAGGAAGCAATTGCTCATGGAGGCCCTCGCCCAAAGATTCCCTTTCCTTAA
GTTCAGAATACAATCTTAGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCATGGTAGCTGGACAGCATCCATTTCTTGTGGTCATGGGGCAAAGGAAGCAATTGCT
CATGGAGGCACTTGACCAAAGAATCCCTTTCCATTAATTCAGAATACAATCTTAGCACTG
CTTTGGGGGCTTCTTTTTTGGGGGGAGTGTTATAAGTAAACAGCTGTCTTCCATGCTCAT
TGTATTTATGACTTTTTCTCCTGCCAGGTGTCGGAAATGGCCGTTTCTGAGCTACCTGGT
AACCCTAATGCTGTGTGGACAGTGCGTCGGCACATTGAAGGTAGGCAGTCCATTCTCCGC
AGTTAGCATAGGGATCTGTGAGCCATTGGCAGAGAAGGCTGCGTTCATAGTATTTCTGTG
TCCCTTTCATCTGGTACTGTTTACTGCTACACAGTGCTTTTGGGTCTTTCAGTCATGGTA
CTCTCACTTCATTTTGTATGGCTGGCTGAGGAAGCTCTGGAAGCTAATCAGATCAGTGTG
TATATATATATATATATATATGTCAGTGTCATAGAGCTGTGGTACACGATGTCCTTTGGC
TTTGCACTGGTCTTTGGAGCACTGATCCCATCTCTTACGAGACGTATGATGTGAGGGAAA
GCTGCTACTCAGTTTTTTAACTATGTTCTTTATTGTACCAAAACCAATGTAGTAGGCAAA
CTCAAGGTGTTTTTTAGATATTGGTATGCAGAGGTTTGGTACCAACCGATGGTTATTAAC
TATTCCAGGGGAATAGTTGAGCTGAAAGAAAGTAGAGATTGATTGAATGGAATACAAATT
TTGGAGTCAGGAAGATGGGAAGGAGGAGGAAAGGGAATCTGAGTTTCTAGTTAAAACCGG
TCGCCTCATTCTTAAACATTTAATGTGGAAACGTATTGTGGTGCAAGCAGAGAAGTCTTA
ACGACATTCACATAGCAGTCTCATATAAGTAGAACTCGGTTTTTGTTTTCCCTGTGGGTC
ACTCTGTGACTGGGGTCATTTCTGTTCCCGGAAGCCCATTTTCCTTTTGTTCCCTCAGGA
ATGTGAGACTGGTGAGTAATACCACCCTGGCCAGCTTACAAAGCCTTGTGGATAAATTCT
CTGCCTTTTTACTGAAATGTCGATGTTCCGGCTGTGTGGAACATTTTTAAGGGAACTGGG
AGAGCTGTAGGAGGGAAGCTTTCTTTTAGCGGGATGCACGTGTTGGGGGCTTGTTTTCAT
GTAGACAGGAATACAATCTGAGTTGCATAAAAAGAGAAAAGCACAAGTAAATAGGGTGGG
CTCATTTTATCTGAGACCTTGGTACATATGAAAACTTTTAGTTAATTCATATGGAAATGT
TTTCTAAATTCCACAGCGAACCTAGTCATTGATTGTTGCCAGTAGGTTGTCAGCTTCTTG
ATACAATAAATCTTATAAACATACTCTTTGAATTAGAAAGATCTCTGGCATAACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CCACACCTACTTACTAAGCTGAACGCTCAGCTCTTAAATCTAGTGCAGTGTTCATTTTGA
GTAGTATCTTAAGTCCTGCTGGCTTTTCAGAATTAGTTCTGTTTTCTTGTTCTGCAGTTG
TTAGAGTGCCTGGATCCCTTTCCTCTTGGTACTTGCCATCCCACAAGGAAAGGCTCGTAT
CTTTGCACTATTCTTTGCACTATGATGAGAGGCTCGAGTATGTTGCCAGAAGGGGTGAGA
GAGAGAGCATGTGGATATACCTTTGAGAATCACAGAAGGCCTTTTGGAAGCGATGCTAGA
CAGTATGCTGCATGATGGAATTTATACTTGAAATGTTTTTTTCCCCATTAAATGTCAAGG
TCTTTAAAAAGAATAATGATAAACTATATTTTTGAAAAAGATAATTTGGCCAGCTATCCA
CAAAACCAGGTCAGGATCTCTGCTAATTCCTTTTCCAGATACAGTTGAGTGAATCTCTCT
TCTGCTCTTCTGTCCACACATGCAGCCGTCTTCCAGGCAAAATACTAACGTTGGCTGGTA
CTTGGTGATGCATACTACCAATACCAAGCCTTTTTTTCTCTTCCACAGGTGGCTGGTGAA
GGTGCTGATCACCACAGGTGTGTACTTACTGCTAGGATCTACCTTGGGGTCTTGTAGTGT
ACTCAGGGAGAGGGTAGCTGCAGTTGGGTATCCACGTGCACTGTAATGATGCACCCATCT
GCCTGTATATTACATGGTTTGAGACAGACATCAGCTTCCCTTAACGAGCTCCCACAGAAC
TTGAAAAATGATGACCTCTTTGTCTAAGTTGTAGCTAGAAAACCCTAGCTTCATGCTTTA
CCTTAGAGCTATCCCAACTATAAACTATCAGTTCTAGAGAAAACTTTTATGTATATTTAG
GAGTGGGCTAAGACGAGACAGCGTCCTGAGAGAGAGTGAAGAACTAGAGGCTTAAATCAT
CGGATGGTCTCTCGTATAACTCCGGTGGGAGCTGCTTATGGAGCCTTAGTGTGCTTCAGC
AGTGCTACCTCCCCCCACCCCCACCCCCACCCCCCGAAAACAGTTCTTAGTCAATTCACC
GACACTTGGTTTTACACTGAAATCCAACTTTTAACCTATAACTTTCTCGGGATGTAAAGC
CAACTAATTTGCTGCCAGTCCTTTTAGCCATAGATGGGAGTGGAGGCAGCTACAGTGTGC
TCAGTATTCACAGGAATTGTGAGTGTTTTGTGAGAATCTGTGATGGAAAACAGCTTTCAG
ACACCTCCTTTTTGGAATTTACCAGCAAGAGTGGGACTCTGTTTGAATCCACTGGCCATT
TCTTTTCCTTTAGGCCAAATAATATGTGGTCTTAGCAAGGGGACAAGAACCCAGGCAGCC
GGCCTCCCCCGCCCTCATTCTGTTACGTGGAAGTCAGTGCACTGGTCTGTTCTGGAGGCC
TCTCTTCCCATGTCCCGAGGTAGACAGCAATCAGAGCCCTTTATCATGTCCTTTGACACA
GCTTTTAAGCACTGGGTTCCAATAATGACAGTGTGGGAAAGGATACAATGTTCATGTAAT
GATGAACATTGTGCAATTTTTGTCTGCCAGAATTTCTAGTAAGTCACTGAAGTTGGAGTC
ACATTCGAAACACACGTATTAAAAGATAAAAGACATTTGTTTCAGGAACAGCCATGTCCT
TATTTATATTTTATGAACTGAACTTTTTCTTTAAACATTAAAAGAACCAAGTAAGTATCA
GCACATGTATTATTAACTGGAACAAAAGTTTCCACAATCTCCTAATTTAAAATATTATGA
CCCCTGAGATTGATTTTCTGTCCCACTGTTAGGTTGGAACACTACTATGGGCTGCATCAG
TGAATCAGGCACCTGACCCCTCCTTCCAATAAAGAGCACAGATTTGACTCTATTAAGCTA
GAAACCATGTTCAGCTCCACCACATTAGGAGACATCAAAATTAAATGTGGGTTGGGTGGG
CCAGGGACTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGATAGGAGGAGAAGCTTGTATAGGAA
AGGAATGCTCTTTAACCGCTATGTGAAATTTGTACGAGGAACTTGGGCTTGCCTTATACT
TCATTTTCTCTGACCTTGAGAACCTCATTAGTGTGTTTATCCAACAATGTTTCATTAACT
GAAAAGCAGATTTTAACGGGATTGCTCATGTCCACTGGGTGGCTGTGTTTTTAAATAGTG
GGGAAACTAAAGAGGTCAAGGGCCGACAATATAAACAACTGTTGCCTCCACCCCCCCACT
TCCTGGATAAGTCAACATTCTCCGTTTCCAACCCTAGAATGGCGTGTCTCACAGAGGCCT
AAGTAGTCTGTTTCTTTCATTGGAGCCTCTGCGCCCTCGGGAAGGAGCTCGGGATCTTTC
CTGGTTAAGAATAGTTTTTGTTTTTAAGAGTAAAGTTTGATTAGTAACTCTCAATTAAGT
GAATTCTGTCTTCAGTATAAAGAATGCTGGTGGCTTACTGGTTAATGTCTCAGCTGCTGA
CTGGAGGGCTAGTGCTTTGAATCCACCCGGCAGCTCCACAGGACAGAGGCTTGGCACCCT
GCTCTCATCAAGATGACCGTTTAGAAAACCCTAGGAGGTCATTCTCCTCTGTCCCATGAG
GTTGCTGTGAGTCTCAATTGTAACTTTATAGCACCCAAAAGCAACAGTAGCTTTAATAAA
CTAAGGTTATATTTAAAATGTCCTTATTCGTGTGACTCCCATGCCATGCTCTCCTTATTT
CTCTAGCAAAGTCTCAAAAAATATTAATTTCAGAGGTATTTGAGATGTGTATATGTAATT
AACATATATTTGGATGTGTTTACATGAGCAAAATATCTGAAGGGTATCAGAGCTCTCACT
TATCTTTTGGTTCATGCTGTGCTGTTTGCACATGACTGTGTGTGATGACTACACACAGGA
GTTTCTTGCAAGGTTTCTCGGTGAAAGCTCTTACTGCTGAACTGACCATTTGGCTTTGTA
ACACCTAGCTAACCACCTCCTGTCGTCTCTGCCTTTTTCCAGATGAGTTTGATGCCTACA
TCATCGTGTCTTTCGTGAATGCCACCCTTGTGTTGTCCATTGGAGAGACTGTAGAAGAAG
TGACTGATTCTGGGTTCCTTGGCACCACCCCCACCTTATCCTGTTCCTTGTTAGGAGATG
ATGCCCTGGTGCAGGTGAGGAGTGTCGGCGCTTGAGTGCCTGCTCAGTTTACTTGGTCCT
TATGAAATAAGAAGTACGAAACAGGTTTTTTAACATTAAAAATTCAGTCTTTCAGATTTT
AAATCACTGAAACAACAACCGTCCAGCTGCTTTCAGGGAGGGGCATCTAGTGGGAACATC
CAGGAAGCTGATTGAAGAATTTTTGGCACTTAACATCTGCTTTCTACCATTGCCATGCTT
GTTACAGAAACACCTTGTTCCTGCTTTCATCTGTTAAAAAAAATTTTGTTAATGAATTTT
GGATTTTCTTCAAGGAGACTTTGCAAAACAAATTTTTTTTAAGTTGACTTGCTTGGAACC
ATATTAACTGTTTTCGCCACTGACCCAACTGGTGCCTAAGCCTGGCTCTGAAGGGAGGCT
CATTCCTTCCATTATTAACTTTAGGTCTATCCAGATGGTATCCGGCACATACGACGCAGA
TAAGAGAGTCAATGAGTGGAAGACTCCTGGCAAGAAAACNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTAGG
ACTGTTTGCAGCCTCTGAGAAACGTTGAGTGGTGCCCAGCCCAGCCGGAATCCTTGTGCA
TCGCGCCTTTGGGGGGGACTGAGAAGCAGGATGAGCTGGGTGAGAGGGGCTCTATTGGTT
TCCTCTACCTGAATATTGGGCTACAGGTAAGAAGAGGTCTAGACGCTCCCAGACCTTCTG
TAGGTTTTCTGCTCTCCTTCATTTCGATGTTTGGGTGGAGGCCTTTCCTAGGCCTGTGGC
TCCAGGTGCCTGCTGTATGAAAAGTCAGCGTTGCTGATCTCTCTTCTACCTCCTCTTGCC
CCACCCGAACAAAGGTGGTGGACTCGGTGGCCCTCTAGTCACAGGCCTGGCACATGCTTT
CTCGAGTCTTCATAGACTGGCTCAGAATTAGCTGAGGACCTCAAGGGTTACCCGCGGTCC
CCCATATGTTGCATGCCAAGCCCAGGGGGACCCTAAATCAGATTTGCCTCAACTTTCTCC
TTTGGAGCGGCTGGGAGCTTGGTCCTCCAGCCTTGTGATTCGCAGCCCCGTGCTTACCCA
GTGCCACCAGGGCTCCACACTTTTCTAGTAGGTGCACAAGCAGGCGACTTGGTTTTACTC
AATGTCCAAAGTGCCCCTGGTGTGTGTTTTCATGCTACACCCTGAAATAGCACACTGCAG
TTTGGGAGGGCGTGGGGTGGAGGGCAAGAATAGCAGGCATTGTTACACATTATTGTTTAG
GGGTTCTTTTTCTTCTGAGTTTAATTAACTAGGTTCCTTTCTAAAGACAGATTTTGCTGT
ATCATCTCTTTGCTTACTATGAAATACAGTTTATGCACGAAGACAATAAATTACTCATTT
CTTTTTTAGTTAGTACCATAGCAACGGACAGTTGTGACATTTGGAGGGGTGGAGTTGTGT
GTGTGTGTTAAGTACTATTATGAATGAACTCAGGCCTTTTTGTGTATTTGCTTCAGACTA
TTGTAGCTTCATTCCTGGATCCCTATGTAGCCCGATTTTAGGTTTTAGACCCGTGTGATT
CTCTCTCCCACCCCCAGTAAAGTTGCACTGTTGTCCTTTGGTCATCACTTCACCGCCTTC
GTGGCTTCCTTGCCTTGTGGCACAAGGTCTTTTCCACACCTGGACCTCTCTCCTCATGCC
TGAATTAGCCTTTTCTCTAAGAAGTCGTGCTTCTCTTAGTAGATACAGAGTCTAGCATGT
ACTTTTAAAAATTCTTAGAAAAATTCTATTATGTTTTCTTGACACTCTTCAATGAGCTGT
TCACTGTTTAAAAAGTTAAGGATACAGGACTAAACAAGTGCTTTCACTTGGCTATTTGAA
TAAATGCCTGTCAGATTTCATTGGAGTTTTCTTCTAACCTCTAAGGCTCTATCCTTCTCA
GCTGCTTTGAGTTAAATCAGAAGTTTGTCGCCTGATTGGTGAGATGAACCTCTGTCTTAA
GTAGTGACTGTAACTCTCTTCTACTCAGAACGGTGTGCTGCTGAGAACTGTTCTGGACCC
TGTCACTGGTGATCTCTCTGACACTCGAACCAGATACTGGGGTCTCGTCCTGTGAAGCTG
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTGGAGGAT
GTAGGTCCTGTATACGGTGGTTTGGTGTTCCCCTGAACGATCTAAGGCTTGCTTTCTTTC
GTTCAGGTATTAGCCCATGTCAAGCCGGTCTTGGCTGAGCTATTCCTACCAGTCTCGCTT
CCATCTCACACCCCTGTCCTACGAGACCCTGGAATTTGCATCTGGCTTCGCTTCTGAACA
GTGTCCTGAGGGCATCGTGGCCATCTCCACAAACACCCTGAGGTGAGTGCCGATGTCTTT
TTTGCCATGGGGTTATGCGGTGGTTCTGCCAGAGTAGGTGGTGAAGAGGTGGCAGAGAGC
CGACACTTCATGGTCTTGGTGTGTTGTAATTGAAACTTTCATTTGGCTCCTGTTCAGGGA
TTGATGTGCCTGGAAGCCAAGTTTCGGTGGTTGGAGTTCTTGGTTCTATTTAGATTTCCA
GGGCTAGGTTTTAAATAATTAGCAGTGCAGTCCAATCTTCTTGGAATCCAATATACTTAT
TTTCCAGAAAAAGGGTTGTACTCTGGTGAATTGGAATAAACTTTGGATCACTGATAACTT
TTTCTCACTGCCTTATTAGCTGCAAGTCATTCAAGTCCTGGTGGTAACTTTTAGCTTTTC
GCAGTTGGATTGTGGCCACTTCATAAATTAATCCAGGGTGCATAGCTTTCAATGTTTTTA
TGTCTTTCCCACGATCATTGGTCATTCTCTCCTAACCTTAAAGCATATTTGTGTACTGTA
GATCCCAGCAAAATTGGTTATTTCTCTCTTCCTTAGCTCTGCACCTCCCCCAGCCAACTT
CCCCCAAGGGCATCTTCACCTGTACTTACCACCCCTGCTGAGCCCGAGCCTCAGTGGCCC
CCGTCCCTCACCTACTGTTTGTTTCGTGTGCTTGTGTTCCCTGGCAACTCAGAAGTTAGA
GGTAGACAAGCTTACATTCTCCAGATGGTTTTCCTAGCAGCAGCGCGTTCTTTTTCCCAA
ATAATTTTTCAAGGAAGGTCTCTTTGGAACATAGTGGAAATCCTACTTCCTAGAGTACTT
GCTGTCAGAACAGGTCACTTTCTCGGCATCGAGCCTTGTTCTATACATGTTTCCATATAG
ACGTACCACAGGGTTTCAATAAATTCTTGGGGGGCCCGGGGAGAATGGAATTATTTCGCT
TTTTCAAGCCCCTTGTACATTTTTGTTTATCTTGGCTATGTATCTTAAGAATGGAATTTC
CAATCCATAGAGTAACTAACTATATTTTAGCTTTTTAAGGAGTGCCAGGCTTCTCCATAG
CATTTACATTTTTACCTGCAGTGGATGGGGTTTGAGTGGACATACTTGTTTTTCATATAC
AATGGCAGGTACATTGCTTTACAGCATTTTCCTTTCCCTTCACACTTTATCTTGGAAATA
ATTCAGTAGAAGGACTAAATGGCCCTCTCTTTTATTTATTTTTTTCACCAGAGTGTCTGC
TATATGTATGTACAAAAACTATGAAAATCTGTCTCATGGCTGGTTGTTTTACAGTGGTTA
GCATATAACACCGCTGTGGTGGAAAGCCTGGTGCATCTCATTCCACATGTGTCTCAATAG
CGGACGCATTTCGGAAGTGGGGTTGTTGGGACAAAGGGTACTTCCCTTTTGTTTGGCTGA
TTGCATATGCCTCCTTCCTTAGGGTTTCACTCAGCTATGAGCCTCTACACCGGAGATCCT
GGTTTCTCATCTCTGACCTTTGCTGGGTTTAAGGGTTCCATTTTTATTGGAGAGTTTACT
CTTGCCATTATTGCTTTTCTTGAAATTTTCTATTTTTGTTTGTTTACCTTTTAATATAGA
GGGTATTTAAATAGGAAATAAAACTCCATCACTGGAGATGAGGTAACTTTTTTTTTTTTA
ATTAAATAATCACTTTATTAGGGGCTCATACAATTCATCACAATCCGAACATACATCATT
TGTGTCCAGCGCATTAGTACATATGTTGACTTCATCATTCTCACAACACCCGCTTTCCAC
TTGAGCCCTTGGTGTCAGCTCCTCATTTTTCCCTCACTCTCCCCCCCCCCCCCCGAACCC
TTGATAATTATAAATTATTATTATTTTAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGA
CCTCAGAGTTAGTGATTGACTCCATCCAGTGGGTCATGGAGAAATACCTGCGTCTACTCC
TATAAAGTCATACCGTGATAACCTCGAGGGGCAGTTCTACTCTGCAACACTAGAAGTGAC
TCAAAGGTAAGGTGTTTGGCCTCTCCTTTTGTTTCATGTTGCCAGATGCTAATATTAGAG
CTTCTGGGGATGGTGGGTTTGCGATGACCCCCATGGTTCTTTTCAACACCATTTTCTCAT
CAGCTTCAATTCCGACCAGGACCGCTTCATCCCTCCTTAGACAGCCTGGTGGCCCCCCTT
TCTCGGGAGGTCACCATATTGATGCCAAACTTAGTGCAGATACCCGATTGGCATAGCATG
CTACAGCCCAGAACTCAAGCGATCCCCTAGCCTTAGCCTCCGAGTAGCTGGGACTGCAGG
CATGCACCACCACGCCGGCAATCAGCACCATTTCTGACTCCTCAGTGAACGTTCCTTTAA
CTACCTTGCCTTCTGCCGTAGGATTTTGGCTCTGGAGAAGCTGGGTGCTGTCTTCAATCA
AGTCGCCTTTCCACTGCAGTACACACCTAGGAAGTTTGTCATCCACCCTGAGAGCAACAA
CCTTATCATCATCGAGACGGACCACAATGCGTACACGGAGGCCACAAAAGCTCAGAGAAA
GCAGCAGATGGCAGAGGTAAAGAGACTGACTTTCATGGGTTAAATTAAAAGGCGTTCATG
TGAAATTGTGTTCAGTTTAAACCCCTGTGACTGACTGTCTTGCTTAAAGATCTCTGTTCT
TTTTGGGTACTTCAGAAACACCCTTTGCCAAGCCCCTGATGTAGGGGCTTGCTTCTGAGT
CTGACTAACCTGCCGGCCGGGTTTCTTTGTCATTCACCTGTCAGCCTTTGGGCTGCCTTG
CCAGGCTGTTACATGTTTTCTGGATTCAAGCCCAAAGCAGCCAGCTTTCATTTTCACCAC
AGCACCAGTTCTTCCCAGAAATCGCCACAACCATGTAGATCAAATCCTGCCTGGACGCCA
TAGTCTTCCCCAGGGAACTCGCACCCTGCTTTGTAGAAAATGGTGTTTTTATTTTTGTGC
TACATGTCTGCTGGTCAGGATGTGACTTCTTGCCTTTGTTCCTTTCTGCTAATAGTGACT
AAGAGCAGACAGCTGTGGTAAGATGGCGTTTACCCTTCAGTGCGTTCCTCTTTCTTATCT
ACACACCTGCCTCTCATCTTTCGTTTGAGACTCCTGTGTTGGGCTTTTTGTTCAGGATGA
ACCCCACAGGAGGTATTTACTACCTCTCTCCTGCTCCCAGACCCTGCCTGTGGGCACACT
GACTCCTCCGTTTCCTTCCTCTTTGGACTTAGGAAATGGTCGAGGCGGCCGGGGAGGACG
AGCGGGAGCTGGCGGCAGAGATGGCTGCTGCGTTCCTCAATGAAAACCTCCCTGAGTCCA
TTTTTGGCGCTCCCAAGGCTGGCAACGGCCAGTGGGCCTCTGTGATCCGAGTCATGAATC
CTATTCAGGGGAACACACTGGACCTTGTCCAGCTGGAGCAGAATGAGGCAGCATTTAGGT
AAGGCGCCCAGGACATCCAAGTTAATAGGCTGGGGCTGGGCTTTCCTAGGCTGGGACCGG
TGCTAAGTGCTGCTTTCTCTCCGTGCAGTGTTGCTGTGTGTAGGTTCTCCAATACTGGGG
AGGACTGGTATGTGCTGGTTGGTGTGGCCAAGGACCTGATCCTGAACCCCCGATCCGTGG
CTGGGGGCTTTGTCTATACCTACAAGCTCGTGAACAGTGGCGAGAAACTGGAGTTTTTGC
ACAAGGTAGGAACTAGCCGGCATTCTCCTGGATCTTGGGTCCCACTGCACCCTCCCACCT
TGGCTGACAGTGGGTCAGGTCTTCTGGGGACTGGCTGGGGTTGGCATGCCCCAGGACTGT
CCTATTATGTGTCCAAGATCCACTGGAAAGGAAGCTTATGTGCCCCCAGCTCACTAATCT
TACTAAGCAGAAAGCAGTTCCTGACCAACTGTGTTACTACAGAATTCATACACACCGTCT
ATAAACAGGGCTCCTTCCGCCCTGCCAGAGGGAGTGTACTCTACCTTCTCACGTGGTCTA
AGATGTAAGAATTAAGAAGTATTATATGTTTTAGTGTGTGATTTAGCTAGTTATCCAGTG
AGAAAAACTAATTAGTAACATCTGAACTGCAAAAGATCCACCCAGCAAGTGACTGTTGCC
AGCCTTTTGAGCTCTAGAGCCCCAAGTCGTTTCCAGTTAGGTTCTTTTCCCACCACTTTT
GAGACATAGTATTTGATAGTGCTGGTTAAACCAAGCACAAGCTGCTTTTGGTAATGATTG
GTCCCCTTCCTCGGGGAAAGGCAGCACCAGTTTCACCCAAACCCTCTGCTGTAGATACTG
CTTGCTGCGTGTGTGGTTGATTACACTGAGGGACCCAGGATTTTCACTAGTTTGTTCTTC
ATGCCAGGTGCCTGTGAAGGACGTGGTTTCAGGGTCATAATGGTGGGGTAACGTGTGGCT
TAGTGTTCTTCCAGCATCTCTGTTCTGTGACCGGCATTTTCTCTCTCAGACTCCAGTTGA
AGAGGTCCCTGCTGCCATTGCCCCATTTCAGGGGCGGGTTTTGATTGGTGTGGGGAAGCT
TCTACGAGTCTATGACTTGGGGAAGAAGAAGTTGCTTCGAAAGTGCGAGAATAAGGTAAA
GATGTGTGGTGGGGCTGGGGTCTAGGGCTGGGCAGGGTGGTGAGCATCAGCTACAGAAAA
TTGTCTTTTCATAAAAGTTTGATTGGCATATATTTCACATACCATACAATTTAATCGTTC
AGAAATTCTGTGATGAGTTCTCCCAGAATCTGAGCTTGAGAGGGCAAGGGAAGCTGCATC
TCATTTCTCAGCTTCCTGCAGTCAAGAACCGGTTTCTAGTCTGTTTGTGTTACAGAGAGT
GCTTCCGACACGTGGACTTGCACTTTTACCAGGCTTGTAGAGCCTTCTTGCTGTGGCCGC
TCTTGGCCTCCACATACTCCAGTCAGGTTGAGCTGGCCCTCTTGTGGATCCGGAACTCCA
GCATTGGACCCATTACTCTCCTTGCTTTCCAGCACATTGCCAATTACATCTCAGGGATCC
AGACCATTGGGCACAGGGTAATTGTGTCTGACGTCCAAGAAAGTTTCATCTGGGTCCGCT
ACAAGCGCAATGAAAACCAGCTCATCATTTTTGCTGACGACACCTACCCCCGGTGGGTCA
CTACAGCTAGCCTCCTCGACTACGACACTGTGGCTGGTGCAGACAAGTTTGGCAACATTT
GTGTGGTGAGTTGATGTTTACTTGGGTCACAGTTAAAAGGGACGCTGCTTTAGTTCTTGA
TCTGAATCAAGCTACGGACCCAGGACTGAGCCTTACTTAATATGAGAAGGAAATAAGTCA
CCCGTTACCATCCAGTTGCTTGATGCTTGGCAGCGACGCCATGTGTGCCCAGGAGAACTG
CTTTTCAGACCGTTTTCAGTGGCTGGGATTTGGGGGGTTTAGATTGCTTTTGGGTGGACT
TGAACTTGTAACCTGTCATTTCACACTTGAGCACATTAACCATTGACACCTGAGCACATT
AACCATTGCACTCCCTAAGAGATTGTATTGAAAGTGAAATGAGGGTATACAATTCAGCCT
TACTAAGACTGGGCTCTACAAACAAATATGGTTTTTTTAAAGCCTTGTGGATTTTTCCCC
TCCCCCTACAACATGAGTTCACAATCATTGTCTTCCTTTGGGATAAAGACTACTTACATT
TTGCTGGTCTCATTCAGTCTAGCCTGCCTTCTGTAGTTTATATTCCATGGTCTGAGTTTT
AACCTTTTAGTGCGATTTGGGGGACCTTTTACTGAGTAAATGGCATTGGTTGCTGTCTCC
TTAGTGTTCCGGCCCTCTTCACACTTCCTCGCTGTGTTTACGCTTCCCTTCCCTCTCTCC
TAACCCTCCCTCCTTCTCAGCTTGTTTCCCCGGCAGATGCTGCCTGGAGCTCGCTCCGTT
GGTCGCCCTTGGAGTGTGCATCTCCTTACTGGTGGTGGCCATGGTCTTTGTCCTTCTGCT
CTCCGCAGTATTAGACACCACCCCCTTCCCCGCTCAGGAGTCGATTGATTCTTTTTGGAG
TTTCTCACTCGGCCCCAGCTGTTGCCCACCCAGAAGGCCTCTGGGCCTGGGGGAAGACCT
GTTGTTTGGTGACCTGGATAAGCAAGTGCCGAGCCCCGCCCTTAGAACTGTGTCGCTTTC
TTGTAGGTGAGGCTCCCACCTAACACCAATGATGAAGTGGATGAGGATCCTACAGGAAAC
AAAGCCCTGTGGGACAGAGGCTTGCTCAACGGAGCCTCACAGAAGGTAAACTTCCAGAAG
GGTCCCAGGAGGGAAGATACAGGCTTGTGTATTTCTCTTCCCCACCCCCTTGCCCAATGT
CCTTAACCAGAGAACCCTATTTCGCTTTCCCATACACGGCCTTTTCTTTTAGGAAATTCC
AAGCAGACAGCAGTCGCCCTGGAACAGATGGGTTTTGGATTTATCATAAGACACAAATTC
CATCCTTGTGCCTCATTTTCTCCCTGGAGCATGGAGAGTGGGCTGGACAGGCTCCCTCTG
GCACTGTTTCTCAGAGATGTCCTGTGCTGTGTTTTCCTCTGACAAGTGTTAGACTCGTAT
GGTCATGCCTTTCTGGACAGGTCAGGCTAGAGCTGTTTCAGAGTTCAGTGATGAATCTCC
TGGCCCACCCTCATCCAGTTTTCTAAAGGTTTTATTATAAATTTGACAGTTATTTAAAAG
ATCTTTGGATTCTGATTGAGTTTGAAAAATGATCCAATATCCAGACGTTAGTAGATGATG
AAAATATTTTAAAGTTGGGGGTCATTTTAAGTTTTTATAATTTTTGAACTTCAGAAGATT
GTGAGAATGGCTTGCTACTGGCATTGCTCCTACTTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTTGAGTGACAGGTGGTCTCTTCCTCCAGGATCATGACTTCTTT
CAGGCATGTGGAGATGCACCTCAGGTCTGAGCATCCCCCTTTGTGTGGGGCGGGACCACC
TCAGCTTCCCGGTCCCTATTACTTTCCCGTGAAAGGTAGGTCTCTGTTGGGAATATGGTT
TGAAGGGTGATCCCCAGGCATTGTGTGAAAAGCCCAGAACCCATCCTGAATGAAGGACAG
CCAGTGGGGGGCTGATGGAGGCATCGATGGGCTGGGAGGCTGATAGCGTTGAGTAGTCTC
TCCCTTCAGAAACGACTGGGTACCCGGTTTTGCTAGTCTGATCTCGGCTAATGAAGATGC
GCTTAGAGTTCCTGGTTCTACAAATGACACTTAGGGATTTGCAAGAGAACGTTCATTAAA
GCAGTTGCTTCAGCATGTGCCATGTTCTTGGGGCATTTACTTTCTTTTCTTCCATCTTAG
AATGTGATTGATGGAGACCTCTGTGAGCAGTTCAACTCCATGGAGCCCAACAAACAAAAG
AATGTCTCAGAGGAACTGGACCGAACCCCACCCGAGGTGTCCAAGAAGCTCGAGGACATC
CGGACCCGTTATGCCTTCTGAGCCCTTCCTTTACTGGTTGGACTTGCCTGGGGCTCTGTG
TCCTGTTCCCCTCAGTACTACCACCACCACTCCCTGGCTCTACACCCATGTGCCAGAAGT
TGGCTGGATATTTCAGACTGTGTGATATTAAAGCTGAGAGCTCTTTCTCATCGACACTTT
CCCTGCAATGATTGGTTGCCCCTAAAATTGGCACTAAGGTTGCTAGATTGTCCCAGCCTA
GAACAAGATGCCTTGCCCCAGATTCCAGTGTGGAATGGGATGGTCCCCTTTACCAAAGCC
TTCCCCGGCATTGATATCTCTTGATTCCTGGCTCTCTGGTCTACTTTTGTATACACCCTT
CAGTTTTGAATTGGTTTTCCTGTAAATACCGTTTTGTACAACGTTACATTTGTGGGAGGG
TGGGGGATCAGATTGAATATAGTCTAATTCCTGAGTTCTGCCACTCCGGCAGGGGACCAG
ACATATAAACCATGTTTTTCGAGTGGCTAGTGTCCATGTGTCTTCTGTGAGCCTGTGCCG
AAGCAGGAAGCGTTGCGTGTGAGTCCTTCTGGGTCCTGCTAGGACACTTGCCACGTGTAA
CCCCTTCCTCTCTGTGCTGTGCCCTGTGATGGTGTTTGGTGTTTCCTCACCCATTCTGCT
TTGCAGGTGACGGGGGCTCAAAATCAGCCAGGTTGTGTTCTCGACTTTTGCGTGCTGAGC
ACTCAGGAAGGGTGGCTGACTCACCTTTCCTGTTGAGCTTCAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 3566..3892, 4513..4685, 5269..5410, 20824..20936, 21037..21174, 21275..21378, 27723..27888, 29928..30023, 31887..31959, 36402..36553, 36984..37013, 37015..37056, 37159..37242, 37343..37498, 51359..51505, 52828..52893, 52896..52949, 53886..53894, 53896..54041, 56781..56955, 57632..57837, 57928..58084, 58849..58974, 59372..59584, 60546..60644, 61845..61988, 62625..62642, 62644..62688, 62690..62708, 62711..62732, 62734..62734, 63060..63200
1001..1070, 3566..3892, 4513..4685, 5269..5410, 20824..20936, 21037..21174, 21275..21378, 27723..27888, 29928..30023, 31887..31959, 36402..36553, 36984..37013, 37015..37056, 37159..37242, 37343..37498, 51359..51505, 52828..52893, 52896..52949, 53886..53894, 53896..54041, 56781..56955, 57632..57837, 57928..58084, 58849..58974, 59372..59584, 60546..60644, 61845..61988, 62625..62642, 62644..62688, 62690..62708, 62711..62732, 62734..62734, 63060..63197
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved