Echinops_telfairi Locus CALB1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi CALB1
Echinops_telfairi
CALB1
GeneScaffold_1646
SNORA42
35725..35858
46377
AAAAAGGATAAGTAATGAGATGTGTGTGTTAAGGCCATAGAATGGGGCATTGGCTGGGT
CACCAATTCACCCAGGGTGAACTTGGGCCAAATCCTTAGTTTCTCTTTGTTTACTCATTC
TTCCTAAATGATAGTGATAAATTATAGTATGTCTAAGATTACTTCTTTTTCTAACATCTT
AAGGTTTTATCATTTAATTCTGTCATCTTCCAATTATAATTCTCTGTCGAACTAAAACAA
AACAAAATAGATCATAATCCTGCTTTCTCGTGTTGGCAAGATTAATTCATATAAACCAAT
TTAAGGGAACACCCACATGATGACATTCACAAGCACAAATAGATAGTTATTAATATCAAC
AAATTCATTGTCTACGTTAATCAAATTAACTGAACCCTTGCCAGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCTCACCCACGCTCAACTCCTCCTTCA
CACTCGCGCACACTCACTCGCAGGCGCACGCCCGCTGTACAATGGCAGAATCCCACCTGC
AATCACCCCTGATCTCAGCCTCACAGTTTTTCGAGATCTGGCTGCATTTCGACGCTGACG
GTGATTATCTTTTTAAATATTTAAGATCCGTTTCCTCCCCTGTCCCTCTTTTCCGAAGCC
TTTTTCTCCCCCCCCCCCTTCATTTCTTTCTCCCTTTCCCCAGTCTTATCTCGTTGGGTA
CCCGCCTGAAAGTTTACATGGCTTCTGTGTAATCCGAAAAACCTTAACTTTTGTCTCTAG
AAATGGTAACAGTAAGCGGGAGGCAGAGAAGGGGAGTGGGGTGGGGGTGGGGGACGCCAG
AGTCAGCACCGGAGGGTCTGGTCCCTCAAAGTTTCCATGGCTGCCTTCAGAACCCCAACA
TCCCTCTTTGCCTTCAAGGTAGCCAAAGTTCTCCAGCCGGGGAAGGGAACGTTCATTGCG
ACTTGTAGCAATGTCGAGGCGTGAGAAAATAGTTCCGAGTCTCCGGGAAAATAGTTATCC
TGGAAAGCGCACAGGGAGGAAACTCTGAAGATGCTTGCAACCTGGCTGCCTTTGTCTTTG
CAGGGAGTGGTTATCTGGAAGGGAAGGAGCTACAGAACTTGATCCTGGAGCTCCAGCAGG
CACGGAAGAAGGCTGGATTGGTAGGTTCGAGTTTGGGAAGGAGGAAAATAATAATAATAA
TAATAATACCTTCCACCGTAAAATAACAAACATCCTTCTGCTTTTCTAAAGTGCCTGCAA
AGTCAAGTGGTTCTTGGTGAACGTAAACTTCTATTGACTGCCATCTGAAAGCAAGAGCGT
CCTTCTAAATTGGTAGTAGGGGAAGAGGGGGAGAGAGAGAGATTTCCTAAAGGGAAATGC
CTTACAGTCTGAAACCGGAGCTTTTAAAAGATGTATTTCTATACTTGTACTTTCTTAAAT
AGCTCTTAAAAGGAAAGGGTGGGTGTGTGAAATCCTTTCGCAGATCATCACCTCTTGTAC
CACGGAGTTTGTTAGGTAATTTTTAACTTAACGTGTACTGTATGAGAAGCGAGGGGGTGG
AGGTACATTTCTGCCCCTTGGTGGTCAGGAAACAGAGCTGCAGACATGGTGCTCGGTCCT
CTCGTCAATTATGATGGCTGGGATGGTGAAAAGATGAGCAAATGTCCTCTCCGTGATCCT
CCTCACGGAACAAATTAGACAGCTTACAACATAGCAATGGCGACGAATTTACCAAGAAGA
GGTCTTCGTTTCTGTGGGAACAGAAATCCAAAAGTTAGAGATAATAAAAGTAAAAGCTTC
ATATGTTCATATATTTTTTAAGCATCGTGATACTCTACTGAGGAGCAATATAAGCTTAAT
GTGTGATTTAAACTAATAGTTAAACAAATAAACCATTAATTAAGTAAAAAAGTGACTACC
ATTAATTATGAATAGCTTCCTCTGGGTTTGTATTTACCTGTGAAGAAAAACAAAAGGTGG
TCCGAGTTAAAATAAAATAAGATCAGCTTTAAATGTAGGCAAAAAAAGTTGTATAGAGGA
AAATAGGTTAAAAAAAAAAGCCCACTATCTACTGAGGTTTATGTAACAGTGCCTTTCAGA
AGCCAATGTCGCCTACGGGCTACTTCACTATTATTGGCCTTCAGCCTTTCTGACTATAGT
TAGAGACTTTACATTGAAAGGAAAATATATGCACCCAGAAGACTGTTTAATAGATCATCA
CCTTTAGCTCTGAGTTTTATAGGTATACAACTGGGTAATAGGATTACCTTTTGTTTTTCT
AAATTGAATATTGTGTGATACACATCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGGGGGACAGTTAAAAGAATACAGAGCTCCCTGGTATTCACC
AGCCAAGCCTCAAATGGTAAGCCCGTTGAAGCTCCGACTATTAAATTATAATCCTTCATA
CGAAACAGGCACAGTTAAAGAATTATATCAAGTTGGTTCAAACCTGATTTTCTGATGACT
TGTTTTGATATTGCATAAGTTCTGCATAGTTAAAATTTAAACCAATATATGGATCAAACG
TTTCATGCAACAGACATTTTTCACTATCAACTCCATTGTATTTAACCTGTATTTGCATTT
CCTTTACCATAAAGGCTGAATCTAGAAACCAGGGTTCTCAACATTCCTTGCTATATGATA
GCATACCTCACTTTATCAATGGAAAAATGCTCAGCTTTTAATATTCAAAATATGAAATGT
CAAAAATATTAAATATGAGAGGGCTTGAAAACCTTTGTAGAAAAATTCCATTATCTTTGA
ATTCCATCTTTCCATGAATTTTGTGAACCTCCCTCATGTAAGTGAATATAATGTTAATGA
AATACAACCAGTAGATTTTCAAAGACTACCCTTTTACACTAAACATTTGGTTTCGTCTTT
AAATTTGTATTCATTTTTATAAAACTTTATTTATTACTATTATCATTATATTCTTACACT
GTTTGAAACATAGATCTAGTTATAATTATGACCCAGAGAGTTCATAAACTAAATGTGGAG
TCTATTTGCTTATATTACACCTTCTTCCAGATTTCAGAATAAATGCTTGGTTTTCTGTTA
CTTTAAGGGATGTATAAAACACTAGAAACTGGTAGTCTCACTATTGCTCGTAAGAATTGT
TTTAATTAATGTATTACAATTGTTCCAGTAATAAAATATAATACATGCAAATTGCAATTT
ATCAAGAGTAAATGAGGTTTTTACAAAAGGCTACCATATAATTAAATTGTTTTGTTACCC
TGTTACCTTAATTATCCTAAAGGCATTTACATTGGATCAAAACAGATTTCATAGTACTAG
TACTAATGACTTTTAGATTCAACATACTCCTTAAATTATTATATTAATCTATCTTTCCCT
AGTGTATGTCTGTGTGATAGATAATATCACCTTCTTAGTAATGATGAACACTGAGACCTT
AATTTACTGTCCCAAGGACACAGAATAGGGCACTGGTAAGAACTGACCTATTTTAAATAG
GCTTCAGCTAATGCAACAGGGCTATTTTAAATGGGCTATGTTGGAGACTCATGGGTAAAT
ACTCAACTTCCTGAATATTAGTTCTATGTTCATATCAGTAGTTTAGAATTCATAGCTCTC
TAAACTGTCAGTATGTGAAGAGCTTATATAAGCAATCGAAGGGATTAAAAAACAAGCCAA
AAGAAAGTATTAATTTGGTCAATCTTAACCAGGTCTTGCTGTATTAAATGCAAGGGAGAG
AGAACATCAAAATAGAACCCAGGCAAAAACTGGAAAACTCCCTGAGTTACCACTGGTAGC
AAAGATCTTAAGCACGCATAATCCGCAACATAAAACAAACCCATTTCTTTTGTCTGTATC
TGATCAAAGCGCAAATTGATCGAGTCGTTATCTGACATATCTTTCTCATATGATTTTCTA
GCTTACTTAATTAATGCCATTTTGATTCTAAAAATAGTTTTTGCTGACAGTCACTCTTCC
ACATTTACATTTTCACCTGTCCAAACAGAAGTCATTGATNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGAGATACCATGATCACGAAGGTGGTTTTAACCGTTGCGAGGCTTA
TCCATTGCACTCCGGATGTGCTGACCCCTTTGATTTCCCCAAATGTGGGAAACGCGACTG
CATAATTTGTGGTAGTGGGGGACTGCGTTCGCGCTCTCCCTTAATTAAAAAATTAATTAA
AAAAAATTATTCTAGAACAAAAACTTTATTAACAAATTACAGACCAGTGTTTGCTTCACA
ATTTCATTATCTTCTACCATACACATCTCAATTTTATAAATGAGATGCATTGAACAGTAG
GATTTGTTTATGAAAAATCATGTTAAGATCAGCTTCATTGGCAATCTATTTCATAAAGTG
AGAGGTGGTTATTTACATATACTTAATATATATATACATATATGTTAGACCATATTTCTA
AATAAGACTCTATCTTCAAGTACTTTTTAAACAATGTTCATAATCATTAACATTGTGACT
ATTGGTACTTTAGTTAATTTGCAATTCCACAGTGGTGGGTGTAGTATCTCTAAGCACATC
CTAATTGCTTTCCATTTGTTTCGCGTTCATCATTGTTCTCCCTGAACACACCCATGATGC
TTTAAGGAAAAAGAAAACAATTTAAAAAGTAATCATATTTTCCTAGAGGAATAAAAGTAT
AATGTAAAAGCTCTCAGTCTGATTCCAGCCCTGATGTTAAAGCTTTGTTAAACCTCAAAA
ATAAAATAGAAAACAATCCAATTTTCAAATATCCTCTGATGGCCTAAGAACATTCTGTTT
TTCTTTTTCTTTTCTTTTCATTTAAATCCTTTTATTGGTATATACTTCACATATTATATA
ATGTAATCTTTCTTTCATTCATATTCAGAAGATTTTTGCAATAATCACCACAATCAATTT
CCGAACATTATACTGTTTTGTATTCATTGTTTTCAGCTCACTATCTCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAATGCGCTTTACACAATTGATGTGTGTATGGATTGTG
ATTAGAGTTGTATGAGCCCCTAATAAAATGATTAAAATATACATATATAGATAGATAAAT
AAAAAGTGAAAACCATGGATGTCTTATCTGACCTTTCAACATGAACTCTCTCTATGGAGG
ATGACTTCATACAGGAAGTCTAAATCCAGGAAACAAAACCTAGAGCACGCATCATTTCTC
CAACGGGGTGCTCTCAGACTTGTGCAAGCATTGGTGTTTACATATCCTTTTGAAAACAGG
GGCATTTCAACTACTTCCTATAACCTACTAGAGACAGTGAAGGAAAGCTGTGTCCAGAAA
AGTTAATAGGGTCATGTTTTTAAGGTGCCATATCGCAATCATAAGTATGCTCTTAAAAGA
GTGTTCTCGGTATACACAGCTCATGAAATTTTCTGGCTGTCTACAACATTCAGTCACAAT
ATACCTTTGATTCAAAGAACTAACCTGGTTTTAATATAATCAATCTTATAAGACACTGGT
GATGCTTATTTTTAAGCAGCTACGACAAAGAGAGTTAAGGAAGGACATACTATTATTATC
CTTGTAATTAAATTTCTTCCCTGGAGTATACACTTTCCCCTTTTCCTATGGCATCTCATT
ACTATATAAATAGGTAAATTAATGGTAATGGGACTTATAAAATTAACATAGAAGCTAACT
AATCAGAAGATGATATCATCAAGGATAAGAAAATAATGTTAAAAATGGACATAAATGACA
TGAAATCAATCTAATTATTCAACATGATTATTCTAAAATCAGTGAAATTATGGATTAGGA
GTTTTGAGTACTTCCTAATAGTTGAGGAAGGTGGTTGTCACCCTACATTTAATGTATTTC
AACTTGGAGGGGTATAATGAACTCAGTTATTTATTCTAGTTAATTTCTCCAGAAAAAAAT
TTGGTTGTGAGGTAATGTAAAGGGCATGATGAATTCAATTCACATGGATTGCACATTCTT
AAAGGACAAGCTAGATAAATCTGTTTTGAACCCAGGTTTTACTATATTTAATATAATTTG
ATAGTTCATGACTGTATAATCATTCAGAAAATGATTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTGCTCCAAAGATTCGAAAATATAAAACGCTTCAAAAATTTG
AAGAAGAATTTCATTATTCTCTCTTCAATGTTTCCACTTCGTTTTGAACACACACACACA
CCTGCCGCACTCCATAACACGGTCAATGTTCAAGTTCTGGCCGGAATGAAGTTGACCTGA
CAATCTTTCCAGGCGATCGATATCCATCTCAAAAGGGTTAAAAGAGGGAGTAGATTATAT
GAGCAGATGTGATTTCTTGTGTAATTTTGGTGTCCTTTAAAGTGATTTTAAATTTCACAG
ACACGAGTTCTGTAATAGAGTGTTAATAATTCCAACATGGAAAGGATTAGTCTCAAAGCC
TTAAGTGTGAGAAATTCTGGTTTGCAGAAGGCAATATGGGATGACTGTGGGAGCCCAAGA
CCCATCTGTGGGAACTACATAGGAAATAGCTTCCGGTGGTCTCCTCTGTCCACAATTGAG
GGATAAGAGGAAAGTGGTTACTAAACAGAATGTATTCAAGAGTTGAATATAGATGATCAA
AGGCATAAATTTGAGTTGAACAGTAAAAACTTTGTCAGCAGATCCCTTCGATGATGCATG
CTGGACCTGATCTGGTTTCCAAAATGTTCAGTATTTTTGGTTTGTATTGTTTGGTTTAGT
TTTTGTTTGTACATATCAAGGTGCATCCCAGAAGGGGATAGGTCATTTGGCGTCACCTTC
TTGAAGATGTTTTTTTTTTTCTTTTTTTCGTATATGAAACCCAGGATTAATGAACCTAAA
AAGAAAAAAAAATGTACGAGCACAAACTAGGACGGCTAAAATTCCAAGATAATTTAACAA
CCACTGTAACAGTCAAAAAAGGATCTAAATGCATTCAGGCTTATACTCTGTTGCAGAGAA
AGCTAAATAAAACAAGTAAAGATGAAAATGGAATGATTTAGCAGATTTTTCTTCCCTGGT
GCTCACATTTGTATAGCTAGTTCCCTTAGCTGGGTGTCAAACCTGAGAGCTTTCCTCCCG
ATGCTTTCAGTAATGTGTGGGCACGTGCCATCCTCTCACTCAGCCTCATTGTTCAGATTG
GCAGGTCAGTGCTTCCACTGGGGGAGAAAAAATAGATCTAAAAGCTATTTTAACCCTAAA
CTGTAACAGCCCTCCCAGGGAAGCAAGCACTTCTCTAGCCTTTTCCCGTTTTCTTCTACA
TTGTGTTTGAGGCTATGAGTTTAGCCAGGGTGAGTGTAATTTTCCCCTGTGAACTACTTT
CCACTTCAGAACCTGGGGAAATGTCTGACAGGGATATCTGGTTAAAGACTTTGCTCTGGC
GAGGGATTTTAAATTATTTATTGGAGAAACTTTTCTGATGGAAGATTTTAATAGAGGGTG
ATGAGGGTAAGCGATGAAGGACCCAAAAACATGAAAGACAGGATGATTTACTTCAACTCT
GACTCAAGCCATCAGCTATGTGATAAGAGTCCATTTAGCCTCCTGGAGCCTCTGTTTCAT
CAGCAGTGAACAGGGATGACACTAGATTAACTTCTCAGTGTTGTTATGAGCATGGAGAGT
AAACGAGATAGCACAGCCAGGAAGACAAATGAACCCAGGCACACTACAAACAAACAACAC
CTGTACATAGTTGCTATCCTTTGTTTTTCAGTAACATACTGAAAATATGTACTATTCTGT
AGAATGTCAAGATATTTAGCCACTTTTATAGTGTCAAATTCACTTAGAACTAAATTTATA
TGAAGATTCTTTGCCTTCTAAATAACTGAAAGATCAGCAGCTTGAACCTACCCTAACTGC
ACAGGAAGGACGGGGCGATCTGCTGCCCTAATTATTACAGCCCAGGAGACCCTGCGAGCC
ATTCTTCTCTGCGAGGGAAAGCCACGATGGGGCCGAATCAACTTGACAGCACACGACAGC
AGCACATCTCCTGAACTCACATTTTCACAGGGTAGATAAAAAATGTCTCTCGTTTCTAAA
TTTTTTAAAAAGTGAATGATCTCATGGATGGGTTTGGATTGATGGCAGGCCCGACCCCAT
GGGCTTCTCAGAGTGTCCCATGCCAGAGCGAACTGTAACCCCAAACTATTACCTGGCTTT
GTCCCACGGGCATCGGGCACTGAAGTGGGTTGCACAGTGAAAAAAAAAAGTGAATGATCT
CCTAAAATATGTTGAAAGAGGTTTATGCATACCAGACTGCCTGGAAGACTTAAGGATAGT
CACGTCCACTTTGAGGTACCTACCCTTGTCATCTATGTCTCCAGTTATGTTACTCTTCCT
GCACATGCTCCTTGAACCTAGGACTTAGCTTGTTCATTGTTTTATCTTTGAAACTGTGTG
TTTACCCATCTGCTTCCCTGTAAGGTTCATATTAGCAATGACTGTGAATTCCCAGTATCC
AGCAGTATGCCTTGTAGTTCTGAATCTCAGGTGAATTTCAACCTATTTCAAAACCGAGAC
AAGGGATTCATGTTATGAATAAGATTAGAAGAAAGATGTTAAATTCCCTGTCATCAGTTC
CTGGGAAGCAGATTCTGAGTTGAAGATTAGCACAAAGAGATTTATTAGGAAGTGTTCCTC
CGTGATAAGTAGCTCTGGTGGTGCAGTGCTTAAGGTGCTCATCTACTAACTGAATGGTTG
GCAGTTCAAACCCACAAGCAACTCATGGTGGATAAAGATGTGGCAGTCTGCTTCTGAATG
ATTACAGCCTTGGTAACCCTATGGGACATGTCTGTTCTGTCCTACAGCGTCGCTATCAAT
TGAAATTGGCTTGATGGCCACAGGTTTGTTTGGTTGGTTTGGGTTCTTGGAATCAATACC
TGTGGAGCGAAGGGAGGGAAAAGGCAGGGTACAGGATAAGGCAAAGGGTTATGGTAACAC
AGCCTGAACAGAGGCCTCAACTGGTCCTTCAGTGAGCTCTGCAGCTGGGATCACCCTTCA
GAAATGCTTCAGGTTTTGTGCAAGAAGGCCTTTACAGTCCCATGTGCATCCGTTATTGTT
GCAGCATAAAACTCTCTTCAGAGCAGACAATCTCAAAGAGGACTGACAGCTGAGGGCTGC
CTGCGAGCAACACACCTAGCACCAGAAGGGTGCTCTGGGTGGCATGTAACAGTGTTCACC
CCCCTCTGTGGGTAATATGTTATTTGAATCACAGCGAAACTTGTGAGACTGGAACGCAAT
GGGATTGCCTTATTTTTTCTGGCCTCTCAAGTTTCCTACCTTTGACAACGTACAATTTAA
CCACTTTGCTAATGCCTATTTTAGTGGAAAATAAAGGAACTCTTCTTGTCTGATAGGTTT
CTGCCTTACACAGGTTCCCGTGTCCATAGGCTGTCTGGTAGCTCTTTAAAAACCCTGTTT
CCATGACTTTGGAGCCTATGTTGAGTTGGATAAATGGTCAATTGTCTTTATTTGTTGTTT
CAGTGAAATATTTACAGATGTTAGGCAAAGAAAAAGAGCCCTCGTGGCATAAGTGGGTTA
CATGGTGGGTTGCTAACGACAAGTTCAGCAGTCCAAAACCACTAGCCACTCCAAAGGAGA
AGAATGAGGCTTTCTACTCCTATGAAGAGTGACAGTCTTGGAAACACAGAGTTTCCAAGA
CAGTATCTGCCCTGTCCTATAGGGTCACGATAAGTCAGAAATGCCTGAGGGCAATGAGTT
TGCTGTCTTGCTTTTGAGAAAAGTGACAGTAAATAAAATACATGACTTCATCCTCAAATA
GTGTCATAGATTAGTAGAGGGACAACAAAGTATGAAGAAGTTTTGGTTTTCCTTTACTCT
CCCCAACAGTTCCCATTGACATAAAATTCACACATCATACAATTCAATAGTTCAATCACA
TGAAGAAAGATTATACAATTATCATCACAATACATTTTAGAACATTTTTTATCAATCTTG
TACTCATCATTAGTAGCTCCCAATTCCCTTCAAACCTTCTCTGCCATACCTTAAGAAACC
ATTAATCCAGTTACTGTCTCTACAGATTACCTATCCTGGATCCCAGTGACATTCAACCAG
TTCTCATATGTGAAACTGGGAAGGAATCTCCTTATGATCAGACCTACCTGTATCTATCCC
ATGGAATTCTTTTCTCTCTTCTCCAACCAATCAAAAAGCTGGGAGAGTTTATGAAAAAGC
AGAAATGCAGCCCAAGAATTATGAAATCACTAATAAGCTTGGGTCAGGTAGCATTTGGAT
ACTTGCAGCAACAGTAGTCAAGAACCATGGTTGAATAGTGGATTCTATGTGGGGCTGCTA
ACTGGAGGTCAGCAGTTTGAGTCCACCAGCCATTCTATGGGAGAAAGACAGGATTTCTGC
TCTCATAAGATTTGCAGCCTCGGAAACTCACAGGGGCATTGCTACCGTACCCAGCAGACT
CAGAATTGACTCAACGGCAGTGAGAGCCCAGAGAAAAACAGCAGTGACTGAGCAAAATCT
GAGAACAAAGTAATTGTACTTAAACCTGACTACAAAAGCTCTTTGGCAGTGGACAGAGCT
ACATATAACATAGGACAAGCACATGTGACACCTTAAAATAGATGCTTCTTTATGTTCAAT
ATAGCTGCATCCTATCCATACATGTTCATTGTTTCTCGTGTTTAAATTCTTTAGTCATTT
TATAATCTTTTTTTTCACTAATAATATCTTTGAAGCAGGATAGTGCTGTGTTCATTTTAA
CATTAACAGTCGAATGAAATCACTGCAAACTGAATATGTTGCAGGATATAATTAGCAGTT
CAGGGTTTGGGGGTTTTTTTTTGGGGGGGTGTTCTTTTGTTTCATTTTTTTGGTAAGACT
AAAACCAGGTGGCACCCTAATGATATGGGCAAAGAAACAAACAGGGGCATTAGATATGAA
GAGCAATTTTGCCATCTCTATACTTGTCTGTTCCATGGACCTCTGAGCTTCTTGTGAGTG
ACAGAAACTTTAATTTGTGAAACAAAGATGATTAAAATTCACAGGATGTTACATTTGACC
ATTTCTTACTAGCTCACCCTTTTATTACTTCCTATTTTATCTGTTTTCATTAACTCAATA
AATTTAAGTAAGTAGGGTTTTTTTAAAGGAAAAGGTACTTTCTTTTGCTCACATCCCCCC
ATTCGTTATTAAAAATTAACCATATAAACACAGTGAAGAATGTAAAAAATTACTCATTAA
AAATTGTGCTAAGTAGGTATTTTTAATGAAGAAAAGGTACCAACCAATGTGCAAGCATTT
AAGTCAGGCTCACACTCTGCTGGGCAACATGCTGGGTATTCAAAGGGTGCCAGCGAGGAA
CATTCTCGGTCCTCCTGAAACTGAGAGTCTATGGGGAGATCCTCTCCAAAAGCTTAAGTT
GGCATCTGACGACTATATTTCCGGTTCCTACCACAAACGCTGTATCCTATGACACCACCC
TGATCAGATGTTCAGCACTGCACAGAGCCCTCTCAGATATGGGCACACACCATGCAGTGC
TACTGGTCCGTCCGCTCTTCACATCCTCATCCTCTTTTTCTTGTATATAGTTCACCCTCT
TTGAGATGGTGCCTTCTTTTTCTTCATTCTTGGTTCCTCTTCTTCTTTTTCTGTTCTTCA
TAAGAACCCTCCCTCCAACTCACTCGTTCTTCCCTCATTTCCTCCTTTGAAAGAAACGCC
CCTTTGTGGAAAATATTACTCGAGACAGGGCAGGGCTCTATAAAGTGTCAGGAGCATGGT
TACTTCTCCCTCTATCAAGACCTCTCCAGTCCCAACACACACACCGACCTGCCTTTACTT
CCCTTCCTCACCTTTAGCAACCTGCTCCCCAGGTATGGCTTTTGAATCCCTGGTTAGTTT
AAGAAAGTAAACCGTTTACACAGCTACTTTCCTCTAGCAGCCTACGCCTGCAGCATGAGG
CAGTCCTGTTTTCAACAAGTGGAAACAAAGTTTATCACACCTGGGCTTTTGTATTTTTTT
GTTGTTTTTGTTGTTGTTGTTGTTGCTGTTATTGGCATGTTTTGTTATTATGCTTTTGTT
ATTGGCATGTAAAAATCACCAACGAATCTGCTATCTGCAGACCAAGAGTGAAGAGATTAA
CAAATCATCAATTATTCTCTCCAGTAAGCGTGTTGGTGACTTGATTTACTAAGAATGAAC
AAGAGCAAAATCCACCAAAGTCAGCCACTAGTCATTCAACTACTCAAACTCGTGAGGCTT
CAGACTCTTCAATCAGAAATATTGGCCTCTGGATTACATTGAATTAAATTATTATTGGGG
TATAGTAATCTATGATCCAAGAATTCTAAAGTCACAGGAATGTGCCCTGGTTCCTTTAGG
AAACATAGGTAACACATTTGTATACACACACACATATACACAAACCTGTTTAAAGATAAA
AGGCTGATTACCAAAAAATTTTTTGCTGCCAAGTTCTAATTTTCTATTTTCTCCTTTTGG
GATATATTATCATCTATACACAATGATGACATTTATTTCAAAATAAATAAGAAAATGCTT
TCTGAATGCATCATATGAAACATCCTAATAAGATGTTAGGCCCCTTACGTAGACTCACCC
CCACATGGGACTGCCTACAGTTGAATGGGTTCTAATTTAAGACATGGTTTCAAAGATGTA
AAAGCAAAATAAGTAAAAAACCATTCTACTAGGGCATATGGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGTTTTCTTTTAAGTCTAAATGTTTTTAATAGACACTAA
TGGATAAAATTCCTACCTTATTCCCTCAAAAAAATTAAGCTTTTCCTATAATTTTATAGA
ATGTTTAGAACCTGAACTGAGTTTAAGGTTGAGCAAAACTATAGATTCTTATCCTAAAAT
CCAAGGACCTGGTTCCAGTCTGGAACTTCATAGGACTTATCAATACCTGGAAATAAAATG
CCATACAGTATTACACAAATACTTTAATGAGGAAGATATATTACTTTCAAGAGATTCCCA
AAGGAACTTTGAACTCAGTACAGTTCAGAATCATTGGTTTCTATTTCAACTCTTTATTTT
CATGATGAGGGAACTGAAATCCAGAAATGACTGAGGGAGTTGATGGGGATTACAGCTAAT
TAGCTGCTGAGCCAGAAATAGAGTCCATGTCTGATGTGGGGCCATCAATCCAGCTCCCTA
CCTCCCAACACTGCAATAGATAGATTATATTAGTCTCAAAATGGGATCTAGAGCCATTTT
TCTAAAAAAAAAAAAAAGAAAGGCTCATTGACGTTATGAAATGAGATCTAAAGGGAAATG
TCATAGAGCCTGGAAAGTAGCGATCAGAAATAACTCCACGCCCTGGGTTCAGACTGCAGA
TAGACTTTTAGAAGAAGCCAACTCTGAGAACTGTTTTGCTCCTATTCATGTTGAATTCCC
ACTGTTTATTGTGAATTGTCATCTCTACCTTTCTTCCCACGGCTTTACAGTTGGCTTTGC
TTGATGCTCCCTTGCATCTTCAGGGCCTGGAAATGCACACTTTTCTTCCTTTCCCCTCCC
TCCCCATTTGTCATAGTCTGATCCCATCATACATGAAATGTATGACTCTTAAGTGTGCTG
TCCTGAAGGGAGACCTCATTGGTGACAGTGAACAGTTGAAGGGTTCAAGCCAGCTTCTCT
GTGAGCAGACTGTGAGGGATCCGACGGGCCCTAGGCAGCATCCCTGCCACTGCTGTCACA
CTGAGGGGAGAACCAAGCACCAGTGGCATGCATGCATTCAAAATATGATGTCCCTTTCTA
AGAACAAAGTACCAGAAAAAGAAAGTGGACTCTGATGTTTTTCCTCTCCCAGTGAGTACA
CACTGGGCTGCTAACCTAGGTCAACAGTTTGAAACTTCCAGCCACTCTGCCAGAGAAGGA
TGAGGCTTCGTACGCCCGTGAAGTTACGGCCTTGGAAACCCACAAGGGCAGTTCCCCCCT
ATCTGTGGCACCACAATGGTCCCAGCTGACTTGATGGCCATGAGTCTAGAGCTCTCTGGG
AAGTGAACCTGCTCCTAGAGAAAATACGGAAGACTAACTAAGCAGCAAGTGATACCTGTT
ACAGAGATTCACTTGGGAGCTCTTGACAATGACCTCTCTCTTCTTAAATCTCTTCCAGTT
GGCTCATGTATTACCCACAGAAGAAAACTTCCTGCTGCTCTTCCGATGCCAGCAGCTGAA
GTCTTGCGAGGAATTCATGAAGGTATGAGAAAGCAAGCTATCATTGAATGAGGTCCTCAG
AAAGCTGCTCAAAGTATGAAAATGGCTGGGATTTTTCTAATCTGTTGGTTTTCCTTATTA
AAAATGGCTTACAGACATGGAGAAAGTATGATACTGATCACAGTGGCTTCATAGAAACCG
AGGAACTTAAGGTAAGCAAAGAAAAACTTGCTCTAAGTTCTCCTGTTTGTTTTTTCAAAT
ACAATTATGAACTGCTAAGGGCTTCATATCTTTTTTAAAAACCTCCCACAAAAGAAACTA
ATGTTGAGCAATGGCATATTTTCACCCACTCTTACATATCATTAATGAATTACTAGATCA
AAAAAGAGACGTCAAGTACTTCTTGAAGTTCTGTTCAGCAGTGCAAGAAATTAGCATTCT
CCCTGGTGAATACAAATTGTTCTCTGAGATGGATGTATCAGCGCACAGATATAACTGTTA
TATTCAGCCTCATGAGGCAGCCCTTTGCTTTGAAAAATGGAATTATAATCTATAAATCAA
ACACCTCCATAGAAGAGGTAAGAAATCTAAGGTGCAAGGAAAAAACTAGTCCAATAGACT
AACAGACCACCCAAGCATCAGTCTTTACAACCCTGAGACCAGAACACGACGGCACCTGCT
TCCCACTTCCAACTGCTCTGGAAGGGGTCACATTAAAGGGTTCTGAGAAAAGCAGGAGAA
AACTCTGAAGGAAATCTCAAAATCATAAAAAACCTCTATCTGTTCAGAAAGAGACTAGTA
GACTCGCCTTTAGATCTGGAAATGAACTCTAGATTTGGCTCCCTTTTTAAGCAATAGTTA
GGTCTATAAAGGAAACAGTAACACCAATGTTGGGCATACCCTTTGAGAAAAACAGTGATT
TCAGACTCAAGGGGCAGCATTTCCACAAGTCAATGACAAAGTTCAGAAGGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCGTGACATGCACTAATGTGTAGACGT
GGTGAACTGATCTGCTCGCCATTCTTAATAAATGTATTTAAGGATGAAAAGACATGGAAA
TACTGAACTCATTATACACTAAGTATCTTGTCATCTTGAATCTAATATCTAACAAAATAG
TTCATTATGTACTGGAGGCCAGGCAGAAATAAGACGCATACTGGTTTTACAAAGATGTCA
AATCGGTATTCATTCATCAACTCAGATCCATTCGAGGTTTCTCCATCTGTCTTCAGAGTG
AACGTTTACTGAGCGCTGACTGTCACTGGCAGCGTACTCATGACTTGAGATGTTTTTAAA
ATTGAACCTTCACCAACAAACCTTGCCAACAAGTATTAACAGACCCATTATAAAGAGAGA
CGGACGTTTAGTGAGACAGACCACTGTTGAAGATCGAATGACCGCCCAGGAAAAGCCTAG
ATTGGGATGTAGGACACCCAACATGCTCCTCGTTGTGGGGTTTCCCACAACACCACCTGC
TGTCAAGCTTCAGTTCAAGAGCACCTTTTGGGCTTTTTGGCTGTTACGGATGGAAATAGA
GGTATCAAACATCATTTCCTGGTTATAATTCAACATGGTTTGTGTTGTATAAAATTTTAG
AGATGGAACTAGGCCCATTGCACCATTAACAAAATTGCTAAAGCACACTGGGCCGCAGCC
TTCTTTAAAGTGTAAGCATTCTAAATACGAAATCACTCAAAGCAGCACCATTTACAATGC
GCTTGTGGCTCAGCAACGGAGAGTCTACAAGGTGACAGTCAGGCTATCGTGTTTCTATTC
CATTGCCACAACAGTTTATCTAACAAATAAAAATTAAAAACAACAGTTTCAAGTTCAAAA
TAACCACCTGAGCTCATTTCCTATACTGACCTCAAAGTACTCTAAAGGGCTCCTTCTTTG
TGCTAAATTTTATTCCCAGAAAGAGATTCTAAATAGAAGACCTCCTCCCTAGAGAACTTT
AAAGTTGGCATTCTTTTTTAATGGATCTTTCAAGCAAGCTAAATTTAAGATGTGCAACAG
AGTAAAACATCTCTTCCTCGCAGATACACCTTTGAGTCTGAGTCCCAAGGTTCTGCCAGA
CTATTTTTGTGACCACCATTCTAGCCTCTGATGAGGCTTTTTGACCCAATTAATCTCTGA
CAAAAGCTTCATAAAGCTCAAAAATACAATTCTCCTCCAGCAGCTTCCTTTGAATTTTCC
ATGTTTCACTCTGGATTTGAAGTGGAATGTTTGAAGTGGAAGTATTTTTATCAAACTAGG
GAAAATGTCTTCTTCATTAAAAAGAGTGAAGTCGATTCAACTCAAGAGAACTGATACATT
TGAGACAGGAGAGGAGAATTTAAATTACTGCAGAACCAAAGAAACCCAATTCTTCAATAA
TATCCAGGCACTGTATCGGCTGTTTTTCCATAATTGCATTAATTCATTTTCTGAACAATA
AGGGCATTTCAAATGAACATCACTAGAGAAACCAAAGACTATTATAAGTTTAAGTACTCA
CACTGTCATTTATGTGGTAAGCCTTTGAATAGCTCTTATTTGATTTATTTCTGTTAAAAA
AATGAAATCCATTTCTTCACTCCAACTGTCAAACTAATAATCATCTTTTTTCATTCTTCC
CACATTAATCTCTATTTTAATATGATTCACATATCCTTCAAGGATTCAGTGACATCATCT
CGGACCAGCCATTTCCACTTAAAATGTGCAGAAGCATTCTGACGGGCGATTAGCACTCAT
TGACTTTAAAGCTAACCAGATAGCCCTCGTGTAAACTAAGGTTATCCACGGATGTGGAAA
TACTGCTTGCGAAGGTGGAGAATACATGTGAAATTCGATCTAGCCTTCATCTGATTCATT
GGTACGCTTTTTCACAAATGACATATCGAAGGAGGAGGTTTGTATTTCACATGAAGATGC
CTTTCTGTAGAAATGCATCCTTTGAGCGGATTGATCTGAAAAGGGTTTATTCAGACTTCT
ACACAGCACTCACTTAAATACTCCTTTAACTGAAATCATACAATGCTTTACCGCACAGAC
TTTGAAGGATCAAGTCGCAGGGAAAGGTAAATGTCGTACCTTTCTATAGTGGTTCCACAG
CGGGGATGCCGACAGGACCCGACCTCTCTTAGTCCCAGTTCTAACACCCTTTCTTCACCC
TTTCTCCTCAAAAAGAAATTTCCCTTGCTTCCCTGGGGTGTTCCATTTCAAGGCATGCTG
AAATGGAAGCAGATTGCGCATTGTTAATGGCATTTACCTGAATGTTCTTTGCCTTAACAG
AACTTTCTAAAGGACTTGCTAGAAAAAGCAACCAAAACTGTGGATGATACCACAATTGCC
GAGTATACAGACCTAATGGTAAGACTGGCCCCTCCACTTGACTGTAGCCAAGAGATTTTG
ATGTATGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1079, 1563..1639, 5299..5373, 41878..41961, 42074..42130, 45300..45377
1001..1079, 1563..1639, 5299..5373, 41878..41961, 42074..42130, 45300..45377
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved