Echinops_telfairi Locus CCT6A
snOPY snoRNA Orthological Gene Database
Echinops_telfairi CCT6A
Echinops_telfairi
CCT6A
GeneScaffold_4777
SNORA22, SNORA15
15729..15862, 19680..19815
23198
TATGCTCCAAAGCATGGATAAGTCTGCTACTCTTACTAATCCATGGTGTGAAATAACAA
AGCTAATATCTACAATACCACCACTGATAGATGAGGTGCTGGTTAAAGGAGAGGCTCTGA
GTTATTGTATCTTTGATATTTTCCAGGAGTTTTGTCAGGATGACAAGTATAGGGAAGCTG
GTAGACTGGTCCTCCTCTTTAGCCCCCACCTCAGTAATCCACAGAATTTACCAGAAAGGA
CCTAAACAGAGAGAGATATTGCTGACATTTGGTGGATCCTGGCCCAAAGCAGAGGATATT
AGCAAGGTGTACCCTTGTGTTTTATTGACTATGCAAAGGCATGCACCTGTGTGGATCATC
ACACATGATGGATCACATGACAAAGACTGGGGACTCCAGAGCACTTCATTCCTCTCCTGC
GGCACCTGGGCACAGAGCAAGAGGGAGGCATTGGGTTAGAAAAGAGAGCACTGCGTGGAT
TCAAGTCAGGAAAGGAGTGCATTGGGTGTTTTCCTTTTACCATCTTTGTTTAATCTGTAT
GCTGAGCAAATAATTTAAGAAAGTAGACAACACTAAGAGGAATGCAGCATCGAGATTGGA
GAAAGGCTTATTAATAAACTGTGATATGCAAAGGACACCGCTTTACTTGCTGAAGCAGTT
AGTGAATATCAAAAGTCTTCAGTGTGGATTAAATCTCAATAAAGAAAATGAAAATTTTGT
AACTGTACCCAAAAAACCATCACAATAAGTGGAGGAAATATTGAAAGCAAAATAATTTTA
TTTGGACTAACAATCAGTGCCCAGGGGAGCAGCAGTCAAGAAGTCAAATGATGTGTTTTC
ATTGAACAAATATGCTCTTTAAACTGTCAAAAAGGCAAGAATACCACTTTGAGGACTAAG
GTATTCATTATAAAACACTCAGGTGGTGTCCCAGCCATGCGGAGTTGACCCTAGGGTTTC
TGTAGGCCAGCTCTCCTCCTCTTCCTCTGCTGCCCCCGACCATGTCGACTGTTAAGACCC
TGAACTCCAAGGCCCAGGTGACCCAAGCCCAAGTGGCACTGGTGGTCAACATTAGTGTGG
CCTGGCGATTGCAGGATGTTCTGAGGACCAACCTGGGGCCCACAGGCACCANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNACTGTAGTTTGGGTAAAGTTGACAGAGTAAAATGCCGTATATACTCG
AGTATAAGCCGAGCCTCCCCCCCCTCCCCCAGCATTTTAATGCAGTTTTGGAGGTAAAAT
TAGGGGCCTTGGGGGATATTCGGGTCAGCTTATACTCGAGTATATACGGTAGCTTTCTGT
TCCAGCAGTTAATTTTGTTTTGTCCACATTTTAAAGTCCATTCTTTGAAAGGTCTGTGAA
AATTAAATTATCTGGTGGTGAATATTTCAACCATTGGAAGGTTTGGAAAAGGAATGTAAT
CTATGATAATACTGACAGGATTATTGGTCAGCCCTATGGCCGGATAGTTTGGATCCGGGC
TCTTTTATCATTTTTAATCTGTTAAGGGATGAAATATGTAATTGTAAAACGTGCTGGGCA
AATGAGCTGAAGTATGAGGTCACTCAGTTGTACATATAATCACCCACGTTCCACAGTCTC
CACAGTTGAAATCTGGGAGGGGGACATTACTTGCCCATGATTTGATTTCAGAATAAAAGC
CAGAATTTTGATAATAGTATGACATCCCGTCAACATCCCCAAACCAAGCCCACTGTCACT
GAGTTGATTCCAACTAGCCACCCTATGCAGGGTTTCTAAGAATAAATCTTAATGGGAACA
GACACCACCAAACTCACCGCCTTCATGTCAATTCTAACTCCTGGTGCACGACTCTATAGG
AGGGCAGGGTAGACCTGAGCCTGTGACATTCCTAAACTGTTAAATCCTTACCGTGGTAGA
AAGCCTCATCTTTCTCCTGTAGAGAAGCTGGTGGTTTAGAATTGACCTCGAGGTTAGAGT
CCAATTCAGAATCTACTGCGTCACCAGGGTGCTTGTAAATATCTTTAATAAGGGCTAGCT
GAGTAGGGGCAAGTGGTTTATATTTATCAGACATAATGGTGGCCTATGCCATCAGGGACC
AATTGAAGCCACAGTTTAAACTTGAGGTCACTCAGAAAAGTCACAGCTGCATAGCAAGTA
TGATTACTGAGAACAACTATGAAATTTGCACATCTTGGACCAGAGGCTTATTTTCTTTAA
AGCACATGACAGGGAACACCCATGTGCCATGTATCTTGGGTCACCAAATAATCATCGTAC
CTAGGACATGGATGCTCAGTAACTGCCATCTAAGGTACCATACATGATTGTTTTCACATT
GTCTCTTCAAATGTAAAGCCGTTTTCCCAGATGGTGAGCTGAAAGATCTGTCTGTAATAG
GACAGTACGTGCGTCTGGTGCCTTGCACGTACACTAAAATACTTAGTCTTCTTTTTATTA
TCATTACTGTGGGATTTTTAAAAATCATTTTATTGGGGGTTTGTACAACTCTTATCAGCA
TACATCCATTGTGTCACGCACATTTGTACATTTGTTGCCATCATCATTATCAACTTAAGA
GTATTCTTACCAGAAATTTCCAACATCAAATTCAGATACTGAGGCAATCGCCAAGATGAC
TGGTCTGGATGTTTTTAAAAGGAGTCTCTAAAGATGTAACAGGCCTGGTGACTCTTCAGA
TTAAAGGACCAGATGAGAGATGAGGTGCCATGGAAACCAGACTGTGCAGGAGCCATTGTG
GGATAGTGCTGGAGGCATGGCAGATACTCTGCCCATCCCTAGCTCCTCCACAGTGGGGTT
GCTTCTGTTGAAAGTGTTTGCAACAGGACTTCTCCAGTTGCTAGTTTGATGTCTTTTTTT
TTTTTTTTTTTTTTTTATGTCTTAATAATACTGGAGGCTGCTGAGCTTTAATTTCAGGAG
CACACAGAGCTTGTTAAAAGAGCCTGAGTCTGGGGCATGGACTTGAACTTGTTACTAGTT
CTGGTTAAGTGTTTGTCATTTACTCTGAAGAGTACATCTTCACCAAGCCGAGCCTCGTGT
TTCTTCATCAGTAAAGTGTAGATACATATGGGACCTAAAAATGCGTTGAGCGTTGCCATC
CTTGTGCAATAATGGTTTGTACTGGTCGCTCTTTAATCAAAGTAAGGTGTAACCAGGGAC
TTTGTTCAGGTTGTTGCATTTAAACTGGGAGACTCTTTCTTTGAAGTTATTGGTGTGTTT
TTTCTGCTTACAGCAAATTCAACACCCAACAGCCTCCTTGATAGCAAAAGTTGCCACCGC
GCAGGATGACATAACTGGAGATGGCACCACTTCCAACGTCCTGATCATCGGGGAGCTGCT
GAAGCAGGCCGACCTCTACATTTCTGAAGTATACACGCCTCTGCCACATCTGAGTTGTAC
TGTGTATAGGAAATGTCTGAGCATTTCAGATAGCAGTTGAGGGTTGTGTCTTAGAAGCTG
AAGAGTGGAGGTTTTACATCTGGGAAAGGGACTGTATCCAGGGTCTGACCCTAAACTTAC
TGTGACTTGGACAGGGTTGTAAAACCCTGCCTCAAGCATGAAAATAAAGAACGTGGCATC
AATTGCACTGCATGTGTAAATTTTTAGTATGGGCAGAATAAATCACTGGAAGTGCAGAAT
TGCGATCTACCGGGCCAGGAATAAGGGCAAAGACCAGAACCTGGATAGACCTCCGTTGGA
ATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCTAATGCAAACCTC
TGAGGACTGTTCCGATACCAGAAAGAGCTTCCTGGAAGAGAGAGAGCAAACACTGGGCCT
GCTTGTGTTTCCCATTAGTAGTAAGATGATGTGAGTGAATTTAAGATGCCCTGTAGATTC
AAAGGCACTGTTCCTCACTGAGTGCTAACCTGTTGCGACCCACTCTAGGGTTTGGGTTCC
TCTCTAGGGTCGCACAGTGAACACCCGAGTGTGCTTTGTAGTTCCCTTGGCCTTGACACT
GTGCTAGAGCAATGTCTGGTCTTTTCCTCTGCATTGAGAGGCACGTTCATCCTTTCAAAT
GTATTCAAAAGGCCAGCACATCTTAATTGTAGTAAATCTTAATTCCAGAATGCTTCCAAA
AAATAATTCGATCCTTACAATGAACTGTTTAGTTGCATCTGCCAGAATAACACCAGGAGG
GTTAATCTTATAACTGTTTATTTTAGGGCCTGCATCCCCGCATAATAACCGAAGGCTTTG
AAGCGGCAAAGGAAAAGGCCCTTCAATTTCTGGAACAGATCAAAGTCAGCAAAGAGATGG
ACCGAGAGACACTGATCGATGTGGCCAGGACCTCACTGCACACGAAAGTCCATGCGGAGC
TTGCTGATGTCCTAACAGAGGTATGTGTTGGATTCAGAGCACACTGGTGCTGGGGACCCT
GCGGGCAGAGACTTTGGTGCCCTAGCAGGTCCACTTGCACAGCACCGCGCAAAGCCCTCA
AGGTGCCGCAGTGCAGGACATGGATTCCTTCTTGCATAGGCATGTGGGGTCTCCTGTCCG
CGATACTGGCCTGGTGTCTCTGAAAGATAAAATGGGGACATCAACACGAGGCGCTCTAGG
CTACAAGGGTCTTTAAGTGGCACCTTCGTTAAAAAGTACCAAAAGGAGGTTCGATGATTC
AAATGCTTTTGGTTATCAGTATTTGTAACAAGCCAATAGGAAGCATGTCAGGGCTGGTTG
GGCAGTTGCAAATTCTTGTAAGATTTTGGGGAATGTAAGTGAGGCCCACCTTTATAGATC
ACATGTCACAGGCACGTCAACAAAGACTTGTGTTGGATCCGAGATTGTAAAGGCAAGAAA
CTGTTGGCTTCACACTTCTGCATCAAATTGATGGGGCAGTATTTTCTGTTGTAGGCTGTA
GTGGACTCTATTCTGGCCATTAAGAAGCAAGATGAACCCATTGACCTTTTTATGGTTGAA
ATCATGGAAATGAGGCATAAATCAGAGACCGATACAAGGTAGGTGGTAAGCTACTATGAA
ATGCTGGTGAAGTGTTCAGAAATTGGCAGGTGTTGGGTCATGTATATGGTGTATTTTCTT
GGCTGATTACTTCTCTTTGGATTGTGTACATTGCCTAGGTGAATATTACTCTTGGTAGGA
TTTCCTCTGAAAAGGAGGTTATGGCAGGCAATGGGTGCCGTTGAAATGGTTGCTCGGCCT
GAGTACAGAGCATAATGGGAGACGGTTGGGAGTGGGGTTTGAACAGTCCTTTGGGTGATA
ACCCCCTACCATTGGGGACCTGTTCGCTGTTACTGTCTATATGTGGGAAGGTGGTTATTT
TTATTTGGGTTGATTTGGTGTGTTTTGTTTGTTTTTTGGTCATATTCTAGAATCATCTTA
ACTTTTCACATGTTGTGGACATTTGCATATTCTTCTTTCAAACCAATTCCGGCTTCATTC
AGATCATTCCAGAAATAAAACTGGTTGTCTCAGCTCAATGTGGTATTATTTACTCTTGAT
ACACCCAATCAAATATGGTAATTGGTCACCTCATATGTTGTCCTGTGTTTTTTGACAGCT
TAATCAGAGGGCTGGTTTTGGACCACGGAGCCCGACATCCTGACATGAAGAAAAGAGTGG
AGGACGCGTACATCCTCACCTGCAATGTGTCCTTAGAATACGAGAAAACGTGAGTGCCTG
GTCCTTACAGACCAGGTGAGGGAACTGGGCAGTGTATTGTGTTCAGGGCACGTGCCTGAG
TGGCTTCTTCTCCACAGCCAGCACAGGAATTGCCTCGCTGTGTCTGAGAGAATTATGGGA
AAAGTACCCCAGAAAATGACCCAGAAGGAAGTGTAGCTCTGTGACTACTTGTGACATCTC
CAGGCAGCTGCAGTTGCTTCCTTGTTGTCTACTGCAAAAGTTGTTAAATATAAACAGACA
CGCACCATTTGTCCCTTTAATGGGCAAAATCCTTTATTTTGGTAAAATAGTCCAAAAGAA
AACCCACCTTTTTAAAAAATCATTTTATTGGCTTAAACAACTCATCACAATCCATCCGTC
CATCCATCCATCCAAGGGTACAATGACATTGATTTCTGGTCACCATGCTAGGAATCCTTT
GTCATGATTTATTTCAAAATGTATTTTCAGCACCCCAAACAAAGCTCATGGCCCTATAAT
CAGTCTTTCCCCCCCCCTCCCCACATAGCCTTTCATGGACTGTGTGCGGTTTCTGTCCTC
GGCGTGATGTGCTGGAGCAGACGGCATTTGTCCTTTGGGGCTGGCTTCCTTCACTTGTCA
CCGTCACTTTCCTTTTTAACAGAGAGGTGAACTCCGGCTTCTTCTACAAGAGTGCGGAGG
AGAGGGAGAAACTGGTAAGAGCCGAGAGGAAGTTCATTGAAGACCGAGTGAAGAAAATAA
TCGCGCTGAAGAAGAAAGTCTGTGGCGATTCCACTAAAGGGTTTGTCGTCATTAACCAAA
AGGTGAGGTGGAGCCAACATGGGTTCCATGAGGTGATGCCGTTGCTTGGCGACATCCTTT
CTGCTGGTGAGATCCTGAAGTGATTTTATTGTTGCTCCAGGGAATTGACCCCTTTTCCTT
AGACGCCCTGGCAAAGGAAGGCATCGTGGCCTTGCGCAGAGCCAAGCGGAGAAACATGGA
GAGGTAGAGTGACCGCCCACTTCAGCGATGCCACTGACAGCTCAGCTCGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCTGCTGGTCTTAAACTGTGGACAATCT
TTCACTTGCGTATCTTAGTCAGGGGGCTAGCACAGAGGGGCTTGAGGGAAGTGAAATGTT
TTTCCCCAGGGGCTTACCACCACTCAGTTGTCCTTCGCAGTAACACTGGTTCTTGCAGGC
TTGCTTTAGCCCGAGGGGACACCTCTCTTCAGTAGGGTGACTTTGAAACTGGTCAGATTT
TATCTCTTCACAAATCAGAATAACTGAAAGGAAGGAAGCATTTCTGTATACGATGCCTTT
GGGTCACAGCAAAGGGGTATTTGCTGACTTAGGGCCCAGGCCGGTTTCACTGCAGAGGTT
GGGAAGAACCATGTAGGTGGGTGGGAGCATCGTCTGGTCTGTCAGGCAATAAGGGACATG
AAAGGGGAACTTTGTAACAGAATATCATTTTACTATGGAATCCTGAAAGATCGCTTCCTT
TTAAAGCTTTCCTAAGAAGCTTTCCTTTGAACGTAATAGATGCCACTCCTCATGTGTCTC
CCTCACACTGTGAACATTTCAGACTGACGCTGGCCTGTGGCGGGGTGGCTCTAAATTCAC
TGGACGACCTGAATCCAGACTGTCTAGGACACGCAGGCCTTGTCTATGAGTACACATTGG
TAAGTGTTTTCTTCCTGAAGGCTCGTGAATTTCTCAGCAGTGCCAGTCAGACAGGCTCAG
GCCAGATGTTACTCCGCTCACATAGCTTTTGATGATGTATGTGTAGCAGGACAGCTGCCA
TGTGTGTGACTTTAAAAGATTGGTGTTAATGGGATACAGTGTTGTGTTAATTCTCTTCAG
AAGCCTCCGCCCCTTTCACTTGTCACAGCCCAGTCCCTATCTGGCAAGGCCATCTCTTGT
CCACACAGGGAGAAGAGAAGTTCACCTTCATTGAGAAATGCAATAACCCACGCTCCGTCA
CGCTGCTGATCAAAGGACCAAACAAGCACACACTCACTCAGATCAAAGATGCCATCCGAG
ATGGCTTGAGGGCTGTCAAAAATGCCATTGATGATGGTAAGGCCTACACGCTTGTCCTGT
TTTGTTTTGTTTTTATTATCCCGTAATTGAAAGCCTGTACCCTGGGAATGGGACCTGAAC
GCATGGCCGAATACTGTGTTTTTTTATCCGTAATCTACACAGCCAGACACCATGCCATAG
TATCATTTCCCTTTAACGTACTTCCGGTGTGCTGTGTCTTCTTCGTGGCATATCATCTGT
AAAGGTGAACACAGAGATAACAAGCAGCTTTATGCTGGATGTAAATGAACAATGGTGCTG
TCTGATAACACTTTAAATTCCATTTTGCCACAAACATTTTTGAAGCCTCCTTGTCTTCTG
GCTTCCAAATGTACTGTATTTGAATTTCTCCGGTCTTAATGAACTCTCACTAAGTGACTT
TAGTGCAGTGGTTCTCAACCTGTGGGTCTTGACCCCTTTGGGGGTCGAACGACCCTTTCA
GAGGGGTCACCCAATTCATAACAGTAGCAAAATTACAGTGATGAAGTAGCAAGGAAAATA
ATTTTATGGCTTGTGGGGGTCACCACCACATGAGGGACTGTGTGAAAGGGTCGCGGCGTG
AGGAGGGTTGAGAACCACTGCTCTGAGGTGTGCGTTGATCTACAGGTGCTTTCTCCGCTC
TCATGATCGATTCCCCAGTGTTCTTTACCATGTCACATAACATTGCTCGTCCCCCTGCTC
TCTAGGCTGCGTGGTTCCTGGGGCTGGTGCCGTGGAAGTGGCCATGGCAGAGGCTCTAAT
GAAGCACAAGCCCAGCATCAAGGGCAGGGCCCAGCTTGGAGTCCAAGCATTTGCTGACGC
GTTGCTCATTATACCCAAGGTGGGGGGACCTTTGTGCACATTTTGTGGGGGGCAGGGAGG
TACGTTGGCTTGCATGCTACAAGGTCAGCAGTTGAAACCCACCAGCGCCTCTGTAGATGA
AAGATGAGGCTTCCTGAAACCCACTAAGGCCACTCTCCGCTGTCCTACCGTGTCAGAATT
GTACTATGAGTCAGAATTGCCTCAGTGGCGGTGGGTTTTGGACCATCGTGTGGATTTTGA
ATGAGCATGGTTGAGTTTTCTCAAACCCCACACCACCACCACCAGCATGGTTGGGTCCTG
AGGCAAGGAGACTGCCTTCTGAAGGAAGGCTCAAGTGGCAAGAGACAACTGGATTTTTTC
CAAGGGCTTGTGGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNAGTTTAGTTATGCACCATCGGAAGACCCTGCGTCCACGCTGCC
AATGGGTCATGAGAAAGGTTCGTGTCTTTTGGAATAATGAAAATGTGTGTCTTTCTAGGG
TTCTTGCTCAGAATTCCGGGTTTTGACCTTCAGGAAACGCTAGTAAAAGTTCGGACTGAG
CATTCAGAATCTGGTCAGCTTGTGGGTGTGGACTTGAACACAGGTAAGATCCTAAGGGAA
GAACCATTGATAAGACAGGTGAAGTGAAGCATCCAGGAGCAATCAAGAAGAGGGAACCAA
AGAATCTGAGTGCTTGCGCGGTACTGCACCACTGCTACCTTGGGTTCTAAATGGGACTAA
AACCTATTAATGACATGGCTAGGTGTCGGAATTAACGGACCAGATGTGAGCAGGCGTTAA
CGTTTCAAAGCGTACCAATTTGTTGGGAGCGGGGGTTGGTCGGTAGGAGATGATTTAGGG
TAGTGCTTACTGAAGGGCTTGCCATATCCTATTTCGATGAGGAACTTTGGAATCTCCCAT
CTGAATTTGATGAGAACACATTCGTGGGTGGAATATAACTGAAAGATGAGATCAAATCTA
ATGGCATTTAACTGGAGCCAGAGTGAAGCCTGCTCTTAAGCTCACATAATAACAGATTCT
ACAGGCACACAGTAGACCCGCAGGAACGGGGGACAAGTGGGAGTAGAACATTTGGCCACT
GAAGAGATGGTTTTTATCCTTGGAAGTCTTCAAGTAATGCCCAGGGGTCATAGTGTGGAG
TAGAAAACAGGCCCTGTAGGAGCTATGGGAGTCCTCCCATTGGTTATGACCGATCAGTGC
TGAATCAACCACTTCACTGTGGGTTTACAAAAACAACTCATTTTCAGGTGAGCCGATGGT
GGCTGCTGAAGCAGGTGTATGGGATAACTATTGCGTAAAGAAACAGCTACTACATTCCTG
GTAAGTTTGAGAAAGCTTAAACCTTTCATAACCTTTAGCTTATGTCTTGTTTTAGCCCCC
TCCTCCCCTCATAACTCCCCAATTTAAAATGGGAACTAAAAGTAGACAGGCTGAACTGGT
CCTGTGTGCGTGGAGGGGGTGAGAAATGAGACCGGGGTTGTGCATGTGGGGGCGTTGGGT
TGTGGTTGGAATCTCCTCTCTCAGCCTCCTCATTTCTCCTGTTCAGCACTGTGATAGCTA
CCAACATTCTCCTTGTGGATGAGATCATGAGAGCCGGCATGTCGTCTCTGAAAGGCTGAG
TTGAAACCAGCCTGCCTCATATCATGGGGATCATGGAAGATTCTACAGAGTGATCCTAAG
AACAGAGCAATGGGATTTTGGTCCAAGCTGAAAATTATTCTCAAAGGGATTTTCTGTTCT
GATGTTGCAACGGGAGATCACGGTCAACTTAAATTCTGGAAGTTCGTAAATTATAATTAC
AGTATTTTTTAAATGGCACTGAAGTATGTACACATAGACTAGTGGTTCTGCCCTCGGAAA
GAAGGGATGGTTTTCCTTTAGCTTACAGTACACTTAGACCATGCATATGTTAACTCCCTT
GTCAATAAATATGTCTTCAAAAATCACTTAGTGGCTTAATTAACTGATCCAATTTTATAC
TGAACATTCTAATGTCAGCACATTTTTGGAAGCATCTCCATGTCTGGTACACATTCCTCT
GAGTATAGGGGCTAGATCCATTGGATTTTTTGCATCTTGGAGATAGCTTTCCTAAAAGGC
CGCCTCCAAAAGAGAAGCTTATACTCTAGCACAGGGGTCCTCAAACTTTTTAAACGGGGC
CAATTTACTGGCCCTCAGACCCATTGGAGGGCTGGACTATAGTTTAAAAAAAAAACTGAT
CAAATTCCTATGTATACTGCACATATCTTATTTTGAAGTATAAAACAAAACTGGGCAAAA
ACACCCAACGGGCTGGATAAATGTCCTTGGCAAGCCGCATGTGGCCTGTGGGCCATAGTT
TGAGGGCCACTGTGTCTAGCAGGTGGAAAGGTGGGTGCACTGGAGGCCAGGGAGTGAGGG
AACAGCTAAAAAGATCTCTGTAGGCATAGTGATAAGAAAGGGTGAAGGTGTTGGCAGTCT
GGCTGCCCATACTGGCACACCTCTATCTTTGCTTCCATTGAAGGGTCCTCTGGCATCAAC
CTTTTCTCATCCACGTTCCTATTGCACCTCCTTTCTCCACAGAACTTCTTAGAGTTGGTT
TATTTCTGTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1128, 1231..1239, 1340..1403, 14953..15087, 15986..16159, 16674..16777, 17338..17448, 18082..18241, 18340..18422, 19102..19198, 19448..19595, 20285..20418, 21059..21078, 21080..21162, 21827..21899, 22126..22198
1001..1128, 1231..1239, 1340..1403, 14953..15087, 15986..16159, 16674..16777, 17338..17448, 18082..18241, 18340..18422, 19102..19198, 19448..19595, 20285..20418, 21059..21078, 21080..21162, 21827..21899, 22126..22195
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved