Echinops_telfairi Locus EP400
snOPY snoRNA Orthological Gene Database
Echinops_telfairi EP400
Echinops_telfairi
EP400
GeneScaffold_7263
SNORA49
53783..53915
152932
GAGGGGGGATTCGAGGTACTACATAAAGTGGTGATTCTAGTCCCTTTCCACTGGACACC
AAGTCTGGGGTTCCCCCCAAGGTCCAATGGCCACCACTTCCATAGTCCTGGGTTGGCCAC
TCTCTGCTTCCTCTGTCATCCGAGTACCCCAGTCCTCGGTCCAAGGGTGCAGGCAGCTTT
GAAGCAGGGCGCAGTTCATTCAGCTGGGCCATTATGTTAAGTCCTTCTGGTGTATTCCCT
GTGTTATGCTAGGCTATGAATCTTTATAGCGCAGGTGTCCTGGCCTCTTCTTTCTCCCAC
AGAGCCATTGGTGGGTTTGAACCTCATATCTTTGAGTTAGCAGCCCACTGCTCAACTACT
ATGCTCCAGGGCTCCTTTCACCAATGCACAGAGCTGTGACTTTACCACAGCCAGAAAACA
AAGCTGTTTCTTAACCCAGCAGCATCCTGACTGAGTGTCCAGCAACCAGACAGTTGGAGT
CCTGGGATCTGGGGGCTGTGATTGCATTCCTGTCTGCGAGGTGGATGCTCCTGGGCCATG
CCTAGGTGAACGCTGTGGGCGGGGTACCCATCAGGGACATCGGAACTCTTTGAGGGTGTA
GGTTCCAGAAATCCCAGGGCAGTGAGGCATGTGAGCTGGGCTGGTAGCCACTCTCAACTG
TGCTCTGTGCTGACTTTCCCCTAGCAGCCACAATGGTATCTGTACCTCAGCCCCTGAGAA
TAACAGTGGGACCTGCCCTGCTGCAGTGGGAAGGGATGGCAGCAACTGTCCCTGAGAGCT
GCTACTCACTGTTAGCTAGCTGCTGGCTCTTTCTGCTCCCCACTCCCGCCAGGCGTATGT
AGGAGGACTGTACCCTAGTGCCGTGCTTTCTCCTGTGCATCTGATGTGATTGGTGTGCTG
TTGCTGCAAGGGGGTCACGCTCCACTTAAGCCTCCAGTAACTTGATTTCCACTCTGATTT
CCTAGGACAACGTCAACTTGGATAGACAAGGGGGGGCGACGATGCACCATGGCGGCGGCC
CCCCGAGTGCCCAGCACCCGCTGCAGCGGGCCCGCTCCTTCCCTGGTGGCAGCGAGGCCG
AGGAGCAGCAGCCCCACTCCAGTCTGCCCCAGTCCCCGGGCCCCGGCCTTCGCCCCGTCC
CCCAGCCCATCTGCGCCCCAATCGCCTGGGTACCAGATCCAGCAGCTTATAAGCAGGAGT
CCAGTGGGCCCAGTGAGCGGGCAGACTGTGAACATTGCCCTGCAGAATGTGGGTCCTGTG
GTGGGGGGCGGCCCACAGATCACGCTGGCACCCCTGCCGCTGCCCAGCCCCACCTCACCC
AGCTTCCAGTTCAGCGCGCAGCAGAGGCGTTTCGAACACGGCTCCCCATCCTACATCCAG
GTCACCTCCCCGCTATCCCAGCAGGTGCAAAGCCAGAGCCCCACCCAACCCAGCCCCGGG
CCAGGCCAAGCCTTGCCGAATGTGCGGGCCAGCACCTCAGGTCCTGGACTGGGCCTGTGC
AGTGGTAGCCCCACCGGTGGCTTTGTTGATGCCAGTGTGCTGGTGCGGCAGATCAGCCTG
AGCCCATCCAGCGGGGGGCACTTTGTGTTTCAGGAGGGGGCTGGTCTCAGCCAGTTGACT
CCAGGCCCACAGGTGCAGCTGCAGCACGGGGGTCCGCCTGTCACTGCGCGGGAACGCAGA
TTGTCTCAGCCTCATGCACAGTCAGGAGGCACCATCCACCACCTGGGGCCCCAGAGCCCA
GCGGCGGGTGGCAGCAGCATGCAACCCCTGGGCAGCCCTGGGCACCTGGCCACGGCCAGC
CTGCCACCCCAGCTCAGCAGCCTGATCCAAGGGCAGCTGATGCAGCAGCAGCAGGTGCTC
CAGGGCCAGCAACTGAGCCGCCCACTGGGCTTCGAAAGGGCGCCTAGCGTGCTCCTGCCG
AGTGGGGGCGGGTCCTCGGCTTTCAGCATGACTTCCCCACCCCCGCCCACCAGCCCCTCC
AGGACCTCGGGGCCACCAGGTCTGTCCAGCCTCCCGCTCACACTTGCAGTCGGCCCGGGA
GTGAGGAAGGCACCCAAGAAGCTGGAGGAGATCCCCCCGGCATCTCCGGAGATGGCTCAG
CTGCGGAAGCAGTGCCTGGACTTCCACTACAAGGAGATGGACATGCTCAAAGAGACCTTC
AAGGAGTACTTGATGGAGCTGTTCTTCCTGCAGCACCTGCAGGGGAATATGATGGACTTC
CTGGCGTTTAAGAAGAAGCACTATGCCCCACTGCAGGCGTACCTCAGACAGAACGATCTG
GACATTGAAGAGGAGGAGGAAGAGGAGGAGGAGGAGGAAGAGGAGAAGTCAGAAGTCATC
AACGATGAGGTATGTGCTCTGTGGTTGCGTGGTCCAGTGGGCGGGTGCCAGGCAGGGCCG
TCTGTGCAGCAGTTACTGAGGCGATGGGGCTCTTCCTTCAGTTCTGGTTTCGTAAGGATT
GGGACCAGGATTCAGAGGACAGAATGCAGTGTGAGCACTTTCCCCTCTTGGATAGGAGGA
CCTATTTCAGGAGAGTGGTGTGCTAGGAGGAAGATCAATAATGGTGCCGTAGTTAGTGGT
TGTTAAAACCCAGATCTTTTCCTGTAGAGCCTGAGACTCGTCCAAGCTCAGAGTGAGTCT
GTGCCTCCGCTTTCCCCTTCAGTCTCACAAGTAACTCCAAACTCACTGCCATCAAGTCAG
CTCCAACTCAGAGTGACCTTACAGGACAGGGTAGAACTGCCCCATGTGTTTTCAAGGCTG
CATATCTTTGCAGAAATAGAAAGCCTCACGTCTCTCCAGAGAAGCAGCTAGTGGTTTCGA
ACTGTTGGATTTGCAGAACTGCTACGCTACCAGGGCTCGTGACTAGCGTGGGAGGGTGGA
TACCAGCTGAGATTCTGACAGTGTGTGCAGGACCAGGTGTGAGCACGTGGAAGATGGATC
TCTGAAGTGAGACGGGGTGTGTTAGCCCATTTGACTGGTGTTCCCTGCTCAGCTTTTAGA
TAGGCCTGCCCAGAGCCAGGAATTGAAATCCATGGCTTTTCTGAGCACACCAGCCACCAT
CAGCACACACTAGGCTGTTGGTGTGGTGCCTGCTGAGTGTTGGAGCCCTAGTGGAGCTGC
TCTGAGGGGATCTTCCCACGCAGATGGCAGGCTCACTGTAAGTCAGGGTATATTGTTATT
ACTTAACTCAAAACCCACTGCATTTGAGAATGTTGTCCAGTCTGTCAGATCGCGAGTCCT
CGAGCTCCTGCAGGTTCCCGCTGGGCGCTATTTCCAATAGCATCTCCTTTAGGTAGGGTA
CATGGCCTAAGTGTGTCACAACCCCCTGGGCTGGGATTTCGCACCACCAGGGAGTCCCTG
AAGTGTGCCGAGAACGTGAGCAATGGGTGTAGGTGGACAGGCCTGGTCCCGTGCTACCCT
GTCTCTGTCTTGTGTTGGTGGCCTCATGCTGTTTGGTGGAGCAGCGAAGCCGGCCCAAAC
CCGTCAGCTCCTACCCTGCCAAGAAATCCACCTTTGTCAAGCAAAAGCCAGTCTCTGCCT
CGGCAGTGCTCACGACATTTATGGCTGTATCTGTGTGGCTTTGCCGTGTGTGTGTCCCTC
AGCACCGCTCCAGAGTGGACCGTGTTTACTTCTCATTAGTTTGACAGTTCCTCTACTGCC
ACCAACCCTGTTTTCCGTCCTCTCTGTGTTTGTACCAGTGACACCGGTGCTGTCTGTAAG
CTCAACCCCTCTTGCCTGAAAGGGAAAAACCCAAACCAAAAAACAAAACCCTTTTTAAGA
ACTCCCGCTGACCGGGCCTTGGCCGTCTCACCCTCAGCCCGTGGGGAGCAGGTGGTCCTG
GGCACCTTGCCCCCGTGGGCGTACCTTGGGCCTCTGCTGCAGGCAGCCTGTCTGCCACTC
CAGTTTGAACATTTGCAGCGAGGGAACTCTGAAGGTGTCTCACTGTGACCAACACTGGCC
TCCCGCTTGGGGGACCCAGAGTGAGGCATCTTGCCGGCCTGTGTGTGCTCAGTGTCCTTC
AGCCGAGAGCTGTCAGCAGTGAAAAGCCTACCAGCGTTTCAACAAGTCTTAAAAATTATG
TTGCCTTTTTTTTTTTTTTTTTTTCTCAAAATATTTCCTCTCAGGTAAAGGTTGTGACAG
GAAAGGATGGGCAGACTGGGACTCCTGTTGCTATAGCAACCCAGCTTCCGCCAAAGGTTT
CTGCTGCCTTTTCTTCCCAGCAGCAACCACTTCAGGTACTTTTCGATGGTTCTCACATGC
AGCCTCATCCCAAACTTTGCCTCCATCCAGATATCTTAACCTTCAACTTCCTGTGTGCTC
TTTGGCATTTTTTTTTTCACCTCAGAGCCCATTCCTTATTTTTAAAAGAAATGGGAAACT
TTCTGCATATAGAGTGATAAAAATTACCTTTGCATGAGTAAATGACAACACAGACCCCCA
TACATCATTTTTTTCGTGTTTGACCCTAACACGTTGTAGCTTTTAGTGTGCCATGTCCCT
GGTCCTCCGCCCTGCCTGGTTGAACATGCCTTGTGGGGCCCCTTCGGGGGCTGTGCTTTT
ACGTGTTGTCCCCTCCCTGGGCCTTTCCAGGAACCGAGCGNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAGCAGACCAGAGCAGACAAAAGGACAGAAGCCAAGGACAG
CGTGGTGTGTCTATAGCTAGAGGAGACGCACGCCAGAGGGAAGCTCGGCTCTGAAGTCGT
CAGGGCCATGGGCTTGCAGTGCGTGCTGCCTGGAGCATTGTGAACCTGCCCATGTCCCAG
AGTCAGCCCCCCAGAGGAAGACTTAGGTCACACCCTAGCCATTGTGAAAACAGTTCAGAA
AACAGTTTCCTCCTGCTGGAGACATGGGGTTGTTATTTCTTATCACGTTATGATTGCAAA
CCTACACAAAAATGGTAAGGGTAGTATAATACCGGGACTCTTTGTATACCCTGTATCCAA
ATTCACCAGTTGCTAGCTTTTGGTCTGAGCTTGTTATTCATTTCTCTCTCACTCTGCCTC
ACATGTCTTCAAAGGGGCTTCCGAAAGTTCATGGAAAAATTCTATTATCTTTCAGTTCCA
TTTTTTCATGACCTTTTCTAACTTTTCCCACCCATGTGTGTGTGTTCTATCTAGCTGTTG
GGAGAGTAAGTTGCAGATAGCATATCATGTCATTTTTCCCCTAACCATTTCACCACATAC
TAGGTAATGTGGGTCGTGTTACCATAGTCCAGGGGTCAGAATCACAGAATTTTGCAGTGA
TGTAAGACTATTGTGGAACCCACAAGGAGTTCTTGTGGCACAGCTGGTTAAGCCTTGGGA
TGCTAACTGCAGCGCTGTCTGTTCATCAGCTACCCTGCAGAAGAACGAGAAGGCTGCCTG
CTCCCAGGGAGAGGAGGTCTCTGGCACTCACTCTGTGGAGCAGCTCTCTGTCTTACAGGA
GCACTGAGTCGGGAATCAGCTCGGTGGCCGTGGGTTACATAACCTGAGGTTCAGATCCAC
ATTGTTCCAGTGATCAGTAATTTGGGAGAGAGATTTTGAGGCCTTGCATACCTGCAAACC
TTTCACCCATAGGTTTGGGCATCTGCTGATGATTCTTGGCCTGAATCAGCTACTACCTTA
AAAGAGAACAGAACATATTTCTCTCACAGCCCCTTTTGCATTTGCTGTGTAGCATTTTTC
TTATCACATTCACTCCTGTTTAGATTCTAGTTAATACATCACTACCAATTTTAGTTTTAT
TTTGTCTACATTTAGCAAATTCATTCCTTTTGGTTCACAGTTCAGTAAGTGTTGACAAAT
GCCGAGTGTTGTATAACTAGTTAAGAAACAGAGCAGTCCTATCGCCCCCAAAAGTTTACT
CTGACTACTCCTTGACAGCCAAACCCTTCCTCCACCCTTAGCCTTTCCTCTCCAGTTCTG
ATTTTGCTTTTTCAGAATGAAATTGCAATGTGATAAATCATTTTTTGTATGGCCTATCTA
GCTAGGGCCTTATAGCTCCCACCAAAGATTGGGTGAGACTACGCAAATAAAGGTGTCTGT
GGGGCACCAAGGGTGCTGGACAGCTTGCTTTCAACTTGTATGAGATGCATGGCACCCTGT
GGGGTTGGACCATGCATAAGGTGTGGGGACTTCAGCAAGGGAATTGGTGAGTTTTGCCAT
CCTACGAGACTCCAAATGAGCCACCTCAGAGGCAGAAAGAGAAATCACGAAGATTTTTCC
CCTTTGTTTTCTGAGAATTTTATAGTTGGTGGTACTTTGGGGTCTGTTTTGTTTTGGTAT
ATAACTCGTGTGTAAGATAGAGGTATAATAGTTTTGTTTTTGCTTTTGCATATGGACTTC
CAGTTGTTCCTTCACCTTTTCTTGAAAAGACTATCTTTTCTCTGTTGAGTTGACTTTTCA
TCTTTATCAAAAATAAGTCAATCACTTTTGTGTTATATCTGTTTCTGGACTCTCTTCTCC
GTCATCTGTGTGTCAGTCTTTATGTTAGTCCCGCAATCTCGTGATTACTCTAGTTTTCTA
AGTCTTGAATCGGGTAGTATGAGCTTTTCTACTTTGTCCTTCTTTTTCGTAATTGTTTGG
CCTATTTTTGGTCCTTCCTCTCTTTAGATGAATTTTAGATTCAACTTGTCAATAGCTAAC
AAAGCATCCTTGTGGAAGTTTCATTGGAATTCCATTGAATAGGTTGCCTAGTTTGAGGAG
AATTGTTATCTTGGCAATACTGAGTTTTCCAACCTACAAACATAGTGTTTGCATCACACC
ATTTTTTTCAGGTTTTTTATTTCGTTCGTTAGCATTTTGAATGCCAGTCCTGTGCATCTT
GTATAACAGATTATTCTGATTTTGCCTGTTACTATAAATAGTACTTTTTTTTAAAGTGGG
GTTTCAATTGTTCATTGCCAATACAGAGAAATAATAGTTGATACTTAATGTTGTAGAGCC
TGGTTTAGCATTTTTTAGTTTTGGAGGTTTGGGGGCTTATTTTTGATAGTTTCTTTGGGA
ATTTCTATATAGACTGTGATGCTGCCTAAATAGAGCAGGCTTGATTTTCACCTACCAGGC
TATATACCATTTCCGTACCATTGCGCGTGACGTTAACTGTGGATTTTGTGGTCGCCATTT
ATCAGATTAAAGTCTCTTCTTTTATGTTTGTTGGGAATATTTATCATGATGCGTATTGTA
CTGTATTGTCTACCATTACTGCTTCTATTAAAATGGCCATGTGGTTTTTCTGTGATCCCT
TCACATGAGCCACATTAGATATGTAGGGTAATTCACATACAGGGGCAAGTCACAGATCTT
AAGAGTCAGTTTCCTGAGATTTGTCAACAAGGTATAAATTGCATCATTGCCGAAAAGTTT
CCTGGGCTTACCCGAAGCCTCACATCTATTTGATGCGGGTCTGATCTATGATCTGGCCAC
TGGGCACCCCTTCAGGCTGGCTCCAGTATCCTCCTGGCGCTTTCTCTGTCTCTCGGACAG
AGAGACATGTCAAGAACAGATGGTTCTTAGTGTGTATTCTTTCCTCCCACGCTGGAATCA
GCAGTTTCTCCGAGATGTCTGGTTCCTTTTATTGTCCGTTGCCTTTGAGTCAGCTCTCCT
TGTTCAACAGAATGAGACGCTTCCTGTCCTGCAGCGTCCCTCAGTTGTTGCTGTGTGTGA
GCCCATTGTTGTAGGCTGCGTCCGTCTGCTCTGTTGAGGTCTTTCTCCTTTTTTGCCACC
CGAGACTTTACCAAGCGTGATGTCCTTTTCCAGCGATTGGAACGCCAGAGCCCCCAAACC
AAATCCATGGCCAAATAGTTGAGCTTGGGGTGATGATTTTGATACAATTTGAAGGTGAAA
AAAACTAAGGAATTGGCAGAAATTTTGTTAGCTGGTCACCTCTGCTGTTACCTCATGGAG
GACTGTGCTCCAGGGTTAAACGGTGACCACATGATACGTATTTGAACTTGTAGAGCACAG
GGGCAAGAGAAGCCAAGGGGCTCCTGTGAGCATGTGCAGGTGATGTGTAATTCCCCACAG
TGACATCACTTTAACCACACAGTCACTGCCACACTCAACGGCTTGTTAGAAACCAAACTA
GATGGCAGACTGATGGGGAGCCATGTGGCCTCATCCGCCGGAGGTAGAAGTGTCATTGGA
TTAACTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTTTCTTCGCCCCCCTCCT
CCCTTCTGTTCATATGGAGGGCTGCTTCTGCCAGTCGACTTCCTTCTCAGACCCATGCCT
GTCTCCCTGTGGTGAGTAGTAGGTGGCAGGCTTGCAGGGACTGTGTCCACCCTCTGTGAC
TTCTGCATTAACAAAGTCTCAAGTGAGGAACTGGATAGGGCCAGATTATGGAATGATCAC
ACAGCACCTCTATTCTTTAGGAAAGGCATCCCGAATGTCCTGTGAGGGTAAGGATGTTTG
CTGCACAGGTGTGGAAGGCCCGACCAGCCCCAGAGTGGTTAGCATCTTGCTTTTTAAAAT
GACATGCTAGTGACCTTTGATGGTGATATATAAAGTCACCCACAACCCCTACAGCCTTTC
ACAGATATAGGTACCAGGTAGGGGGCACACTACCTGCAAAAAATGACCTGCCTTGAAGAC
CCCAGTGAGTTCTCCAGTGACTTCTCTGAGTCTGATGTGGTCAGGTTTTGCTTTGTTCTC
GGGGGGTTGTGTGTGTGTGTGTGACTTCTCAGTGGGCTGAGCCTGCTGCTTTCTTCACAT
GTGAGCACAGCCTGTTGGTTGTGAGTGAGGTCCTTGATCTGCATTGACTTGACATTCCAT
CGATAGCCAGAGCCATGCACTCTTTTTTCCAGTCCCCCCGACCCTCTACTACAAGTTAGG
GCTCAGACTGCCCAGGGCGTGTGTAGGCGCAGGTGACTCGCCTGGGGGTTTCAGAGCAAC
ATCATCCCGGTCACAGGGCTTGAGGACCTGCTCTGCCAAGTGATGATGGTCTCAGCGTGC
GTGCGTGTGTGCGTGTGCTTTTCTGCTTCAGGCACATCTGGTCTCACACCAACTGTCTCC
ATCTTTCCCACAGCAAGCACTCACAGGGACCCTGGTGGCCACGGCAGGTAGCGCCATTGA
AGTGGACCCCTTCCAGAGGCAGCAGTCATTGCCTCCGCCGGCAGGTAGGTCCCAGCCAGG
CAGCCAAGGTATAGCAGGTGCTGCCAGGGAGGTGACTGGGGTTAATTCTCTCCCCTGTGA
CTGTGGGATGGTGTGTGTTGTGCAGGCATGACCCAGACTCACCCTCCTGGGCACAGGCTG
GCTCATGTCCTCTCAGTGGAGTCACCACACTTCTTCTCAAATCAGGTTCCCTTCCAGTCA
TGAGCGCAGTCTTTTTATGGCTGAGACTCAAACAGGTCAGCACGGTCTGCCTTTCCCCTC
CCTCTGGGTCGGGTTATCTGCTGGCCTCTGGGGACACTGATCAGCCCCACACCCCTGATG
TCTTCTCGCAGACATCTGCACGTGACCACCCACAGAGACACTGTTAGGTGCCATTATCAC
TTCTCTTACTTAATGGATAGCCGTGGGCCTCTTCCCTAAGTCCTCTGCTTGGGCTCTGGG
TGGTGTGCTGAGCATTTAATTCATCAGACCCTTGCTTACATTCATTTATTACTGTCCTTG
TCCCCACTGCTATTGTGCAAGATTTGGACGTCTCATCTCAAATATTCTCCACTGTCAGTA
CAGCCAAAGGACAAGTCCCTGGAAATGAAATTGCTGATGCTGCCCCGCCCCCTTCAGGGC
AGGCAGCACCCGCACTTTCACCTCATTGTAACTTTTGGTTCTCTCTCTCACCTATCTGCC
ATTTAAATATGCCCAGTGTTAGCGTCTCTGCTGGTCGGATGGGTGAAAAATTATACCTTG
TTTTGCTGTAGATTTCTTGAATCTTGAGGAAGGGGCTATCATGGTGTAGTGGTGAAGCAG
TCTGCAGCAAACTGAAAAGCCAGCACCTTGAACCTGCGAGCAGTGATGTGGGGGAAAGAG
GCCCTCTCCTCCTGTGAGGATTTATAGCCCCAGAAGCCCTCCAGGGCAGCTCTGCTGTGG
CAGTGGTTTGAGGGCCATGGCAGTGTCTGCTCGTGGCACCTCCCATGAGTGCACATCTGT
TCTTGGCCTGTGTTTCCTCTCTGGTTGTGGATATTCTCGATAGTAACTTGTGAGAGCTTT
CTGAATACTAAGTCCTAGGGGGCTCGGGACGTGTGTGGAAAAATCCCATCATCTCCATTC
TGTTTTCTGTGGCTGTTTTGAGCCCCTTTGTAATGGCCGTGACCGTCCTGTGCGTGGCTG
CTCTTAGCTCTCAGGTGCTGCTTGCCCTTTGCCTTTGAGTGATGCTTTTGAAATGTTTGC
AAATTTTTAATGATAGGAAATTGTACTTTCCACCCTTTCTTAACACTGCATTTGGTTTTC
TGCGCAAATATTTTAGAAACACTTGTCCTACATTTTTCTACTACGCTACAGCTTTCGTTT
TTTGTGTCACACTACACCTTGCTTTTGAAAATCATATAGAGCCTTCTAAGAGACCTCGAC
TTGAAGTGGGCCACCAGGGCATTGTGTTCCAGCACCCAGGGGTGAGCACTGGTGTCCCCC
TGCAGCAGTTGATGCCCACAGCACAAGGTGAGCCAGTGCCCAGCACCCCTCCAGCCAGCC
AGCCGTGTTCTTGAGGTCTGGGGCGGGTGGTGTTCTTGCTGGCTGGAACAGGGAACACTT
CCTGCCACCCAAGTCTGTGCCCTGGGGGCTTGTCTCTGGATCTGCAGGAGGGATGCCCCC
GGCTCCGCAGGCCTCGAGGCTCCTGGGGCAGAAGCAGAGTCCTCAGCAGTACGACCCTTC
CACGGGGCCACCCGTGCAGAACGCTGCCAGCCTGCACACCCCACCGCCGCAGCTCCCCAC
CAGGCTGCCCCCAAGCAGCACCCCCTCCACGGCCCCGCCTCCTGCGCTGCAGTTCTCACA
GCCGCCTTCCATGGTGGAGCCACAGCTGCAGCTGCAGTTGACGGTGAAGACTCAGCAGCC
CCCCGCGCCTGGGCCCCCACCCAGCCAGTTCCCTGCACCCCTGCAGCAGTCCGTACAACC
CGCGCTCCATGTCCCCATGCTGGGGAAGGCCCACATGCCCGTGTCACAGCACCCATCTCA
GCCACAGGTATGTGGGACTGGTGCCAGCAGGCGCATTCTGGGCTTCTTTCTGAGTCCTAG
AACCACCCCGACCCCAGACCTCACTCGCACCTGTGCAGTTGTCACCCTGTTTAGTCTGCA
GGGACACATCCCCATCCCCGCCCCTGTCCCCGCCCCCCATCTCTTGTGTGTGGCACTGCC
TCCTGGGGACACTGTCCGTGTGCCTTTTTGATGCCACAGTCCTGGGACGTTTGGAATGCT
CCTGCTGATCTAGAACAGGGGTCTGCACACTGGAGACGCAAGAGCCAACCTTCTCCCTCA
CCATTTAAAAATTGTTCAGGAGTCATAAATGTATTCTTACACATAGGGAAAACTTAATGT
TATAAATGAACCTATCATAGCTTATTTTCATTTTCAGTTTGTGGCTTGTGAACCTCAGCT
TGCTGGCCCCTAGTCTAGAACATGCTGCGAGCACCCCCAGGCCCTACAAAGTCATGGATA
TCGATGGGATAGGTAGCAGGAGTGGGACCTGGAGCCCTCATTTCCCACTCTGTAATCAAG
CTGGTTCCCTGTCTCCTCTGACCCCTCCAGAGTGGTCTGCCCTCTGCCGGCTGATGGGCT
GTGGCATCAGCTACTTCTCTCCCTTGACACAGTAACCCTGGGAGGTAGAATCCGCACCCC
CACCCCATTGTACAGATGAGGTGAAGCAGCATGGTCAGACCATGGGGCGCTTGCCTTTGA
GCCCAGAGGTGGTCCCAGAGCCTTCTGTTGCCTCATGTCCAAGGTGCATGTGTTTTGAGA
AAGCGAGTGTTTCCCTTGAGGGCACTTTCGAGGCTACTGTGTGCTTTAGAGTCTGGAAGT
GGATCTTTCTGTTTGGGGCACTTTGTCTCACTGGTCCCACCCTGCTTTAAGAAGCCCTGG
GTGAAAAAAAAAGAAGAAGAAGCTCTGGGTTTTTCTCGTGTTGCGTACCTGTAGTGTGTG
AAGTTCACCCCACCTGCCTGTCAGCATGTCTCACTGCAGTGGCAGGCAAGTGGCCGAGTG
GCTGTGATGCCTGAAGCTTTGCCGCCTCAGGTACTTCAAACAGAGCCACTGCCACGCTGG
GTGGACAGCATTGTTCTGAAAAGCTGCCCATGGAAACACTGTGTTTCCTGGCAGGACACA
AAATGGGTTTGAGGCTAGAAGGGACATGGACTCAGAGGCCTCAGTGGGCTCGGAGCAGCA
GTGGCCTCGAGCATGCCAGGGTTGGTGCCTGGGCTGCAGCCAGGGCCTACATGTACTGGC
TCACCCTCTGGGACGGTTCTGCTGCTGGCTTTAAAGCAACTCTAGACCCCTCATCCTAGG
AGGCAGGGTGAGTCCTCCTGCATTTCCTGTGAAGGTCCAGAGGGCTACTCAGCCTCCGCT
ATACCTAGTGGGTGAGAAAGTGGGCATAGCCTGTTCCCACAAGAGTGGGCACGCCGATGT
GTCACAACACTGGGTTCCCCTGGACTGTAGTTCTGGAAGGAGCTCCGTAGTAGTTACAGA
TTGGGCCACAATCCGCAAGATCAGCAGTTCAAAACCACCAGCCGCTCCTTGGAAGACAGG
GCTTTTTACGCCTATAAATAGTTAGCAACTCAGAATCCCACAAGGGGCAGTTCTGTCCCA
TGGTGCTCTGAGTCAGAATGGACTCAGTGGCAATGAGCTTGGCTTATGAGGCGTGGCTTG
GCCTTGGAAGGGAGGAGGAGATGACTTTGAGTGTCCAGAAAGACACCCACACACCGTGAC
GGGACTGCCTTGCCTCAGAGCGAAGGTGGTGATGATGTCTCCCTTCTTCTTGATTGGGGA
GGTGCTGCACTTGTTGGCACTGGCTGATGGACAGGAGCCGCCTGAGGGGGTCCTTGGCAC
CCCTTATTGCTAGCAAGCAGCTCCCCTCCTTCCTGCTTGTCCCATGCCACTCACTGTGGT
CTTCAGGGAGTGGGGTTGGAATGCTTTTTCTTCAGCTATACAAGTTCTGCTGGGCCGCCA
GCAGGCACATGCGCTCACGTGTGCCCCTGAGAAGAGATAGGAGAGGCCAAGGCACAGCTT
GGGCTCAGGGCTCCACTCTCTGGTCACCCGCTGGGTCACTGCTGGTTAGGGAGGAAGCTG
TGCGTGTTGTTGTCTCATTAGGCGATATGTACTTCTGACGCCGCTGACGTGTCTTCTGCT
TGCTAGACCGTGACTCTAACGAGGCCCCCTGTGGATGCCGCCCAGGCTGGACAGCGGCCT
CTGTCCACCTCCTCTTCTACCTCATCCCTCACCGCTGTGGGCGGCCCGGGACCCCTACAT
ACACGAGCCTCACCGGTGAATCGACCTTCCTCAGCAACCAGCAAGTCACTGTCTCCTGTC
ACCTCCCGGTCCCCAGGAACGGCTGCCCCCGTCCCGCCCAAGGCACAGAGCCCAGCTCAA
AATGCTGGCACCCCCCAGGACGCTTCTCAGGAGAAGCTGGCGGAACAGATCATTCTGGTA
AGCTTGCCTGCTCTGCCAAGGCTACCCCCCGCCAGTGAGCTGGTGCTGGACATTCTGTGT
CCAGGTGGTTGCTGGCACCCAGAGGGGGCTAGGCAAGCAGACTCCGCTTTGGAGAACATG
GTGACTGTGTTAGCCTAGGGAAACAAGGGAAACAAATCCACAGAAACTCACATGTATATA
ACAGAGTTTTATATAAAGGGTAAGTGTACATTAAGAAAGCATCCCAACCCAGTTCAGTCC
AACCCCATAAGTCCAGCTTAGCTCATATGTCCAACACTGATTTACAAAGACCTCCTCAAA
CTCACAAAACACACAATGACACCGAATGCAGGAGGATCACAGGCCCAGTGGGTAGAAAGT
CTTTGTATCCAGTGGTGGTGTAAGCATCTCAGTGCTGGCAGGGGTCTCCACACGGCTTCT
CCAGCACCCAGGGCTGCATCAGGGTAAGTCCATGTGGCTTCTCAGGGATGTCTCCCAGGA
AGTGAGCCTTGCCAGCTAAGACAGCCACACAGTGGTTGAAGCCACACAGGGTTCAACCAT
CAGAAAGCAAGAGACCCAAGAACTAGAAAGGCGAGACTCACCTAGCCGTTTATCTCTCTG
CCCTTCAATTAATCCCACGTGTGTTTGTCGGCCAGGTTGGCACAAAAAACCTTAATTATC
TCAGTGACCTCTGTTGAGGAAGGGGTACTGGCTGGGGGGTTGCCACTACTGGTCTGTAAC
ATAAAAGATGGAGCACCCTTGGGGGCGGGGGGCCTGGAGAAGGGCAGCGTGGAGCTAGCC
GCAGGGGTGGAGGAGGGGGCAGGTGTGTTCTTGCCCCAGCACCACTCAGTCCACCGAGAT
GCACTCCTTGTCCAGACCTGCTCCTTGCCTCTTCTCTGTGGCGCCTCCTAAGTAAAGAGT
CACTTAAGGTGGTGCCGAGGGGTCAGGTGTGCACATGTCTCTCACTCCGTGTAGCTAAGC
TCCTTCCTGAGGGCAGTGGGCAGGGACAGGGAGCGGGAGAAAGTGCCAGTAGATGACACT
AGATCATGCGGCAGAGGTGACAAGGAGCAGGAGTCCCTCTCCTTCTTTGACTCAGCCACC
TGCATGTGGTTGAGAAGCTAGTGCGTTGTGTTCAGGTGTCAGCGTCTGGCCTGTGACTCC
GCCTCGCCCTTCCTTGCAGGAGAACCAGGTACAGCAGCGTGTAGCAGAGCTGAGGAAGGA
GGGCCTCTGGTCACCTCGGCGTCTGCCCAAGCTGCAGGAGGCCCCTCGGCCTCGGGCGCA
TTGGGACTCCCTGCTGGAGGAGATGCAGTGGATGGCCACTGACTTCGCCCAGGAGCGGAG
GTGGAAGGTGGCTGCTGCCAAAAAGGTATGTGGGCCAGGCAGGGGGCAGCGCCAGGCAGT
GCCCACTGCTTCTGTTCTCAGGTACAGGGCTACTGCGGGAAGAGGGGTCTTGGAGACATG
GAGGTGTCCTGGCAGTCTGGGTGCACAAATGCTGTTGATGGGAGGCATGGACACAGGTGT
CCTAAAGAGCTGTCCAAGGGAGACACAGAGCCCGTCACCCAGCCCTTGGCCCCACGTTCA
CAGCTGGTGAGGACGGTGGCTCGCCATCATGAGGAGAAGCAGCTGCGAGAGGAGAGGGGG
AGGAAGGAGGAACAGAGCCGGCTGAGACGCATCGCAGCCTCCACCGCTCGGGAGATAGAG
TACTTCTGGTCCAACATTGAGCAGGTAAAATTCTGGGGGGTGGCAAGTCTGTCCGGCATG
AGTGTGAGGCTGGCTCCAGAGAAAGTGGAGTGCAGGCTGAGAGGTTTTTGTGTGCCTGGT
CCGCTGCAGTAAGTCAGGGGCCTAGGAAATATTGACCAGGGGCACCCTCAGAGCTCCTCT
CTCCTCCCACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCAGAGC
TGTCGCATTTAGCCAAAGAAGGTAGGCTGCCGGTGCTGTGGAGCACTGCTGATCAGAGCT
CTGGCTGCCCTGCGCACCAGCAGGGAGTGAGGCACACCCTGTCACCAGATCCTGCCAGCC
GCCAGAGAGGTGTTGAAAGACTGCTCTACATCTCCCCACCCCCACGGCCCGTCTCTGGTC
TCCATGTAACGATGTGAGCAAGCGTCCTTCACCTTTAGTGTGGTCATGGGCATCAGGCCT
GCTTAGGCACCCTACTTACCTGGAGCTTGTGAGACACACCTGCCCGGGTTGTGATCGAAA
CGTTTCTGTGTTTCGAGTGTGGGTGCCTGTGGTGCCCTGTGTGGTGAGCCCCTCTCCCAC
CCACTCCAGCCCTGACCGGGAGGACACCCCATCTGCCCTTCACGGAGCTGCATCAAGGGT
GCCAACCTGGTACTTTCTGGACCCTTTCTGGTGCCCCTGGCCAGTCTGTCTTTGTACCAC
AGAAGTGCAGCTTTTTAGGGTTTCAGTGTCCAGTTTGCCCAGTGCCACCTCCTTGTTCTG
TTTTCAGAGGGTCCTTGGCTTTGACCGAAGGGACAGTGGTTGTAGCTCTCTGTCTTGGTG
ATTTTAAAGGGAGCGTTTCCCAGGACGGCTGAACCAGGTTCACTTAGCTTACATCAGCAT
TTTCCCCAGGGCTGGTGTGCCTTGTCCTGTAGACACCTCCGTGGGCTCCCAGAAGCCTCC
TGAGGGCTTCTTGTAGCTGGGGTCCACCTCATTCCTGAGGGCTTTGTCTTAAAGCTGGGG
GTCCACCTTATTCCAGTAAGGATCTGTATGTTACATCTGCCAGGCACCAGCACTGTTCGT
GGAGGCTGTGGGTGATCTTAGTGCAACAGCCTGCCAGCGTCACACCTGCTTTGACTTTCT
GAGCCATGCTGTTCTCACGGACAGAAACAGTGACCACTCTTGGACACCACACTACCCTCA
GTCTCTGGTGGCTGCACTGGTGCTGGCTTTGTCACATGCAAAGCTCTCCTTTTCTCCAAC
CCTTAGTTCAGGATGGTGACTGTTGTAACTTGTACACAAAATAATGCAGGGGTGTTTGTT
TTATGGGTCTCAAACCGACAGTGCCTTTAATATTGCCTTTTAGACCACTCAGAGGGATCA
AGGAGCCCAGGGTGTGCTGTGAAATACACATTGGCCTATGAACCCCAAAGTTGGCAGTTC
AAACCCACCAGCTGCTCTGGGTAGAAAGATGAGGCTGTCTGCTCCTTAATAATTGACAGT
CTTGGGAACCCCTCTCTCAGGTCGTTGTGAGCCAGGATCAATTCAGTGGCAGTGGATTTG
GATATACAAAAGCTGTACATTTATTAGACAATTCCAGAAGTACTTCTTTTTTGTGAGTTA
ACCCTTAGTGTCCTCCTTTCTCTGTAGAGGTTTTCATCACAGTCTACAAAGAAAATATTC
TAGACCCAGTGTTTTTAGAGGAAACAGAGGTGCTGTTGGGGCCACACTTCCCTTAGGAGT
TGTGTGTGTCACCAGCCTTTGTCCTTTTCTCAGACTTCTGCAGTGACCCTGTCTCTTCAC
ATCCTGACCTCTGGCCCTGTGCTCCCTTCCAGCTGAATTGCCACTACTTGACTTGATGAA
GTTATACGAAGGTGCCTTTCTGCCAAACTCCCAGTGGCCTCAGCCCAGGCCTGACAGCGC
GGAGACGAGTGACGAAGAAGGTAAATTCTAGAGCTGGACAGGCCCCAGCTTTCTACAAGG
AGCCCAAGTTGTTCCTGTGGAAGCAGGATAAAAGGAGGCCTTGATGGGGCTGGGGGTGGG
GGAAATGAGCACGATACCAAGGACTCAAGTAGAAAATGTTTTGAAAATGCTACTGTCAAC
ATATGTACAGATGTGCTTGATACAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGTGAGCTTGTTTTGACTGTGAG
GGAGAACATGAGCACACTTTCTCCAGGTGTCGATGTGTCGCTTCGTGGGCCTGGATTTCT
TTTTTTTTTTCAAACATTTTATTAGGGGCTCATACAACTGTTATCGCAATTTACACATCA
ATTGTGTAAAGCGCATTTGTACATCATTCTCAACGTGGGCCTGGATTTCTATCACCCTTG
TTCACTTTTGACTGTTAGTTCAACATGACTGATTTTTTTGTCTTACTGTGTTTTTAATTG
CGAAGTGATAGTTTACGGAGGAGAACATCAGTTTACATTCAAGAGTCTATACATACTTTC
TTTCATCTTAGCTACTGTAACCCCTCGTTGAACCATCACTTCCTAGGTTTCTCAAGTCCT
TTCCTCCCCCTTTCCCCACCATTTAAACTCTGGGCAAATGCTGCCGTTTTGAGCATGAGT
GGTTGGTTTGGCTAACGTGGTGGGACGTTCCCTTCCAGACCTGAAGGGTAACTAGACACC
GTTGCCTTGGGCCCTCCCCAGCCTCTCAAACCAGTGAGCCTGGTTTGTAGTGATTGTGAG
TTCTTTCACCGTTTTCTTCCACTCCATCCAGGGTCTCATAAGGGGATCCTTCTCAAAGCA
TTGGTGGGGGTAGCTGGGCATCATTTAGTTTTTCTAGTTTCAGGGTCATGGAAACGGATG
TTTGCATGGTCCATCATTCCGTTAGATTAACGACTAGATTCGCTGTGTTTCCTGCTTTGC
CTCTCTCTCCTTTCCTCTGGCAGCTGAGGGCTAACCGTCGCACCTTACTTAGGTGGCTGC
TCATGTGTTTTCCAGATCCTAGCTGCTCCTGTATCATGACACTTTTGAGGAGTTTCTTTT
ACATTTTTAACCATTCTAGGCAGACACACAGACTGCTCCTGGATCACCTAGTGAAAAGCA
AGCTGACGCTCACCCTTTCCTTGTCCTCATTGTTTCTGAGGGGGCTTCCCAGGTTTGTGG
GAAGATGGAATGAAAAGACAGTGGAACATTTCAAAGCATGTAGGGCAAGTGAGGTCAGGC
AGGTGAGTGAGGGTCCTGTGAGAGGGGTCCTTTCAGACCTCCTTGTGGCAGGGAGTCCTC
CGTGTTGCCTGTGTTGCAAGACTGCTGAGTTCTCCTTTCGTGGGTGCACATGCACCTCAG
GAGGAGGGGAGCAGGGAGGGGCAGTACATCAGGTACATTTCCTCTTGCTGCTTGTTTTCC
TGGCCGTTGTGAGACATCTTCCACTTGCCAGGTTGTTTGGGGACAAATTAGACCTGAGGG
CTCCCCAGCAATGTGCTGGAGTTGGCAGCGCCAAGTCCCTGGGCATTTGTCCACAGAGCA
TGACAGGCAGGTGCAATGAAGAATGAAGAAGCACCACTGAGCTCTGGACGTGAGGGGTTT
GGGTTTGCTCTCTGACTTGGCAACAGCAGGCAGCCCCAGCCCCTTTGCTGCATTGTCTCT
CATAGGAGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTCATCGGGTCAGTAGA
CGGTGTGTACTTACTCATCATTGATGTCCGCTGGGACAGATGTGGGCCACTGTCTGAGCA
CCTGTGTCCATCTCTTGGTGCACATACTTGGAGTAGAAGGGCTGCGTCCTGTGGTGACTT
GTCTTCACAGCAGCGGTGGTCCTTCTGGCAGCACACAAGGATGCCAGCTTCTCTACATCC
TTCCCAACACATGCACCCCTTCCAGAGTTAGATAACCATTGTCGCCAACCTGGGGGGTGG
AAGGGGGGTCCTCGATAAGTTGAAATTGGGCAGGAGTAGGCTGTGGGTCACCGGGAAAGG
CCTCCGACTGTTGAGTGAGCCCTGATTCCCCAACTAGCCAAGGGCCAGAAGGGAAAGGAG
CCTGCCTTTTCTGGTCCTGCCTCCTGTGGCTCACTCTCTCAGTGGGGCTTCCGGGCAGCA
TTGGTGTCTCTCTTGAGGAAGCACTGCAGTAGCTGCTTCAATAGGAGGTCTCTGTTGGGT
GTGTGTGGCTGCAGGTGAAGTTTAACACACCGCCCCTGCTCTATGGGGTGCTCCGGGACT
ACCAGAAGATCGGGCTGGACTGGCTAGCCAAGCTGTACCGGAAGAGGCTCAATGGCATCC
TGGCCGACGAGGCGGGGCTTGGCAAGACTGTGCAGGTGATCGCCTTCTTCGCCCACCTGG
CCTGTAACGAAGGTGAGACTGCTTGCTTCCAGGGTGCTGACACACACATAGTGGTGTGCC
GGCGCAGCAGAGAGCTGCTGTAGGAGGCAAAGACATGAGGCTAGCTCTGGTCTGCTCGAC
CAGACTCACTCTTTGCCCTCTGTGACTTACGAAGTTGTGCTGGCTATGAGCATATGAGCA
GGCAGGACATGCCAGGCTTGTCCTTGGGCGGCTTCACTAACACTCAGCCCTCCTGCCCCA
GAGCACAGAGGTACTCTTGTGTACGTGTGAACATGCAGATGGTGTACACACACAACTTAT
GATGTATACAGGCATACACAGGCACCCTCGTGCTCTAACGGCACAAACATAAGGACGTGC
TTAACATGCATACCTTTAATTAGGGAGACCCAGTCCACCTAATACCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAGGCACGTGCAGGCGCACGCCTCTTCAGACACGT
AGAGCACTGCGCTCAGTGTGCTTTCTGCAGCACACGATGCTTGGATTGCGGTTTCCCCGC
CCTGGAAGTCTTACGTGTTAGAGAGTTTGCTGTCTGCTGTCTTTTTCCTCAGAATCTTCT
GTGCACGTCTCTGTTCGCTTTTCTTCTGTATTTCTAAAAAAATCAGTTTATTGGGGCTCG
TACAACTCTTATCACAATCCAAACATACATCCATTGTGTCAAACACATCTGTACGTTTGT
TGCTATCATCATTTTCAAAACATTTTCTTTCTGCGTGAGCGCTTGGTATCAACTCCTCTT
TTTCCCCACTCCCTCCAGAACCCTTGATATTTGTAAATTATTATTTTTTCATGTCTTACA
TGGTCCCAATGTCTCCCTTCACCCACTTTTCTGTTGTCTGTCCCCCAGGGAAAGGGTTAT
ATGTAGATCATTGTGATGGGCTCCCCCTTTCTCCCCCACATTCCCCTTACCCTCCTGGTT
TCGCTACTCTCATTATTGGCCCTGAGGGGGTATGTCTGCCCTGGATTCCCTTTGTTTCCA
GCTCTTATCTGTACCAGTGTACATCCTCTGGTCTGTCCTGATTTGTAAGGTAGAATTGGG
ATCGTGATAGTGGGGGGGAGGAAGCATTAGAGAACTAGAGGAAAAGTATATGTTTCATTG
GTGCTATACTACACCCTGACTGGCTCGTCTCCTCCCTGCGACCCTTCTGTAAGGGGATGT
CCAGTTGCCTACAGATGGGCTTTGGGACCTTAATCTGCGCTCCTCCCTTTTTCACAATGA
TAGGATTTTTTGTTCTTTGATGCCTGATATCTGATCCCTTCAACACCTTGTGCTCACACA
GGCTGGTGTGCTTCTTCCATGTGGGATTTGTTGCTTCTCAGCTAGATGGCCGCTTGTTTA
TCTTCAAGCCTTTAAGACCCCAGATACTATATCTTTTGATAGCCGGGCACCATCAGCTTT
TCCCATTTGCTTATGCACCCGCTTTGTCTTCAGTGATCATATCGGGAAGGTGAGCATCAT
GGAATGCCAGTTTAATAGAACAAAGTGTTCTTGCATTGAGGGAGTACTTGAGTGGAGGCC
CAATGTCCATCTGCTACCTTAATACTAAACCTATACATATATGTACATAGATCAATTTCC
CCATCCTCATATATAAATACATTTACATATGTACATACCTGTATTTAGATCGCTATGAAT
GCCCTTTGCCTCCCAGGTCTTTCCTGTATTTCCTTTTACTTTTCCTCTTGTCCCACTGTC
ATGCTCAATCTTCATTTGGGTTTCAGTAATTCCTCTCAGTTACATTGCCCTTGATCAAGC
CCTACCAAGCCTCCTACACCCTCCTTACCATCAATTTTGGATCACTTGTTGGTTATCCTT
GTCCCTGGGTTAGTTAACACCCACTTTCTTTCCCCTACCTCCCCTTCTAACATGTGCCCT
CGGAACTGTCGGTCCCATTGTTTTCTCCTCCAGATTGTTTATAGACCTGCAGATAATAAT
ATGCACAAAAAACAAGAGAGAAAAACAAAGCAACAAAAGAAAACAACAACGAAAAACCAA
CAACCAAAAAAGAAAAGAAAAGCCTGTAGGTAGTTGAAGGACTGTTGGTTGACCTTTAGG
AGTGTTTTCTGGTCGAGTCTGATGGGGTGCCACTCCCTGGCCCCAAAGTCTATTTTTGGC
ATTCCCTGGGGACTTTGTTGCTCTGTTCCCCCTGCTGTTCTGTTGCACACCCTTGGTGTT
TTTTCTCCGTACGGTGATGTCAGATTGGGTGCAATTCCCGCACTATGTCTCCAGTGTTGT
CCCCCGTGACGCTATGGGTCAGTGAGGGATGTCATGTCTCACGGGGGGGGGGGGGGGCGC
AAGGTGGCCATATGGTCTCTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGTGCCCTGATGCTGTTGCCTGCGTCCTAGATGACGGTGGTGCTAACAGCACTTTT
CTGGGTGTGCCCATTTTGCCCGTGGCTGCTGTACTGCAGAGCTTCTTGTGTACCAACTAC
AGTGCGTCAGTTCACATAACACACTGGCGGGGCTTGTGTGGACACTCCAAGACAGGTGGA
CATTGCCAAAATGGTGAGCCCTGTGTCTCTGTTTCTGTGCAGGCAATTGGGGGCCCCATC
TTGTTGTTGTGAGAAGTTGTAACATCCTCAAGTGGGAGCTGGAGCTGAAGCGCTGGTGCC
CCGGGCTGAAAACCCTGCTGTATGTTGGCAGCCACACACAACTCAAAGCCAAGAAACAGG
TACTCATGGACTCACAAAACTACGCTTACCCCACTTTGTGCGGAAGGTATTTCAGAATGC
CTAGACCTGGTGGTACAATAAGTTGCACACTGGACTGCTAGCCCAGAGGTTGGTAGTTGG
AACCCACCAGCTGCTCTGTGGGAAGACGTGACACACTCTGGACAGCCTTGCAGGTCACAG
GGCCGCTCTACTCAGCTGAGGGGTTGCTGTGTTTGAATCAACGCCACAGCGAGACAGTCT
TTTTTTTCCCACTGAAAAAATAGGTACCCTGAGGTACGCTTTTTTCTTTGATGCCTCTAC
TTATTAACGTTTTTTTTAAAGGGTAGCTAGAGTGCAGTCATTTTCAAGTTCAGTACACAT
CAGCCTTCATGACCCTGAGATCCAGAGAAGTAGACAGTGTCCAGCTGCCACTGCCAACTG
CTGTGGGAACGACCAGAGTGGGGAAACTCAGACTCATAAGGGACCAGGTGTGTGGCTCTT
GGTCACTCTTCAGGTCAACAAAGTCAGCCCTGTGTTAGCATCATAAGCTCCACCTAGGCT
CAGAAGGGTAGCAGCTGGGAAAGGAGTACAAACAGGAAGTGTGATGAGCGCCGACGGTGC
ACTGAGGGGATGGCAGTGATGAGTTGAGCAAAATGTGTGTGAACTGGTAAGTGTAAAACT
GAAGGTCTACACTCTACACCTTCACCCGGTTCATAATAAAGTATTCAAAAAGTGTGGGCA
AAGAGGGTAAAAAAGATACTGGAAGTTTTCCACAAACCTCCCTCATGAAGCCCCCTGCCA
TGCATGGGCTCTGGGAGCACTGGGGCCTCTTGGTGCTGCCAGAGCTACTCCCTGCTTAGT
CGGCACAGTGCTGCCGACAGCCAGGACAAAGACTCGCAGCCCGCCACTCAGCGGATCAGC
CGAGCACTGAGACAGGAGTGGGAACCGGTCACAGCCAAGCTGGGGATTTTCAGGCCTCAT
GTTCCAAACTGCGCCGGGACTGGGAGACCACGGCAGCCTTGTTCTCCACCTGCAGGAGTG
GGCGGAGCCCCACAGCTTCAACATCTGCATCACGTCCTACAAGCGGTTCTTCAAGGGCTA
CCACTCCTTCTCGAAGGTGCGCTGGAGGTGCCTAGTCATTGATGAGATGCAGCAAGTGAA
GAACATGACTGACAGGCACTGGGGAGCCATCTTCAACCTGCACAGGTGCGTGCGCACACC
CTGCTGGGTGCCCCTGACGCTGGGTCGGGCAGGCAGGATTAGGGTTATCTTCTAGTGGCA
GTGCTGCCACACACCTGGTTGGAGTGTGCAGGGCTCAGGAGACTTGAGAGTTGATTTCAC
GAGGCCCACTTCCTCTGTTCCCCCTACTGCGCTCTTGCCCTCTTGTAAACGCTCCCAGAG
AGGAAGCGTCTGCAGTCCCTGTGCTTAGGAACATGGGAGTTTCGCTAGCATTTCTCCCCT
TACCTGCAGCCAGCAGCGCCTGCTCCTCATTGATGCACCTCTGCACAACACCTTCCTGGA
GCTATGGACTGTGGTGCACTTCCTCATCCCCGGCATCTCCAGGCCCTACCTGAGCTTCCC
ACTGAAGCCTCCCAACGACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCGT
TCATATTGAGGAGACTAAGAGAGATGTGGAGAAGCAGCTGACCAAGAAGTACGAGCATGT
GCTCAAGTGCCGTCTTTCCAGCCGACAGAAGGCCCTGTACGAGGACGTCATCCTCCAGCC
CGGGTGAGTGCCCATGCACTCAGCTCAGGGTGAATGAGGCTGAGGGTGCACGTGCAGGTG
CACGTGTGCTGGGGACACAGGGGCTTGGTGGACACTGATCGTGGAGGATGGATCTCCAAG
AGGCCCAAGAAGGGCAGAGGGATGGCTCTCTGTCTGGGGCCATGTCCGCCATGTGCCTCA
GAGTGCCTCCCACACTGTCTGTCCCCTCTGTTGTCTGGGTCAGCTGATAGTAGTCCTTGA
GTAGGCTACCCACTCAGAGAGCTGCTGACACCCCAGTTCCCTACAGCCTTGGAGGCTGGG
ACCTAGGCCAGCTGTGTCTGCAGGTGGACAGACAACTCCCACTCTCCTGACAGCCATTCT
CAATGGAGCAAGGCAGGTGGCCGTGCACCCCTGCTGCTCATGAGCACCCCCAGTGCTTTC
CTCAAGGCCCCCTGTGCTGCAGCCAGAGCACAGAGCTGGAGCTGGAGCGACGGGGGTCCA
GACTGAGCTAGGCTGGTTTCTCTGACCTCACAGGACACAGGAGGCCCTCAAGAGTGGGCA
CTTTGTCAATGTCCTGAACATCCTGATGAAGCTGCAGCGTATCTGCAACCACCCAGAGCT
CATCGAGCCCCGCGTGCCCGGCTCCTCCTACGTAGCAGGCTCTCTGCACTACCACTCTGC
CTCCCTAACTCTCAAGGCTTTGGAGAGAGACTTCTGGAAGGTAGGAGAGGTTTGCGTGGG
CACACATCCTGTTGCTGCTGCCACCGTTGCCGCCACCGCTGCCACCTTTCAGCAATCGAG
ACCCTGGTCCTGAGTCCCGAACTCAGTGACTGAGGCCCTCAAGGGGTTTGGTGATGGCTG
AGAGATATTTGTAACTTTACCCCCGTAATGCTCTGCTATGATCACGGCTCTATTTGCAGC
ATGATCCGTGCCCGTGCAGAAATACCTCTGTCAGAGGTGTGTGTTTGTGCCTGTGGGTGT
GGCCCCATCTCCCTCCCACCCCGTTGCACCTGCGTGCCTGTCTCTGTGTCCATGCGGGTG
GCTGTTATGACTGTGCGGGCAGGATGTGTATGTTACAGCCGTGTTTTCCATTGCCAAAAA
GTCTTGGAGGTTGTTTTCTAATAAGGTCTTGCATTTTGTAATTGCCCAATGGAGCCAATA
CCGAAAGATCCCTGATGGTACTGTGGGTTGAACATTGGGCTGCCAACTGGGAGGTTGGCA
GTTTGAGCCCACCAGCCCCTCCACAGGAAGAAGGTGGCGCTGCGGCTCCTGTCAGATTTT
GTCCCAGGCCACGCTCAGGAGCAGTTGTACTCCGCCCTCCAGGGTTGTTGAGGGGTGGGG
ACAGACGCGATGGCAGTGAGCATAATTTACAGCATGCCCGTCTCTCGTTGTAGAGGTACT
TGGAGTGGGAGACGGGTTCTACTTTCAGCATGTTGGCGGGGAGGCGCTGCAACATGTCCG
GTGTCATGTCCGTGTGCTCACGCTGAGAGGATGCCAGTTGGCGGGGTTCCGTCCCCTCAC
AGCCTGAAGCCCCACTTCACCTCTCACTGCAGTTCTTTCTGTCTGCTTCACAGCTCAACG
CCTCTCCCTTTAACTTTTTATTGTGACCTATGCGCTTACATATCAGATCATCGTTTCTGC
ATTTGGTCACTTACCCAACCTCCCAGCAGCCTGCTCTGTCACACCACACCCCTTCTCTCT
CTTGTAGCATAGTCTCTCCCTTCACCCAAGGTAGCACCTGTCTACCCTCTAGCCGATGAT
TCTTCCTTCCCGCTTTCCCTTCCCACTCCTGTTTGCCGTCACAGCCTGTGTCTTCTGGTA
TGAAGACCATTATCTGCTCTGTTTCCTTTTAAATCACAGTGGTGCTTCTTAGGGCTCTCA
AGTGGGTTCTGACTGCCAGCGACCCTATGCGCAACGGAGGGAAGCGCCCCTCACCACTGT
TAGCTGTGAGCCGTCCACTCAGCCTGTGTCAGTCCTTTCGCCGAGGGCCTTCCTTTATCC
ATCACCGCCCTCGACGTTACTAGACATGGTGTCCTTCTCCGGGGGCTGGTCCCTCCGGAC
AACGTGTCCAAAGTATGAGAGACAGTCTTGCCATCCTTGCCACTAAGGAGCACTCCGCTG
CACTTCTTCCGATGCAGATGGTTTGTCTTACTAGCAGTCCATAGTACTTTCAATACCGTA
CCAGCACCACAGTTTAGAACACATCGATGATGCTTCAATATTCCTTATTCATCATCCAAC
TCTCACAATACATATGAGGCAGTTGGAAATATCGTGGCTTGGGTCAGGCACATCTTAGTC
CCCAAGTGACATCCTTGTTTTTCAGCATTCTAAAGGGCCTGGTACAGCACGTCCTCCAAG
CCTGTCCCAGCTTCCTTGTCATGCTTGAGCGGTTCCTGGTGTACTGTGTGTGCGTGCTCG
TGTGCGTGCCGTGTTCCTTATTCTTTAGGGCACATGCCAGATGGGGGAGAGCGGAACCTA
AGGTATTTCTAGTCCCACTTGTTTGAGGAAGCCCCACAGTGCGTTCCACAGTGGTTGTGC
AGGTTTGCAGTCTTGCCAGCGGTGCTCTGGTCCCTCCTCATCCTCTCCAGCACGGGTTTG
AGCGCAGTGCCAGGGTGAGGTGGCATTCGTCCTGGTTTAGATTTGCTTCTCTTGAATGCT
TGGTGGTCGTGAGCATTTCTTCACATGCCTGTTGGCCGTCTAGGATGTCTTAGTGAGCTG
ACCGTGTCCTCTAGCCATTGTTTAGTTGGGTGGTTTGCCCTTTCCTTGCTGAAGTGTTGA
CGTCTGCTGTAGATTTTAGAGATTAGTGTCCCTTGTCTGTCATTGACAAAATTCTTTTCC
CAGTCAGTGAGTGGGTCCCCCTGGGCCCTCCTCCCTCTTGGGATGACATCTTTTGATGTA
GTTATGTATCTTATTTCTAGGATGTCTCAGTCATCAATTTTTGTCTTCAGTTGTGTGTGG
TTTTTTACATTTTATTACGTTAGTTTGTTTATGCCATGGAGCAGGGATCCAGAGTGTGCC
CTGGTTCCATTGATGAGCAAGCTGTGTTTCTCGGTTTACGTCTGCATCTTCAGCCCATCT
TGAGTTTGCCTGTGCATGTGGAGTGAGGTGGGGCTCCTGTTCTTTGCTTCTCTGCACTGA
GACCCAGCCTTGCCAGCCCTCCTGGTGAATGAGATGCTCTCTTGCCTGATTCATGGGTCT
CACCCTCACTGGCCGGTGGGCAGCGGGGCTGGCGTCTATCCCAGTGGTCTGCGTGTGTTT
GACAGGGCCAGCCCCTCGCTGTGTATCATACCTCGATGTTGCGTAACGATACGCCTACTA
CTGCTCTGCTCCGTTAGAACACAGGCAGCTTGAGGCACCCCCTCGTGCCTCACCTGCCCT
GAGATATCACAGGAATTGAGTCACACCGGGACTGGATCCTATTGTCAGCTGACTGCTTTC
TCTTGAGGGAATAAAGGACTTGATTGCAACTCCCCTGTCTTGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNCCCGTCAGCCTTGGGGAGCACTGGCAGTGGCCAGC
TGTGTTTTCTCTTGGTCCCCCAGTATTTGCTGAACCCTCCTCTCCCCCATCCCCTCCTTG
TCATCTGTCGTTGATACGTCGACAGGCTGCGGCCCTCGGCTTAGAGCAGGCCAAGGCGGA
TGCCAGTGCCTGCACACCTGCACTGGCAGACCCATCTCCCCCTCTGTCTTCAAGGGTGCT
GTGCAGGTCTTCTAGATGCTTCTGTCTCACTTCTGCTGCATCTTCGCTGTCACTTGTCTT
GGAGGGACTTGCCTCCAGCCTTCCCTGGCAGGCTGACCGCCTTCTCTGCCACTGAGAGTG
GTTGTTTTCCTTCTTTACGTAGGAAGCAGACCTTTCCATATTTGATCTCATCGGGCTAGA
GGGTAAGACCACACGCCACGAGGCGGAGCTGCTGTCCAAGAAGAGGGTCACTCGGAAGCT
CATTGAGGAGATCTTCACCTCGCCCCCACCGGCAGCCAGGCCCGTTGCGGTGAAGCTGAA
GCCGAGCAGGTGTGTGGCACTCACATGTGTGATCCTTGCTCCATGCACTGTCATACCCCA
GCCTCGACACACCCTTCCTGCCAGTCACATAGCAGCTCTCAGGCGAGACCGGCCCTCACC
CCTGCATGTGTTGCACCCTGAGCTGCTCCTCAGGGTGGCTCTCAGGGCAGACATCAGTGT
GTGCAGACGTGCCTTGAGGTGTCTTCGGGTCTGGGCAGCAGAACCATGTCAGAGAAGCTG
GCCCTGAGCAGCATGGGACCAGTGGGTTGAAGCCGAGGGCGGGAGAGAGGAGAAAGCGGG
TGTCATAGAGGTGCTGCTGCTGGGCCCCATCATTGGTTTCCTGACTGTGGTTTTCATGCC
TGGTCCACGGGCTTTCAGGTTGTTTCAGCCTGTGCAGTACGGCCAGAAGCCAGAGGGCCG
TACCGTGGCCTTCCCCAGCACCCACCCGCCCCGGACAGTCACGCCCACTGCAGCCCCTGC
CGTGCCTCAGGGCCAGGTCCGAGGACGGCCGCCCATCGCCACCTTCTCTGCGAATCCAGA
TGCAAAAGGTATGCACACATTACCTGCTGACCGGCAGTACACAGTTGTGAGCAGGGCAGC
CCGGTGGTGGCCGCTGCCACGCAGCGGTGGACCGCCGCTCTGTATGGCTGAGGTGCAGCC
CTTCCCCTCAGCCGGGGCTTTCTCTTACACAACAAACCCTGTTTGTGTGGTGCTGCGTGG
ACGCCGCAGAGCAGGTAGATGGGTGGTGGAGGTGCCGTAGCACTTCTGAAAGGCCCTTCT
TGCTCTATTTGTGCCATCGTGGTAGCTCACCTAGCTGTTACCGTGAAGAGGGATGCGATT
CAGTGGCAGGACAGGTACAAAGAGTGTTGCAGCTTCCAATCTAGGAGTTCTTAGCATTAC
TGCTTTCCCTTTTTCTGAGAGAGAAGCTAATGTGCAGAGCTGCCTTGTTGCAGAATTCCC
TTGGAAGGTAAGATCGGAAGCTCTGTGTGTGTGCGTACGCACGCAGGAGAGTGTCTAGCT
GTCTAGTGGATAGTAAGGTTGGTGGGGCCACTTGTAGTTCCTATTTATCTGCTCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNAGGCTTTTCTGGAAGGATGTGTGAGTGGAGAGACACGTGACAGGAGACCT
GCTGCTCATGTGACAGGTCTCTCTTCTTTTGCCGGTAGATAGAGAAATTGCCCTAATGTT
TTTCTTGAAGACATAAAGCTAAAAACCAAACTCACTGCCATTAAGTTGATGCCCTGTCCT
TTAACAACTCTATAGGACAGGGGAGTCCTGCCCCAGAGTGTCTCCAAGGCTGTAAATCTT
TACAGAAGCAGACAGCCTCGACTTCTCCCATTGAGCCACTGGCGGGTTTGAACCTCCAGC
CGTGCTGTTACCGGCTCAACGTTTACGCCCTCAAGCATTCCACGTGTTTCTCAGCTCAGC
ATGCTCTCCATGAGATGACGGTCATGTGGTTGTGCCTTGACTGTAGAGGAGGCTGTCCCT
TGAAGGGCGGGCTGAAGAGGGCTAGCGGGAGCCCCACATTCCAGTGGCAAGTCACGTAGA
CCTCTCCCCGCTTTCCCCGTTCTACCTGGGTGTGTGTGGGCGGAGCTGAGACCAGCGTTC
CCGAGCCTACTAACTCTTCTTGACCTCTCACTAACGCTCTGAGGAAGGGCTGTCTAGACT
CAGACATCCATGTGGTGCTCAGCTGTTGCCCAGGGCTCCCCTCTTGAGAGGCTGGCCAGG
GTGTGACGCTGCAGATGGAACCCTCTGGTCGGTTCCGATCAGCGTGAAGACCCCATGTTT
TCTCTCACTCACGCGAGTTCACACGCGCGTTGGGGTATGTTCTGGGCTCAGCAGGTCCTG
GTGTGGTTGGGACAGTCACTCCATGCATGGTTTGCCCTCGAAATGCTCCACGGTTTGAAA
GTTTTCTGAGAGTCAGAGGCTGATGCGAGTTTCCGAGGGCATGGCAGCTAGGTCTCTGCC
GGGTGGTGTCTGCTGCTTTCCTTATTGCTTGGGAACATAGGACCTACAGAAAAAAGTAAC
ATCTTTGATAGTATTTCGGTTAGTAACATTGACATCTGGTATCTAAGACTCATAGCAGCT
ATGGTTAAGGGAGTGAACTGTCACGAATCTGACATACTTCTTAACTCTTTCTCTTTCCTG
TGGACATCCCTGTGTTGCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATTTCTCGGAACGCGGGTGTAAGTGCTGCGTGGTGTTGAGACCCTCTAACCGCTCTGCG
CACACGCGCCTTATCGATTGCAGTGGCGGCCGCACAGTCTCAGCCACCTCAGGCCTCCAG
TGCTCCGAGACACCAGTCCACCACGACCTTCACCTCCGCACCTAGCGCAGCCCATCCTGC
CAGCCTGCGGGGCCCGACCTCGGCCCCTGGCCCGCCCCTGCCCCCGGCCCCCGCGCACAC
CGCCTCGCAGAGTGCACTGCCCCCGAGGCTGGTGCTGACCGCCCAGGCCCAGGCTCGGTT
GCCGAGTAAGTGGCCTCACCTTCCCAGATCTCTGACCTCTGACCCAGAGAAGTTGTACCT
CACACACTGGCGTGAGTGAGGGGCCTCTGCTGCCCACGCCTTCTGGGCCAGCGTCCCAGC
CTTCTCTTCCTGTTCTCCTCTCTCCCCACTCCCACCTGCTCACTCTGCTGTCCTCATGGC
CTCCTGCTGGACTCACACATACACTATCACAGGCTCTGTCCCCCGGAGGGCACCCCTGCT
CTCGTGTCAGCTCTTCCCACTAACCACGGGCATCCACAAACCTTCCTTTCCTGTCGGTCA
CTTCACACCACACTGCTCCCGAGAGGTCTTGTGATAACTAAGACAGATGACTAAATCTGA
TGAGCCTCACAGATCTCTTCTCAATGGTAGAGGGATTACTGTGCTTCCTGTAGTTCTGCG
TCTTCATATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAGTGAAG
TCGGCAGCTCCCACCCACTAGCTGCTCCACAGTGAGGGAGGAGGAGAGGCTGCCTTCTCC
CAGGCTCGGAAACCCTGTGGGGCAGTTCTGTCCTGTCCTGCAGGGTGCTGGTGGGAGTCT
GCGTCCACTTGACGCCACTGGTCTGGTTTGACTTCTCTTTTTCTGCCCCTGATTGTTGCA
GGCAAAAGAAAGAGAGTGAGTGTGTGTTGGTGTGTTGTGTGGCGTGGTGTGTCTGGTATA
TGGTGTGTATATTAGGTGTGGTGTGGGGTGGGGGGCTGTTCAGGTAACCTGGAGGGAGTG
TGCAGTGTCCCTTTCCTCTGTTTCCGCCCAGGAGGAAAGGGCCAGACTCCTGAAGGAGCG
GCTGGACCAGCTCTTCCTTGTCAATGAGCGCCGCTGCTCCCAGGCACCCATCTATGGCAG
AGACCTGCGGGGGGTGTGTGCCCTGGCCACACGGGGTTGTCCCGGCGACAGCAAGAGCAC
TACGGCATTGGTGCTGAGCCAGTGGAGAGAGTCTCTGCAGGACCTCACAGACAGGTAGCT
CACCTGGGTGACGTGGTTCCTCCATAGAAGCATCTCTGTCTCTGAGTCGTCAGGTCCATT
TGGAACTCATCCCAAGTGTTGGGCGTCGGGGTCAGCTGTGCCTCCTTGTCTGTGGTCTGT
GGGAGGCACACAGTCTGCCACCCTCCCTCAGACGTATCTACCCCACCCCACCGGCTGGCC
TGTTCCTCTAGGGAACAGGTCAACCTGGGCGCTCCTTGGCTGTAAAGCCAGGCTCTTGTG
CCCAATTCTGTGCATATATTATTGATAATTCTGTTTTTCTTTCATTAAAAACCTCTTTTC
TTGAAGCAAGGAGCCCTTGTGGCGCCGTAGTTATGTGTTGGGCTGTGATGCGAAAGATCC
GCAGTTTTAAACTACCAGCTGCTCCCCAGGACAGAGGCGGGCTTCCTACTCCTGTAAAGC
GTCCCGGTCTCAGAAACTCCTGGGGGCAGCTCTGCCCTCTCCTAGAGGTCACTCTGAGTC
CGTGTTGGCTCAATGGCAGGGAGTTTGGTTTTGGTTTGGCTTCTTGAAGCGACAGCTGAT
GTGTTTCGTTCGACTGATGAGCAGCGTGTGTAGGAGTTAACTGAAGAACTCACTCTGCGA
GAACTCTAGAAGGCAGTGAGCGCTGTGCCTGTCAGCGAGGCCAAGTGTGCGTCCCTTCCT
TCCTCCATGTCACTGTTGAGACACAGTCCCAGGCGTGGTCCCCATTCAGAGGGAGGTCTG
CCCAGGACGTCTCAGTTGCAGGCTAGGTCTCTCGGACCAGAAACAGAGAGGAGAAAGTCA
CACACAGGCACCTCCAGCTCCAGCCTCTGCTCCGAGCTGCTTAGCGCCTCTTCCTCTTTG
GCACATGTCTCTATCCATCTCCCTTCAGACTGGCTAGTGTGGACACAGGCTGTAGCAAGT
AGATAGGAAATGAACCAGCTGGGCCTTGTAGGGAGAGATTGCCAGGAGGTGGGTGGTGGG
TGGTGGGGTGGTGGGTGGAGGGCTTGGCAGGGTCCAGCAGGGTACAACTTCCACAGGCAG
GTCTAGACAGCAGGCCACCTCAGAACCAATTCCTGAGGTCCGGGAGCCCTCTTCTGATGG
AGTCAGTCACTGTGTGGTGACTCAGCCAGGACCAGCCAGGGTCACCCTGTAGCCCTGCTC
CGCCTAGCTGTTGGAGGTAGTGGACATGCCGGCTAGTCCCCATGGCAACGAGTGAGGCCA
CCACTGCAGCTCCTGCAGGACCTTCTTTCAGAGACCCTGGCCAGTGTCCTAAGCGGCCCG
CTGCTGTCTGTCCGGCCCTCAGGCACTCCTCACTGAGCCTCCGTCCTCTCCCTCCAGGGT
GGCGTGTGTGATTCCCCCTGTGGTTGCGGCACCACCCGCCCTGCGAGTGGCCAGGCCGCC
CTCCAGGTACAGCCACAGGATGAAGGTCTTTGAGCACAACCTGCGGGAGCGTGCCGCCCC
CTACCTCCAGCAGCTGCAGCAGCTCACAGCCCTGCGCCTGCTGCAGTTCCCTGAGCTCCG
GCTGGTGCAGCTTGACTCAGGTGTGGTGCGGTACGGTGCGGTGCGGTGCGCGCTGGGGCT
CGCCACACTTGTGCCCCCCGGCCCCTGCTCAATGCCATCCTCTCTACAGGGAAGTTAGAA
GCACTGGCAATCCTCCTGCAGAAGTTGAAGTCGGAAGGGCGCTGTGTGCTCATCTTGTCT
CAGATGGTGCTCATGCTGGACATCTTGGAGATGTTCTCTGAACTTCCATTACCTCACCTA
TGTGAGAATCGATGAGAACGCCTAACAGCGAACAGCGGCAGGTGGGTGGGCTAAGACCTT
GGCCTGGCTACTTAGCGCTGTACCTGCAGTGCTGTCAGAGCCCTCTCGGGGCACAGGCGG
GTCTGGGTGAAGTCATACTGAAAGCCCTTGGCAGTATGCGGTGTGGTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGGAATGAACGTGAGGCTGCGTGTCCCCGT
GCTTCCCCTTACCAAGGTAGTTGAGAGTGTTGTGCTGTGTAGACAGCATAGCCTGTAGGG
AGCATCCCAGCAGACGGATGCACTCAAAGGTGAGTGTGCAGCCTGACTCTGACATCTGCT
GAGGACATGTCCTTACTGTCCTTACACAACAGCCATGACAGACTTGGTGAGGGTGTGTGC
GGGGGCGCAGCTTTCACCATGGAGATGTTGGCAACAACCCCTGGACAGGGGCAGCGTAAC
TCCCACACACGTGCAAGGAGAGGTGTGCCATGGGCCACATGGCGTGGCATTCCACAGTCA
TAATGATGCCTTAGAAATTTGGGAACGCGACACATGTTCTCAGGACAGTGGTAAACGCTG
TACCATGGGCCACACTCCCACTGAGCTGTGTGCTCTCCCTGTGCCTACATGCATGTTGGC
TGGGCCCTCGGAGACAAGCGCACATGCACAGAGAGGGTAGGGTTTGTTGCAGGCAGAGGC
TTGGTCGGGCGGGGCAGGAAAGTCTTCTTGGCTGGTGGCTCTCCCTGAGGCGGGCTCCTC
TCACGGCTCCATTCCCTCACTGGCTTCCTCAGCCTTACTCCTGGGCCTTCTCGCTGTGGA
GTGCCCTGGCATTGCCTGAGGATAGATAAGAAAGCCCGTGTCCCTCCCCAGGAAGAACCC
ACTTTTCTTCTGGGGCCTACACATTGAGCTAACAGTGCATGCACACTGGGACACCACCCC
TCACCCCCACCCCGCCTCCGCTATGACTGGTGACAGTTACCGAAAGAAGGTGCAGATGCA
GGAGGGAGATCAGGGAGCAGCTGGGTGGAGTGAGCATTTCCCTGGCTCCGCCCCAGCCTC
TTGCAAGGACTGACCGTAGCATGTCTTTCCTGGTAGGAGCTTATGCGCAGCTTCAATAGG
GACAGGCGCATCTTTTGTGCCATCCTCTCGACGCACAGCCGCTCCACAGGTGTGAACCTG
GTGGAGGCAGACACTGTGGTCTTCTACGACAACGACCTCAACCCACTGATGGATGCCAAG
GCGCAGGAGTGGTGCGACAGGATCGGGCGCTGCAAGGACATCCACATATACAGGTGGGAG
GTGCCACACTGCCGCAGTGCTGCCCAAGCAGAGGGCTGGGTGTTTCTGAATATGCTCTTG
TCCTCGGACCCTGCTAAGAGGGGTACTCGTGCTTGGGATTGTTTCAGATATTTAGACATC
TCAGTCATCGGTTAGGAAACTGGAGCCCTTGTAGAACAGAGGCTTAAGTGCTCAGCTGCT
AACCAAAGGTCAGAGGGTGAAAGATGAGAGCTTCTGCTTCCAGAAAGATCCACAGCCTCA
GGACCACCCCACCCCCCCACTCCCCGGCCCTGAGGCATAGCTCCACTGTCCTACAGAGTT
ACTGTGAGTCAGAATGGACATGATGGGGGAGGGGGAGGCGTTGGGTTTGGCTTGAGGAAC
ATCTTTAAGGAACCCTGGTGGCGCAGTGGTTAAGCACTTGGCTGCTGATTGAATGGTCTG
GGGGTCAAATCCACCATTTACTTCGTGGGAGAAAGGTGAGGCAGCAGTCTGGTTTTATAA
AAAGGTCACAGTCTTAGAAATCCTGTGGTGCAGTCGGCCTCTGTCCTGCTGAGCTACTGC
GAGTTGGGGTAACATAGCAGCAGAGGCGTTGGCTTTTATTTTGGGTTATTGTAATAAAAT
GGTTACTGAACAAAGCCACCTCTGTTAAAATTACCTTCAAGCGCAAACAGTAACAACCAG
CCACACTATGAGGGGAGAAGTGGCTCCCTGTGCCCAAACCTGTGATGATGTTGTGTGTGT
GCGACTGGCAGTGGCAGGAGGGCCAGGCCAGGTAGTTGGTGCCTGTGTGCGCTGAGCCCC
CTGCTGCCTGCTCTGGGTCACTCACTGCTCCTGTAGATAGGGGGTGCCCCATCTGCTTTG
GGCCAGGGCAGAGCTACAAGGCATCTGTCTTCCCAGCCCAGCCAACCAGGAGCCATATCG
GTCTTCTGCGAGGCCACGCATGGCTCTGAAAAAAGGTGTTCAAAGAAAAACCTCAGAAAT
CACTGCCATTGAGTCCACCCTGACTCAGGTTCCCTACAGCAACGGAGAAACAATGATGGC
TTGCAGAATTCTGCCCTGTGGCCTCCACCATCATTTCTGCTTTCCAACGACCGCTTCTCC
CTCTTGGTGTCAGATACCAGCACCAGCAATCATCAGTGCATCTTGAGTGCATGTTTGATC
AACTTCAAAGAAAGGAAATTGGAAGAATTCTTTAGTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCAACGGAGAAACAATGATGGCTTGCAGAATTCTGCCCTGTGG
CCTCCACCATCATTTCTGCTTTCCAATGACCGCTTCTCCCTCTTAGTGTCAGATACCAGC
ACCAGCAATCATCAGTGCATCTTGAGTGCATGTTTGATCAACTTCAAAGAAAGGAAATTG
GAAGAATTCTTTAGTTTCTTCATCACTCACTTTGGTAGTAGGTGTGGACATCTTAATAAT
AGTTGTATAAACTAGAAAATAGTAGTTTTCAGCGTCTAGATATCATCCTGTCACGAACAG
CATTGTATGTGCTTTAAGATCTTGAAGGGTTCTTTTTGACTCAGAATGGACACCATTGGT
CTTGAATTTGCCATTCCTGGAATAGTAAATCCTGTGATTGTGTGACCTGGAGTGACCCAT
ACCAGTCCACTCCAGCTCGCTAGTGCTTGGGAGAGCGAGTGTTTTGTGAGTTCATTTCAT
TTTTGAGGTCTTCCTATTTCCCTTAGATTTGTGCTTTGTACATTCCACGTTCCGATTACT
AGTGTTTATGGCTGTTCTCTTCTCATTTGAGTGGTGCCCCAGCCACAAATGAAGACATTC
TGCTCTATCCACATCGTTATGGTTGGCTCTACTTTTTTTTTAAAGTTTTATTGACATATG
ATGTACACATCATGCAATTCAGTAGTCACATTGAGACAAGCTGCACAGTCATTCCCACAG
TCAGTTTTAGAACATTGTTTCCATCCTTGTGCTCATCATTATTCGCTGCACACCTCCCCC
AGCCTCCCCTGCTTGCCTCCAGGGAGCCATTCGTCCAGTTCCTGCTCTAGATTGACCCGT
TCTGGAAGACTGTTGCTGAACTACGACAACGGCAAAGGAAACATTAAAGCCTCCACGTGA
AATTAAACATTAGAACAAATTTGAAATGGACATGATGCATTCGGCATGATCGCATGGCTG
TTCACATACCTGACCCATGGTTAGAGGGGGATTCACCAGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCTTCACTTTTCTTTTTTCCCCAACTAAAACAACTTTAATG
TGGGTTAATAAGGGAGATAAAGTGATAAGATACAACATTCTAACCTAACTATGTCTGCCT
TAATTGACTTTAGAATGAACTCTGATGACGAAGCCATTCATGTCCCTCAACTATGATCGG
GGGTGGGGTGGGGGTGGGGGGTGTTCACCTGAGGCTTAGTCCACGTGTGGACCCTGAAAT
GCACTCTGGGCTTCCACTGTGATGCATAACCTCCTGCAAGGTCGGCTTTACTCTGGTGAA
GCAGCTTCTGCAGTCCTTTTTCGAGTGCCTTCCAACCTGAGGGGCTTACCTTGACACAGT
GGTCTGTCCCTCAGAGGTGGAAAGCCTGCTCCCTCTTGTTGTCTGTTCTTAGCCAAATAC
AAGTTCCTCCTGGTTTCTGAAATACTGGTAGCATAGCTTCCAGCCTCACAGCAACAGGCC
AGCTAGCACAGCGTCGGATGGGATGGAACCCATTGATGACATCAGTAGGAAGAGACGAAG
GAGAAGAGGCACTTATTTCAACAGAATAGGGGCAGACTGCGTGTCAAAATCAGGAAAGGT
GTGCCCCAGGGTTGTATCCTTTCCCCATACTTAATCTGCATGCTGAACAAATCTTCCAAG
AACACAGCATCAGGATTGAAGAAGACTCATCAAAAATTTGCAATATGCAGATGAAATAAC
CTTGCTTCCTGAAAATGAGGAAATTGGAGCATTTGCTATGAAATTCAACGACTATAATCT
TAGGTGTGGGTTGCTGCTCAATGTAAAAGTTGGGGCCAGCCCCAATCCCAGCTACATTAA
CCCCTCCCCCAGGAGATTGCACTACAGCCCAGGTGGGGTGGCGGGTCTGCCCAGACCACA
CAGGAGCAAACTAAGAGGGAGAGTGAGAACTGCACCCTGACCCACCAAGCCCCGAGTACA
ACTCTCCTGCTGGGAGCAGCCAAAGCACAGAGAGGACTGTAGGGCCAGCCCCACCATGAG
ACATGACACCCCCTCACTGACCCACAGTGCTGCAGGGGACAGCACTGGAGACACAGTGTG
GGAATTGTGTCCGGTCTGAACCCCCCACACTGGGGCGAAACACGAAGGGAGTGCACGAGA
GCAGCCAGTCCTCAAGTAATCCACAAAGTAGTACTTCAGACTCATAGGTCAGGGCTGGGC
ACCTCATCAGACTCGATCGGAAAACATACATAATGGTCAGCAGACAGATCTTGTGAGCTA
TTTATAGGCCTTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAG
AGATTAGCCAGAGAGAGAACCCTCCAGAAAAAACTAGGTGCCTGTTTTTTCGACGGGAGA
GGGCCAGGGAGAGGGGGAGGTGGGGGGAAAATGGGGAGCCAGCGAACTCAGGGACGAGGA
AACAACAAGAGAACTAAAATTGATGGCAAGGAGGGTGTAGAGCGCCTGGTGGGGTTTGAC
CAAGTGCAGTGTAGCCGAGAGGAATTACTGAGAGCCAAATGAAGGTCGAACTTGGCAGTG
GGATAGGAGGAAAGTAAAGAAAACAGAGGAAAGATCTAGGAGGCAACAGATATTTATAGC
GGTATAAAGATAGGCGTGTATGTATGTAAATATACTAATATATAACAGTAGGGATATAGA
CTGTACATATATTTATATGTTAAGTATCAAGGTAGCAGACAGACTTGGGCCTCTACTCGA
GTTCTCCCACAATTCCAGAACACTTTGTTATAATAACCTGGCTTTCTGTGATGATCACCT
TCCCGACATGATCTCTGAAGGCAAAATGAGCGCATAAGCAAATGTGGTGAAGAAAGCTGA
TGGTGCCCGGATCTTAGAAGATATAGCGCTTGGGGTCTTAAAGGCTTGAAGGTTAAACAA
GTGGCCATCTATCAGGGAAGCAACAAAGCCCACATGGGTGAAGCACACCAGCCTGTGTGA
TCACAAGGTGTCAACGGGATCAGGTATCAGGCATCAGAAGACCCCAAACAATCATATCAA
TGTGAATGATGGGGGTCCGAGTAAAGACCAAAAGCCAATTGGATATCCCTTCACAAAAGG
GTCACAAGGAAGGGACAAGCCAACCAGGGTGCAGTATAGCACCAAGGAAACAACACAACA
TTCCACTAGTTCTTAAATGCTTCCCTACCACCACCACCACTATCATGACCCCAGTTCTTC
CTTACAAATAGGGCTAGCGCGGAGCTCTCAATACTACACAGAGTCCAGGACAGCTAAATC
CCTCAGAGCTAATAATGAGAGTAGTGATACCATGAGGGGAAGGAGAAGGGGGAGAAAAGG
GGAAACAATTGCAGTGACCAACATCCAACCAACTCCCACCTCACCCACCCCAGGAGGATG
AACAACAGAAACGTGGATGAAGGGAGAAAGTGGACAGTAAAAATATGAAAATAATAATAA
TTTTTCAAGGGGTCATGAGGGTGGGAAGTTGGGGGAGGGAGGGGAAAAAATAGCTGATAC
CAAAGGCTCATGTAGGAAGAAAATGTTTTAAAAATAATAATGGCAACATATGTCCAAATG
TGCTTGATACAGTTGATGTATAGATTTTTTTTTTCGAATGAAAAATAATTTACACCTGAA
TACAATTTGTTTTTTGAAACTAAATGAGACCATATGTATACCATTAAATTCGGAGTGCAT
TATCCGAAAGTCAAACAGCACGGCAAATCCAACACATGTGCAGATGTTCTCTGAATTCAC
GCTTCATCGAGCATCAAAAACCACCAATCTTGTAGTCCTTTTCTTGTACATTATTCTGTA
TCCACATTCTCTGCGTCTGATTGGATCCCTGGATTTTATTTCATTTTCCATGTTTACATT
CTCCGCAGATAAATAGCATGCCGTTTTGGGGGTTGCACGTCGTCCTCCTGGAGTCTGTTG
TTAAATACCTATGAAGTCAGAGACAGTGCTCGCTCCGCAAGGCCAAACAGCAGCTGATGT
GTGGATTATTGTAAGAGTTGTGAGAGCCCCCAATTAAATGATTTATTTTTTAAAAAGCAA
GCAAATAAAAGTCCTCACAAACAAGACCAGTGGACAACATGATGATAAATGGAGAAAGGC
TTGAGGTTGTTAAGGATTTCGTTTTACTTGGATCCACAATCAATGCCCATGGAAATAGCC
GCCAAGAAATCAAACCACGTATTACTGCTTTGGGCAGATGTGCTGCAAGAGACCTGTAGA
AAGTGTTTAAGGGAGAAGAAGCCAGTGGAAGAGCTAAGGCAGCCCTGACCAAGCCGTGCT
GTTCTCCATCACGTCATGCGCATGTGAAAGATGCCCATGGAACAGGGAAACCCACAAAGA
CCGGACCCGCTTGCATCAGGATGTTGGCAAAGAGTACTGAAAGTGCGGTAGACGGCCAGA
GAACAAACCAGTCTGCCAAAACACTCCTTAGCAGCTAAGACGGCGAGGCCTCATCTAATG
GCCATTGGGCATGTTGTTAGGAGCTAGCAGTCCCTGGAGGACATTGTGCTTGGTGATGTG
GAGGATCAGAGGAAGAGAAGAAGCCTCCCTCACTGAGCAGTGGAACCTCAGAACAATACA
GAACCTGAGAGGAAGACAGAGCGGGGGCTGGAGGGGGCCATTTGAACTAAACCGAACTCC
CAACTAAGGAAAGGCAGGCAACTTTGATTACTGTGAAGTAAACATTCCATTGTTTTCAAA
AACAACAGCAATGCGGTAAGCGTAGTTGACCGGCAGACAGCAGATTGGAAAAGATACTTA
AAATTCAGATAGGCAGCCAATCTTACCACGTCATAACATCTCGGTCACATTTTAAGATGA
TGAACAGGCAGCCCCACATGGTGATGCTCACTTTCGGGGAGGGTGTGTCTGTTGGACCAC
CTCTCGTGTGTGTGTTGCCAGTGTCAGTACACAGTCTCCCGGGCACTAGCCCGTAGGCAT
CGCCAGGTGAGGCCTATTAAGTGAAATCCACCTGGCGTGACCCCCCAGGGCCCTGTTCTG
AGTGGCAGCCATTGTAGCTTGTCTGTGTAAGCTACACAGACTTGAGTGTGCCCGCGGACT
GGGGGGAGTCGCTGGGAGGTGAGAGGCTGCAGGTTCACGTGCTCAGTGTTGCCGCTGGGG
AAGCTGGGGGTGTGGGCGCTAGGGGAGGGGCCGGGCAGGTGGAGATGGCCCTGTGAAGGT
CCGCGTTGGCAGTGGGGAGGGGAGGCTTGGTGGTCACTGTGCCGCATACCCATAGGCTTG
TGAGCGGCAATTCCATCGAGGAGAAGCTATTGAAGAACGGCACCAAGGACTTGATCCGAG
AGGTGGCAGCCCAGGGAAACGACTACTCCATGGCTTTTCTGACGCAGGTACCTGAGCTGG
GCGGGGCGGGACGAGGACGAGGCTCCCTGGGTGGCCCTGCCCTCCCCCATGGTGGACCTG
ACGCCCTCCTCTCGCGGGCGGGCGGGCGCAGCGCACCATCCAGGAGCTGTTTGAGGTGTA
CTCACCCCTGGAGGACGCGGGCTTCCCTGTGAAGGCGGAGGAGTTCGTGGTTCTCTCCCA
GGAGCCTGCCGCCAGCGAGACCATCGCACCCAAAATCGCAAGGCCGTTCATCGAGGTGAG
AGGCTGGCTGGGCCGTCCCTGTGAGGTCGGGAGTGGCTCCAACCGCTCAGAGCTACTCCC
TCCTTCCCTGACCCTGACCTAGAACTCTGTCTCTGCGCCTCCCCAGCCATCTCTCTGTCC
CTGAACCAGCAGAAACCCTCTAGGGAGGCTTGTTTGGCGTTTGTTATCAGTTCACTGTGT
GCCTTGTAGCTAACTCTTTTGGAAAACTCCCAGTTTGAGACAGTAAGTCATTCTCCTCAG
GCCCTCAAAAGTATTGAGTACTTGGAGCAGGATGCTCAGAATGCTCAGAAGTCCTACGAG
GAGGCAGTGCTGGGGGTGAGGACCGACATGGCCTCGGCAGACGGAGACCGCCCGAGACTC
CCTGAGGAGCCGTCTCAGTTAGAGGAGCTCGCGGACTTCATGGAGCAGGTGGGGAGCTGC
CTGTGCTGGTACCGCCAGGGTCTTCTTGGTGGGCACAGCCACCCCTCGCGCACGCCTTTG
TGGTTACTCGGAGCAGCAGCAACCTCTGCTGTGGTGGGGCTGGGGGAGGGTCCTCCAGGG
GATTCCCTCGGCCTTTCGGAGCCGACTCTTAACACCCCTGTCGATACAGCTAACACCCAT
AGAGAAGTACGCGCTGAATTACCTGGAGCTATTTCATACTTCGATTGAGCAAGAAAGAGA
GCGAACCAGTGAGGTAAGAGCATCGGCTGTGCTCAAGGTGAAGTTTATGTGAAGTCCCTG
TGGGTGCCACAGACTTGACAAGACAGAAAACAAAGCCCGCGCCCGAAACTAGAGACTAGC
TTACAGCGAGGGTCGTGGGGGGAGGGGGAGGTTGTGTGTGTGTGTGTGTGTGTGTGTGTG
TGTGTGTCAGAGAGAGAGAGGAAAAGCTAGGGGAGAGGCAGAGGTTTCTGTCTGCTGAGG
GGCGCCGGCAGGGACATGCGGCTGACGGGGCGTGCGCTCTGCTGTTCTTCCTCAGGACTT
GGCCTTGGCGTCCATGCAGGAGTGGGAGGCCCAGAACATGAAGGCTCTGCAGGAGTGGGC
GGCACGGGCGTGGGAGGAGGGGCCGCAAGAGGAGCTGCTCACCTACACGCGGATCGATGC
CTATAGCATGGTGCGTGCTGCTCTCAGGAGAACCCTCCTCCCGCATCCGTTTGAGCTCTG
GGCTTAGCAGCCGCTGTTGTAGCATTCCCTTTGGGGCTCTCTGCCAGCCGACTGGCTGAT
GGCAGTCTCCTTAGTGCTGCTGCAGAGTGTGTGTTGGAACCCTAATGACACCCGCCCACG
CTCCCCACAGGAGTACATCTATGAAGATGCGGACGGACAGACCGAAGTCATGCCGGTGAG
TGGCTGCATGTGCATCCCCTTCTGCACTCGCCAGCCTTTAGGGATGCAGCTGATGGCCTC
TCCCTGTGTGTGCAGCTGTGGACGCCGCCCACGCCCCCTCAGGATGACAGTGACATCTAT
ACGGACTCTGTCCTGTGCCTCATGTATGAAGCCATCCCCATCCCCGAGTCCAAGCTGCCT
CCTGTGTATGTGCGGAAGGAGCGGAAACGACATAAGAGCGACTCCTCAGGAACACAGAAC
ATCCTCCCCGCTTCAGTCCTTGTGACTGTCCACAAGACCGCAGGGAAAGTGTTGTCAACC
AAGTGAGCGCATGTCTCCTGTCTTCTTGGCCTGAGTGAGGTTGCCATGGACACATGACAA
CTCTATTGACACACGCTGGCAGCCACAGAATCCCTGCCTGGGTGAAAAAAAACTCATAAA
ACAAAAACAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCA
GCTCCTCATTTTTCCCCCTCCCTCACGAACCCTGATAATTTATAAATAATTTTTCATGTC
TTACACTGACCGATGTCTCCCTTCACCCACTTTTCTGTTGTCCATCCCCCAGGGAGGTGG
TTATATGTAGATCATTGTGATCCATTCCCCTTTTCTCCCCCACCTTCCCCTTCCCCTCCT
GCTATTGCTACTCTCATGATTGGTCCTGAGGGGTTATCTGTCCTGGATTCCCTGTGGTTC
CAGCTCTTATCTGTACCAGTACATGCTCTGGTCTAGCTGGATTTGGAAGGTAGAATTGGG
ATCATGATGGAGGGAGGAAGCATTAGAGAACTAGGGGAAGGTTGTGTATTTCATCAGTGC
TGTACTGCACCCTTGTGGCTGGTCTCTTCCTTGTGACCCTTCCGTAAGGGGATGTCCAGT
TGCCTACAGATGGGCTCTGGCTCTCCACTCTGCACTCCCCCTCATTCACATCAATATGAT
TTTTTGTTCTGGGTTTTTGATGCCCCATACCTGATCCCATCAACACCTCATGATCACACA
GGCTGGTGGGCTTCTTCCACGTGGACTTTGTTGCTTTTCAGCTAGATGGCCGCTTGTCTG
TCTTCAAGCCTTCAGGCCATAGGCTGTATCTTTCGATAGCTGGGCACATGAGCTTTCTTC
ACCACATTGGCTGATGCACCCGCTTTGTCTTCAGTGATTGTGTTGGGAAGGTGGGCATCA
CGGAATGCCAGGTTATTAGAACAAAGTGTTCTTGCATGGAGGGAGGACTTGAGTAGAGGC
CCAATGTCCATCTGCTACTTTGATACTTAACATATGAATATATGTACATAGATCTATTTC
CCTATCGTTACATATAAAAGTATTTATATATGTACATGCCTGTATTTAGACCTCTACAAA
TGCCCTGTGCCCCTTAGTTCTTTCCTCTATTTCCTTTCACTTTCCTCTTGTCCCACTATA
ATGTTCAGCTTTCATTTGGGTTTCAGTAATTCCTCTCGGTGACTTTGTCCTTGATCAAGC
CCTACCAGGCCTCTTACACCTTCCTTGCCACTGATTTTGGATCACTTGTTCCACTGTCTC
TAGGTTTGTTAACACCACTTCCTTTCCCCCACCTCACCCTGTTCCGTGTCACCCTGGAAC
CTCTTGTCCATTTGTTTTCCCTCCAGATAGTTCATCCAGCCTATCTTATCTAGATAGACC
TGCAGAGATAATAATATGCACCCAAAACAAGACAGAGCAAAACAAAGCAACAACAACAAC
AAAAATGAGGAACAAAAGAAAAGCCTGTAAATAGTTCAAGGTCTGTTTGTTGACCTTTAG
GAGTGTTTTCCAGTAGAGCTGATGGAGTGCCACACCCTGTCCCCAAAGTCTATTTTTGGT
ATTCCCTCAGGACTTCCTTGCTCTGCTCCCTTTGCTGTTCTGTTGCACGCCCTTAGTGTT
TCCTCTGTGTGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACAAGGTCAACAG
TTTGGACCCACCAGCCGCTCAGTGGGAGAAAGATGAGGCATTTATCCCCTTAAGGGGCTT
GGTCTCCAGAGCTCACCAGGACAGTTCTCTCCTGTTCTCTGGAGTTGAGAGCCAGCACTG
GCTTGAGGACAGTGAGTTTGATTGGGGTATGTCTGGGCTAGTTTTCAGGTGGTGATGTCT
TGCGTTTTGATCTCAGGTTGCCTGCTGTCGTTGGTTTCTGTACAAAGGACTTCCTTTAGC
ATTTCTTGTTAGCTTGGTTTGGATTTTACAAATTATTAATATCTCTTTACATACGGATGT
CCCTACTTACTATTTGAAGGATAATTCTGATTAATCTATACTTCTTGGATGGTGTGGCAG
TTACGTAATCTCCTGTCAACTTGAGCGAACGGGTGGAATCTAGCCTGTCAATCAGGTTGC
AGCTGGATGACCTCATTTGGAGGCATGACGGAGATAAATAGCTCACTGGAGGCTAGACCC
ACTCTCTCTGCCTTCCCCTTTCTGCTGTTGAGACACTCAGAGAGCTGGAGGAGACGCGTG
GAGACCCACGCCGGTGTTGAGATGCTTCCACTGCCACTGGATCCACAAGGCCCTCTACCC
ACTGGCCTGTGTGATCTTCCTGCATTCAGTGTCCTTGCATGTGCTGTGTGAGTCGGAAGA
GGAATTTATGGACTAGTATGGGGCATATGGACTAATGCCGGACTTAAGGACTTGATCTGG
ACTGACTGGGATGTTTGCTCAATATACAATTGTTCTTTGTTATAAAGCTTTTTCTTAACA
CACGAGTGTCCCTGGATTTGTTTCTGTAGTCAACCCAAACTAACACTTATATATGAAGAA
GCTTCAAAAAGTTCAAGGGTCAAGTCCATTATCTTTTCATTCTGTATTCCTGTGAACTTC
TTGAAGCCCCCCAATATGTCACCCCCTTGCCTTCTTGCCTGCATGGTTTCTGCCGAGAAA
TGGAGTTTAATCTTGTTGGTTCTCCTTTGTGGGTCACCTTGTTGTACCCCAGCTGTTCTA
AGGGTCCCCGCTCTGTCTTTGGTTGCGGGAAGTTTATTATGATATGCCTTGGTGATTTTC
GTTTGAGTATCTAGCCTATTTGGGATTCATTGAGATTTTTAAATGCATATGCCATCTTGC
GCTTTATGGTATTTTCTTTTATGATCTTTTAAGAGTTGCTTTCTTCCAACAAATATTTGA
CAGTCTTCTTGGTGCTCTTCCCCCGCCCCCACCCAAATTCTTGCTGTTCTGGAATTCTGA
CCACACCAAGACATTCCTCTTGATGGTGTGTCACATAATCTCTGTGCTTTCTTCTTTTTC
TGATTGTTGTTCTAACAGAGTAGAATTAAGGCCTTTTTCTGCGATCTCCATTCCTTGCCT
TTCACTGACTCAATTCCACCCCTTTGTCTTTGTGCATGTTACCGATTTCTGAAATTTTAA
TTATTGATCATCTAGATTTATACTTGATGTTTCTGTGCATTTTCTAAAGTTGTCCATTTA
TGTTGCCAATTTGTTCTATGTGTATTAAATTCTATTATTTTTTCTGGTTTCCTGGATCTC
TCTCAATGTGTGGAAGAGCCCTAATTTAAGTAGTTTGATTTCCTCCATATTTTCTTTCTT
TTACTCGTTCGGGACACCTTGTCATGCTGCTCTGTCGTTGCGCCCGCTGTTGTAGTGTGG
TTTGCAGGTGTCGGTTGTCTCTGAAACACTGTAATGCGGGAGTGCAGTCGCTGCCCACTG
GCCGCGCAGAGCAGCTGAGGGCAAGCTGGTGGGGTTTGGCTGCCCTCTGTTGTGGACCCA
GCTGGAGCTGGGTGGCACTACCCAGTGGGTGGGTGGTCCGGCTCCTCCTGACTGCTGTGA
AAGGAAGGAGCAAAGGAAAAGGACCAGTTGGGGTGCGGATAAGAGAATAGGGACAAAGAA
GGAGAGCGGTGACAAAGAGGAAAGAGAAAGAAAGATGTCACACTGTGGGCAGCACCCGCC
CAGCGCGACTCCAGTGGAAATGCATGCCCACTCCAGGGGAGTGTGCACCCAAAGGAGCTG
GGTCAAGGGCGGATGGAGCACTTGCTCACCTGGACTTAAAAGGGGGGATGGGGAGAGGGG
AAGGAGGAAGGAAAAAGGAGGGAAGCACCGAGAAGCAGGAATAGCAGTGTACCCGTGCTG
CTCCCTCTGGGCTGACCAGGGGGTGCGCACCCTGATTGATCGACACAGCAATACTCGGGT
GGGGAGAGCGAGAAGGAAAGTAAAATGGAGGTGAGAAGAACTAAGGATCAAACGGCGATG
ATTTCTAAAGAAAAGCCGTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCACCACGGGAG
GCGGCACTGCCGTGTTGGTGAGTGGCTACCTCCCCCGTCAGCCTGGTGCACACTGCCTCG
GCTTTCTGTTGGGCGCCTCAGCGAAGACAGGTCAAGGCCCATCTGCCTGGACATGGTGGG
CTTGCCCATCCTTGACCATGACCAAGGGCACAGTCACGTTCGCACGCACACGTACGCTCC
CTGAGAGGCCCAGGCATCTCTTCTCAGAGAAGCAGTGGGGAGTTAGGGGTGAAGAACCCT
GAAAACTGAGGGACACACCACTTGTCTCCTTGAAGCGTGTAGAGCAGTCACACACTCTTC
CGGGCCGTGGAGCTAACAGGGAGTGTGCAAGGGGAAGGCCCCTGGGCCCAAGGCCTCCCC
ACTGGCTCTGGTGGGTCTGGCTGTGTGTGTGCACCAGTCAGATGGGAAGCGAGCCAAAGG
GGCAGATGCACCTGAAGGGTGCGAGTCAGCAAGACACTCAGGTGAGCCCTTTTCCCCTCA
CAGGCGGGCACCATCAAAACGTCGGTCACAGGGACGAGCATGGCCACTGGTAAGCGAGCC
CGAGAGTGCACTGAGACCACACTGGGGCCTCTCTCCGCCTCTTCTCACGCGCCTCTGCCC
ACAGGCACTGTGAGTGGAAACGTGATCGTGAACACCATCGCCGGCGTCCCAGCCACCACC
TTCCAGTCCATCAACAAGCGCCTCGCCTCCCCCGTGGGGCCTGGAGCTCTCCCTGTGAGT
GACCCTGCCAGGTAGACCCTGGGGGAGGGGAGGTGTGTGTGTGGGGTGTCGCATGTTCTT
CTCAATGAGAGAGTGACTGCTGATGGGCTGTGACCAGACCTGGGCACNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGGGTCAGGCCTGACCTGAAGCAATAAAGGGTCTGTGTGCTGG
TGACCCACGTGGGTTCCTGCCTTACGGGGGGGCCGGGAGGAGGGAGGTAAAAGAGCCTGG
CCTGCAGCTACTTCTCTGCAAACTTGACTCCCTGAGCTGGCCATCCTGCACCTCGGACCC
TCACCCTCGCCCGTGCCTGCTCCACAGATAACTGCGCAGCAGATGGCGGCACAGGGCCAG
CAGCAAAAGGTGACCTACGCCACCCAGCCAGCCCTGAAGACTCAGTTCCTCACGACGCCC
ATCTCCCAGGCCCCAAAGCTGGCGGGGACACAGCAGGTGCAGACCCAGATACAAGTGAGT
GTGAGGGCTGGGGTGCTAGCCAACTGGTTGCACTGTGCACATGGGAAGATAGCAGTCCCC
ACCTCCCGTCCACCTACCTTCTGTCCTGGCCCTGGTGACTCACCCGCTTTTCCACATCCC
TGTGCCACTGAAGGGACCGTGTGGGTGGACGAGTTTGACTTGTGCAGCCCTGCTACGTGG
AGCATGTGAGACTCCCCTCTTGGCTTCTTGGCTTCTTGGCTGTCACCACAGTGTCCTTAC
CTTCTGCTGTAGGGCAGCTGGGGGCATGGCGGCGCCAGGGCAGTGTGCAACAGCGCCCTT
GCTGCTTTCTGTGCAGATGCGGGCATGTGGGCTGCAATGTAGCTGTGCTGTGGTGGGCGC
AGGTTCACTGCCCCACAGCAGTGGTGCCCCCGTGCATGCGCCCACGGGAATGGCTGACCC
CGTCAGGTTGCCCCTTGTACTCTGGAGCAGGGTATCTCGGGGGCTCTGGGCACTTGTGCA
CAGAACCCACTCAGCTCTGTCCATCTGGATTTTGCCTTCTGGGCAGTAGGCTTCCTCTGC
TTCCCAGCTGGCAGCATCTTCTCCCCTATTCTATGATGTCACCTGACACACAGGCTTTCT
TCAGGTGAATGCACTGGAACTTGCGGCCTATGTTTGTCATTTCTGAGTAACTGCTTGTGA
CATTCTGCCCCAGGGGCTCTTATCGCTGGGATCCTGATCCCCTGGACTGGGCTTGGCAGC
ATCACTTTGCCCCAACGTCACTACATTGCTAAGCGCGGACACAGAGTCCTCCCTTACCAT
CCTTCCCTCTGCTGAGCATGGCCCTGCTCTGGGCCCTGAAGCCCGGTGCCAGCATCACAC
GCACACATGTGCTCCCACATGCGTGCTAGTCCCGCTTGCTCCTTGCACACATACACTCAC
ATCAGTGCCTCCTCCGCAGGCACACGTGCGTGCCATTCCCTGTTCCCCCACTCACACACC
CACACACCCACAAGCCCTTACCTTTCTTATGCACACACCACTGCCTCCCTCACAGGCACC
CATGCCATTCTCTCCCCTCCCATGTGCACATCTCCCCCTTCTTGCAGCCTCCTCTCCCCT
GTTCCACTTGGTCGTTCTCCCCAACTCCTGCAGTGGCTCTGCACTAGGCTTGTGCAGGCC
TCCCCCCATGCCCCTGCTGCTCTCCACTCTGTCTGCCCCCTGTGTTCTGAGTTCCGGGGC
AGTTGGGTCTTTCAGCCCCCCTTGGGCTATGGTTGTCACTTGTTTTCTTTTGCTCCTCTC
CTGCCTTACTTCCTTTTGAGCTCTTTCCTTTATTCTTTCCTCAATACCCCTCTTCTGCTC
CCTCACCGTCCGCCCCGGGAATCCCACATGCTCAAACAAGCTTCTCCAAGGGTANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGGGGGTGGG
GTTAGATCACCCCTCTCCTCCCCCGGACGTGAGGACTGAAACACAGGGCGAGGACTGTGC
TGATGCTGAGAACCCCTGCCTGACATTACCCCCTCTGAAATCGTCTTTCTGTACCTGGCT
CGGTGCGCTCGCCTACCTGGAGGTTCAGAACTCGTGTTTTTGGTTGTTCTCTGCTTTTAA
AGTATCTTTGCTTGGAGAGGGTGTCTGCTCACAAGGCCATGTTTTTCCAGTGGGTCCCTG
CTCAGTTTGGAGGCTGGGTAGTTTGGCTTCTGACAGTGCATGTTTGTGTGTAAGTAGTCT
TCTGGACAAGCAAGCCCCCTTTCCCTTAACCCACGGTGGGTGTGGCGGCTGAAGAGCTCT
GTGGGAGTTTATTTCCCCATAAGGGGGTATCCCTGAAACATCCAAGCCTGCGTTTCTGTA
GAAGGGACACATTTTCAGGGTGGATTTTGCCCCACTCCTTACTCTCCTCTCCACGTCTGC
CTGCTGGGCAGGGGTCCCCCACGGTGGGCGGTTGGTGGCTCTGTCATGAAGACCCTCTCC
GGGTAGCTGGCAGCTGCCAGCGAGTGAAGAGCTGCCTGACCAGAGCCCGCAGGGTCGGTT
TCCTGCCTGCCACTGTGGGTGACTCGGCCTCAAGGTCAGTGCTTCCCGGCCCCTGGTGGC
CAGGCAACACCTGGTCAGTGTGGGCAGCAGCCTTCGACTGAGGTGGCCTCTTGGTGACTG
GTGTTTAAGCCCCTCATCTGCCCCCACGGCTCCGGCGAAATGGGTTCACAGGCCAGTCTC
TGGACACTGTCATGTTAAAAAATCTCACTTCTCTTTTAAAGCACTAAATAACTGTTGGGT
AAGCATCGGACGGACTGCTAGCCACACTTGGTGGTTCCAAACCGTCAACCACTCGGCCAG
GAAGAGGAGGCTCCCTGCTTCCACAAAGATCGACAGCCTCGGAAACCCGAGTAGGGTCAC
GAGTCAGAAACCGACTCACAATGTTTACATTCTCATTTCCACGCTGTCAGCTGCGGTAGA
GGAATCCCGGTGGCATCATGGGCTACTCGCCGGGCCACTACTTGCAAGGCTAGCAGTTCA
AAGCCACGAGCTGCTCCACAGGCCAAGAGGAGCTTTCCATCCCCAGTGGGTCTCAGAGCC
CACGGGGCGGCTCCGCCCTCTCCTGGAGGGAGAGGTAACTCGATGGCTGTCTTGGATCTG
TGGGACTCATTCTGCTGCGTACCAAAGAACTGACACACACAGTTCCACAAGTGCCTGCAC
TGCTGTCCCCTCCCTTCTGCGAAGTCCAGCGGTGAGCAGCGTGCTTTTGTCAGACGTATT
GTCACGGTCTGGTTTCTGTACGCCATGATGCCCATAGCGGAGAGGCTGGAGAACTCGAGA
GAAGCCCAGCACCCACGTCAGTCAATGCGCGCCTACAGGTATGGTTTTCTTAAGTCACTT
TATTGGGGGCTTGTACAACTCTTATCACAATCCACACACAGATTAACTGTACAAAGCACA
TTTGTATTTCGTTACCCTAATCACTCTCAAATATTTGCTCTCCATGTAAGCCCCTGGCAT
CAGCTCCTCCCCCATGAACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCCCGGTATCACCACTGGTCTGATGGATCATCTGCCTGGATTCCGTTTCCAGTT
CCTATCTGTACCAGTGTACATCCTCTGGTCCAGCCAGATTGTAAGGTAGAATTGGGATCA
TGATAGCGGGGGGAGGGGGGAAGCATTTAGGAACTAGAGGAAAGTTGTGTTTCATCGTTG
CTACACTGCACCCACCCTGACTGGCTCGTCTCCTCTCTGCAGCCCTTCCGTAAGGGGATG
TCCAGTTGCCAAAGATGGCCTTTGGGTCCCCACCCCACACTGCTCCTCATTCACAATGAT
AGGATTTTTTGTTCTTTGATGCCTGATACCTCATCCCTTTGACACCTCATGATCATGCAT
GCTGGTGTGCTTCTTCCGTGTGGGCTTTTGCAGTATTAAATTAAAATGGCGCTGTGAGGT
GAGGGTCCAGCCCCCACCGCTACTACTACTCCCCCCCCCCCCACGGGTTCAGTAATGCAC
AATTGTACGGTTGAGATATATGAGTATTAAAGTCATCGAGAGCATGAGAGAGATTACAAT
GATGCAGTCAGACACATTACATGGTAGCACTGCTCACCTCAGCCCAGCTTGGTGGTCCAC
GTGGAGAGAGGGGGAAGGGAAGGAGGGCAAAGGAACAAGGGAGAGGGGGAAGAGAGGGGA
GCCAGAGTGAGCAGCACGGAGGGATCAGAGTCAGAGAGCTCTATATTGCTGCCCCAGGCC
TATATACCTTTTGGGGGCATGCCAGCCCACTAATTACAGGTAGAGACATACAGGGTGGTT
TCTGGGTCTCCATAGGAACCATTATCAGTAGGGTGCAAACTCCTCCTACAGGAGTCTGTC
CATTGTCCCCAGAGGCAGGGAGCAGGCCCACCCCTGGGGGGGGGGGGGCGGGGGATGAGA
CAGCAGTCTGGCAACTGATTGCCTTCAGGGGGAGGGAATGCCTGCTCATCTGACCTCCCT
CCCACAGGCTTTGTTGCTTCTGAGCTAGATGGCCGCTTGTTTACCCTTCAAGCCTTTAAG
ACCCCAGACGGGCTTTATCTTTTGCTAGCCAGGCACCATTAGCTTTCTTCACATTTGCTT
ATGCACCCCATTTGTCCTCAGCAATCGTATAGGGGAGGTGAGGACACAAGGATTTTTGTT
CTTTGATGCCTGATCCCTTTGGCATCTTGTAATCACACAGGCTGGTGAGCTGTGTGGGTT
TTGTCCTCTATTAGCAACTGTGCCTGGAGGAGAGGCAAGAGACAGGAATGGACATGTTCA
CCCAGGGACACACACACACCAACAGGCACGTCGGGCTGACACCCCACATGTGCACAAACC
AGTCTACTTTTCACGTGGAAACCGTTTTCTTGATTTATTTTACAATAGCAGTTGCATGGA
CTATGCGTCTTTATGGGATTAACTATCTTTGCTTTCCGTGGTTATCTTCCAAATTCACCC
ATGTCAGGAGGTGATTGACAGTTTCTTCACCATGCTAGTATTCCATTTTATTGATGTACC
TGGGTTTAGTTATCTTTTCTTCTACTGATAGGCATTCAGGTTGTGTCCATCTCCTGGCTG
TTGTGTAATGAACAGGTGTTGGCTCTTTATGTCGTAGGGCGCACACTGGGCAGTGGTATT
TCTGTTCCTGTTTGAGGAGGGGCCACACCGCTTCTAGTTTTTTTTACAATCTTACCAGCA
ATATGTGAGGGGTTCCATCTCTCCAACATATCAATAACAACAGTGATTTCCATGAATAAT
GTAGGGAAGTGACTAGATGGTCTCCAGTTCCCCTGGAAAGTCAGGGTGCCCGGGACCCTA
AAGCCCGAGGCTGCAAGATAGTGTAATATGGCTGGTGTGCAGGGTGCAGGGCCCACCCTG
AAGGCACCACCCAGTGCACAAGCTCACGTGCCTGTGAGCCAGCGATGTGGAGCTTGGGCC
TAGTGAAGAGAGCCTGGCCGGACGAGCTTCTGCCTGGGAAGCCGCCACGTCTCTCTGGTC
TCACACGGAGAACAGGAACGTGTCCTTCCGAAACCTGTCAAGTCTCACTCTGGAAATGAG
TGGTTTTTGCTCCAAATCATGGCCTGCTTTCAGGTCACTGAAATTAACTTCGAGAAAGAA
AAAAAAAAGGCCTTAAATTTGAATAGGTAACTAGTTAAGCTAATTGAAATTTTGTGTTTA
AGACATTATTTGTGTAGCCAGTTGCAACCCACTTCCCCCCCCTACCTTCAGCTACTCTAA
TAACTCATCAAATCTCCTAGTGGCTTGCCCTGTTTCCTCACTCCACCCACCTTTCCTTTC
CCATCTGCCTCTTCACCAAAGTAAACTTCTGTACCCCTTTAGCCCCCCTTCCATCCCACC
TTGGTAAGAACCAGTCTGTTGTTGTTGGTATCATGTCTTTAATGAGGCATAGTCCAAGTT
CCTATTCGTGCAAAACCAAACCGCTGCCATTGAGGAGATGCACCGTGGAGGCCCCGTAGG
CGAGGGTAAAACTGCCCCGGTGTGTTTCTGAGACCAACCTTTGATGGGAGAGCCTGTCTT
GTTTCCCGTTCTTGCACTAAAGGCAGGCTAGACAAGCAGTCCTTGCAGTTGCCTCTTACA
GCACCCTAGGGGCCAGACTGCCCGTGGATCCGTGGAGGGTGGTGGTGGTGATGCAGCACG
TGGACTCCGGCTGTTCTCCAGCACTTACCGGCTCACAGGAAGCTTCCAAGATCATCTGGC
ACGGCGTGCAGCACGCTCTGCCCTGCTGTCTAGAAGTCACCAGCTGTGTGATGGTGACAA
CCCCAAGAACTTCTATTGAACAGGCTTGGCACTCACGTCAAAAAGCAGTTTGTCATAGGT
GTAGGGGGTTTATCTCTGGACTCCTGTACTTCACGGGGCTCTGTGAAGTTGCATGTGTAT
TTCAGTGCTGTCCTGTTCACCCTGGCTGTGCACACACTCTCCTTGAATTCCTGAGGGCTT
TGCCTGCACCTGTATTTTATATTTTATTCTCCCTCCCATCTTTCTGGAGCCTGCGTCTCC
AGGCTGTAAGTGTCCCTTGGTGGTGGTGGATGACGGCTGCTGTAAGCGTCTGCAAGGGGC
CAGGATACCAGCCAGCTGACTCGGTGCTCTCTCAGCCTTTGTGTAGATGAGGAAGCTGAC
AAGGAATGATGGGGCAGGGGAGACAAACAGGCTGCATCTTTGCAGGTTGGACAGGATGTC
TCAGTACTGCCGGTGTGCCCATGAACGTGGTAGACGGAGCACACTGGGCACCACGGTGAA
CACTCACAACCGAGCCCACAAAGACAGTGTTCAACCACCTAAGACGGACCATCGGCCCTT
CCCTTTGGGGGACGGTGCTGCCGAACGAAGTGCACACGGTCGCCCTGACTCATCCCAACT
CCTCCTCAGACACAGCTGAACCCGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGGT
CCTTGCATACTGAAGGAGCATCGTAGTTGATCACCAGCTGCCACGCCTTGCACGTCGATG
CCGCGGGCCGTGGCGTCTGTGCTCACGAGGCTGTGGGACACAGAGTCTACCTGAGCACAG
CCAGCCCCCTCACCCGCCCAGCCGGTGACACCAGTCCCAGCAACTCACAGCTGAACCTTG
CCCTGCTCAAACTGCTTCAGGATCTTCTTCCTCTGCCCGGGCCCGTGGCGGGACGAGAAC
TCAGCCACGCTCACTCCCCCGAAGGCCTGGACCAGCAGGAAGAGCCTGGGAGGAGAAGAG
GAGCTGCCTCAGAGAGCTGGGCCCACCCAGGCACTGCGGCCAGAAATGCCCGGAGCCTCC
CCGTCTGCCTGGCCCACCTGTGGGAGTGCTCTCGGGAGTTGGTGAAGCAGAGCACCCTGG
AGAGGCCCCTGGCCCGGACCAGGTGCAGGACGGCCAGGGGCTTGGCCCTCAGCCTGCAGG
GCACGTAGTGATGCTGGAGAGAAAGGTGCACGGTTGGCCCGGGGAGTCAGCCCCACTGCC
CTGTCCCCTGCCCTGCCCTCCACTCACCTCCAGCCCCTCAGGGAAGGTATACTTCCCACC
TGTACCCTCATCAGAGCCTGCAGGCCCTCTGCACTCCAGCCCCGTGGAGAAGAGCTGAGG
CTGGTGGAGGGCCAGCTGCTGCAGTTTTTGGGGGTTTTGAGTCAAGGTGGCTGAGAAGAG
CAGTTTCTGCAGGGGCAGCTGGGGGACCCAGGTGCTGGCAGAGAAGCAGGGTCGTGAGGG
CTGGGGGGGGGGGCACGTACACCCCATCCCACCCCCGGGAAGGAGGTCGTATGGTACCTG
GCAGCAGTGACAGCCTTGGGGGGTACCCGCTGAAACAAGGCCCAGGGGTCCGAAGGGCCC
TCTCTCCTGAACACAGCTGCCGTCACCCGAGCCAGCCAGGCCTGGTGCTGGCTGTCCACC
ATTCGGTCTGCCTCGTCAACCACCTGCAGGGAGACTGGTCCCAGCACCGAGGGAGGCCCG
GGGAGCCCCTAGCCTGGATCTGGGCCCTGGCTAACAACCTACCAGGAAGCGCAGCTGCTG
GAGGCTGAAGCCAGGAGTCTGGTCAATGTGGTCCACCAAGCGGCCAGGGGTGGCCACCAC
AATGTCAGCCAGGCTGCGGAAGCCCTCTGCTCTGTGGAGTGCAGGGCAGCTGAGCTCAGG
GTGCCCTACCACTCTCTGCCCCTGCCCCCCGGCCCCTGCCCCCAGGGACAAGCTGCCCCA
GCACCTACGTCCTCTGGACAAGGCTTTCCTGCTCCCTGACCAGCGGCTTCTGCCCGGTGA
CCAGGGCCACCCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCACTG
CTCTGCTCATGAGCATTGCGTGTCATCTGTGTATCTCTGCATACAAGTGAGACGAGAGAC
GGAGCTCATGTCTCTGCACATACTCGTGTGCTACATGTGGTTCTCTCTCGTCAAGATGCA
ACTCCACAGTGTCCAGCAGCAACAGCTGTGCCAGCATCCACAGTGGCCACAGCGTCCAGC
AGATGAGTTCTGGCAGACTGGTTCTCGTGCACAGGGACTCTTTCCAGAAGACTGAATGGG
TCTTTGGTCTGTTTTGTCTGTTTGTGTGTGTACACATAAACACACACACACAGCATTGTA
AGATCAAAGAGAACAGTGGGAGGCTGGGTTCTTGTGCACGGGACTCTTCGCAAGGCTGTC
TTTCTAATGCTCTGGAGGATGCTGGGGGCGGTGTGGAGAGGTGTTGCTGTATCCAGGGTT
CTAGCTTGTGTGTCTTCTCCGATGTTCCGTGCAGGCCTCTCCACAGACAGTTACGCTCAC
ACAGGCGACTACAGCTGGCCAGCAGGTCCAGATGATCCCCACGGTGACCGCCACGGCCCA
GGTGGTGCAACAAAAGCTCGTCCAGCAGCAAGTCGTGAGCCCAGCGTCCACCCAGCTTCA
AAGCCCTGGGGTCCCCAACCCAGCCCACGGCCCGGCCAGCTCTGAGAGCCCGAGTCCACA
GCCCAAACTACAGATGCGAGTGCCCGCTGTCAGGTTGAAGACCCCCACCAAGCCTCCGTG
CCAGTGAGTGGGCTGAAAGCAGATGACCCAGATGCCTCACCATCCTGCACACATGTCTGC
CGCCTCTCGGAAACCGTCCCGCCAGTCCAAACCTCGGACAGTGTCACATAAGGTGCCCCA
CACTGGGACAGCTGTCCTAGAGTCAGGGTGCGTGGTCCTTCTGTTACAGTGTACCCGCAC
TCAAGAACAAGCCCGTCCAGTGTCCTTGCTCTGTAATGTGTGACTCACGGAAAAGTGGAC
ATTGGCAACTTCTATGAAGCCTTCAGTTTTCATTTCCTTTCTCCATCCGGGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 1119..2348, 4124..4234, 24073..24150, 24153..24155, 24160..24163, 25539..25618, 25621..25627, 25787..26166, 28326..28616, 29779..29964, 30183..30325, 30327..30328, 30592..30593, 30694..30772, 30873..30922, 31023..31080, 31181..31270, 32972..33079, 35330..35520, 36134..36311, 39582..39718, 40735..40904, 41169..41343, 41507..41533, 41536..41642, 42153..42339, 45682..45848, 46218..46387, 49163..49384, 49911..50075, 50176..50334, 50435..50529, 50971..51087, 51089..51091, 51094..51099, 51101..51120, 51123..51173, 52497..52699, 52789..52896, 52898..52941, 52943..52960, 54096..54292, 60955..61066, 61171..61314, 61560..61661, 61663..61665, 61667..61674, 61682..61727, 61909..61992, 62275..62409, 62590..62634, 62715..62868, 100862..101103, 101204..101377, 101478..101614, 101715..101771, 101872..101950, 102051..102305, 102903..102948, 103024..103133, 103347..103560, 103661..103896, 103997..104215, 104316..104511, 104612..104736, 105027..105173, 151734..151811, 152374..152646
1001..1117, 1119..2348, 4124..4234, 24073..24150, 24153..24155, 24160..24163, 25539..25618, 25621..25627, 25787..26166, 28326..28616, 29779..29964, 30183..30325, 30327..30328, 30592..30593, 30694..30772, 30873..30922, 31023..31080, 31181..31270, 32972..33079, 35330..35520, 36134..36311, 39582..39718, 40735..40904, 41169..41343, 41507..41533, 41536..41642, 42153..42339, 45682..45848, 46218..46387, 49163..49384, 49911..50075, 50176..50334, 50435..50529, 50971..51087, 51089..51091, 51094..51099, 51101..51120, 51123..51173, 52497..52699, 52789..52896, 52898..52941, 52943..52960, 54096..54292, 60955..61066, 61171..61314, 61560..61661, 61663..61665, 61667..61674, 61682..61727, 61909..61992, 62275..62409, 62590..62634, 62715..62868, 100862..101103, 101204..101377, 101478..101614, 101715..101771, 101872..101950, 102051..102305, 102903..102948, 103024..103133, 103347..103560, 103661..103896, 103997..104215, 104316..104511, 104612..104736, 105027..105173, 151734..151811, 152374..152643
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved