Echinops_telfairi Locus APC
snOPY snoRNA Orthological Gene Database
Echinops_telfairi APC
Echinops_telfairi
APC
GeneScaffold_3744
SNORA30
58533..58660
151684
CAACTTCATAGGGAGAAGGAAATCTTTCTTCATGTAATATATTTCAACTCGGAAGTATT
CTCTTTATTACGTAGCCTTCTGTGTTTTTTTCTTCTTTCACAGTCATTTAGCTTAACTGC
CAGGCTCTGCTTTTCTTTTCTTTGACAATCTAGTACTAAACTCAACCAGTTTCTTTAAGT
GTCCTTCGGCTTCAATCTGAGCACGAGTACCAACACCACATATACTGTACTATGACCCAT
CATAGTGATCCTTTTGAGTACATGAAATTGCATTTTATATTATTAATTCTTATTAATCAT
CCTAACCAAAATATATGCAATCTCAATCTGTTGTCCTTCATGTCCAAATGATTGCCTTTT
TAATGAGATCTTATTAAAATTTTAGAACTACCACCTCATGGATGATGTTTAAGACTAACC
TTTTATTAATCAATTATGACATTGTGTACTACCTAATTTCATTAATTCCCTTCTGCCTCT
TCCAATGGTCCTTCCAAAAATTATGTGACTCTTTTCGTGAAAATATTATGACCAGATTTT
TACACGTTTTTAGGGGGAGGGAAATCTGGGTTATGACTATACCATTGCAAAGTCAGGGGA
AAAAAGTACCCATTTAAATAAATGTCTTATCAATGATAACATTTCCTGTGTTTTGCCTCT
AACACCAGATAAAATATCTTTGAAACCTTGAAAAAGTCTAACATAATAGAAATCTTATCC
ACAGAAAGGCAAATGTGGTCAGACAGTTCTTTGTCTCTTGGTTAATCCTGTTTGTCTTCA
ACTAAGATCATCCAGATTTGCATCTTCTTATATTCTGCTACTTGAACAATGTTACTTTGA
GACTGAAACTAGCATATCATTGCAATTCTTGTTAATAAATGCCTGAAGGATTTGTATCTT
TTACCTCTTTCGTTGTAAGCAAGCCAGGCACGTTTTTGTTGTTTTTTGAGTAGTGAATTT
CAAAATCCTTTTTAACCTTATAGGTCCAAGGGTAGCCAAGGATGGCTGCAGCTTCATATG
ATCAGTTGTTAAAGCAAGTTGAGGCACTGAAGATGGAGAACTCAAGTCTTCGACAAGAGC
TAGAAGATAATTCCAATCATCTTACAAAACTGGAAACTGAGGCATCTAATATGAAGGTAT
CAAGACTGACTTTTCATTGCAGTTCATCCATTTTCATTCAGAAATCTCTTTTGTGAACCT
GAGGATGAGGCATTTTAATTACTTAAGTATATTTTAAGTTAGGCAGTGGTATGTAAATAC
TTCCTTGCAAAGGCTGACATTTAACAGGATATATTGGATTCATCTTGTGAATCGCGTAGA
AAATCTAATGTAAAACTACAGTGATTGGTTAGTTCCTAGTTGTTTTTAAACTTAAAAATA
GAAACTAGCTTTAGCATCAGTATAATGAGTGTTCTGTGTTCACAGAAACTAGCTTCCCAT
TTTTGAATATATCCCAAACATTAAATATAGCTTTCCCTCTCAGATCATCTCACTACTTCA
GGGTTGCAATGATAAGTGATCGGGAGAATCAGGGAACCCCAGCGAGAAGAGCCTGAACTA
AAAGTCAATATTTGGTCCTATTCCCGACTTATCTGAGCTATTTGACCTTTGGTTGAACCC
TTCTGGATTTACGTGGTCTTGGTTAGAAAATAATGGTTTATATGATTTCCATGGTACCTT
AAATTCCTAAAATTGATTTGCTAGATAGCATAGAAAAGGTTTAATAATCTCTAAGGAAAT
TTATAAAATATTCTATCTGTAGTAGCAAATTAAGATCTTTTTTAAATAATTGAGGTTAAA
AGTAGCTATACCAATTTCTAGTAACTTTGGCAAATTCTCTTCTCACAAAATCGAATATCC
TTATAGACTGGAAGATGGTCAACAAAAAATGTTACTTCCTTTCTTTTCTTTAATTCCTTC
CTGTTTTCTGTCCTTGAGCTATTTTAATATCTGAGTTCTTGACCCTGGTCTTCCTGTCTT
ACTATTCTTTTCTTTACTCATTTCCTGTTCTCATCTAATTCTTTTTACCCTGTATGTGTG
TATTACAAGATCTTCATTCTTTCTATATATCACATAAGTAGCTATTTTATTCCTCTTTTC
TTTATATTCAATGGAATAAAGGTTCAATCTTTTACTTAAATGTACTATTCTATTTAACTA
TATCAAAAAATCTTTTCTCTCTTAATGTCTATTTCTGTGATAAAACCTCCAGCAATGACA
AATTTCCAAGATTCTGCCTTAAATTCTTTCTGAAATAGACTGTAAACAAACTTTTATGTA
TTATTAGAAACAATTTAAAAAAAACACCTTATTGCCATCAAGTCAATTCTAACTCCATGG
GTAATCTTTAAAACAGCAAATAACCTGGTAAGTTAAAAAGGTAAGGAATATATAAATTCC
CCAGAGGATGACTCTTTCAGCTACTTTAATGTGGTACATTTTGCAGATAACTCATCCTGG
CAGGCTTATCTGTATAGGAAGTGTCTGTGTTTTACTCAGAATTCTGCAATCTCCTTTTAT
GTTTCACACAGTGCTGCAACAATGGGTGCAAACATAACAATTGTGGGGAGGGTGAAGCAG
GGTCAGGCAGTGTTTCCTTCTGTTGTACAGAGTAGAAGCCAACTCAGTGGCACTTAACAT
TTGAGCAAATTCGTAATTAATTTTTGGGAGGCATTTTAACCTACCCTTTAGTTACATCTT
CATGCAGAAGTGGGATGTCTTTTCTAATGACAATACAAGTCAGTTTGATAAACTTCTGTG
GAAGAATATCACAATGGTCCATTATCCATGAATATTGGCACAGAACAGATGTTTGAATTT
TTAACCATGAATTGATTATTAGCAGCAATATGTGCTTTTGGAGATCCTTGCAAATCCATT
CATGTGTGTCTTTAATATTTGTCCAGATGGTATGTACATTACAGCTTTAGAATAAATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAAAGCTTTGTTGTTGATTGCATAGGATCAGTGCAC
ACAAACTAAAAATATTTTGTGTTACATTCTAGAAAAATATTTTTTAAAAGAGTGAAGTAA
GCTGATGGTGCCCGGCTATCAAAAAGTATAGCGTCTGGGGTCTTAAAGGCTTGAAAGGTA
ATCAAGCGGCCATCAAGCTCAGAAGCAACAAAGCCCACATGGAAGAAGCACACCAGCCTA
TGCAACCACGAGGTGTCGAAGGGATCAGGTGTAAGGCATCATCAGAACAAAAAATCTTAC
CATAGTGAATGATGGGGGGAAGTTGCGGAGTGGAGATCCAAAAGCCCATTAGTAGGGCCA
CTGGAGGTCCCCTTTGCAGAGGGGTCTCGGAGAGGAGATGAGCCAGTCAGGGGTGTGATG
TAACAAATGATGAGAAATACAACATTTCCTCTAGTTCCTAAAGGTTTCCTCCCCGCTCCC
ACTACCATGACTCGAATTCTATCTTGCAAGACTGGCTAGACCAGAGGAGGTACACTGGTA
CAGATAGGAACTGAAAATACAGGGAATCCAGGGCGGATGAGCCCTATAGGACCAGTGGTG
TGAGTGGCAAAACAGGGAGGGTAAAGGGAGAATGGGTAGGAAAGAGGGAACCGATTACAT
GGAACTGTGTGTGACCTCTCCTCCCTGGGGGACAGACAACCGAAAAGTGGATGGAGGGAG
ACGTCGGACAGGGCAAGATATGACAAAATACCCATTTATAAACTATCAAGGGCTCATGCG
GGAGGGGGGAGCGGGGAGGGAGGGAAAAAATGAGGACCTAATGTCGGGGGTTTAAATGGA
GAGAAAATGTTTTTGAGAAACGATGTACAAATGCGCTTTACACCGTTGATGTGTGTATGG
ATTGGGATAACAGTTGTATGAGCCCCTAATAAAATGTTAAAAAATAAAAAAAATAAATAA
ATAAATAAAAGAGTGAAGTATAAGCAATTTATTTGAAAATAAGAAAATGTTAGTTTTTAG
GTATGTGTACTAGAATTTTATATATGAGATTTTTTTTCAAATTAATCTGGATTGGGCTGG
TGGAACAAAGTGGGTATACCTGTAGGTGAAACAGGATTGGCCATAAAATGATAACTGTTG
GAGCAAGATATGAAGGTACTTAAGGGTTTGTTATAACAGCCTCTATAATGCTCTTGGTGA
TGGTGTGGGTTACACATTGCGATGTGGTTCAAACCCACCAGCTTCTCCATGGGAGAAAAA
TGAGGTGGCTTACACCCATGCAGATTTACAGTTTCAGAAACACTATATAGAGCCACTGTA
AGTTGGGATCAATTCAGTGGCAGTGAGCTTGGTTGGGTATACTTAAGTATGAAATTTTCT
GTATTATAATTTGCATAGGATTATGTTCAAATCATAAAACAGCAGAAATTGTAGTAGCTA
AACTTAACACTACCACCACCACCACTATCCCCCACCAAAAAAAAGAAACTTATTTTTTGC
ATGGTTTCACAGTTCAGACCCTATGGCCCACCATCCTTTTTTATGCTCCAAAGCCCAGCC
TTAGGCCTTGGTAGATTCATCTGTTCCTCATAGGGGCCTGATAAAGGAGAGGAACCCTGA
TGGGAGGACATAGCATTGACCTCACTTCACCACACCCTGCCCCACCCACACAGGGACTGG
GGAGGGTGTGGGAACTAGAGTTGGAAGACAAGTTGGGGGCCCCACTTGCAAGGAATGGAG
CAGTTCTCAGATGGTTTGGCTCCTGGAGGGGCAGAATAAATGGCAAAAGATGGGGGAAGG
AAGGCAGCCCCTCCACCCTCTTCCCCATCAAGTCTGGAGAAGAGGTGGAGGTAGATAAGA
CAGGCCTGAATTCATGAGTGAGCACCATGGACCACCAAAGGACCAACAAATATGTCTTGG
AAGAAGTATGGCCAGAGTAGAGTGTTCCGTAGAAGCCAGGATGGCAAGACTTCATCATAC
ATACTTTGTTGTATGACATGTTGCCAGGAGAGACCAGTCCTTGGAAGAAGTACATCATGC
TTGGTAAAGTGGAAGGGCAACAAAAAAGGGGAAACCTTCAGCAAGGTGCATTGACACAGT
GGCTACAACATTGGACTCTAGCATAGGAACAATTGTGAGGGTACTGCAGAACTAGGCAAG
TGTTTCCTTTCTGTTGTGCATAGGGTCAATATAGGTGGGAACTTACACGATGGTGTGTTA
GACAGGGTTCTCTAGAGAGAAAACCAAATTGCTGATAATTTAATATATTTATTTATAAAG
ATAGATATATAACAAGAAGTGAACTGTGAAATCATATACAGATAAATATATAATACAAGA
AATAAACAGCTTAAATTATAAAGCACTACAAATGGCTCAGTGCAACCCACTCCCGTGAGA
GAGAGTTGTGAGAGACTAGCAGTCCTTCAAGTCTAGTCTGCTGCCAGATCTTCTTCTATT
TATAGAGAGAGCTAGGCTTTGTCAGCACAGCATCCAGTCACAAGGCAGGTCACCAACTGC
CAGCCAGGCCACCAACCGTCAGTCCCCAGCTCCAGAGATGTCTTAAAGGAACCTCAACTT
ACAGCGACACAGTCCACAGGCTAGGTAGGCGTCCCACAGTTAGTGTAACCTTTAAATTGA
GGCACAGAACAAGCAAGGCAGCCTCACTGGTCTGATGATCAAAGACCGAGAGACAAGGAA
GGCAAGGCTCACCAAGCCATTTATCTCTCTGCCCTTCAGTTAATCCCCCTTGTGTTTATC
GGCCACGCTGGCACAATAAACTATCTCAGATGGCACCTCAGAGCAACATCTTCAGAGCAT
TTCAGAAGATCAGCCAAACTTTTGGAAGGAGCATGCAAGGCAAGAATTTTGGCATCAAAA
GTTGTAACTACCACTTATGTTTTAAAAGATGGAGCCCCTCCCTTCTAAGCCTCCATTTCA
AGAATGGGCTGCCACCCAAAGTTGAAGGGGTTTGGGCTGCCCCATCCATGGACCATAAGA
ACAGAGCACCTTCCCAGTGTGCAGGGCTTGGGCTGCTGTGTCAGTGGATCAGGAAAATAG
AGCCCCATGGGCTGTCAACTGTCCAAAACCGAGGGAGCAGGATTACTATCCCAGTGAGCC
TAAAAAGCAGAATTGATATACCCAGGGTTAAGGGCCCTCCACCTAGATCCAGAGTGAATA
GCTAGTGCAGAGGGGTAGAGCCCAGGTGTAACTGGAGTTAATTAAAATTGTTTCAGACTT
ATGGAGCCCCAGTAGCTGTGTGGCCTAGGATTTGTGTTACTAACCACAAGGTCGGTGGTA
GAGACCAGCCAGTTACTCTCAGGAAGAAAGATGAAGCTGTCTGTACCTGTAGAGATTTAC
AGCCTCAGAAATGCTCTGTAGCAGGGGTGCTCACACTTTTTTCAGCATGCAAGCTACTTA
TAAAATGATCAAGTCAAAATGATTTATCAACTACAAAAATGCAAAACATTTATTTTTATG
TATTACATTTATTCATAAATGCATTGAGAATTCTTTTTATGTACCTTGCATAACTGCATG
AGTCCATATTGTACAACACAACACAATTAACTATATACATTTTTTGTCATTACCTGAGTT
TACTCTGATGACTTGCACTGAATGGAATGAGCCAGGGATGCATAGTCCAGACAGTAGCTG
CTGACAGCCAGCCTCGAGCACACTTCCAAATGATCATCACTCATGGTGGAACGGTACTTG
GACTTAACGATCTTTATGTGGGAAAAGGCTGACTCACATCAATAAGTGGAGCCAAATAAT
ACAGTCAAGGAGGTAGCACATTTTCTCACGTTTGGGTACTTTCCCTCTGAGAGTAAGTTC
CAGAACTGTTCGTGTGCTCTGGACTTCAGCGAATGTCAGCTTGTAGTGTCAAAATCTCCC
ATTCCATATGAAAGTGATAAGTTTTTGTCTTATCACTTGGTCCAGCTTCCCCACTCATTT
TAATATCCTTTCTTACGTTTAAGAGAAAAAAAACAAGGTCTGAAAATTGGCAATAACTTA
GCTTGTTAGTTTTGCTGCGCTTAGCGCAGTTGTTTGCACATGCGTTTGACAGCTAAGATT
GCATCTGATTGGCTGCAATCCTGATTGACAGGATTGATGATAGGCCTACATCTATTTTTT
TTAATGCCATGCGATCTAGCCACACTACGTTTGCGATCGAATAGTAGATCACGATTGACT
ATTGAGCCACCGCTGCTATGTCAAGTCATGTGTTTCGGTTGGCTCTGGGGTTTGGGTTTG
GGGTTTTAGACTTGTTTGGTACCTAAGATCCCTTCTTTCCCTTCAACTTCTCCCCTTTGA
AATGGTGATCTACCTTAGTCTACGTCCACCATTGTGCTTTGGAAACAGTTAAATTGTATT
CTAATTTACAAGGTCCAGAGATGGACAGGAGTTTTGCCCCCACCACGGAGCATACAGTTT
CACCCATAGTTAATTGAGAACTTTAGGTGATTCAGTAGAGCTTTGGGGTTTAGATTTGAT
GATGGGCAATATGATAGGATGAATGGCATTGGATGTTGGTAAAATGAATGTGTTTTGCAT
GGGGGGAAAAAGATGGCATTTAGGATTCAAAGGGGGTTATAGATTGAGTTGTGTACACCC
CCCCAAAAATTGTTGTTTGTTTATATGTATGTTGGAATGCTGGCCCTTCTAACTGGATGT
AATCACATTTGGGAATATGATTTATTTGTTATGTTAATGAGAATTTATCAGTGTAGGGCA
TGTCCTGAAACTCTTTTGAGTTATTAAAATAAGTAGGTTAGACAAAAGAAGGAAACACAA
ACAGCAGCAAAATAGATGCCACATGAAAATCAGCAATGAATTGGAGTGCTGGGGCTACAG
AAGCTGAAGGAGACAAAAAAAAATTTTTTTTTTAATCATTTTATTAGGGGCTCATACAAC
TCATCACAAGCCATACATACATCAATTGTGTAAACCACATTTGTACATTCGTTACCCTCA
TCATTCTCAAAACATTTGTTCTCCACTTAAGCCCCTGGCATCAGCTCCTCATTTATCCCC
TCCTTCATGAACCCTTGATAATTAATAAATTATTATTTTGTCGTATCTTGCACTCTCCGA
CGTTTCCCTACACCCATTTTTCTGTTGTCTGTCCCCCAGGGAGGTTATATGTATATCCTT
GTAATCGTTTCCCCCTTTCCACTCCACCCTCCTGATATCTCCACTCACACCACTGGTCCT
GAAGGGATCATCCGCCCTGGGTTCCCTGTGTTTCCAGTTCCTATCTGTACCAGTATACAT
CCTCTGGTCTAGCCAGATTTGTAAGGTAGAATTGGGATCATGATAGTGAGGGGGAAAGGG
GAAAGCATTTAGGAACTAGAGGAAAGTTGTATGTTTCATCATTGCTACACTGCACCCTGA
CTGGCTCATCTCCTCCCTGCGACCCTTCGGAGGGGATGAGACAAAAATCTTTCTATAGAG
TCTTCCTCTTAGGCAGTACACTTACTGTATTTGGACTATGAGAAAACAAGTTCATGTTCT
TTAACGCCCACTTGTGGTATTTCTGTTACCGCAAGTGCATGAGGAAATAAGACATGAAGC
ATTAAGGTCTAGAGGACCTCCAAATGCATGGCCATTTCCCTCCATGGTCCATTGGCTGAG
TCATATTTTGTTGAAGCAGATTATTCATACACTGACTGGAAAGGCAGGATAAATTTCCTA
TAGCTTCAGTGCATAGCAGACAAAGGCCTCCTGGAGAAAGAGGCACATTACTTTCACAGG
AAGTCTCCTCAGTAGATTTTGAATTTTGTGAAACAGGAAATTAAAAAGCTAAAGTCACAA
CCTCCCAGAGAAAAGATCTGTATCAAACACAAGAATGGTTGTCCTTCAAAGATAGTTGTC
AGAATGGGAAGCTGTTTAAGATGGGAGAATAAAGGCAGAGGAGACAGAAACCTAATCATA
TTTTCAATCTAAAATCAAGGAAAGGTACACTCAAGAAACTGGTACAAACAGATGTGCATT
TAACATAAACAAAACTAAGTTGCCACTCATTTTCAGTTCCTGATTTTTATCGAAGAGATT
GGACCCCCAACAGTGAAAAAAGCAAACTCTATTTAAGTAAAAATGCTATCATATTAACTC
TCTTTTGTTCTTATATAATAATTAGCAAATAGTCCAGAGTTAGGAGAAATGGAAAGGATT
GATGTCAAGGAAATAAATATATAATAAAAGACCAAGAAATGATCTAGACGTTGCGTCAGT
ACTCAAGGATGTTAACAAATTATAAATGTCTTCAGGAGAAAAAGAGAAAAGATGAGCAAA
ATCTATTAAAAAATGGAATATTTCAACAAAGAATTAGAATCTATAAGAACAAAACAACAA
CAACAAAAGAACAAAACAAATAGACATTCTAGAATTTTTTAAAAACCTGATATTTATTAA
GTGGGATTAACACAATGGAAGAAATAATTAGTGAACTTGAAGGTAGATACATAAAAAACA
CTCCAGCTGCAGAGGGAAAAAAAGGAGGGTGACTAGATTCTAATGTCACTGTTGGGTCAC
TGGACATGTAACCGTAGAGTCAGCAGTTCAAACTTACCAGCTGCTCTTTGGGAGAAAGTT
GAGTTTATCTGTTCCCATGAAGATGTATAGCCTCAGAAACCCTACATAGGGTTTTTGTGA
GTTAGAATTAACTTCATGGCAGTAGTTTGCTGGGTTAATTGATTTAAAAAATAGAGTATA
GAAAGCCATATATAATTGCCCAATTTATGACCGAAGCACTCTGAACCAGTAAGGAAGGAG
TGGCTTTGTAATAAAAGATGTACAGGGGAAAAGGTTATTAAATACTTTAAAAAGAACAAC
CTGGAATCCTACTTTGTATCATATATAAGAAATTAATACCTAAAAATATGAAAGGCAAAA
CTAGTTTCTGGAAGAGAACACGGAATTGCCTCATCCCCCTTGGGTTAGACTAAGATTTCT
TTAGTGCTTCTGGTATTCCATTTGAAAAATATTTGCCTAATTTAAGGACACGAAACTCAT
TTCTTCTTTGTTCCAGAGGCTGTTTTGACATAGAATGACATAAGGGGTGGGGACGGCAAA
TTAGACTTCATTAAAACCTAAGAATTTCTTTGCTTTTGAAATACCAATTCAAGTTTGTGG
GCAAAGATTTTCCCTCTGGAAGAAAAGGAGAAAATTTAATTGGTGAAATTTTAAATATAT
TCCCGAAGATATGAAGAATAATAAGTACTGCTAGAAATTATTTTAGGTGGTGCCAAAAGT
GAATGTTTCTGTGTCATGTATTTATATTACAGATATATATTTTTTTAAACGTAAGAATTT
TTGTTCATTCAAAAGACTATTATACCTCTTTTGAGTGCCTTTTTTATGGCTATGGAAAAC
GTATCAGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTGGGATTCAGTCTAGCTGGTGTT
CTTTCCGCCTCTTGAATGATTGCTTGGGTTTCATTCATTAAGCTGGGGAAGTTTTCCTTC
AAGATTTCTCTCACTATTGTTGCAGATGACTTCTTTGTTGTGTCCTCCTCTGGAATGCCA
ATAATTCTAATGTTATTCCGCTTCATAGCGTCAGACATAGCTCTTGGATTTTCTTCAGCT
TCTCTGATGATCTTATTAGATTCTTGTTCGCGGTTGTTGAAGTCTGCTTGGCTGTCCTCC
AAGTCACTGATGCGCTTCTCTGCTTCCTCCTGTCGATTCTCAAGCTCTGTGTTTCTGTTA
TTGGTTTTTGTTATCTCCTCCCTAAGCTCCTGTATTTCTCTTTGATGTATGACCTTTATC
TCCTCTATCATTTCATCCTTTTTCTGTATGACTGCAAGCAGCATTCTGAAAATTTCTTTC
TGTGGCAGCTCAATGTCTGCTTCTATGTATGTTGTTATGCTCTGGATATCTTCTGCCATT
GCCTTTTGTTTCTCCTGTTTTTTTTGTTGAGGTGGTTGGGGCTGAAGGCTGTTTGCATTG
CATTGTTTTAGAGGGGCCAGGTGCCATTTTCTAGGGGGTCTAAGAGTACTGGCTCTCTCT
AGGAGACTTGTAGGAATGTTTCTTTGAACTGCCTACAGCTAACTATTACTATGGCATTAA
CCTACCCTTAATCTTCCTGTGGCTTCCCTATCAGGGGAGTGTCCCAGAAGGTTGGTGGGC
TGTCTGCTTTGGTGTTGTGGAGGTTGGGCAGAGGTTTCTGCAACAGCTTGGAATGGTGAT
GAGTGTTGGTGGAGCTGCCTTATGCCCCCAGGTACACAGGCAGGAATTCCCAGGTGAGTG
GTTGGGTGGGGTATCTCCTGGAGGGAAAGCCGGGCTTTCCCTAGCCTTGTGCTAGCTACA
CAGGGTGGGGCTAGCTACACAGGGTGGGGCTCAGGCGTAAGTGCCCTAGGCTACTGGGGG
TGGTCTGGAGTTCAAGTTCAGCAGTGGATTGTGAGAGAACAGGCAAGAGACAGAGGGGAA
AGAAGAAAAAAAAATTAAAGAGTAAGACCGTTTAAACTGGGGGGGGCGGGGTATAGGGGA
GAGAGGGAAAGAAAAGTAACTACGTAGCTGTGAGTCCCACTCTCCTTCAGTGAGTCCAGT
CCCTACTCTGGGGCAGCGGTGGCAAGCCACAGTTGCCGCAGTTGAGCTGAGAAAAAGCCC
CTGAGCAGCCCCCAAAGACCGTGAGGGTGGGGTGGGGTGTTGGACAGAGGGCAGAGATGT
AAACAGAGGCAGCAATGCAGCTGGACCCCGATTCTATCGCAGATCCCCGCCTGTGGAGCT
GTGAGGGTCTAGTCCCCGCCTGCAGGCAGCAGTGGCAAGCTGTGGCTGTGCCGAGAAAAC
CTCCCACGCAGGCCTCCCAGACTGCGGGTGAACAGAGAGCAGAGATGCAACCCAAAGCCC
AAGACCAACTGAATCCGGCTCCCCGACTGTGGAGCCCCAAGGGTCCAGTTCCTACCCTGA
GGCTGGCGGGGGTAAACTGTGGCTGTGTTGGAACCAAACCCCCCTACAGGCTCCAAATGT
TCCCGGCTCTGGCAGCAACAGTGGCTGGGCCAAGGTCAAGCCCCGGCCGGCTTTCCCGCT
CTGGCAGTGTCAGTAGCTGGGCCTAGGTCAAGCCCCAGCCGGCTTCCACTGAGGTAAGCC
AAAAGCCCCAAGCCCCTCAAAACCCCGTGGGTCTGTGCCTACTTATCTTTATGATGCTCC
TCCTGTGTTCTAGTTGTGTTAAAGTTCCCTCTAAGCAGCTCTCCTGGGCTGGATTCTGCG
GAGTCCCTCTGGTACATGTCACTCCGTCGCCATCTTCCCGGAAGTTCTCCTGGTTTGTGT
TTTGCTACTGTATTTATCCTAAGAAAAACAGCTCTATTCTCCATAAGAAAATCAAAATGC
TATGAGACTTAGGCTTTATTAACATCTTGCCCTAAACATACATCATAGTAAATTGCCATG
GGCAATGATCAGATAGAAGATTTTTGTCATTTTGAATATACTGACATGCTACTGTTAGTT
AAATTTACACATGGTTTCCCTGTAGAAATTCTCTCACAGATAATATGCAATAACTTGAAA
TGCATATCCTTGTGAACACTTCCTTTACTCGTGTATAAATTAAAATTTTTTTTAATTTAT
GCAGTTTGCTGCATTTTGCTAAAAGTCAATTCTCTAAAAGTGTGTCCATATATTTCTGTA
CCTGCAGAGTAGTAAAAGTTTAGATGAAACCCCATAATTTTTTTAACTCACACTTATGGA
GTTTATTTTTATTTTTTAAATCATTTTCTTGGGGGTTCGTACAACTCATCACAATCCATA
CGTATACCCATTAAGTCAAGCACATTTGTACACTTGTTGCCATCATCATTCTCAAAACAT
TGGCTTTCTACTTGAGCCCTTGGTATCAGCTCCTCATTTTTCTTGTGTTTTGCTTCAGAC
TCATGTTAGCTGCAGGCCAGTGGTGCAGAAAAGTAAATGGGAAAGCAGGAAGATCAGAGG
CTGTGGGGTGCAGTCAAGTAGATACAACTTTGGTGAGAGCATGGCAGAGCATCCAGTTCT
TCATTAATACCTGTTGAAACAATTCAATGGTATTCCATCAGTTATTGGAGCCTTATTTTT
AGCTCATGCTTTCAGTGTGGCTTGGATTTCTTATTTTAGTACCAATGGTTCTTGCCCATA
GTCACCCTGTAGAACAGAGTATAACTGCCCCTGTGGGTTTCTGAGTTTCTGAAAATGGTT
TTCCTAGATCTTCACAGGAGCAGAAAACCTCAGCTTTCTCCAAAGTACTGGCTCTAGTGG
GACTGAACCACTGACATTGACATTGTGATCAGTAAAGCATAACCCACTATGCCAGAGTTC
TTTAAATCAAACTAATATACACTTATAAGGATATGTTAAAAAGTATCGTCAGTTCATATA
TACTGGGATTATTGCAAACTAATCTTGTTGTGCATGTTGCTGTAATCAGTAGACTGCTGC
GGACAAGTTCTCAGCAGTATACTTGTGTCACTCAGTAGAGTACCTTCAAAACCAGGCTAA
CCCAAAGAGTGGCTTCTAAGGGACTTATTAGGAAGACGTTTTAAGAAAATGAAAAACTGC
TCTGGTGAGAAAAAGGCCAAGAAAGTTGTACTGAGGAATCTTGTGCCCATCAGAACAATG
TATCTGCTCATTCTTTGAGGGTAGTGTAACGATCAGATTTACTGTCAATTTGAAGATATA
TGAAAGTGTAGAGATGGAATTCAATCTGTCAATCAGGTCACATCCTGATGATGTGCCATT
GGGTTGTGACCTTAAGGGAACCTCCTTGCCACTTTTTTTCCCTGTCTTTTTCTTACCAGA
GCAGTTTTCATTTTCTTAAAACGTCTTCCTAATAAGTCCATGTGTCCTTTAAGGAAATTT
TTCAAGATTATCCCTTTGGAAAAAAGAAAATAAGTCACCTTGATCTTTTTAAGTGACATC
TCTGCTTTGAATTTAACATATCAAGCTGAACCCCTTAGGAGCCATTCTTTGGGTTAGGCT
GGGCTTTTTTTTTGGCTTTGTTTTTGAAGTTACTCTACTGAGAATGAGAGAACTTTTGAA
ATCACTTTTTAAAAGTCACACAACTTTAAGAATTGTGAGAATCAGCTTCACTATTAGGAA
GTGAGAATCCAAATCAACTTGTGTTTTAGAAAATAAAAGATTGTCTTTGGTGAACAGAAC
ATTTTGCTTGAATTTTTCTATGCTTTATCATAACATTGGATAATGGCAATAAACATTTTT
ACTATCATGACAAGAAAAACAAATAGTTGCATTTATTGTGTTTAAATAAAACTAGATGTG
ATCAACGAGTCAGGTTTTTTCTGTGTGTGTAACTGTTAAAACTGTTACAGTACTTTATCA
CTGGGGGATAATATTTGTTCTGGAATCTTTTATTGATGGGTTACATAATCAAAAAGGTTT
GGAAATGACTTCATCTAGCTTCTAATGCTTTTTCCATATGGAACAACCACTTTTATAGTA
CAATTTTGTTTATTTTTCAAAAATATTTTAACATTTTTATTGGCACTTCATCCATATATA
CAATTCAATAGATCTGTCATATCAAGAAAAGTTTACAATCATTGCCAAAATTATTTTTAA
GACATTTTCTTCTTTCCTGTACTCAGTGTTACTAGTGTAATTATTATTTTTCATTTGTGG
CAAAAATATACACAATAAAACATTCTCCAAATCAGCATAATCCAGTGCCATTGATTATAC
TCTTTGTGTTGTATAAGCATTATTATTATCATTTTTCAAATTACTCTACCCACATTAATA
TAAACTCAGTGCCCACAGCAAAAAGTCCTCCTCCGCCATACGAACCATACTAATCATTTG
TCAATTTTTAAAGTAGTTTTCCTGATATAATATTCACATATAATACACTTCCACAGTTAA
GTAGTTTTTTAAAGAGTTGCATATAAATCATCACAATCAGTTCTAGTGTTCCTTCCCCAC
TCCCGCATTCATTGTTTGCCCAATTGCCTTCATTCTCTCTACCCTCATTCCCAATAAACC
ATTGCTTCAGTTATTGTCTCTATGTATCCATTCCTTCTGTGCTTCACAAACTGAGAAACC
CAATAAAAACAAAAACACAAAAAAATAATATAAAAATAAAGAGTAAGAAAGAAAAGGCTA
CCAATAATACTAAAAAAAAAAAAGCCAGAGAAGAAATTTTTAATGAAACAAGTGAGAAAT
ATTTGAGCCTAGCGCAAACTTAGGTTGAATCAAGAGGAAGGTAAGCTGACCAAGTGTCAT
GTACCTTGGTTTGATCCACCATAATCAAGTTTACAGTCATCTCTGATAACAAAGCCGTTC
CAGTCCCTCTCCTGTGGCTATAGGAGATCTGCCAGAGACTTAATCTGACTAGATACTCTA
CAGATGGATTTTGGCCTCCCATTGTCTGCCATATCCTTCTACAAATTGAGCGTTCACAAT
TTCAACTCTCCTGACACTTTTCCTTTCATCTTATATGGATTTTGTTATTATCCTCTTTGG
ATCACACTGAATGATGTGCTTCTTCGATATGGACTTAGTTGACATCTTGCTTAGATGACT
GCTTGCTTGAATGCACACCTTTAAAACCCCAGATACTATTCCAGTTGATAGCGGGGCACC
ATCTGCTTTCTTCACCACAATTTGCTGTTGCCTACCCTAGTCTTCAGGGATTTCTTGATA
TCGGGAAGTATGGAGCAGGGCCATGTTATAGAGAATAAACTGTTCATGGATTTGGGGCTT
GAATTAAGTGGGAGACCAGAATCCATGTATCCTTGTGCTTGTCCGCAGGTCATGAAGTAC
ACTGATGTGCTTTAGCGGTCTTATTATGACACAAAACACAAACGAACGGGAGCGACCCAG
CATCACTACTACATGCCCTAGGGGTATCAGGACAATTGCATTGATAACATCAATAAATTC
ATCTATCGACCTACTAAGTGACCGTATTGAGGATGTGACGCACTTTTTGCTAGTATAAAC
CAACTACGAGCTGTAATCCATGAGTTGTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCCTAAGTCCAAGGGCTACATGTAGTTTTGAGGT
AAGGGCCAGTTCATTCATTCTGACTTCCACATCAAGCCCTGCTGTGGCCTTTGAGGATGC
CATGTTCCCTTTAAGGCCAGAATCTAAGGTCATAATGCTTAGCCCATGGCATGATTCAGC
AAGAATTGGGTAGAAACATACTTAAAATGTTTGCCTGGGAACGTGGAAACAAATTTATTC
TCCCCTTAGGTTCTCTACAGTTATTTTTTTAGCACTTTCTGAAGTGAGTTTGATCTTCCT
GTTTACCTACCATACCCACCAACAGAAATACATGTTCCTGCTCTGAAATGTCAATGCTCC
CCTCCCATGGTCTTAACTTGAGTTTTCCAATAAGATTCTTCTCTCATTCCTATGGAGGGT
ATGTTCATTTGTCCCAGCCTTTTCTCAGTATTGGTCAGCATCCAGTGGATGGTCTTCTTC
CTTTTCCTCCCTCTTGAGTGACCCCAGCTGATGTGAGGTCTCCTCTTTCAAGGTGCTTCT
TATAAAGTGTACGTAAGCAGGGTGATGTATGCTTCATGGCCAGTAGGTAGACTCTACCCC
TTAGTTTGCAAATTGATCTCTCATAATTGTTTAATTTGTATTTCTCTTTATAGTGGTGGA
CTATTAACAATATTTGCCCTTTTGTGATTGACTAACATCACTTAGCATCGAGGTTTCCAG
GGCCTTATGTGTCATGTGATATTTCATGCTTTCATCACTGTTTTTAAGGGGTGCATACAG
GGAGTACAAAAAAAACCCTGGAACTCCTACCCCACCCCAAGCTATGTATTTAAATTGTTT
TACAAAACAACATTAACCCCTTCAAAGTACTCTCCATTACACTTAATACATTTGTCAAAT
CTGCAATTTCATTCTTGGAAACATTTTTCAAACTCATTTGTGTGGATGGCTAAGAGCATC
TCCCTCATGTTTATCTTCACCTATTCCACATCATCAAACCGCTGTCCTTTCACACTCCTC
TTCATTCACAGAAAGAAAAAGAAGTTGCAAGGAGCCGAGTCAGGTGAGTAAGGTATGTGG
ACAAGAGAGGCGTGATGTTTTTTGCCAAAAACTGGTGCACTGTGGGCATTGCCCTATTGG
CCATACCAGTCCCCCATCTGTCACAAATCAGGCTATTTTTTGGTCACACACTGTTACAGT
CTTTTAAAATCCCTCAATAGAAAGCTTGATTAACAGTCTCTGACCTGGTGGGATAACTCC
AAATGCACTATCCCCCTCACATTTTAAAAAAAAAGCATATTGTCTTGATCAATGAGCTTT
TGGTGACAATGGTGTCTTCCACTGGGGTCGTAAGAATAGCACCATGCCTTGTAACCAGTA
ATGACCTCAGGAAAAAGTCTGGGTCGCTTCAGAGCTGTTCTTTCAAAGCACAGCATGTTT
CCAGTCGATGCTCTTTTTCCTGGTCAGAGCCCGAAGCACAAATTTCGCAGCAACTCTTCT
CATTTCCAAATCTTCCATTAAAATTCGCTGAACCGAGCTCTAAGATAAGTCAAATAACAT
CCCCATCTCTTCAATGATCTGTCGTTGGTCTTTGAGCACAGGTGGATTCATTTTGTCATT
TTCATCCTTTTCGGAAGTTGACAGACATCCAAAATTAGGTTTGTTATCAATTGACATTTC
ACATTTTTTGAAACAAAAACACTCATACACTTGAGTTTTTCCCATAGCGCTGTACTTGTA
AGCTGTGTTCAACATCAGTTTCCGTGGCATTTTTTCCTAAGCAGGAAACAAAATTTCATG
GCCGAGAGCTGTTCTCTTAAATCAGCCATTACAAAAAACAAGGTTCGAGTGAAACTGCTT
CTATGAAAAATTCCACTGTGACCAGAGAACCTTCCCAGGTGATGCATTAACTAACTCAGA
GTGAGTTGCTTGATGCTCACCTAGTAGGAGAAAATGAGTACCCTGCCCAGCGGAGCTTTT
TTTCCCTGTCGTTTTCTTTTTTGGTGGTGGGGAACGGGGGCTCTCCCCTCCCCTGTATTC
TGTGTTTGTACCATAGTTTCATTGTCCATTCTTCCACTGTTGGACAATTGGACTGTTTCC
AGTTTCTTGCTATTGTGAACTATGCTGCTATAAGGATGGGAGAGCATACATGCACTTATG
TTCTTTGGGGGATATGCCTAATATTGCTGGAGATTTCAATTCCCAGTTGCTTTAAGTGTC
ATATCATTTTGCATAGTGATCATATATATTTGCAAGTCCACCAACAGTATATATGAATTC
CCTTCTCTCCACAGCCTCTCTAGCATTTGTTGTTTCCTGTTGTTGTTGTTTTTAATTGGG
CTAGCATTATTGGTTTAAGGTGGTATCTCTTTGTGGTTTTAATTTGCATCTCCCAGATAG
CTAGTGATCATGTGTTTGTTAGCCATTTATACATCATTTTTGGTGAACTGTCTGTTCATT
TCTTTTTCCCATTTCTTAATTGGATTGTTCGTTATTTTCTTATTGAGTTGCATAGAATTC
TACAGACTTTTGTAATTAGACCCTTGCCTGATGTGTTATTGGTTAAGAAAAATAAAATTC
CCAGTCTCTGAGATCTTGTTTTCTTCTTTTGATGCAGTCTTGGATGTGCATAACTGGTAA
AAATTCAACACGCCCCAGTCATCTGTCTTGTCTTCTCCTGTGTGTGCCTCCTCCATTGTA
CTTGGCAGTCCATGTACACCCTGCTGTAGAGCACTTACTGTTGGAACAGCTTTCTCATTT
GGTTCTGATAGCTCTGGGGTTTACATTTAGGTTTTCAGGTTTGTTTGGGTTTTGTTTTGT
TTTTTAAAGCAGTTTATTGGGAACTCTTACAGACATTATAACAGTCCATACATCTAGGTT
TTTAACCTATCTTGAATTCATTTGGGGACATGAAGAGAGAGATGAGTCTTGTTTCATTCT
TCTGTATATGGCAATCCAGTTTATCCAACACTTTGTTGAAGAGGCTGCCTTGGTACCATT
GAATATTTCTAGGTCCTTTGTTGAATATTAGGCACCTCTAGGCGATTGATTTATGGCTGG
GTCTCCTGATCTGAATCATTGGTCTATATCTCTCATTGTACCAGTGCCATGCTGTTGACG
ACTGTGTTTTTTGTATTAGCTTTCAAGTCAGGTAGTGCTAGGCCTCCTACTTCCCTCTTT
TTAAGAAGTTCTTTGCTTATCCTGGTTCTTTTGCCTACCCATGTAAAATTGGTAGCTACA
TTTTCTATTTCTTTAAAAAATGTATTTGGGATTTGGATTGGAATTGTTTTGTATCTGGAT
TATTTTTAAATAGCATTCACATTTTCACAGTATTAAGTCTGCCTATCCCAAGAGCTCAGA
ATATTTCCTCCATTTTCTGTAGAGTCTTTTGGGTTTCGTTTGTAACCTAGGGTTCTGTAG
TTTTCTCTAATATAAGTCCTTTTGTTTTCTTGAGTTAAGGTTATTCCCTAAGTAGTTTCT
TCTTTAGAGGTGGTAATTGGTAAATGGTATTTTTCTTAAATGTCTTTTAACATAGCTTCT
TTTCCACTAAGCATACAGGGAAGGAATGCTCATGTATTCCCCTGGTATAAGTTTTTGTGT
GCCTACCTACCCTGGTCAAATTCCCTTGAATGGTATCCCATTTAGGGCTTTTTTGGAACA
AAAGTTTTTGGGGGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA
ACCTTAACACACACCTTTCTTGATTTCAAGCCATGCAGTATCCTCTTGTTCTGTTTAAAC
GACTGCCTCTTGGTCTATGCGCAGGTTCCACAAGCTTGCAATGAAGCGTTCTGGAATTCC
TCTTCTTCATGGTGTTATCCATAGTTTGTTATGATCCGTACAAATACCTTTGCATAGTTA
TTAATATACATGTAAACACTTTCTCTGGTGTTTTCTGCTTTTAAACAAGATTTATATGAT
GTCAGCAGTGTTATGCCTCATGCCATGTCTTCAGAATCCAACTTATGTTTCTGGCAGCGC
TTTGTCAGTGTACATTTTAAAAATTATCTGCAGCAAAACTTTACTTGCATATGATAATGT
TCAATAATTTCTGAATTCTGTTGGAATGGACACAGATATGGATCTCTTCCGGTCAACTGG
CTAGGTAGCTGTCCTCCAAATTTCTTGACAAAGATAGCTGAGTGCTTCTGGGCTGCATCA
GTTCGTTGAAGCATTTGAAGTTCCTTTTCTGTCAAATCCTGGTTTCTTGTTTTATTTTTC
ATCAATGCCTTCAGGGTGCCTTGAACTTCTTCCTTCAGTATCAGTTCTTGATTCTGTGCT
ACCTCTTGAAGTCTTTTACTAACCAACAATGAAGCTGATGATAATGAGCACTAATATTTG
AAATCAGGGATATGTCAAGTTGCAGTTTTATAACCTCCTTAGTGTAATCAGAAAATATCA
TTAGTACATATGTATATAACCAAATTTATTGCCTTTGAGTTAATTCCAACTCATGGTGGC
GGCATATGTTAGAGTAGAATAGCTCCATAGAATTTTTTTGGTGGTAATATTTATGAAAGC
AGTCTCCAGGCCTTTCTTTCTAGTAACTGTTGGCATGGGTTAGAACCACCTACCTTTAAT
TCTGTAATCAAACATTTGTACTACCCACGGACATTGTGCATAAATCACTGCCTGAGTCAG
TGCCATTTGATATGGACCCTATAGGACAGAATAGAGCTATCCCTGCAGGTTTCTGAGACT
GGCCCTTCAGTAGAGTAGAAAGCCTCGTATTTCTCCTGTGGAGTGGGCTGGTGTTTTGAA
CTGCTGACCTTGAAGATCTCAGCCCAACCCCTAACCAGCACTTAACCACTGTACCACCAA
GGCTCATTTTATGTATATATAAGTAGTATAAATGGAAACAATTAAAATTAAATAGGGATG
GCAGAATCTTTATTCTGAGACGCGCAAACCTGATAACATAAGTTAGTGAATGATTTAGTA
GTTTCCATGGTGTTGTTCTCATTAATACATACTGATTGTAGCACTGCAGAATAAAGGCCT
CCCAAGCTGCTTCCATAAAGATTACAGCCAAGAAAACTATGGCAGAGGTGTATTCAGTGA
CACATGTGGTCATCCTGAGTTTGGGCGTTGACTTGATAATGAGCTAAAAACAACATAGCT
TTCATTACAGAATTTAAAATAACTGAATTAAAATTCAGTTGGTAGTATTGTAAAGTCTAG
CTATTAGGTTGAGTGGGTTTTAGCTTTAAAGCACAGTGATGATTAATGAACACATAATGG
TCAGGGCTTTCTTTGAAACTTTGTCATTTGAATCAATCACAGATTAAAAATTTAGACAAC
TATTTTGGCTGTAAACTGGTTTACTTAATAACTTGAATCACAGTCTGAGTCAAGGGTCAT
AGACTTACAATTGTTTCTTGGGGTACTAAGAAGTTTTTTGTTTTTGAAATTACAAAATGT
AATTTATTTTGAAGAGTCCTTTTTCTTTGTAGGCAAATCTTATGAGAAATGATCTAGTCT
GACATCAGTGACTGTAAATAAAGAAGGCCTGTGCACTGAGTCATACACTTTCAATAAGAG
GAAAGTCTTTGACAGCTTTTTAGTAAATAAGTCATCTGATGATAAACCCATTGCTGTAAA
GTCCATTCTGACTCATAGTAACCATATAGGACAGGAGTAGATTGACCCACAGGGCTTTCC
TAAGGCTATAATCTTTATGGAGCAGACCTGATGCCTTACTCATGCAAAATGGCTAGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGATCTA
GCAGCATACATTATGATACTATGCTCTAATATGCTGTGTGACTAGAGATGAGCTCAAGTC
ACATGTCGCTCATGTGGAAGAGATGACTGTTGTCTGCTCTCATAGAGACTACCAGTCTCA
GAAACCTGTGTGGGTTCCCTGTGAGTCAGGATTGAAGATGGCAGTGCTCATCCCATGCTT
CAATTCACATTTTATCATAGGAGGAAATCGAAGGTCTAAGAGATTCAGTGACCAAGATTG
CACAGCTAGTGGGGTGGTAAGGGCAAAGATTCTACCCAGGCCATGTGACTTCTGATCTCA
GTCATGGTGGTCTGCTGCCATCATAGTTTTTCATGGAACTGCGTTTTTTTTTTAATTCAA
GCATAATTCAAGTGATTTCCTTAACAAGTCAGAGGTTTGTGATGTAAAATTATACGTTGT
AATATATTTAAATATATTATTACCTGGTGGTGCAGTGGTGTAGGGCTGCTGACCTTGTTT
CTTCTAAACCACCAGCTGTTCCCAGGAGAAAACTGAAAGGGTTACAGTCTCAGAAACCCA
TAGGGCCAGTTATTTGGGGCCGCCAGGAGTCAGAATCAACTCGATGGCAGTGAGTTTTTT
GAATGAAGACATTCAGTAGAATTCGCCTCATGCTGCTAACTGGGTCATCACTATAAGCCA
GAACCAACTTAGTGGCATTGAGTATGTTGCTAACATGTAAATCTTAGCGAAAGAGATAGA
ATTTATTACTTCCCTAGCACTTCCTGCTAATCTATTCTATGGAACACCCCACCCCCCACC
CTATTGTACATTTCAGCTACCTGCAGCTTCTGTAAAGGCATACCCACAAAGACCAGGTGC
TGTGTTGGGGCGCAGGCAGTGTGGAGGGGCGGGGTCCTGTGCCTTGCTGCAGAGTGCGGG
TCTGGTAGCGGAGCGTGAAGCAGCTGAGTAATCCACTGGATGCGGACCAGGGCGCTCCCC
ATTTCCTTTGGGGGTCTGCTGATTGGTTGAGCACGGATACACGTGACTGACATGTGGCTG
TATTGGCGCAGCCCGCCGGGGTGTCATTGGAGACGGAATGGAGGTGCTGCCGGGTTCGGA
AATGGGGTAGGTGCGGGAGCCACCGTGGCCAGGCTTTCTTAGGGGGAGGGAGACGATTTT
TCCTTGCGTGCACGCTAAAACCGATGGACTTTGCTTGGCATGGAGTCCACTAGCACATGC
CAAAGCGAGGAGGCAGGGGCGTTTCCTCCTGCACTGCAGCACAGGGGATGGATTTCGTGT
GCCTTCTGATCCAGGGGCTTTTGACAGGAGAGGAAGAGGGGGAGGGGGAGGGGGGTAGAA
ATGTTAACGGGAGTCTGCGGTGAAAAAGAGCTGTTGTTGAAGCTAGAAGGGGGTTTGTTT
TTATAATGCCTGTTGACCGAGTAGAGTGGAGTAACAGTATCTAAGGAAACGGGTAGAGTA
CAACAAAGAATGGAGCATATTCATGGCGAGAAGCAAAAACTCTAGCCCATTGAAAGGCTT
CTTTTCCACCCGAGCCACAAGAACACATGCTCTGGTATCCAAAAGGGAGGGGATACAAAG
CTTCTGCTGATGCCAGATGTAAATCTAGTAGAAGTAGACTACTGGGGAGAGGAAGAGCAG
GAAGAAGCAGGTATTGCAAAGCTTGCCTTAGTGTTTTTGGTTGGTAAAATTTTGGTCACC
AGTAGCATCCTTGTTTTTGTAAAATATCTAATCAAACTCCCTACAAATAGGGTGGCAAAA
GGATGGCAGTGTCTTTGTTAGTTATAAGCCGCAGTGGTAGTGGCTTTTTGCGGATGACTG
CAGCAGTGGTTTCCTCTCTCAGGCTGAAAAGACAACTGCAGGGTAATAAGCCTTGCAGCA
TTGCTGCCAGTAGAAGCCCATTAACAAGGAACTCTAGTTTGTAATTACAACCTGAATCGC
AGAAAAAATATTTTGCTTTTTAAAGTAGGAGAAACAGCAGGATAGGAATGTTTGGACAGT
GGGCCATACCACTTTGATTCTACATCACAAAAGGGATGCTTAAATTATTTGATTTAATGT
AAATCCTACAGGGGATTTTAATAAATTATGTATGAAACTGGGAATCTTTTTCTTTGTTAG
TGTAGCTTTTATGCCATTAATTAGGTCATTGACAGTAGATCACTTTATAATGTACATTCC
TTTGTAAAAAATTAATACACTATTATAAGCTTAATATATAAGAGCGATTGATTCCACAGC
CATAGGTTTAGTCTAATTTTACATCGCTCACTGGTCACTTTCAGATATCAATCAACAAAT
TATATAAAATATTTTCAATTAAAGAACTATGACTGTCTTTTAGATGTATTTGTGTTTAGT
GAGTACTCATAAATTATGCTCTGTATATTTTTTTCTTTCCATAAGTATCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACAGAACTAA
ACTGAGATTTTTGTGAATAGAAAATCAAACTAAAAATTTGATTTCATTTCTTCTGTAGAC
TGAAATCGCTCCTGTACCACTAAACTTTGACATTTTTCAGTATTAATTGGTATAACCAGA
ATTGATCAATTAAGGACTTCAAGAAGTTAGATACTAGTAAATACGGTTACAAGCTGATCT
AAATTTGTAATTTAGTGTATTTGTTGCTCTGTAGATTTTTATCTTAACATTTGTCTCTTA
CTGTTACTATTTTTACTTATTTTATGAGTGTATAAATATCTTTCAATTTTGATGGTTTCT
TTTTAATTTCTGCAATTAACTAGAAAATTTATTTTCCTTAAATTAATTTTATATAATTTC
CTATTTGTTTTTATTACAATATGAAAAAAGTTAGTTATACGACCCCATGAGATGGGGCAC
TATGGTGAGGAAATGGTGGGTAATATTTGATGAAATACATGTTCTACGTATTTTTCAAAG
TGCCTACTACCTACTAAATGCGGTCTGTGATTGGGACCTAAGAATCAAATAAGATGTGGA
AACTAGCTTGGAGAAAACTCATAGTAGCACTGTGGGAAATTTTTAAATTATTTTTTTGAG
GGCTCGTACAATTCCCATCACAGTCCATACATACATTCATTGTGTCAAGCAGATATGTAC
ATTTGTTGCCCTCATCAATCTCAAAACATATGCCTTCCACTTTAGCCCTTAATATCATTT
GCTCATTTTCCCCCTTCCCTGCCCCCATGAACCCTTCATAATTCATAAATTATTACAGTT
TTGTCATAAGTTACACTCTGACGTCTCCCTCCACTCTCTTCTCTGCTGTCCATCCCCCAG
GGTGGAGGCCATACCTAGATTCTTGTAATTGGTTCCCTTCTTCCACCCCACATTCCTCCC
ACCCTCCAGGCATCCTCCCTCTCACCACTGGTCCTGAAGGAGTCATCCATCCTGGATCCC
TGGTGTTTCAAGTGACTGTGGGAAATTTTATTGCAAGTTCAACACTGCTTATTATGGCTT
TCTTGGGGTCTTTAAAGGTTTATACATTTGACCCTGGAACAACATGGGTATGGAATGCAT
GACTCCATTTATGCATGGATTTTTAAAAAAGTGTGATGCTAATCACCTCTGCCTAAGGTG
GTGTCTCGGAAATGACATATCACAGTAAAATGCAGTCTCTTGCATGCTCATCTATTTTTC
ACCTTTTATGCTACAATCCCATAAATCAGACCCCTACACAAAGTGTCGCCTAGTGATGTT
GGAAGTGCTCCCAAGCAGCAGAGAAAAGCCATTGCATTACAAAGTTAAAAGGAAAAGTTG
AATTGCTTGATAGGTACCATATACTATGGTCTGCATCTGTGGTTGCCCTCCATTGCAAGA
TAAATGGATACAGCATAAAAAGGAAAAAACGGAAATTTATGCAAGGTGTCACTGCAGATA
ACAGCTTGTACTTTTTTGCAAAATAATTTTTATCTTAATGGAAAATGCAGCTTTTTAATG
AGGCTGCAGTATATAATAACAGCGCTAGTGGCGTTGTTACTCACTGTTCTGCAATTCACA
AGGTCAGCAGTTTGAAACCACCAGCTGCTTCTCAGGAAAAAGATGAGACTTTCTACTCCC
ATAAACAGGTACCATCTGAGAATCTCACGGGGGTAGTTCTTCTCTGTCCATTAGAGTTGC
CATGAGTCTCTATCAGTTCAATGACAGTGAGTTTGTTTGAATATATAATACATTTACAAA
ATTTAAAAATTCACTGCTCAGTTCAACTAATTGCAAAGATACGTTAAAAAACAAAACAAA
ACCCTGCCCCTAGGGTTCCAGTTTTTAATACACAGGTTTATTCTAAGCAGTGTTTTAATA
CATCTTTTCAAACAGTGGATGACGGCAGACAAACTCTCTCAGTAATATACTTTAGTCTCA
TTTAAAAAAGCAACCAAACCCACTTTTCTGGAGTTGATTTCGACCCATATTGCTGTAAAC
AGCATTGGTGAGCCGTATCTGATTTCCTCTGGCAGGGATCAGGCAAGCCTCAGTGGTCCA
TCCTCCTTTACCTATTCTGACAGCAAATGTTCCTTCCACGCAAATCTACATTTATACTGG
GTTTGATGATTCATTGCAGTGGTCTCAGAACTTACAATACTCACAATTAAAGGGTGTTAT
TAGGGAAGGATTCATGAGGGAGGGGGGAAATGAGCAACTGAGATTAAGGTTTAAAGTAGA
AGGCAAATGTTTTGAGAATGATGAGGGCAACACTTGTACATATGTGCTTGACACGATGGA
TGTATGGATTGTGATAAGAATTGTACAAGCCCCCAATAAAATAATTTTAATTAAAAAAAA
AGAGTGACACTCAGAAACTCACAAGAGCAGTTCTACCCTGCCCTGTAGGGTTGCTACGAG
TCAGAATGGACTCCAGCACTGAGTTTGGAGTTTGAGCCGATTATATATCTTCAAATAACT
CCTTAGGGAAGATGCTTGCTTAATACTATTCAAAACTAAATGATGGTGATAGTGAAAAGG
ATAACATTTGGATGGTAACTGGAAAGTGGGCAATATGGTAAAAGTTATCTAGAAATGTGG
TGATATCAGTGTGTTCACGTTGTTTACTTTGGTTTATATATGTAAAACGATAATAAAAGA
ATTATTTGGGGGAAAAAAGAATCTTGAGACCCTTGTAAGTAATTGCATGACTGAAAAAAA
ACACTGGAAGTAGAATTCTAAATTAAGACGCATTTTATTTGCAACTTGAAATTCTCATGC
GATTTTGCTATTAAAAATATGCAGCCTGAAAAAAAAAAAAAAAGAAAATATCATGGCTTG
AGTCAGCACATTTTAGTCCTCAGAGTGATATCCTTGCTTTCAACACTTAAAGAGGTCTTC
TGCAGCCTATTTTCCTAATGCAGTGTACTGTTTAGATGGCATCCTTGACAACTTCAGACT
TTTCTCCATTTAGCCTGGTATTGACTATTGGTCCAGTTGTGAAGTGTTTTTGTTTTCAGT
TTTTGTTTTGTTGTTGTTGTTGTTAGTTTTAGTTCATATTGAAGGCTACAATCTTTGATC
TTCGTCAGTAGGTACTTCACGTTCTCATTTGAGCAAGCAAGGGCGTGTCATCTGCTTCTT
GGAGGTTGTTAAACCTCCTAAGCCTAAAAAAAGTGGGGGCGGGGAGGTGCGGGGGTATTG
TCCTAAAAAGAAAGCACTCTGAAGATCAGCTAGTTCTAAGAACGGACCTTTCCATCCGTC
TTGTAAGCAAGATCAATACTGAAGGCAGTGAATTTATGGAAAGAGTTGTAACTGAGGATG
TCTTGGATTTGCCAATGCAATCCAGAGAACAAGGTTCAATTTGAGGGCATGTTCTGGGTC
AGCTCAATTCAATTTAAGGCAGAGGGGTCAGGTCAAAAGGGGTTACAGTCTTTTGGAGAC
TGTAATCTTGATAGATTCAAAGCATGATTCTGGAGCTTTTTTTCTTTTTTTTTAATAAGA
AAAATTTTTTTAAGGGAGAGAAGAAATATACAAAAATCCTGGGTCTGTTCGCTGGCCTTC
AAGACTGTCCAGAGCTGACCTTTCTGGCCTGAAGCACCCCCTTGGGGGTTCCTCAGTGGC
TTCGTAGCTCTGCCTTGCACCAGCTGTTGATCTGGTATGGTTTGGGAGCTTCTTAATGAG
AAAGTTTAAAGAAGATAGAAAACTGTTGCTAAGAAAAGGGCAAGAAAGTTGTGCCAAGGA
ATATTTTTTTCAGTTATGATAAAGTTCCTACTCTTCCAGGATATGAAATAGTGATTGTCC
CACAAGCATTTTGTGGGGAAATCTCAACCCATCTAGCTTACATCCTGACTCTTTCCCCTT
TACATTTTTTCCCTCAAATTCATAAAACACTTAAAAGGAATATGATTCGAGTCCCGCAAG
AATGCTAAAACTGCCATTTGATGTGGTTTAAATAAAAAAGCATAGAATTCTTTAGAAAGG
CTAGACAGTATAAAATCTAGATGGAGGATATGTTAAACAAAGTCTTCATATTTTTAATTT
TTTGTTTAATCGGGGCTTCTGTAATTTTGTAGCAATACTTTTTCAATAGCTTTCTAAAAA
AATAATTGAATATATTGTTGGTAAAGTTTCTTTCTGGTCAACAGTAAGTAGGCTAATAAC
AGTAAACTATTGGGGAAGTTAAAAATTGTAAGGTATTTTTGCATGTGTGGAATAGGGTAT
CACCAACCCCCATATTGTTTAAAGGTTAGTGAATAATCAAAAGTACCTTTTAGTTTAGAG
CATTGTGGTGGTATTTCTTTGAAACAACATGCCTGATGAAAAATATGTGGTAGAGCCACA
GATGATTCTGGAAAGTAAACTAATTTTGAAGTACTAAGGGTGTGAAATATAAAACGGGAA
AGAGGGTGTTTTCTAATGTTCAGATCTGTTGCCCTTGATGCCTACAAGGTGAACTGTTAG
AAATATCTAATAATTCTTGTTCTGGTACAGATGACATCAAATAATAGATGAGCTCTCAAT
AATTATTTTTGTAACTCATGACATTATTAATCCATTATCAATCCTTTTTCTTTCCATACT
CAATTCCTACTCTTCTTAAAACTCACTGCCATTGAGTCAAGGCGGACTCATAGTGACCCC
TGATGAGTTTTTGAGACTATAACTGTTATGGAAATAGAAAGCCCAGTCTTTCTCCTGAGG
AGCTACTGATTGATGGTTTCACACTGCAGACTATGCGGCTTGTGGTCCAATATATAACCA
CTACACTACCAGGACTCCGTATAGGCACTTCAAAATATCCATGAATTCCTGTGAAATATT
ACTTTGTATGTCAATGTTTTTACTTTACATAATTTTTTTTACAAAAATTTGAAAAGTTTT
TAACTTTATGATGCTTTTAAGATTATCCATTTTCTGGCACTTGCACAGGCCCTCCCCAGG
CGTTGGGGCCAGGACTTGGTAGCTGGTGCTGAGAGAAAACTCACAGTTGCATCCTTGCTC
TGGGACTGTGTCAGTGGCAGTGGTCAGCTAATGGGACAGAGAAGGGAAAAGAAAAGAAAA
AAAGATAATCCGTTTTATGTATGTCCATCTAATTTTTAATAACAGCTGCTCTGTGATATT
CTATGTTGTTTATTCCCATTGAGTTGATTTGGTAGAATCACTTCTCTTGTGAAGGCTTTC
TGTTGCTCTTAATCTCTTGCACAAACAGTGCTATAATGTGCCTCTTTGTGCATGACTCTT
CATAGTCTATGTCAGTTATGTATTGCCAGATAACTAATTACTCTAAAAGTCAGTGGCTTA
AACAACAAATGTTTACTTTTTCAGCATTTCTTGTATCATGAATTCAGTAGTGATTTGGTT
GAGAATATGGCTTAGGATCTCATTAAATGAGTCAAAATATCTGCCAGGACTACCTGCAAA
TTTGACTGGATTGGGATGGCCTACTCACATAGCCTCAGTTTCTCTCTGGCTTTCAGTAAG
AGTCCTTACTACTTCTTGCCACTTGAACCTCTTTATTGCCAGGAGCCCTTGTGGTGTAGT
GGTTATGTATTGGACTACTAATTACAAGGTCAGCAACTCAAAACCACTGTCAGCTCCTCA
GGAGAAAGATGAGGCTTTCTCCTCCCATAGAGAGTTACAGTCTCGGAAATGCAGGGGCAA
TTCTAACTTGACCTGAAGTGTCACTATGAGTCAAAATTGACTTGTTGGCAGTGATTTTTT
TTTTTTAAGTAAGCCTCTCCATTGGACTTGGATGCTATGATATGGCACCTGACTTCACTT
CCCAGAAAGAAAACAAGGAGGAAGCTGCAGTCTTATTCTTAATTAAGTCCATAGGTTCAC
GAATTTATTTGACCTACACGTTCATCAGGAGAGACCAATCCCTGGAGAAGGTCATCCTAC
TTGGTAAGTGGAGGTGCAGTGAAAAGAGGAAGGCACGCGTCATGATGAATCAACACAGCG
GCAGCAGCAGTGGGCTCAAAGATTAGGTCAATTGTGAGGATGGCGCAGGACCAGGCAGTG
TTCCGTTCTGTTGTGCGTGGGGTCACTATGGGACTGAACCGACTCAATGGCACCTAACAA
CAACCACCATCACCCACTTTCCAGAAAAAAGAAATTACTTAGCACTCTCCCTCCTGCCAA
TTAAAATCTCTTTTTTTACTGTAGCCCATAATCAAGGATAAATTTCAGATACCTGTTTTT
GCAGCCCTTCTGGATTGTTACCCAGGGGATGATATCACCTACTTTGGGAAACATTGATCT
AATCTCAGAAGTCATACTCTATCATTTTCCTCATATTCTTTTTGTCTGAAGTCATTTAAT
TCAGCCCACATGAGTAGAGATGAATTATGCTTCACCTCCCGAAGAAGGAATGTCAAAGCA
TTGTGAATTTATTTTTAAATTATTACATGGACCAATGGAAAGATTTTACTGGAAATTTAT
CCCATGAAAGGGATAGGTGAATAATAGTGATGAATAATAATATTGTATCCTATTGCTGTT
ATAACAAACTATGAAAAACTTGGTGTCTTACATTTATACACATTTATTATTTTACCTGTA
TGCTGGTGAGAAGGCTAAAATAGATTCCACTGGACCAGAATAAAGATAGAAAAGCTGTGC
TCCTTCTGGAGGCACTATGACGCTAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGATTAAAATAAAAAGAAACTTCTTTGTATATAGA
TCTGTATCTGAACCAGTACAAATTTCCTATTTTTTAAGAAACTTACGTTTTTTGCTTATT
CTTTCCTAATACTAGAGATTTTCCAGATTGTATTGAATAAAGGTAATTGATACCTTTATC
TTGTTCCTAATTTTAAAGAGAATACTTCTAACATTTCACTATTAAATATGCTTACTATAT
AGGTTTTTATAATATTCTATTTCTAGTTGAGTTTTTGTCATGATGAAGTATGAACGTTTT
TCAAATTAAAAAAAAATTTTGGAGATGGTCATTGGTTTTTATTTGATATTTTAATGTGGT
TAATGACACGCATAAATGCATTTCTGGAGTAAATTCAGCTTTAGTATATACTATATATTT
TACTGATATTTTGTTTAGGTTTTTATATTAATATTCATGAATGGCAGTAAGTTATAGTTA
ATCTTTTCCATACTATCTTTAACTTTTATGTCATGGTTTTATTTGGCCTCTAAGAATGTG
TTGGGCAATATACCCTATTTTGCTATTCTTGGATAATTTTGTATAATATTAGAATGATTC
TTCAAGGTTTGCTGTAGAACTGTTAAACCTATAAAACCATTGGGACTTTTTTTTTTTTAA
GGTTTGGAAGAGGATGAGAGGAAATTTAACATCTGTAACAAAGTTTTCAATATTTATAGA
ACGCTTAAGGTTTTCTGTTTCTTTTTGAAGCAACACACACACCTAGAATTTCCTTCCCTT
TGTTTGGACTCTCTCTCCCCGCCTCCTCATATTTTACAATCTTTTCAGGGAATGAAAATG
AAAATTTTGTTCCTATCTTCAAATTCTACCAAAGGGTATACAATGGGGGGAAAAGACTCT
CCTCGCATTTTTCCCAGAGACAATACTGTCTTTTTGTGTATCCTCTAAATGTGTCCTTTC
AGTATTCTTTTTACTAGAACAAAATGGATTGTATAAAACATAGTGATCTGCAGTCTCCAT
TAGTTTTTTTTATGATCAACCTTTTTAAAAAATGCCAATGTAGTATTCTAGTGCATAGAT
GTAGCCAATTTATTTAAAACAGATGTGTTTTTATGCCAGATAGAAACTTGTGCATCTCTT
TGGAGTCCCAAAAATCTGATATATGAAGTGTCCTTTATGGTGCAAACAGTTGTGTATTTA
GATGCTAACCAGAAGGTGTGGGAAGTTGTAGTCCACTCAGAGGCACCTTGGAAGAAAATG
ATCTACTTCTGAAAAATCAGTGACTGAGAATTATGGTTCTTCTCTGACACATAGGGGTTG
CCATGCTTCAAAATTAACTTGACTGTAACTGGAGGAACCCCTTGCAGTTTTTTGGGTTTT
TTTTAGTGTATTTTGTAAAATATCTTGATTTCTTTATTTTTTCACACACCTGTAAAATAT
CTTTACTGAGTATAAATCAATTCACACTTAGAAAAAGTCAGATTTTTTTAGAAATAAAGT
TGCCTCATATTTTCAAATGGAACATACTCATCTTCCTGGTTGTTTGAAGAAATGTTGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNTTCTTATTATTTCCATTCTGTTTGTCCTTTTTCTATTGCATTCTCATCTTTGC
TTCTGGATAAATGTTGACCATTTGGTCTTATACAGTCAATTGCTTATGGCCACATTATGC
AAATGATATTTTATAAACAAATCAGTTGTTTGGCTGATGTTATTTTACTGTTAAATCTTC
TGTGTGACTGAAAGGTGACCTGAATGTGCCTTTAGTTTTTTTTTTAAATTAGGCATAAGT
CCTATGATATACCAGTATGTTTCTCGTTGTTTTTAAACTTTTAAAACTGTTTAAAAATTA
GAGAGCAAAAAAAAAAAAATTTAGAGAGCAAAGACATTTGTTTGGAATCTCAACTTCCTT
GGAATAGTACTATTAGCATCACCTGGGAACGTGTTCAAAATGTAGACTCTCCTCCCCAAT
CCAAGAGTTATGGAACCCTAGCAACTCAGGTAAGCATTGGACTGCTAACTGCAAGGTCAG
CTGTCCGAAGTCACCAGTCACTCCATGGGAGAAATTTGAGACTATCTGCCCCCGTAAAAA
TGTGCGACCTCGGAAACCCAATTTAATTGAGTCAAAATCCACTTGATGGCAGTGGGTTGG
GTTACTTGTGACTTACTGAATGTTTTAACAAATGCATCAGGTGATTTGGATACATGCTAG
AATTTGAGAACCACTAATGGGTGGGTTTTAATGTAGGCTTTTGGGGGAAATCTTATATAA
GGAGAGACCTGATGTGAGCTGGTGTTTAAAAGGATTTTCTTGGCTATCAAGGCAGGCCTT
GCTTGCTGAAAATGAGGAGGACTTGAAGCACTTGCCAATGAATATCAAAGACTAGCCTTC
AGTATGGATTGCAACTCAGTGCGAAGACTAAAATCCTCATAACTGCACCAGTAGGTTACA
ATATGATGAATAGAGATAGGGTTGAAGTCAAGAATTTTGTCTTGCTTACATACACCATCA
ATGCTCGTGAAAGCAGCTGTTAAGATATCAAAAGACACGTTGCATTAGGTAAATGTGCTG
CACAGTACTCTTTCTTGAAAAGCAAAGATCATTGGTTTTATAATTTTTAATTTAATTTAT
AAAATGTTTTAGCTTTTATTGTGTGAGAACTGTAAAATAAGAGTATATATTTTTAACAAA
TATAAGAAATGTTGAAATAAAATATATTAAATTTTAAAAAAAAGCAAAGCAAAGATGTTG
TTACTTTGAGAACTAGGGTGCACCTGATCCAAGCCATCATATTTTAATTTGCCTCATATG
CATATGAAAGTTGGACATTGAATAAGGAAGACTGAAGAAGAATTGATGTTTTTGAATTGG
GGTGCTGTAGAAGAATAGTGAAAGAACCATGGACTGCTAAAAGGACAAACCAATCTATCC
TGGGAAAAATATGGCCAGATTGCTCCTTAGAGGCAAAGATGGAAGCGTTATTAGTCTTAC
ATACTTTGGACGTATCAGGAGAGACCAATCCCTGGATAAGGACATCATGCTTGATAAAGT
AGGTGGGCAGTGAACAAGAGGAAAACCTTCGGAGATGTATTGACACGGTGCCTGCAATGG
TGGACTCAGGCATAGAAACAATTGTGAGGATGGTGCAGAACTGGTCCGTATTTCAGGTTC
TGTTGTGCACAGGGTCACCATAGGTTGGAACTGAATGGCATCTGATAACAATTAGGCAGA
CTGCCCTGGTGGTATATTAGGTTATTAGTTGGGGTGCTAGCCAAAAGCTACTCTGGGAGA
GAAATGAGGCTTTCTTCTCTAATAAAAACTTAACTTCTCCCTATGCCCCCACAGGCAGTT
CTTTCTGTCCTATAAGGGTTACCACTGGTCAGAGTAGAATTAATGGCAGTGAGTTTTGAG
TATTTTTAGTACCATTTTGTTGTGTGCTATTAAGTTGATTGCAACTCATAGTGACTGTAT
GACACAATACAGCCACTATCACCACCACCACCACCACCCCACACACACACCTCATTGCCA
TCGAGTTGATTCTGACTCATAGTGACCCTGTAGGACAGCAGAATTGCCCATGGGGTCTTT
ATCCAAAGTTGTAATCTTTACAGAAACACACTGCCACATCTTTCTCCCACGACGAAGCTG
ATGGATTTGATCTACAGACCTTTCAGTTAGTAGCCAAGTGCTTAAGCATTGTTCCACCAG
GAATCTTTGGAAAAAGATTTTTTTTTTAATCCCACAGTAAACCCACTGCCACGGAGTTGA
TTCTGACTGATAAGCAACACAGTAGGACACATTAGAACTGCTCCTTAGGGTTTCAGAGAT
ATATAGTCTGAATATATAGAGTACAATGTTTTCAGATCTGAAAGGGTGTTAATTCCTACA
TGTCAGTAAACTAGAATCATGTCTTCTAAAAGTTGTTTAGAATTTTGTCGTGTTAACATA
TGGTGTTGTTTTTACAGGAAGTACTTAAACAGCTACAGGGAAGTATTGAAGATGAAACTA
TGACTTCCTCTGGACAGATTGACTTAATAGAGCGCCTTAAAGGTAGGGATTTTTCAAACT
GTTTTAAAGTCATAGTTTAAATTCAATTTATCAATTATAGATGTGTAATTATTCAAATAC
AGTGAGCTCTGGTGGTATAGGAGGCTGATAACTAGAGAAGTTAGCAGTTTGAATATACCA
GCTGCTCTACAGAAGAGAAAGATGAGGCTTTCTGTTCCTATAAAGAGCTACATTTTCAGA
AACTCACAGGGGCAGCTCTCCCCTGACCTATAGGGAAACTATGAGTCAGAATTAACTCAA
GAGCAGTGAGACAAAGAGATATGAGTGTGAGGAGCTGATACCAAGGGCTCACATAGAAAA
AAATGTTTTGAAAAGGATGATGGCAACATATGTACAAATGTGTTTGACACAATAGAAGAG
CTGTAAGAGCCCCCAATAAAATGATTTAAAAAGAAAGAAAATATGGGAAAGGAACAACAG
GTATCATTCTTACCAGAATTATACAATGTCCACATTGAAGCAAGTGGTGCTTTATTAAAA
AGTAATGTACTAATTGTGCTTGACACAATGGATGCATGTATGAATTGTGATAAGAGTTGT
ATGAGCCCCCAATAAAATGATTTTTTTAAAAAGTAATGTACTACCACACACAAAAAAAGA
TTCACGTGCAAGGTTGACTAAATCCACTAACTGCTCTTGGAAGGAAGATGAGGCTGTCTG
CTCCTATAAAAGGAAATAGAGGAAAGAACAAGGAAGCAAAGGACATTTATAGAGGTCAAA
ATACAGGCATGTACATGTGTAAATATATTTATATATAATGATAGGGAAATAGACTTATGT
ACATATATTTATGTGTTAAGTATTAAGGTAGTAGACGGACATTGGGCCTCTCCTCAAGCA
CTCCCTCAAGAACACTTTGTTCTAATAACCCAGCATTCCGTGCTGCTCACACAATCGCTG
AAGACAAAATGGGTGCATAAGCAAATGTGAAGAAAGTGGTGTCCGGTTATCAAAAGATAC
AGTATCTGGGGTCTTAAAGACTTGAAGGTAAACAAGCGGCCATCTAGCTGAGAAGCAACA
AAGCCCACATGGAAGAAGCACACCACCCTATGTGATCACAAGGTGCCAAAGGGATCATTA
TCAGGCATCAAAGACCCAGAATAATAAATCATAACATTGTGAATGAGGAGGCGTGCATAT
TGGGAATCCAAAGCCCATCTGTAGGCAACTGGACATCCCCTTACAGAAGGGTCACAAGGA
AGAGACGAGCCAGTCAGGGTGCAGTACAGCAACAATGAAGCATTAAAACTTTTCTCTAGT
TCTTTAATGCTTTTTCTCCTCTCCCCACCCATCATCACCCCAATTCTACCTTAAAAATCC
AGCTAGACCAGAGCATGTATACTGGTACAGATAAGAGGTGGAAACACAGGGAATCCAGGA
TAGATAAACCCCTCCAGGACTAATAATGAGACGAACGATATCAGGAGCAGAAGGGGAAGG
TGAGGGGAGCAAGGGGGAACTGATCACAACGGTCTACATATAACCCCCTCCCAGGGGGAC
GGACAACAGAAAAGTGGGTGGAGGGAGACATTGTTCAGTGTAAGATAGGGGGAAAAAAGT
ATAAATTATCAAGGGTTCATGGTTGGGGGGTGGGGTGAGCTGATACCAAGATCTCAAGTA
GAAAGAAAATATTTTGAAAATGATGATAGCAACTTCTGTACAAATGTCAAGTGCATTATT
TAAAAGAAAGGGGGAACAGATGACAGGCCTACATATAACCTCCTCCCTGGGGGATGGACA
GCGGAGAAGTGGGTGAGGGAGACGTCGGATGGTGTAAGATATGATAAAGTAATAATAATT
TATAGATAAGGGAGGGGGACGCGGGGAGGAAGAGGGAAAAAATGAGCTGACACCAAGGGC
TCAAGTAGAAAACAAGTATTGTGAGAATGATGAAGTCAACATATGTACTAATGTGCTGGA
CACAAATGATGTATGTACGGATTGTGAAGAGTTGTATGAGCCCCTAATAAAATGATTACA
AAAAAAGAGAGAAAACTTTTAGCCTTGGAAGCTCTATAAAGGATAACAACAAATTGGAAT
TGACTCAATAGCAGTGCATTTGGGTTTGTTTGTTTGTTTGTTTGTTTGCTTGCTTGCTTA
CGGTCCAAGAGATCAACAGTTTGAGTCCACCAGCTGCTCCCTGGGAGAAAGATAAGACAA
TCATCCTATGTAAAGAGTTACAGCAGGCATCCTCAAACTACTGCCTGCGGGCCACATGCG
GCCCCGCCAAGGACATTTATGCAGCCTGCCGGGTGTTTTTGCCCTGTTTTGTTTTTTACT
TCAAAATAAGATAAGTGCAGTGTGCATAGGAATTTGTTCATAGGTTGATTTTTTTTTTTT
TTTTTTTTTTAACTATGGTCCGGCCCTCAAATGGGTTTGAGGGACAGTGAACTGGCCCTC
TGTTTAAAAAGTTTGAGGACCCCTGAGTTACAGCCTCAGAAACCCGGTGGAGCAATTCTG
CTCTATCGTATAAGGCTGCTGTGAGTCATAATGTGGGTGGTGGTGGTTTATTTTATGTAT
TTAAGTGCAGCTTCTCTGGTGTTTGCATAAGGTTTCTTAAGATCATTCTTACCCATTCAG
GTGTATTTGTTTAATTTTGGTAGGTAAAAAAACCTACTTATTAAACATTTAACTAGTTTT
GAATAAAATATTCTAAAACTCTTCAGTGATATTTTTCACCTGTTTTTAAGTTCATTGCCT
TAAAATATTGTATGCCACGGACTAAGTACACTGACATTTCAACAAATATACTTTTCTGTT
CCCTCCAAGATGGAAATGCTTTGTCATAGATTCCATTAATAAATCATTTTAGCAGAATTT
TAAGGACTCCCCCCCACCCCTCTCATTTTGATTTGGAAGTGTATTGTCAAGACAAGGAAA
GTACATAATACTTGAAGTTACACAGAAACGTTACCTTCATCTCAATATTAGATTGAGGGA
ATCTAATGACATTTTGCATAATTTTCCTTTAACATAATTCTTATTTCACCCTGCCCAACT
TGGTTTTGGAAGGAACGTTTAGTTATTCTGATTCTGAATTATAGTTTATTTAGGCAGGCA
TATCTGTGTCCCCACTGTTAGCAATTAAAAACTGTAGGCTCTACACCACACAGTGTACCC
TTTTCTAGAAGCTGTGCTTCTAGATTCAGTATGCTCTTTTTACATACTCTCCAAGGGCCA
GCTCATTGAGGCTCAACTACTTTCTTTTTTTAATCATTTTATTGGGGGCTCATACAACTC
TTATTATCATCCATCCATCCATCCATCCATCCATCCATTGTGTCAAGCACATTTGTACAT
TTTTGCCATCATCATTCTCAACACATTTTCTTTCTACTTGAAGGCTCAACTACTTTCTAA
TTTCTGGAAGACTTTTCCTTTTAGTTCTCCCTCCTACTTTTTACCTTTACATTTACCTGG
AACCAGGTGCCAGTTGATTTGTCTTAGGGCTGTCATTTGTGATAAGGATTTTTCTCTGTT
TTTGCATAAATTTCTGCTCAATAGTTGTCATAATTAGGTACTCCCTTCCAGGCTTTTTAT
GTTATATATTTTCAGGTTAGATTTTGAGTGAAAATAACCTTTCAAATAATAAACATTCAG
AATCACTTAGACCACTGAAAGCATTGCTGTATAAAAACTTACCCCTTCTGTCTCTTATTT
AGAGCTTAATTTAGATAGCAGCAATTTCCCTGGAGTGAAACTACGTTCAAAAATGTCTCT
CCGTTCTTATGGAAGCCGGGAAGGATCTATATCCAGTCGTTCGGGAGAATGCAGTCCTGT
TCCTACGGGCTCTTTTCCAAGAAGAGGGTTTGTAAATGGAAGCAGAGAAAATACCGGATA
TTTAGAAGAACTTGAGAAAGAAAGGTAACTTTTGTTCATTATATCCTAAACACTGGTTTA
TAGTGTTGTTTGTATTGTATTTGTTTCTATTATATTATTAGTTGTTTTTCTTTTTTTCAT
TTTGTAACCCAAGGTAGAAATTCTGAAATGCACTGCCCTCATTAGCGGTCTCTATTTTAC
TTCTCTGGTTTCTAATATCCATTGTAATGGCTGCACAGGATTCACATACAAAATTTGGTA
GTTACCAAGTTGTAATTCTAGTTAATGCTCAAGGTTGAATTATCAGGACGTATTATAAAA
AATCTGTCAAGTGTGCTGATAGATGCCCAAAGGGTATACCACTCCTCTGTAAGCATCAAC
CCTGAAGAGTCTGGGTCAGCAAATCCAGACCCTTAAATTAAATACACAGAAGCACTCCAC
TTTGGTAATCCCCAGTCCAAAGGCACTCAGCTCTACTTCCTTGGGTCAGCAAATCCAGCT
TCCACAATTAAGTGCCCAAAGTCACCTTAACCTGCAAGCCAACTTCCTGCATAGAAGCAT
GTAGCTTTACGTCCTCCCTGGATTCGGAAGTCCATCACTCTGTCCATGTTCTGGATGCTG
GTTCTACTGCTCTCCTCTGATGGTATAGCTGTCATCTGGTTCAAGGGGGTTCACTGCGCA
GGTTTGATCAATTTCAGATTACAGAAGTTGGTAGAATTTTTCCATTTTTTTCATACTGGA
CTACATAAATTTGAATAATATTGTATTATCTGGATTTCCTTGTATGAGGAACTATCCCTT
CACAGACAGCATTGTACTTCTTGATAAATCTTAAAATATATATAGGTACATACATTATTT
AGGGGGGTGAAAAACTGTTTTTGGCTTAAAGTTTATAGAACAAAATCAGTATTTAAAAAT
TTTCTTTCTTAAAATAATAAAATAAAATTTTCTTTTTGATGAAGAATGTGACACCATTCC
TCTTGAATTTGGCATTCTTAGCTTATTAAACCATATGACTATCTAATTCAAAATGGACAG
CACTCATTTATTTCATCTCATTGATGCCGAGGATGTAGATCTTTATGCATTCCATTTCAT
TTTTGAAGATTTGAAAATGGCTCAGGTAACTGCATGTAACCTCCTCTGGGTTCCCTATTG
CCACAAGGCAAGGGTCAGAGATGCCTCTATGCTCCANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCTCTTTCACCCACATTTCTGTTATTTGACCCCTTT
AGGGAGTGCTATATATACCACCTTGTGATGGGTCCCCCTTTCACCTCCTTCCCCCTCCCC
AACCATCCCCCTACCCTCTCCCTCTTTCTTTACCTATTCTGACACCGTGTCTCCCAGCAT
TGTACTTTTCTGCTGGTTTCAATAATTCAATGCATGGACCACACAACTCAAAGATAAACT
CACAATCGGGCATATATTAGGGACTTTAACAAATTACCATGAGTAAGGATGACCAGCAGC
CATATCTCTCTGGTCATCAATCAGCCTTTCAGCCATGTGGCCCCTTGTAAGTAAATGTTT
ATATTACTAGTTCTTTACATAAAGACTGGACAGATCCTACATCACTTTGAAAGATGTAGA
TTTGTTAAATTCAATTGCTGTCCACTTTTCAATTTTTCCTCACACATTTTTTGTAGACAT
ACAGGTACCTATGTATGAATGTGAGGAGACTTCAAAAAGTTAATGGGGAAATTTCACTGT
CATTTAATTCCATTTTTCTGTGAACTTTTTAAGTCCCCTCATATATTCTTATGTTTATTC
ACTTTCATTCACTGCCATTGGGTCAGTTCAGACTCATAACTACCTTATAGGACACAGTAG
AATTGCCCTGCTGTCGGTTTCTGAAACTATAACTCTTTACACGAGTAGTAAGCCTCATCT
TTCTCTTGCTTGTGTTTGTTATTTCATAAACTTAAACTGAACTCTATGGTTTTCCTTCTA
ATAGTTCGTTACTTTGTTGATTAATCCATATTTGTACCCATTCCAAAGAAAGGTGACCCA
ACAAAATACTAAAATTATAGAACAATATCATTGGTATCAGATGCAAATAAAATTTTGCTG
AAGAATATCCAACAACAGTTGCAGCAGTACATTGACAGGGAACTGCCAGAGGTTCAGGCT
GGATTCAAAAGAACCCAGGGAACAAGGGATATCATTACTGATGTCAGATGGATGTTGGCT
CAAAGCTGAGAATACTAGAAAGCTATTTACTCGTGTTTTATTGACTGTGCCAAAGCATTC
GACCGTGTGGCTCATAACAAACTATGGATTGCCTAGAGAAGAATGGGAACTCTGGAACAC
TTCATTGTGCTCAGGAGAAATTTGTACCTGAATCAGGAGGCAGTTGTGCAAACATAACAA
GAGAATACTGCTTGGTTTAGAATCAGGAAAGGTTTGTGACAGGGTTGTATCCTTTCACCA
GACCTAGTCAATCTGTATGTTGAGCAAATAAATAGAGAAGCAGGATTAGATCAAGAAAAA
TATGGCATCAGGATTGGAGGAAGGCTTTTGACAACCTGAAATATTCAGGTAACATAACTT
TTCTTCCTTAAACTGAGGAGGACTAAAGCACTTGCTGATAACTATCAAATATTGCAGCCT
TCAATATCGATATAATGTAAAGGAAAGAAAATTCCTCACAACTGAACCAAGAGGTAACAT
GATAAATGGAGAAAAGGTTGATGTTGTCAAGGGTTTTATGTTGCTTGGATCCACAACCAA
TGCTGATGGAAGCATCAGTCAAGAGATCAAAAGACGAGTTTCATTAGGTAAATCTGCTGT
ATAAGACCTCTTTGTGGTGAAGAAAGCTGATGGTGCCTGGCTATCAAAAGATAAAGTGTC
TGAGGTCTTAAAGGCTTGTAGTCAAACAAGCGGCCACCAAGCAGGTAAGCAACAAAGTCC
ACATATAAGAAACATACCATTCTATGTGATCATGAGGTGTTGATGGGAATAGATATCAGA
AGTTCACAGACAAGCAATCACATTGAAGTGAAGAAGCGTAGACAAAGTGGAGACGCAAAA
GCCACCTGTAAGATAATTGGACAATCCCTCACAAAAGGGCTATATAGGAAGAAAGAGATA
GCCAAGGTGCAGGATAGCACTGATGAAACACAGAACTATCCTCTAGTTCTTTAGTATGTC
CTCCCCTTAATATTATGGTCCCAGTTTTATTTCAGTAAGCTTGTTAGACCTGTGAATATT
CATTTGTATAATGAAGATCATTCAGTGAATGAAATCCAAGATAGATAACTCCATCAGAAA
CAGTAATGGGAGCAACAATTCCCTGGAGGTATGGGAAAGATGGAGGGAACCGATAGCAAA
GATGACTGTATAACCCTCACCTCTGAAGGGAATGAATAACAGAATTGTAGGGCAACGGAA
TCAGTGGATGGTGTAAGATATGGCTAAAATAATAACTAAGAAGAGTTTCCTGGGGCGAGG
AAGGGGGAAAAGAGGTAAAGGGGAGCTGATATCAAAGAGTTCAAGAAGAAAGAAAATGTT
TTGAGAATGATGGTGGGCAGTCATTGTAAAATTATGTTTGATCTAACAGAATTATGGGAT
TGTTGTAATACCTGTAGAGACATAATGGATATCCATATGAGCTCCCATAAAATGATTTAA
AAAAAAAAAAAGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCTTCTAGCTTCTTTACTTCTTGGAAGAAAAATTTACTGGGTTCCAGTA
AATTTGTTCTAATTTGAGCTTTTGCTTTTGAATCCTGCCCTAAAAGAATCATGCCGAATT
TCTTGTCAGTATACTTTCCATTTAGTTCAGGTATCTAGTGCTCTCTTGGTTCTCACTGTG
TAGAGGAAAGTAAATGGAGTCCTTGCAACTATGACAATGTGTACTGTATATTTGACTCTC
ATACTTGGTTAATAATTTAGCTAAGGCTACATTTAAATTAATTTTATTAGAGACCTCACT
GGTACGAAATATGTACATGTCAGAGGCTCATTCCTTTGTAGGCCATCATTATTTTTCTTC
AAATTATTTTAGAATTCCTTGGTATGAGTGCATGCATCATCATGCTAGATATTCATTCTG
TCTTTTTATTCTGAAGTTTTGTTTTCTGCAGCTTTTGCAAATTCTTTCATTTCTTAGATG
ATTTCCTCTTGTTTTTCTGTTGCTGTATTTTTGCTGTCTTTTTAGACATCCTATAAATCA
TAGATTAACTCCTTGTGCTTTCTTGTTATTTTTAGTCCTCATTTTCTGGATTGCCCAAGA
GAAATGCCAGAAATTGGCCCATTCAGAATTCGAACCCATGTCTATTTAACCTTTTTGAAG
CAGACCTAGGAAGAGCAGATGAGACATGGTCAATATGACTTTTAGCCATAATCCCTTAAT
GCAGTGTATTATAAATTCTAGACTGTATGCCTGAGACTATAATCCTAATTTGAGAGAGTT
CTCTGCTGTGCTGATGGACAGGATTAAGGTGGGATTAATTATCCATTATAATAAAGGATG
TGATCCTTTGTTTCATTGGGAGGATGACCGCCTAAAAGACAAAAGCCTCACCTCCACATA
AGAATGAGCCACCGCAGAATAAGAAACACACAGAAATCCCAGGACCCTCAGAAGAAGGTC
CACCAGTGGAATGCATTCAGGATCTCTGAGTGATGGAAACTGATATACCAGAAGCACCAG
CGTGTATGGCACTGAGACCATGAGATAGAGCAAAGGAGCCCGGCTGAGAGCTGAAGCTGA
GTCAAGGAGACCATGACATAGAACAGAAGGGCAACACTGAAACTCTATGAGACTATGAGG
AAGAACACAGCAGGGGGACTTCCTGGCCTATGGAGACCAGAGATCAAAGGACTTTGTGTC
TGAGAGGTTGGGTGCTGGAAAGAGGCTTGGCTGTTGGCTGAGGAGAGGTGTTTCTGTGGA
CCAGTTACTGATCCTGACCTGTTAACTTCCCTAATAAATCCCCATAATTGTGAGGATTGT
CTTTGAGTTCTGTGTGGCTGTTGTAGCAGATTATTCAACCCACTATGGTGCCCTGGGAGG
AACAGTTGGTGTCAGAATAGGATAAAGAAGGATGGAAGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGTTTAAGTGG
GATCATACAGATTTTGTCCTATTGTAAATCTGCTAGTTTGGGTGGGGGTTTTTTAAATAG
GGGGGGGTTGTTTGTTTTTTTAATAAAAATAGTACCTCATCAGGGAGAATAATCATAAGG
GAACTGAACTTAGGCTCGCTCTAATTGGGCCATTTATACAAGGGGGCTTCAAAAAGTTCA
TGGGAAAGTTCTTTTATCTTTTAATTCCATTGTCTCATGCCCTTTTTGAAGCCCCCTGGT
ATATTCTAAATGTAATAGTCCAATTTAATTAAAGACATTTGTAAAGATGTAAAGACTATA
CAAGTGTTTTAATTTAGTGTTTCACATTAGGAACCCTGAGTGAACATGGCACTTATAATC
AAGTTTTTGTTTTTGAGCTTTTTAAAATCATTTTATTGGGGGCTCATACAACTTTCATCA
CGATCCATACACACATCCCTTTGTGTCAAGCACATTTGTACATTTGTTGCCATCATCATT
CTCAAAACATTTGCTTTCTGCTTGAGCCCTTATAATCAAGTTTTAAGACTCCTTGGAGTA
CAAAATTATATCATTGTGTGCTGTGACAACAATTTGCTTACTTGCTTTTTGTAATTTTAT
ACCTTATTGTTTTTATCAATAAACAGACAAACATGATACGATGCTAAATTTTCACTTTAC
TTGTGGTTTTAGTTTTCTTTACAAACAGATATGACAAGAAGACAATTGGAATATGAAGCA
AGGCAAATCAGAGTTGCAATGGAAGATCAACTAGGTACTTGCCAGGATATGGAAAAACGA
GCACAGGTAACTTAAAATTATTTTAAATTATAGAACAGCGTCAACTAAGGAAGAACTAGA
AATGAATTCCACCTCTGTTATTGTTGGTTATACTTTATTTCAAAAAATATTTTAACTCTG
TTTTCAATTAAGCACATTTTTTTTAGAGTAAAATTAGTTAGCTTGACTAATGAGCAGCAG
AGTCAATGTCTACATAGTTCTACCTCCGTCATATTTCAGGTCCCCTGATAGGGCTCTCTT
TTGCCCTAGAACTGGAAAAGGGAGAAAGCTAAGTTGCTGTTGCATTGGTACTTAATGGTT
AGCTTTAGTTTTGCTAGAAATTTTTATTCTCTTTAGTCTTAAGTATATGACATTCAGAAT
ATTTCATTGTTCAAGTTTTGCCCAAACAAACCCCCCAAATCCCCGATTTCAAGTATAATG
GAAAAGATATTTCTTAAGGAAAATTTTAGGTGATATGAAGTTAGTTGAATGAAGAACAAT
TCCCATGATTTCTTTCCTCTCTAATATAAAAAAAAAATACTAACTAACTACTGTTTCTCA
TATATATGAATTTAACTGTTTTATGTTCATATAACTATATGACTGATGGTGTATTAAATC
TGAAGGAAGCTTTACTGGTCACCCTACCTGTTTCAAAGCAAGCTGGGAATTTTTGTATTA
ACCTTAGAGACAGATTGGAAGCAAAACATTCTTTGAAAGATTTTAGACACACACACACAC
ACGCACACCCACAAGTGCCTATATTTGAATGTGTGTTAAAATACTTGTATTTTGTATTGG
GAGCAAAACATTCTTTGAAAGATTTTTTTAAACCCACACACACAAGAGAGAGCTTCTATT
TATATGTGTGGTAAAATATTTGTATTTTGTGTTCTGAAAATTATATAACTTTGGTCTTTT
TTTTAATTATGAAAATATAGAAACATATACCAATTGAACTATTTTTTCATGCCAGATTCA
GTAACACTGATTATATACTTCAAGTTAAGCAACCATTCTTGCTATCCTTTTCCAAATTAT
TAACATAAAATCACTGCCCCTAAGCAAAACCTTTTCCCCTCCATAATAATTAATTTTTAT
ATTTCATATAAATTTTATATTTCATTTACATATTTATATTGCATATAATTCAGATCATAT
AATATTTACCCTTTTGTGATGAATTTCACTATTTTGGCATGCATCCATGTTGTGACATGT
ATCTATATATCTATATAGCTCTCTATAATGAGTAAAAATTTTTGTACATACCACATTTGA
TTTATCCAGTCATCTGTTTGCACACATTTGGATTGTTTCCATATTCTGGCTATTGTGGAA
AGTGCTGCTGTGAGCATTGATATGCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTGTTTCCTGAGTTAGGGTTATTCCTAAGTAGTCTTCCTTTAGTGTGGTTA
TGTAAATGGTATTTCTTAATGTCTTTAACATAGCTCTTTTCACTAGCATACAGGAGGAAT
ACAATTGATTCCCTGTTAGTTTTGTGTCCTACTACCATGTCAAATTCCTCGATTGTTTCC
ATTAGGCTTTTTGTAGAAAGTTTTGGGTTTTCTATAAATAGGATCATATCATCTGCAAAT
AATGAGGATTTCACTTCTTCTTTACCAACTTGTATTCTCTTGATTTCTTTTTGTTGCCTG
TTGGCTCTAGCTAAGACTTACAGCACAATGTTGAATAAAAATAATGAGAAGGGACATCCT
TGCCTGGTCTCTGTTTATGGTTGAAATGTTTTTTGTTTTTCCCCATTGAGTGTATTTTTG
GCTGTTTGTTTTTCATATATGACTTCTATTATGTAGAGGAATTTCCCTTCTATACCTATT
TTGTTGATTGTTTTGATTTTAAAAAATGGGTGCTGAATAGTGTCAAATTCCTTTCTGCGT
TTATTAATATGATTGTGTGGATTGTATTCTTTACCTTGTTTATGTGGATTACATTGATTG
TTTTTTTGAATATTGAACCATCTCTGCATCCCTGAAATGAATCCCACTTGGCCATAGTGA
ATTATTTTTTTATATATAATGTTGGATTCTATCGGCCAGAGTTTTGTTGAGGATTTTAGC
ATCTTTGTTCATTAATGATATTTGTCTTTAATTTTCTCTTTGCCTTTTGTTTACACTGTG
TTACAGTGGCTTCACAGAATGACTGGGAGTTTGTTGTCTTTTTCTGTGTTCTTGAATAGT
TTATGTAGTACTTTTATGAGATCTTCTCTGAATACTTTGTAGAATTCTCTTGTAAAAGCA
TCTGGTTCTGGATTTTGGGATTTTTTCTTTTTTGGTTGGTAGTTTGTTAATGACCTGCTC
TATATCTTCTTTTACTAAGGGTCTGTTGAATTTTTCAATACTGGTCTGCATTAATTTGAA
TGGATTATGTATTCCTAGGGATGTGTCCATTTCTTCTAGATTGGTGAATTCGTTTGAATA
CTGTTTTTAATAGTACTGTTTTATTTTTATTTCATACGGATCTGGTGTATGTAATCTCAT
CCTTTGAATCTCTTATTCTGTGTATTTGTATCTTTTCTCTTTTTTCTTTCTTAAGCTTGC
CAGTGGCCTATTTTTTTACTCATTAAAAAAAATAGATTCTTGGTTTTTTTCCATTGCTGT
TGGGTTTTTGTTTTCTGTATTGTTTATTTCTGCTTTGATCCCTATGATTTCTTTCCTTCT
TTTTGGAGGGTTTATGTTCTTGTTCTGGTTTTTTAAAGTAATTGTGTTAATTTGTTAATT
TTGGATTTCTCCTCTTTTCTCATGGTCTGATTGCTATAAATTGGCCTAATTACTGCTTTT
GCCTTACAGATACTTAAAATGTCCTTCCTTATTTGTGTTATTACCCAATCAATTTTTAAG
TATTATGTTTTTCAGTCTCCATGTGTTTGTCTTTATGTTTCTAATTGTTTTAGTGTTGAT
GTCTAGTTTTATAGCATCATGATCTGAGAAGATAGGTTGTATGATCTTTTTTTTTTTTAA
TGTTTGAAACATGATTTGTGGCCTAGTATGTGGTGTATTCTTTTTTTTATTTTTATTGTT
TTATTAGGGGCTCATACAACTCTTACCATAATCCATACATACATCAATTGTGTAAAGCAC
ATTTGTACATTCATTGCCCTCATCATTCCCAAAACATTTGCTCTCCACTTAAGCCCCAGC
ATCAGGTCCTCATTTTTTCCCCTCCCTCATGAGCCCTTGATAATTTATAAATTGTTATTT
TGTCATATCTTACCCTGTCCGACGTCTCCCCTCACCCTCTTTTCTGTTGTCCATCCCCCA
GGGAGCAGGTCACATGTAGATCCTTATACTCGATTCCCTCTTTCTAACCCACCCTCTCTC
TACGCTCCCTGTATCGCCACTCACACCACTGGTCCTGAAGGGATCATCCGCACTGGATTC
CCTGTGTTTCCAGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAGACTTGCAA
GGTCGAATTGGGATCAGGATAGTGGGGGGGAGGAAGCATTTAAGAACTGGAGGAAAGTTG
TATTTTTCATCGTTGCTACATTGTACCCTGACTGGCTCGTCTCCTCCCCGAGACCCCTCT
GTAAGGGCATGTCCAGTGGCCTACAAATGGGCTTTGGGTCTCCACTCCGCACTCTCCCCA
TCATTCACTATGTTAACATTTTTTGTTCTGATGATGCCTTATACCTGATCTCTTCGACAC
CTTATGATCACACAGGCTGGTGTGCTTCTTCCATGTGGGCTTTTTTGCTTCTGAGCTAGA
TAGTCGCTTGTTTACCTTCAAGCTTTTAAGACCCCAGATGCTATATCTTTTGATAGCTGG
GCACCATCAGCTTTCTAAACCACATTTGCTTATGCACCCATTTGTCTTCAGCGATCGTAT
CATGGAGGTGAGCACATATGATACGATTTTTTGTTCTTTGATTCCTGATAACTGATCCCT
TCGGCACCTCGTGATCACACAGGCTGATGTGTTCTTCCATGTGGGCTTTGTTGCTTCTGA
GCTAGATGGCCGCTTGTTTACCTTCAAGCTTTTAAGACGCCAGATGTTATATCTTTTGAT
AGCTGGGCACCATCCCGCTTTCTTCAAGTATGTGGTGTATTCTTAAGAATATCTATAGAA
AAAAAATTTATCTATCAGGTCAATTTTGTTGACTGTGTTATTGAGCTCTTTTATGTCTTT
ATTGAATTTCTTTCTTGGTGTTCTCTCTTTCCTTGAAAGTGGCATATTGAAGTCTATTGT
TATTGTTGAGGTGTGTGTGTTCCTTTTTTAAATTCTGTGAGAATTTGATGTATTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTATGTTTATTATAGTTATCTCT
TGTGGTATTGTTCCCTTGATCATTATGTATTGTCTGGTCTGTTTCTTTTTAGATTGCCTT
GAAGTCTATTTTCTTAGATATTAATATTGCTGTTCCTACCTTCTTTTGATTGCTGTTTGC
TTGGTATACTCATATCCGGTATCTGATTATTAGTCTGTTCATGTCTGTTACGGAGGTGTG
TTTCTTATAGGCAGCATATTGATGGATTTTGTTTTCTTATCTGTTCTGTTACTTTCTAGC
TCTTTACTGTGCATTTAGTTCATTAACATTTAGTGACATTTTTATATGCATTTGTTCCTA
TCACTGTGCATTTTATTTGTGCATGTATATTGCGTGTTTATGTGTGTTGTGTTTAGTTTC
TTTGTTCTTCCTATGTTCATTGCTTAGGATGTTCCTCTGTGTGTTGATTTTTGTGAGGAA
TTATGTTGTATTTTGGTTTTGGATTTTTGTGTTGGTGGTTTTTTGAGTATTTTTTGTGAA
TTTCTTTGATTTTTTTTTTGGTCTTGGAATACTTCTATTTCTCCATCATATTTAAGTGAT
ATTTTTGCTGGGTACAAGATTCTAGTTTGACAGGTTGTGTTTTGTTTTTTTCCTTAAAGA
CTCTAGAAGTCACTCTATTGCCTTCTTCCCTACATGATTTCTGTTTAGTTATTCTAATGG
CTGGCCCTTTGTATATACCGTATATACTTGAGTATAAGCCGAGTTTTTCAGCACCTTTTT
AATGCACTTTTTGTGGTAAAATTGGGTGCCTCGGCTGATACTCTGATACTCGGGTCAGCT
TATATTCGAGTATATATAGTAATTGTTCTTTTTTCTCTGGCTGCTCTTAGAAGTTTTTCC
TTGCCCTTGATGTTAGGCATCTTGATTACGATAAGCCAGGGAGTTTTCCTTTTGTAATCT
CTCCTGATTTGGGGTGTCTTCAGCTTCCTGGATAATTCTCTTTTCATCATTTAGGCATTG
AGAAAAGTTTTCTTGCAGGAGTTCTTTGACTATTCTCTGTGTGGGTTTTTTGTTTCTTTC
TCTTCCAGAATCCTTATAAGACATAGGTTGTTCTCTCTTTTGCATTTTTGTTCATTGTTC
TTTTAGATTGAAGTCTTCAACCTCATTAATTTCAGTTTCCATTTATTCAATTCTGTTTCT
CTGTTCTATAGTATTATGTAATTTTCCCATTGTAGTGTTTGACTATTGCATTTCTGTTTG
GAATTTTCTTGTAAGGCACGTAGTGAGATTTCTAGCTTCTCAATTTTCCCCCCACTTCTC
AGCTCTTTGTTCATCTGTGTATGAGTTCAGGCATCCTTTTAAGCTCTTTTTCTGATAATT
CCATGGCCTGTTAAACTTCAGGAATTTCATTTAGGCCTGCTTGGTGTTTGGCTATTTTTA
TCTGTGGTGTGTGTGTGTGTGGTGTGTACACCAATATCTTCTGTTGGTTCCTGGGCATCT
TGGTATAGCTATGTAGGAGTATTAGAAAGGTGGGTTATATGGGAGTGGTTAACTCTGTTA
GGTGGTGCAGTGATGGGTCGTAGAGGCTTTTTAGTAAGTATTTTGGGGGAGAATTTTAGA
TTAAATGTTAGAGGGGGAGATCAAAGAATGTAAGCGGAAGTGTTAGCCACGGGAGAAACA
AAGGAAAAAGGAAATTAAGAAGGGAAGGATCATGTGATGTTAATTGGTAGGTTAAAGAAA
GGAACGTAGACCAGAAAGAAAAAAAAATGCCTTCATTTGAAATGACAAAGGAGTGGATAA
TAATATTTCAGGGAAAAAATAATTGCTCTGGTTTTATGAGGAAAGAGAAGGGTTGATGAG
AGGCAAAGAAAGAAAAAGGTAGACAAAAAGGGCTATGAAGTAAAAGTTTAGATAATAAAA
TTAAAGGAGGAAAGGTCAAGAGACAAAAGTATTAAAAATAAAAGTGGAAAAAAATAATAC
CAGGGTAAGAAGTGGAAGAGCTGTTAATGTATGTTTGTTAAGTCTCTAAGCTTTGCCCAG
GAGCTTTGTCTCTGACGTCAATTGATGATGTGTTGAGGAACTAGAAAACAAACTCAGTAA
ACTAATAGTAAAATAATAATTTTCCCCCCTTCCTTAGACCAAAGGATAGGGAAGTCCTAA
CTAAGGATGAATTGTAAGAATAGTGCATGACTTTGTTTTAAAGAGGTAGAGGGTATAGGA
ATGATAGAACACACAGAAATAACAGTACCAACAAAAGAATAGTTGGGGTACCTTGTTCTG
GGGGTAAATCAGGACTGTGTGGAGCAGACATCTTTTGAGCAGTTGACGACAGTGTCTGGT
AGTATGTTGTTTCACTACCTTATGGTCCTTAGGGTGTTAGAATATGGTTGAGATTAAGGT
TGGGATGATTTTGGTGTCTTGTAAGGCTGAGAGTTCTGCATTCTCGTGAGTTAGGTAATG
GACCTGTGGAGGATCAGGTTAGAGGAGATGAGGTTTGCTCCTTTCAGATGATAGAAGTGA
CCGAGTGTGTGCGGAGGAGTGGGGTCTAAAACTGCCACCTACCTAGGTGGTCTAGGAGTA
ATGAAGCAATAGCTTACTCAGCAGTTTGCTTATCCAAGTGGCTTGAAGTACTGATCAGGG
GCTGGTGTCGTGGGACAACTGGCAGATTGCTCAGCCTATCCAGTACCTCAGCCGGAGTGG
CCTTTAGACCCTGGGGCTTATGGTGTTTTTCTCACATACAAACTCCCCGCTTCTGTTTCG
TAAAACTGCTGGTACAGTATACCTTGCTAGTAGGTCATGTGTGTGTTGTCTGCTAATAAG
GGGGTAGGGGAGCCTACAAAGGGCTGTGATTTTGGGGTGCCTTAAGACAGGGTTGTGCAG
AGCTGAACCTCAGGAGTGGGGTATTAATTTTCCCGAGTGGGGCTGGAGCTCCCTCTGTAT
GGAGAGTTAACTTAGTCACTATTTACGCCTGCTCCACGCTGGCCTGTAGAGTTATCCTCA
CGAGGCTTGGTAGGCTGTGTTAAGATAAGGCTGTGAGGGGATCAGAACCAAACTCCCTTG
GCTTGGGCTAAGAGCCAAAGCCTATCTGTGCTTATATTCTGCCAGGCTGGTGTCACAGAG
CTATGTCCCTGCAACTTTATCAGCCACCCTAGGCAGCTCCTGGACCAGGAAAAATTGATC
AGGAGAGTTGGGAATCTGCACTCTACTGGCTTGTGCTGGGGGGAAATGACAAAAGGAAAT
CTTATTAGCAGATGTTGCTGCACTTTTGGTTTAATAAATTTGTGTTTACTTATGTGTATA
TTGAGAATTTCATTCTCTAGAAGTGTGGGATATCCCTCTCCATGGCCCCTATGTGCTTGT
CTATATAGAGTTCCTGCCATGTGTGCTACTTGGTTGCCATCTTTCTTCTTTCCTCTATAC
TATAGTATAGAGACTATAGTGTAGTTTTGATATCACGATACTAGGATACCAACTACATAG
AATTATTGGAAAAAAATAGCAGTAATTGTATTTTATTTATTTTCCACTTTTGTAAATTTT
ACTCACAGTTTAACATGTTATTCTTTAGTAACACACACACATACACAATTAGTCTACTGT
GTACTAAGGCAGGGTTATTTCTAATTTTCACACAGACATTTAGCAGTTGAGGAAACTCTT
TAGATAGATTAATAGGCAGATTAATAAGCTCACATAAGACTACAATACTATAGGTTTGTT
GACTTAAAAACTCAATCCCCAGTACTTGTATTTTAAAAGGATTTATATTTGAACTTTATT
AAAACTAGTATTTAAATATAATAAAGTTTGTATACACAATATGATTTGTTTTTCACATTT
CTGTATTTATATAATTTAAAGAAACTTTAGCTCTTATTTTAAAAAGCCTTTTGCTACAGT
GTTTCAATTTTACATTATTTAATTTGTAAATTACTGCTGTGTGATTACTTACGTGCTTCC
AGTAGTACAAAAGCACAAAAGTGATCCTAGTGTTAGAGGGCAAAAGTGTTTAGCTGTAAT
GGGCATTTGAAAAATACTAATGACTTATTAATGCATCCTACAATTCAATATATAACTTGT
ATTTGTTAAATTTTTCAGTACAGATCAAGGTATCTGCATAAAATGAGATATTTTTATATT
TTAGAATTGAACTGACCCTGATTTGTCCAGTGTATGAATACACATACATACTTGCCTACA
TAATAATGATTTGACATAACTGTAAGCTGTTAAATTGTCGCCATAGTAGATTATTTACAT
TAGTGTTCTCAATGAAACGATATCTAATTTATGTATATATTTTATTTTAGCGAAGAGTAG
CCAGAATTCAACAAATAGAGAAGGATATACTTCGTATACGACAGCTTTTGCAATCCCAAG
CAACAGAAGCAGAGGTAGTAAATTGTATTGTTTATAAGTATAAATATTTCCTAAGGGGAA
AAAAAAAATTTCCTAAGAAAGGTGACATACTCAATATAATACATCGCAATTATTAGCTGT
TCGTCTAAGATCGGGATACTTTATAAAATGTATCTAAAAATTTGACTTGAAAAATCATTT
ATTAGGAGTCATACAATCCATCTCACAATCCATCCATACATCCACTGTGTCAAGCACATT
TGTACACCATCATTTTTAAAACATTTTCTTTCTGCTTGAGCCCTTGGTATCAGCTCATTT
CCCACCTCACCCACCCCTACCTACCCCCTTACGAACCATTGATTTTTTTTTTTTTTTTCA
TGTCTTAAACTGACCGCTGTCTCCCTTCACCCACTTTTCTTTTTATACGTAGATCATTGT
GGTCTCTTCCCTCTTCTTCCCCTCCACTTTCACCTTAACCTCCTGGTGTCACTATTCTCA
TTATTGGTCCTGAGAGGTTTATCTGTCCTGGATTCCCTATGTTTCCAGCTCTGTGCCAGT
GTACATGTTTTGGTCTAGCTGAATTTGTAAGGTAGAATTGGGGTGATGATAGTGGGAGTT
CGGGGGAGGGGGCAGGGAGAAGCATTAAAGAACTAGAGGAAACTTGATGTTTCATCGGTG
CTATACTGCACCCTGATAGACTCATCTCTTCCTTGTGACTTTTCTGTAAGGGGATGTCCA
ATTGAACCCAGCTATTTTTGTGTTACCATAAATTCAGACATCTTATGTTAGCCTTTTCAA
GTCCTGAAACAGCTGAGTTTACATGATGGAACCCCAGAAAGCCCCAGAAGTAGCTATATT
TGGTACTTCTGGGAGTGAGAATAAAAAAGGTTTAAAAGAAGGAACATGATTAAGTCTATG
TTAAGCAGATGGTTCCTTCAGAAATTTTCCACAGCTTTTGTAAGGATTGTCTCCCTTACA
AAAGATGAGAGGTTTATTTTTTAAAGAAAGACTGTAACTAAGGTTCTTTCAATAGAAATA
CCAAATTATTCCAACATTTGTATAAATTCAACTCAACACAGTCCCAGGACTGAAACTCAT
TTGTAATCTGAGTATTGCCTATACTGTTAAGAATGTATGTAGTACCCCTACTATCATGAC
CTTAGTCCTGCCTTTCACTTCGGGCTAGACCAGAACATGTTCACAAGAACAGATAAGACA
TAACAGCTCACAATACATGGAATCCAGGAACAGGAATGGGAGTAGTGATACCTGGAGGTT
AGGGAGAATGTGGGGAGGAAGGATGAACCAATCGCAATGATTAACACATAACACAGACAC
TCACTCACACACACCCGGGGGACAAACAACAGGAAATGTGGCAAAAGGGAGCCAGCTGTT
TGTTTAAGATATGAAAATAATAATTTATAATTATCAAGGGGTTGGATGGGGGTAGAAAGG
GAGGAGGGGGAAAAAAGGTGACATCAAGGGCTCAAACCTAAAGTAAATGTTTCTGGGGCG
GGGACACAGGAGAAGGGGAAGTGAGGGAAAGAAAGTGGGTGTTAACAAACCATGGGACAA
GGGAACAACAAGTGATCTAAAAGCGGTGGCGAGGAGAGTATAGGATGTCTGGTGGGGCTT
GATCGAGGGCAGTGTAACCAAGAGAAATTAGTAAAACCTGAATGAAGGCCAAACATGATA
GTGGGACAAGAGGAAAGAAGGAAAGAAAAGAAGTAGGAGGCACAGGGCACACTTATAGAG
GTCTAAATATAGGCATGTACATATATAAATGTATTTACATATAACAATAGGGAAATAGAT
CTATGTACACATATTTATAGGTTTATTATTAGGAAAGCAGATGGGAAAAAAAAAAAAAAA
AGATAGCAGACAGACATTGGCCTCTACTCAAGTACACCCTCAATCCCTCAATGCAAAAAC
ACTTTGTTTTCTAATAACCTGGCATTCCATGATGCTCACCATCCCAATACAATCACTGAA
GACAAAATGTGTGCATAAGCAAATGTGGTGAAGAAAACTGATGGTGCCCAGTTATCAAAA
GATATAGCGTCTGGGGTCTTAAAGGCTTGAAGATAAACAAGTGGCCAGCTAGCTGAGAAG
CAACAAAGCCCACATGGAAGAACCACACCAGCCTGTGTGATAATGAGGTGTCAGTGGGAT
CAGGTATCAGGCATCAAAGACCCAGAACAAAAAATCTTATTATTGTGAATGAGGGGGGAG
TGTGGAGTGGAGACCCAAAGCCCATCTGTAGACAATTGGACATCCCCTTACAGAAAGGTC
ACAAGGAAGAGACGAGTCAGACAAATAGTATAGCACGGATGAAACATTCAACTTTCCTCT
AGTTCCTTAATGCTTACCCCCACACCCCACTCTCATGACCCCAATTCTACCTTACAAATC
TGGCTAGACCAGAGCATCTGTATATATAGAGGTATAGATAAGAGCTGGAAAAACAGGGAA
TCCAGGACAGATAAACCCCTCAGGACCCATATTGAGAGTAGCAATACCAGGAGGGGAAGG
GGAAAGTGGAGGGAGAAAGGGGGAACCGATCACAATTATCTACATATAACCCCCTCCCAG
GGGGACAGACAACAGAAAGGTGGGTGAAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAAAAATGAGCCTGATACCAAGGGCTCAGGTAGAAAGAAAATGTTTTGAG
AATGATGATGGCTACAAATGTACTTGACACAATGGATGTACGTATGGATTGTGATAGGAG
TTATATGAGCTCCCCAATAAAGTGATTAAAAAAAGAAAAAAGAATGATGGCAACATATGT
ACAAATATGCTTGATACAATTGATAAATGGATTGTTATAAGAGCTGTAAGAGCCCCCAAT
GAAATGATCTTTTAATAAAAAATAATAGTAATGTACAGTTAAAATGTATCTAACAATATA
GAGTTGAAAATTAAGAGAGCAGATAGAAAGAATGTATCAGCATTCATTTACTTAATAAAG
TTATTAAAAGCATGGTGAATCATTTATTGATATTAAAAATGTTTTTGCTGTATTAAAGGG
AGTACTTTGACTTCATTTTATAAAAATACACACAAAACATAGTCACATGTATCATGACTT
TATTTCTCATGTTGATGAATAATATTCCGTGATACGGGTAGGACATTTTGTTTACTCATT
CCTTGATGAGTATTTGAGTTGTCTACAGTTCTTGGTTATTATAAAATATACTGAAGTTAG
TATTCACATACTTCTATACTATACTAATCGAGGTATCTTCTTTATCCCCTGCTTTGAATT
TATGGAGGTATATTTCCAAGAAGAGAATTGAACTTATTTTATGTTTAAATTGTTTCCCAC
AGCATCTGCCCTTGCATGTGTACCATTTTACCTGGAAAAAATTAATGGAAAGAGTTGGAA
TGCCTCCCCATCCTCTCTAGGACATGTTGTTTTCTGTCTTTTTTATAATGACCATCCTGG
AAGGGTGAATGGTATCTAATTGTGGTTTTGATTTTCATTTCCTAAATGACGAATAATAGT
CTAGTCACTCTTAACATACTGGTATCTGCTGATACCTGATACCTAATCAAATAGTTTCAC
AAATTCGTCGATGCTTTCAATGTTATTGTTAGGGGCCATCGAGTCGGTACCAACCCATAG
TGATCCTGTGCACCCCAGAACAAAACATTGCCCCGTCCTGTGCCGTCCTCACAGTTGTTC
CTATGCTTGAGCCCAGTGTTCCCGTGGGGTCAGTCCATCTCTTGAGGGCCTTCCTCATTT
TCCCTGCCCTCTACTTGACAACCTTGAAGTACTTCTTCAGGTGCTAGTGTCTCCTAATAA
CATGTCCGAAGTATATAAGACCAAGGCTTGCCATCCTTGCTTCTAAGGAGCACTCTGGCT
ATACATTTTCCAAGACGGATCAGCGTGTCCTTTTTTCAGTGCATTATACTTTCAAGATTC
TTCTCTAGTGCCACAATTCAAATGCATTCATTCTTTCGTCTTTATTCAATGTCCAACTTT
CATATGATGTTGAGGCAGTTGAAGAGATAATGACTTAGGTCAGGTGCACCTTAATCCTCA
AAGTAATATCCATGCTTTTCAATACTCTAAAGAGGTCCTGGGCAGAAGATTTACCTAATA
CAACTCATGCTTTTATTAATTAATACTATTAATTAAACGGGCATTTTCAACCGTTATCTT
GATATTTTTCACATTATTAACCACTTTGCTTGAAACACTCTCTTTTTGGCATCTACAACA
TAGCACTTCTTGATTTCATTCTGCCTCTCTCATCTTGATTTATCTGAACATTAATTATAG
GTATTCTTTTAAGGCTGCTCATGAGCCCCAGTAGCATAGTGGGTTTCACATTGGGTTGCT
CAGAAGTTGAGAGTTCAGACCCACCAGCCAATCTGAGGTGGAAAGAGTAGGCAGTCTGCT
TCTGTAGAAGATTGATAACCTGAGAAATCCTAGGGAGCAGTTCTACTCTGTCCTATGGGG
TCACAATGAGTTGTAACCAGTTCATTGCCAGTTAGGACTTATTTCTCAGTTCCTTAGATT
CTTTCTCCCTGGGACAATCTCATTTATGCTTACGGCTTCAGTCACCAACTATGTGCTCTT
ACTTTCTAACACTGAGTTCCAGAGCCCTAAATCTAGAGTGCCTACTCTACAACTCCACAC
ATGTCTCAAGGCACTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCA
CACACAGTTCCATGTAATCGGTTCTTTCTACCCTATTTTCATAACACTTGTCAAAGTTTT
TTTTTCTCTTATTGTTTAAGAATGTCCCTGGCTAGATTTTATGGCCCAAAGAAGCGTACA
ACAGTCTGCCTGGCTAGCACTATACCCTCAGCACCTGTCACAAGTAACTAACACAGCAGA
TGCTCATTTTTTTTATCATATACATTGATAATTTCAATTATGTTAGTATCAAATCTTTGT
GGGTTTAGTAATCTTTATTTTATCTCTAGGTTTACATTGTCCGTTTCTACTCTTATTTTG
TTGTTTCATAATGTAATTTCCAGATAGCACTTTTTTTTTTTTACTAATTATTGCGGAACT
ACTTTTGCCTACCTGCAACTCATACCAATTTATGGATGCAAATATTAAAATGTAAATTTG
TTAATTATATTTTAAGTGATCCAGAAAAGCTTACTCTTTAAAAAATTTCCTTTGGGGATC
ATTTTATATGCAAAAGGATATCCAAAAAGAATTAAAACAAACATTCTGTATATAGCCATC
ATTTGTTATATGGAATGAAAATGGCAATGTATCCAGGAAAAATGGTCATTTCAGTATTTT
TGTAAAAATTCTACTGCAAAGTCAAAGAATAAAATAAATATCTACCATCTTTTATAGAAA
CAATTTCAAATACATTTCCTCTTGGAAAATTATATTCTTTCCCCACAAACTTTTTGAAGC
CCTTTATAATGCAATTATCCAGTCTTATGTCAGGCTTTCCAAGTATCATTTTTATTTATC
ATTTTAGTTTTTACATGGGTTTTTTGTAGATGTTTATATATTCTATGCATAAATATGCCT
AGCCAGAGATATTTGTAAGCACAGTTACTTGTTCTCTTTGGATTATATTTCTGAGAGTGA
TAGGAGCACAGCTGCTGGAAGATGGTGTTTATGTGAGTCTTAGGAAGTCCTTTGTCTTAC
ACAACTATAATACTCAAGGGACCCACTTCACTTTTCTCCAGTGTTGAGATGTTTGACGGT
TAAACAGTGTTGAAGGTTATGAAGTATAAAGTGCAGCTCCATGCCTTTGTGAATCTGTAT
GATTAATGCATTCCATTATTTAAAGCAAAAAGCTGTGATTTAATCAAAGCATATACCATT
TTACATGTAATAATGCTAACTCCATATTAACAGAGGTCATCTCAAAACAAACATGACGCA
GGCTCTCATGAAGCTGAGCGGCAGAATGAAGGTCAAGGAGTGGCAGAAATCAGCATGGCA
ACATCTGGTAGTGGTCAGGTAAATGTATTATTTTGTTTTTTAATTAAGCATTCTAAATAC
ACCTGGAGTCAAGAGCATTTCAGAAGAATCTGTAAAGCTTAAGTGTTTCTTTAATCCTGA
ATGGTGTAGCTAGAAGCATTCTGTACCAAAAATTATTACATTCCTTTATTATATCTAACA
ATAATGCTTTCAATTTTTCTAAGTATTTTTAATCTCTAAATTTTGTATTTGTTTTAGTAA
AAAATGAGTGGTTTTGAGTAGAGTGTTTTAAATAATATATGTGATTTGTCCTAGGTATTA
TTGCTTGCATCAAATAGAGTTGCTTTATCCCTAAGGCATTCTATGTAAAGAAATTTTTAA
AGTTATAATCATTACGACTTACATAGTGTTCGTCTCCGTTCTACTTCAAGATTGCATAAG
TCTAGACATGTAACTCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTATTTCTGT
GTCTATGGTTTATGGATTTATTTGGGAAAGTCTTGCATTCCCACAGAGATGTAGAAAGAA
AAACGTTAAATCTTCTTGACAGAAAAATATTTGCTATGGTTAGACCTATTCTTAGTGCTT
TGGGTATATTTTAAGTATTACGTATATACTTTGAAAGCCATATCTGTTCATGTATTTTTT
TTAAATAGAAGAAAATATGAGTAGAGTTTTTATAATCGTGAGATGGGTGGCACTACAGTC
AAATTTCATTTTTTTAAAAGGTAATTTGTAAATAAAATTGGGAAACCTCAGAATGCTAGA
AAATTATAACAAAGGTACAAGACAACCAAAACCCAAATTCATAGTTGCAAACATCTATGA
CCAAAATAAAGAAAAGGAAAGTTAAAATATATATGTCGAGGAGTACCATTGAGTTGATTT
AATCTCAGAGCCAACCCCATGTAACAGGGTAGAACTGACCCTTAGAGTTTTCTAAGCTGG
GATTTTATGGGAGCAGATGGTGGAGGCTTTGTCCCACTGAGCCACCAAATGACTTCCAAT
CAGCAGCCTTTTAGTTTCTAGGCAAGCACCTTACTATTGTACCACCAGGCTCCTTCAAAA
TACATGCACATTTGTAGAAATCATTTATTAAATTGGACAAAGAGCATGAGCAGGAAGTAA
AAAGGAGAAATAAAAATCACTTTAGAAACACATGAGAAGATCAGTTTTACTAATAGTAAC
ATAAATATAATTTACAACAGAAATGAGACTTTGGAAGGCATGGGTGGTATAAAAGTCAGT
GTGTTCAGTTGCTAAATGAAAGGTTGGAGTTTTGAATTCACTGAGCAGTGCCGTAGAAGA
AAGGTCTGGTGATCTACTTCTGAAAAAGCCAGCCATTAGAAAACCATTCTCCGACATTGT
GGGGTCAGCATGAATCAGAGGCAGCAGACAGCAACTCTTGCTTGCTTTTTATTTTGCTGA
AATTGGTAAATATCAATAACTCTCAGGACCATCAATATATAAAGAAATAATCATTCTCAT
ATGCTACTTTTAATTGTGTAAATGCGAACAAGCTTCTGGAGAGCAGAATTACAATGTGTA
GCTGATGTATATATAATATACCACCTGCCTTATGGCTTATCATGACCACATCTAAGATAT
TTCATTAATCAAGTAATGGGAAAGAGCGTCCAGACATCTTTGAGAAGATTCAGCATGACA
TTATTTATAATAACAAAAAATTAGAAATCATTTACATATGCATCAGTCAGATAAGTAATT
GGTTAAATTACAGTCAACTGAAGTTAAATGCGTAAGCGTTCAGGCTCTAGAGTCTGCAGT
TTAGAGCGTCATGTTGCTAGTATGGAGCCAAGCATATAAGCCACCAATACAGGGAACTGA
CAGTACAGGACTTAATGGATTCTGAAGAACAAAGAAATGTTGAGGAAAGAATGAGGAGGA
AGAAGGGGACAAGTAAAATTTTACAGTGAAAGGATTACTTTAGTTTGTTTTTTTTTCTAA
GCTGAATCAGCTAAATTTTTGTGATTTTTGTATTTCTATGTATGTGTGTAATTAAATATA
TATGCACATTTATATTTAATGTTTCCAGCTCCCAAAGATAGAGATTCATAAAGATACTGT
TATCAAAAGCAATAATGAAAACTAAATTTTAAAAAAAAGATCAACTTATTTCAAAACCCA
TTTATGGAGTCATCAGAACAGAACTCCATCATAAATAGGGACTCAAGGTATAGAATAAGT
GTTTAATAAGTGCTTACTGAATATTAGTTCATCTTATTAATGTAGAAAATATCACATTTC
TTAATTTTAAAAAATGCTAGTGACAGACAAATATATAACCATACATTTCTATATATGTGT
ATATGCATAGAGAAATGTCTAGAAGAATGTCTTTCTAAATATTACCAGTAAGTTATCTCT
CAAGGTTGAGATCAGTGGTTTTTACTTCCTTATTTACACTTTTAAGTATTATTTTTAAAG
GCCATTTAATTGACCTATGATTCATGTGCCATATAGTTCAGTGGTTTATTAAGCCATCTC
ACAATCAATTTTAGAATATGATCTTCATTCTTGTTTCCGTTATTAGCTCACCATTACCTC
CGGTCTTCTTGCCATCGCCCTAAGGAACTAATAATATAGTTATTGTCTTTGTAGGTTTAC
CTATTCTAGATTTCACATAAAATCATACCAAAAAATCTTAACAGAAAACCTCAATCTAAG
GGAAAGCAGAAGATAATAGAAACTAGTCGATTTGAAATGAATCAAAAATGAAAACAAATA
ACAGTATTTTAAATTTTAACCTATGTCTACAGTAATGTACTTTCCAGTGCACTCTCTCTG
AGGCAAGACTGTTCACGTCCCTTCTCATTGGTCTGATGGGATTCAATGGTGGCTTATTCT
GCATGGGGCCTTTGCAATGGGAATTTGGGTTTTCACTGTCATCCATAGCCTTTGCAAGCC
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCACGG
AGTCGCCTGAGACCATCGGAAAACACAGATTTCCGATGGTTTTAGGAACCTAGACACCGC
TCCTCCATCCATCTCCAGGCGGGTCTGCCCACATGCAGATATGCCCACATACAAGTACCC
GGTGTGAAGACTGTTACCCATGCTACACCACACATCAAGACAAAATTTCATTTATTTGTC
ATTAGAAATATTTCACAATATATAATTACATATTATTTTGTGATTATGCTTTAATGATGT
TCAATTTGTAACAATGAAAATACATCCTGCATATCAGATATTTACAAGATGATTCATAAC
AGTAGCAAAATTACAGTTATGAAGTAGCAATGAAAATAATTTTATAGTTTGTCCCCACAG
CGTGAGGAACTGTAGTATAGAGTTGTGGCATTAGGAAGGTTGAGAACCTCTGCTTTAAAC
TATTTTAATACATGCCTGTACAAAGGAAAACTTTGTGGAGTTTATTTGTCTTAGCTTTGT
TTTGCTATTTGCTTCAGGATTTTTTAAAAAAAATAGCATTGATACTAATTAAAAATGAAA
CTTAATCTCTGACTTTCTCATAGTTACTGTACTGTGCTCAGCCAAGCTCCTGTCCTGGTG
TACTTAATTTATCTCCAGTGCCTCGTGGGAATTCCTTCCATCACTCCTCTCTCACCTAAT
TTTTTATAACAGACTCCCAGCAACTCTGCCCATATTTACTGTGCTTTCATGCCTCTCAAC
CAGAATGCTTGTTACAAAGACTCAATCACTCTCTTTGTAAAACTCTATTGACATCATTCT
ATTCTGAGAGTAAGTATAAACCCTTTATTATGGTCTGTATACAGTGAACCCTCGTTTATC
GCGGATAATCGGTTCTAGACCCTACCGTGATAAATGAAATTCCGCGAAGTAGGATTCCTT
ATTTGTAAATCAAATATTTTAGTAGTTAGAGCATAGAGGACATGAAAAAACACCCTTTAG
TCACCATTACACTCGTATTACCCAATTTATTAAACAAAAATGGGAAAATACAGTAAAACA
TTTTGGACGTTACAATTATCATTTATTATTTATTATATTATTTATGGCATCTAGTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATACTCGAGTATATGCGGTAATC
TCTATTGAAGGAGTGCACTCAGTAATGCTCCTTAGAAGTGAGGATGGTAAGACTTCATCT
CCATTAATTTGGACATGTTATTAGAAAACACTAATATAAAAAAAAAAAAGGAAGAAAGAA
AGACAACACTAATATCTGGGAAAATGTAATCACGTGTGGTGAATAGAGAGAGAAGAAGAC
CCTCAATGAGATGACTGGCACAGTGGCTACAACATTGGGCTCACACATAACGATTATGAG
GGTAGAACACATGTTTCGAGTCACTAGGAGTCAAAACCACTCAGTGGCACCTAACAACAA
TAGCAGATAGTTTCTTCCAGTTTCCCTTAAGGATTTGTAGTTTCAGTTTAAGTGGTCCTT
AGCATATCACAATATAATTTTTCCTCGTGTCTTGCTCCAATAGAAATTTCTTTCCAGTAG
CCCTCTTTATCTTTTGCAGACTTGGGCTTTGCCAAAATCACTCTTATTTTCTGGGGTCTT
AGGACATTTCAAAATGTGGGCATTCTTTCATTGCTTTTCATTGTTCAATTTGCATTTAAT
ACAATGTGGATTCATAACATTGGCTCTGAGAAAAACTACTTGTTGGATTTCTTCACTCTT
AGATTATTTCACACTCCGAGGGTAATGGTGTTTTGCAAGAAATGTCCTTTTCTCAAAAAT
CTTCTCTAAGTTTTCAGGTTAAAGTAATCGCTTTAAACTGATTATGGTGATGATTGCCCA
ACTCTTCTTGATGTTACTGAACTATTGGATTGTATGGTATGGGAATTAATGCTAATCAAA
CTAAATGAATAAATAAATAATCATTTGAACTGTTAATAATGTATGCTCCTAATGGTATGT
AAGTTTTACTCAAAAGATAGCATGTTTGGAATAACAACGTGAAGGTGTGTATAGGTGATC
TATTTGTTTCATTTCTAGGGTTCAGCTACCCGGACGGACCATGAAACAGCCAGTGTGCTG
AGTGCTAGCAGCACACACTCTGCTCCCCGAAGGCTGACAAGTCACCTGGGAACCAAGGTA
GCGGGAGATTACAAATCTAGATGGCTAATATTCCACTTCACTCAAACATTGTTCATACTC
ATTTTTAATGCAACTGGAAAAGAATTCTGATATCATCACCACTCTCTGCTAAAGAAATTA
TAGCTTTGTACTAATACATATAAAATTTTATAATATAGATAAAAATGAAGAGGTAAAATT
GCCAAATTAGCTAATTTTTTAACCTTTTCTAGTCTTATTATCCGTTTCTCTACAAGCGTG
TTACCAAAAAAAAACCCTCAAAACTCACTGCCATTGAGTAGATGCCACCTCATAGTGACC
CCGTAGGGAAAGTAGAACTACCTTGTGAGTTTTTAAGACTGGGGCTCTTTACAGGACTAG
AAAGCCTGTCTTTCTCCAGAGGAGAGACTAGTGTTTTGAACTGGAGAGTTTGTATATCAC
AGCCCAAAGCCTAACCACTCCGCCACCAGCACTCTCTACAAGTATCTTAAGCTCCAGCTA
AAGTGGCTTACTCAGCAGTGTACACTCCCATAGTTTTCTGCCCCTGTGCCTTGCTTTGGT
GGCACATACCTCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTAATATTATATGAAGAGGCATCAAAAAG
CTTGTGAGAAAATTCTATTATATGTTCATTTTATTTTCTGAAGACTTTTTGAAGTCCCCT
CATATTAACTAAGATAAAATTCTACTAATGTATTTTCATTTAAATCTAGGTGATTCTGTT
GTTTTCATAGTGTACTCTAAATAGCCTTTATTTTATGTAATAGCCTAAGTGAAAGTAGTA
CTGAAATAACTAATGTTAATTTAAGAAATGTTTTAGAGTACTCAGTCATATTGTCAGTAT
GAAACTTGATCCTGTCAATAATGCCCAGTAACTTCTACAAGGGAACTTTTGCATGCTAGG
CTCTGGGCTGGGAATTTTATGTACATTATCTCTGATCTTCTCAAAAACACTCTGAAGTAT
TCTTATCTTTTTTTCAATGAGAACACCAAAAGCAAGAAAGGTTCAGACAGCTATGCTATA
ACTAAACCAGAATTCAGCCCCAGATTTATCCAACATCAATACGTTTTTACTATAGAGAAT
ACTTACTAGCAGTACAGTTGTAGGAAACTAGCAACTAGAATCTGCTTGTGACGTGATTGG
AACCGTGGTGGCACAGTGGCTAAGCTCTTGGCTACTAAGTAGAGCTCAGCGGGAAGAACT
CATCAGCCATTCCACAGGACCAAGTTGGTGCAGTCTGCCTCTACCCCATGTACATGAGTA
CAGTCTTGGTAACCTATACACAGTTGGTCCTGTAGAGTCACTGTGAGGTGGGATGGACCC
AATGGCAGCAGATTTGGTTTTTGGTTTGGTTTGAAGAAATTTTGCATGTACTGCCTTATC
CATTGCTGTTATTTAATCTCCACAGAAAGAAGCTAATTATTTAGATCCGTGGTTCTCAAA
CTTCCTAATGCTGGGACCCTTTATTACTGTTAGTTACTCATGTTGTGGTGACCCCCAACC
ATAAAATTATTTCACTGCTACTTCATAACTGTAATTTTGCTACTATATTGAGTCAGGTGA
CCCCTGTGAAAGTGTCGTTGGATCCCCAAAGGGGTCACAACCCACAGGTTGAGAACCGCT
GATTTAGATAATTCCTCTATTTTATAACAAATAAATTGAGGCCCAGAGAAATCAGATAAT
TTGCAAAGACCTAATTTGTAAGTGATGAACTTTGAATCCAGGGCTGGTGAAAGTCCATTT
TTACACAGTGCTATACTCCCTTCCTCATACTTTCTTATCTGCAAGTATGTTTATGTTAAC
ACATTCAGAGCAGTTTCTCCACCTCAGCACTGTTGGCTGTTCTGGGTGTTGTAGAATGTT
TAGCAGCATTCGTTGCCTTTACCAACTGTATGCAAGTAGCACCCCTTACCTCTCAGTTGT
GACAACCCCAAATGTCTCCAGATGCTATCAGATGTATTGTAGGGGTCAAAATCACCCCCA
ATAGAGAACCACTGATTTGTAGAGATAATAATCTATACTCAAACCTTGAAAGGAGGCTTA
TCAGAATCCACAGTAGTTACCCTTTTCCCCCGAAAGTAAGACATCCCCCCAAAATAAGAC
CTACTTACAGTTTTGCCTCTCGCTGAAATATAAGGCACCCCCCGAAAATAAGGCCCCCCC
GAAGCTACTGTAACTCTGGATCATAGCTGCGAGTGCCGCAGCACAGCCGGAGCAGACAGG
AAGTGCGAGGTCTCTTTTAATAGAACAATAAGCTTGTACCGTATTCTTCTTCATGGAAAA
ATAGGACATCCCCTGAAAATAAGACCTACTGCATCTTTGGGAGCAAAAATGAATATTTAA
GATTCTGTCTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAATCCACTTCACCCACAAAT
GCTCCTGCTGAGAACTAGTACTTAATAAATAGAAATTGTTGCAGAAGTGTTTTCTGTTTA
TTATAATTACAGTTTTAAAAAGTAAAAAATGGTAAACTGTCTAAAGTACTTAGATAATGC
ATTTTCCTCACTGTGTGAAATCCGTTTACATACTAGTCAGTTATTATAATCAACAATGAT
CACCAACAAACCCACACAAATAGTATACCGGTATATATTGAAGTATACCAGCACCTACTA
ACTCTTTCTGTATACTATGTCTATACTATTTACTCATAAAAACAAATGTCTATTATCTGG
ATTTTGAAATAACACTCATTACTTCATCTTGGAAAGGTGGGGCGGGGGGTTGTTTTTTGT
TTTAAATTACAGTAGTAATTATCCCATTCATCACTTCATTGCTTGTGGCTTTTGGATATT
AAAGTCATAATTTTGTTTCTGAACTCATTTGGCCCACAGGTGGAAATGGTGTATTCATTG
TTGTCAATGCTTGGTACTCATGATAAGGATGATATGTCACGAACTTTGCTAGCTATGTCT
AGCTCCCAAGACAGCTGTATATCCATGCGACAGTCTGGATGTCTTCCTCTGCTCATCCAG
CTTTTACATGGCAATGACAAAGACTCTGTATTGTTGGGAAATTCCCGGGGCAGTAAAGAG
GCTCGGGCCAGGGCCAGTGCAGCACTCCACAACATCATTCACTCACAGCCTGATGACAAG
AGAGGCAGGCGTGAAATCCGAGTCCTTCATCTTTTGGAACAGATACGAGCTTACTGTGAA
ACCTGTTGGGAGTGGCAAGAAGCCCATGAACAAGGCATGGACCAGGACAAAAATCCAAGT
ACGTTTGTTTATAGTCTTACAACATAGTACATGTTACACCACAATATCAAATCTTTAGAA
AAGAAAACTTAGGTTAGTATGTTGTCTTCATAAGTGGAGGGGGAAATTCTTATTGTTTAG
CTCTACTGCCATTGGAGTCAGTAAATTTAGCCATAAAGCTACAGCTAAATTTCCCTAGAA
AAACTTAGTTATGGAAAATGTTATATGCCTATCTAAGCAACCAGAAAGAAGTAAAGATAC
AGAGTGACATCTAGAACCAGAGCATAACAAAACTAGAAATAATTTGAACAATTCTGTGAC
CTACCCATAATAGCTGATAGGTTGTGGTGAACCAGATCATGAAATTTTTACCCTTTTATA
TCCGCGCGTTAGTGGACACACAGCTCATGTTAGGGGCGGGGTGTATTATTTGAATCCCAA
CAGCTTACTCTCGCCCCTCTCGGGGGGGAAAGGTGCGAGCAATATACAAGGTAACAAACT
AGGATAAAACTCAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAA
AGGCTACCAGCTAAATTTTCCCCTAGAAATACATTAAGTATAGAAAAATGTTTATATGCC
TATCTAAGCAATCCCAAAAAGAAGGTAAAGGATACCAGAGTGACATCTAGAACCAGAGCA
TAACCAAAACTAGAAAATAATTTGAACAATTTCTGTAACCTACCCATAATAGCTGATATA
TTATAGTGACCAGATCATAACTTTTTACACATATATATCTCTCTTAGTGGACACACAGCT
ATGTTATGTCTGGTGTATTATTGAATACAACAGTTATTTATATAGATAGGGAGGAAAGGT
CCTAGCATTTCCATGTTAACAGTTGGTGAAACTGAAGTTTAGAGAGGCTAAATAGTTTGT
TCATGGCTTCACAGCTAGTTAGTGGAGGGGCCTAGAACAGAGGCCAGATCTTTACTCTCA
GTGTGGTGCTCTTCCTACTGCACCAACCTGCACCAGGTGATGGGCCCCACCTACTGGGTA
TAATCAGTCACCCAGCCCTTTGCTTAGGGAAAAACCCTTGCCCACCAGCCCCTCTCCCTC
AGGAGCAGGGAACAGGAGAACTGAGATCCCTGGAAACATAACTTACTTCATTCCTGTAGC
GAAGAGCCCAGAGCAGTAAGTATTAAAGGTAAGAGCTTTGCCATGAAAATTGAGCTTATA
GACCCAGTATCTTCAACCTAGCAGTGAACTTAACATTTTCCCTTGAATTTTCATTGGGAT
TCCAGGGTCAAAGATAAGTAGAAACATAAACATAGATGCAAGCTATTGATAATGAGGAAC
AGGAGAAGAGAGTGATGGCGCCAATATAATTTGCCAAATTATTGTTTAAGTTTAGATGTA
AGGGTGATTTTTCAGAAACAGAGTAAGGAAGTCATAATCCACGGTTACTGGAAAACTTAG
GGAAATGTGATAGGGATGAAGAGAACTAAGGAAGTACTTTACTAAGAGGACACGGTCCTT
TTGGGTTTTCTTTAGTTATCCAACTGATGTATTACCAACATTCTGTGATCTTTTGATGCC
TGTCTCAAACAGTAAATAAAATAAATTCATGTTACTGCTAGAAAACAGACTTGTAAAAGT
TATTTTATTTCAAATAATGAAGTTTAAAGCCTATGCACAATATTTTATGTGGAGTATGTT
TTATTGGACACTTTAATTTTTTTCTATTATCTATTTATATAATAAACTTTCTCTGCTGGG
TACCATATTTGGACATAGCCACATGCTATTATGCCACACAAGATAATAGTGTGAATAAGA
AGTGGAAACAAAGGTTAACAGTTTTGTACCAAAATGCTTTTTATTCTTTCATTTACTCAA
CATAATTTTAAATGATTAATTGCTAAGTCTTTTTCTAACAGACTAAGTCAAGGGCAGATG
AATGATAAACATTTTTATAGAACCAAGAAAAAAGCCCATTTTCCCGTCCATTTTTTCTAA
TTCATTCAACAACTATCTGTTGACCCTAAACTGCTGTGCATCAGAGGCATATTAGTGACC
TCTGTGTATTAACATCATTGTTTTTGAGGTAACAAGACATTACGATGTATGTCAATTTTC
TTTTTCAGTGCCAGCTCCTGTTGAGCATCAGATCTGTCCTGCTGTGTGTGTCCTAATGAA
GCTTTCATTTGATGAGGAGCACAGGCACGCAATGAATGAGCTTGGTAAGATGGAAATGCT
CCTGAATGCAAGCTGATTTTTAAATGATGACACAAGTTCAGTAAGATAAATGAAGATTTT
TTTTAATCATTGATGAACTGGAGTAGAAGTTCGTCAACCAGGGTATGAAGCCGCTAACTT
CTGTTACCAGCTGCTTTCTCCTTGAAGCAAATGATAGGTGCCAGTTGTCAGAGGAAAAGG
GGTCCTGAATCATAGAGACTGCTACCTTGTTACAACGTTAACTTGGATTTTCAAAGTGTT
AGCCAAAGATTGGAAAAATTGTATCATTCTTTGTCCCCACTGCCAAGGTAGGCTCTCTGT
GACAGTTGGAAAAGAGTCACTTTATTTATTCTGAAATGTAGTTAAACTTAATGGTTTGCA
GAACTTAGTAGCTTCTGAATAACACCAGGAGGAATTACTATTAAGATTCTCTTATTGTTA
AAATGTCATCATAGTTAATAGTGCTGTACTAGATTTTCATGATGAGCAGCATGATAACTT
TGAAACTAGTTTATATAGAAAAATATGGTCAATTTAAATTAGAAACATTTCATTAATATT
GAAAGAACTACTTTTAGGTACATATATATCACACACTAGAAACCTTATATAGACCTGCAT
TTCCGCACCCCATTTTTCATGTAACAGTTTTTCTTTGACTTCTAGGTTCATTTTGCACAT
GTGGTTTTATAAATGCATCGTGCTGTGCCATCTCATGTGAACTGGATCTCTAGTCATGCC
ACAAGCAAGAAGCATACACTGAATTTCCTCTTGTGTAGCTGTGCCCTTGCTTTTTATGCT
GTTTGTGTGACATTACACTCCAGCCCCACTTTGTATTTCTATCACCTCATTGTTGTCATT
CATCGTTTATCTTAAAGGTGATACAGTCATGAGATTCATTTAAACCCGATAACCGAACAT
CCACAAACAAGTGTTGTCTCCTTCAGAGTCATCACGTTGGGAGGCTCTGTACTTGGTGCT
TTCAGGCCTGCCCTCCATCCTTTACTTTCCACAGACCCAGTGACCTTTCCTCCCCGGCCT
TCTGTGGAACCAGTATAATCTGACATGTTCTCCCTTCCTCAGTACTATCCCAGCATTTCT
AAAAAGTTTTAAGTTTTTTTGTGTCTCTGTGTGTGTTTTGTTTTTAATGCTAGTAATAAA
ATGGGAAGGGGGTAAAAATTATGAATAAACAGGAAAATTATTCCAATTTTAAGACACTAC
ATAAGTTTTTACATAATGTTCCTGTGTTCCAATGGACTATAGACTAGGACTGACACAATA
ATCATCTGAATTTGAAAATAAAACCTAGACTCAGTATTTGTTCCTCTTCCTTCTTCAGGT
AGGAAGGCTACCCGGGGCATTTCATCACAGGAGCTAGGGCAGGGGCTTTCAGGTGAGGAG
CAGGATGGGGCCTCTGGGGGTGTGATTGCCTGGGACATAGCCAAGGGGGATTAACTTCTC
TTTCCTAGCCTCTGAATTTAACAAAGGGAGGATCAAGGTTTGCATATTGGGGGGAGGTGC
AGTATTAGACAGTACAAGGTATCTGGCCTCTAGGGTTTAGGAGAGAAAAGAAATCCCAAA
TGGGTGAAGGGAAATTCTTTAGAATAATCAGCTAAGACTGCCTTTTGTATGTATATGAAT
ATTATACAACCCTCAGAATCTCTTAGGTTTTTACCTATTATTATTGTAAGTTTCAGACTA
TAATATGAATTAGATTTATTCATCCCCTACTCTGTCTTGGAAACTGTGCTAGATAAAAAA
ATAACTAAGATGTGATCCTGACTTTCAGGGAACTCATGATGTATTCTATTTTAGTCCTTC
CTAAACCAGATCATAACAATCACCAGAGGCATGTGTCAAACATTATAAATCCTCAGGCCT
AGCTAGCCCCAGGCTTAGGAAAACAGGATCTCCAGGGAAATCAGGAAGTTTTGTGAAACA
TCATCCTGTAGAACTATTGATGTTGAGCCCCTAATAATTTATTTTAGATTGAGGTATTTC
CAGCTAATAGTAATTATTTAAACAAAACAAAAATGATACTTTTAAAAATTAAGTGTCTTC
TATTATCTTTTTGATATGAATCTTAAGGATTCTGTTGAATGCCACTTTAGGCTATTCGTT
CTCTTAGTTAGGTTATGAAATGCCATATTAAATAATGCTTTGGTCCATCTAAATCACTAT
TTTCCAACATTAAGAAAAACATGAAAGGATATGCTCATCATCTTTGGGTTATCTGGAAAC
ATTCTAATTATTCTTAGGACAACTTACTTTTTTATTCTATCAAATACAAATCTTACCATT
TTGTGAATCTGTTTATAGTTTTAGCATATAGATTATATTCTTTATCTTAAAATGCACTGA
ACTCTTCTTATTTGCCTGAAATCTTAAACGGCTTCTTCTTTTATCAATAGCAGATAAAAA
TTTTTTGTAGAATGTTCTTTTTTATTGTTCTTTTGCTATGTTCTTCATGATCTTGTAGAC
GTACCTTATTCTTCTTTAATTTTTGTTTTCAGAATCGAATCCAAAATAGATAATAGTCAA
CTCTCTAATCACTTAATACCTTTTGGGGATCTGTTTAGATGCAGTTTTATTTAAGAAAGT
ACCCCAAATGTAGCTGTGCCAGTTAGGTGTAGGTTTTATCCAGATACAAAGCGTAGTATA
TCTGGTTTTAATATTGATACACTGTTTTATAATATTTTATATTTTTGTAATTTCACCAAT
ACATCAGGTAGAATCAGAACATTAAGTTTACAGTGGTTCCAAGTTCTTGTACAGATTCTT
CTCGTTCACCCAAATGCTAAATGATAGAATTTAGGCAGTATTGTCTACTCCCAGGGCTTC
AGTTACAATAGTTTTCAAATTCTGTCCAGAATTGTAGACATGATCAATCTCTTTTCACAT
CCTCGATTTCTGCTGTCACAAACTGGATTTTCTTCTCTCTCCCATCCCCAAATCTATATG
TTATAAGGTTTCTTTTCTCACTCAGAAAATGGCAATCCAGCCAACCCAGTTGCTCAAGCC
AGACTTTTATCTTTCTGCCCATTCTTTAGTAACAGTACTTCAGATCTGCTTCTAAAAATA
TGTCTCTATTCACTGTCCTTTTCATTTTCAGTCTAAGCCACCAGGAAATCCTTTCCTTCC
TCTTTTGCAGTACTTTATCATACTTGGATTCTCCATTTCCAAACATATTCCAGTCTGCTC
AAGGGAAACATGTACTCTATTTAGGAATCAAATCTAAATTACTTTCTTCNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTATGCCTTAATTTGGCACAGAAGGGCTT
GCATGATCACTCATATCCCATACCCATTTCTGTAGCCTCATCTTCAGGGTCTCTCCTTGT
TGCTGTACAAAGACTGTATTCTGGGGCACCTGAAGAGTGCTCTTTCTTCTACCTATCATG
CGTTGTGTCTGCCCTGCCCCCTTTCTTGTGAGTCTTAACAAACAGTATTTCTTCCACCTT
TATCCTGATCCCTCACACTGATGTAAAGTCCTCTGTTATCATGCCTTGTGCTTCTCCACA
ATCCATCACACCAGTTTTGCTGTAATCGATAAGCCCCATAAAGACTGTAACTATATTTAA
TTCCCTGGATAGGTGGGTTGAGGAATATCTTTCCAAATATGGCTGGGATTTTTCTTAACC
TAATTTTCACTTTTGTGCATTCCAACTCTGTCATTTCTGCTAGTCATATAGTATTAGAGA
CTCTCTTGGCCTGGGATTCTTGCCTCAAAATGGAACTCTGCCTCATTCACAAACTTGCTG
AATCCTCTGCATACTGACACTTCCAGATCACTTATAAAAGTATTCAGTGTACTGGCTCTC
TTAGATTAGTGTTTAGACTTCTAGTGTCTGAATTTCCTGTTTATTTATATTCATTTTTTT
CTGTCTAAGCCGCTTCTCTGTGATAAAACATATCCCCCATTTCCATGATGATTCAATATT
TTGAATAGTCTCCATATGCATTTTGATTTCTTTTTGTTCACTCTGTCATCATTTGCTTTT
CCTTAATTTTTTCCCTATGTCTTTTCCTGTTCCTTTATTTTCCATCTTACCTTTTTAGTG
TTGACCACAAGGGTATGAAAAAATACTAATTCCTATAGTACAATTGGAATTTCATATTAG
TATCAAAAATAAGTAACATTTTAAAATCTGAAATAAAATGTAGTCATAAATTTAATAGAT
TTTTTTTTAAACTGCTTTGTGCACAGTTTCATTTAAAAGTTTCAGTATTCCTAAAGGTAA
TTTGTTGGCAGATAAAAATTAGTAAAATATTAAGACCACATTGTGTGACAATGAATATTG
TAAAATCCTCATAATTAAGTTATTTTCTGCTTATTTTCAGGAAGACCTAGTGTTTACCTT
AGAAAAGTAGCCTTCTCCATTGTTGGCAAGTTACAGTTGATGAAGGCTGGAGGGTGGAGA
AACTGGCAGAACATGGAATAGTTGTCAGTGGTATTTAATAAATGTTATATGAAAGTCATT
TATAATTATGTTGCTTTTAATTCTAAAGGGAAATTCAAATAATATAGTCTCATTCTCTGA
GGGTTTGTTTGGGTTTTTTCCCTGTTTTTTCTTGAAGTTACCATCTTGGCACCAGTTTGT
CTTATTTTAGATTGTTGTTTTGTTTTGTTTTCCCTCTTGCCCTTTGTAAATTAGGGGGAC
TGCAGGCCATTGCAGAATTACTGCAGGTGGACTGTGAAATGTATGGCCTTACTAATGACC
ACTACAGTATTACATTAAGACGATATGCCGGAATGGCTTTAACAAACCTAACTTTGGAGA
CGTAGCTAACAAGGTATGTTTTTATATGTCCATTTCTTAAGATGTCTGGGTCTGAGTCCT
TTTACTTTCCTACACACATTTCACTGGTGTCCTTTCTGTCGCTTTCTTGGTTAAGTGCTG
ACTAATAAAGCACTGTACCTCACATCCCTCTGCATAGCCAATACCCATTCAGTTGCCCTG
TGTTTTAAACAAAAGCCAAAGCACATCAATGGATGGAACATAATAGTGAAGTCTTAATTA
CATAATTGTTTTTAAAACACTGTTATTACAAATGAGAGCAAAATTGGAAAATCCTACTGA
CCAAGGCAAGTGCTATGCACACACTGATTTTATCCATATAAGAGGCCTCACTTTAAATCA
CTTTGCATGTAATTCCTTTTTTAAAATTCACTTTATTTTCTAGTTTGGCAAGGGAAGAAC
AATAGCAAAAGATGGCATGGTATTTGTCTTTGATCACAGGGATTTGTGTCTGTCTACCTT
TGTGTGCAAAATATGAATTATGGTTAAGTGAAACAATACGAGTTTGAAATGATAATACTG
TCCAGCTTCAGGTTGCCTCTAAGAACCTCTGCTCTGTATTCTGTTTCTTCACAGGCTACT
TTGTGCTCCATGAAGGGCTGCATGAGAGCACTTGTGGCTCAGCTGAAATCTGAAAGTGAA
GATTTGCAGCAGGTAAACATTATCATTTCATTTTTTTCCTAGCTATTGGTAGGTATGCAT
TCTGATTTAGATTAATTTAAACTGTGACTCATTGTATTTCATGTTGGAAAATGGTGTTAT
ATTGTAGGAATCCCCTTTAGTGTAGCACATAAACATTGGAAACACATTTCTTTATTACTA
CTCTAAAACAGCATGAAATACCAAAAAAGCAACTAATACGATTCATTTTTTATGTGTAAT
TCTAAAATTGGTTATTTGCAGGTTATTGCAAGTGTTTTGAGAAATTTGTCTTGGCGAGCA
GATGTAAACAGTAAAAAGACATTGCGTGAAGTTGGAAGTGTAAAAGCATTGATGGAATGT
GCTTTGGAAGTTAAAAAGGTACCTTTAAAAACATTTAGTACAGTGGTACGGATTTTACTT
TGTCTACATTTTTGCTGCCCTCTCCCACCCTCAAAATTGGCAGATTCTTGAACATTAAGG
TGTAAACGATTGTACAGGGTGACTTAATCTAAATCAGGTTTTATCACTTCCAAAATACTA
TTGACATTTGAAAAATAATTCTGTGGTTTGGGTGCTGAACTGCATCATAAAATGTTTAGC
AACTTCCTTGGCCTCTACCTATAAACTGCTTCCCAAATGGTAACAATACAAAATAACTCC
AGGTAGTGTCAAACAATCCTCAAGGGGAAGAGAGACAAAGAATCACCCTTGCGTACCCCA
GATGTATTACCTCTACACTGTACATTTCTGTTCCCCAAAGTCTGCAAATGTTGATGGCTA
GCTTATTGAAAGTCATCATACCCCAAGAGTGAGAAATCCCTCAATAATAATTCGTGTATA
GAAAAAAATATCTCCAGGTGGGATATCTATTTTAGGTACTAAGCTAATTTTTAAAATAAA
TAAATTTGTATTATAAAAGGGACCCAAAAAATCTGCTAAATTAGTCTGAACTTCTATCCC
CCCAGCAGTCCTCCTGAGCCCACAGACTGTGTTTTTGTCAAAACTTCAAAGAAAGTGAAG
GGTTTTGGTTTTGTTTATCAGTTTATTCTTGTGGGGTTTTTTTATAAGTATAAATAAGTA
TGTTATTTTAAAAGTTGAAAATTATTCAAAATAAGAAATGTATTCAACTAGTTTTAATGA
TAACTCTAGACCACTGCTGAATGGGCAAAAGGTCTGTACTGACATTTCAATGAAAAATAT
ATGTAAGTGGTCAATAAACATTAAAAAAGAAAATACTAATTAAGCATTATGAGTCATCGA
GAAATTCTAATTAAAACAATAATGTACCATTAAAGATAATGGTTAAATTCTTAAATATTG
ACCAAGCGTTGGCAAGGATGTAGAACAATTGGAACTCTCGCAGTTTGAGGTCAATGGGAA
ATTTGTGTAGAAAGTATAGTGTTCTGTTCTTACTGCACATCATCTATTACTTACATTTTG
ATTTTGATAAATATTTGTTACAATTGATTAACCAATACTGCTTAGTTGAACTTTATTATT
GATTAAAGCCCATAGTTAATTACATTAGGATTCACTCTTCATGTAGTAAAAGCCATATGG
GTTCTGATAAGTGCAGGTTGTTTCCACCATTAAAATTCCACTGCCCTAAAAACACTTCGT
GTTCCATCTCCTCATCCCTCCTCCTCTTTCCTTGAATATTGGCAATCACTGATCATTTCA
CTGTCTGTAGTTTTTCATTGGGAAGAGTAGTATTTCAAAGATCATTTCTTTTTAAAAAAA
ATCATTCTCTCGGGAGCCTGTACAACTCTTGAAGGTTTCCACACATACATCCCTTGTGTC
ATATTTCGCGCTCGTCCGAACGGTAGCCACCTATATTTAGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGATAATTTATAACTTAATTATATTTTTTTCATGTCTTAC
ACCTGACTGATGTCTCCCTCCCACCCCACCTTTCTGTTGTCCATCCCCCTGGGAAGGGGG
CCATATGCAGATCATTGTGATTGGTTCCCCTTTTTTTCCCCCACCTTCCCCTTCCCCTCC
TGGTATTGCTACTCTCAGTATTGGTCCTACGGGGTTTATCTGTCCTGGGTTCCCTGTGTT
TCCAGCTCTTATGTGTACCCGTGTACATGCTCTGGTCCAGCTGGATTTGTAAGGTAGAAT
TGGAGTCATGAAAGTGGGTGGGGAGGAAGCATTAAAGAACTAGAGGAAAGTTGTATGTTT
CAATGGTGCTATACTGCACCCTGACTGCCTTGTCTCTTCTTTGTGACCCTTCTTTAAGGG
GACGTCTGACTGTCTACAGATGGGCTTTGGGTCTCCACTCCACATTCCCCTCATTCACAG
TGATAAGATTTTTTGTTCTGGGTCTTTGATGCCTGATACCTGATCCCATCAACACCTCAT
GATCACACAGGCTGGTATGCTTCTTCCATGTAAACTTTGTTGCTTCTCAGCTAAGTGACC
ACTTGTTTATCTTCAAGCCTTTAAAACCCACCATTGCTATATCTTTTTCAAAGATCATTT
CTTACTGAATTTATCATTTTTTTTAATACAAGCCCAATCTTAGAAACAACAGCCTTTGAG
AATTTTAAATACCAAATTCTAATGTGAGCCTGCTTCTGTTTGGTAATATTAAAATGCATT
TGGGTTTTTTTTTAACATTATGTAGTCATTATGAACATTCTCCTTTCTCTTTTGCTTTCC
CTTTTCATTGACTACATCCTTCTCAAGTTCATTTTCTACTAATGATTAAGAGAACCAGAA
CTATTTCTCATATACCCCATGTCCTGTGCCACGTTTAACTTCATTCAGCTGGCTGCTCTT
CTTCTACTCATTAGAGGAGAACTTTTCCTTCATCTGTACTGTGTCCCAGGCTTTGCTGTG
TATTCAAAACTCTTTGGCCTTTACTTGTGTTCTTCATCTTCTTTACTGGGTTTTCCTTTT
TTTTTTTTTTTTCTCAAAACCATTTTATTGGGAATTAATACAGATATCATATTATTCCAT
TGTTGAATCACATCAAGCAGTGTTGTACAGTTGCTACCACAGTCAGTTTCAAAACAACTT
TCTTTTTAAGTTAATTTTGGTTACCATATACATGATAAAGCATATGCCACTTCAGTTTCT
ACATGTACAATTCTGTGACATATATTGCATTTTCAAGTTGTCCCCTACTCGTTTATCCTT
TTTCCAAATCATTCCACCACCATTCTAAACATAAAGCTTCAGCCTCTTCCTTACACCCCT
GGTAATATTTTGTTTCTGTAAATATGCTTATTTATCATGTAAATGAGTTCATGCGGTATT
TGCCCTTTTGCAACTGTCGTAGTTCATCCAGCATGATGTTGTCAAGGTTTATCTCTGTTG
TGGCATGCATCAGCACTTCATTTCTCTTTAGGGCTGAGTAGCATTCCATTGTGTTCCTAT
GCCATATTTTGGTCTTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTTCTGTAAATATGCTTATTTCATGTAAATGAGTTCATGCGGTATTTGCCCTTTTGCAAC
TGTCGTAGTTCATCCAGCATGATGTTGTCAAGGTTTATCTCTGTTGTGGCATGCATCAGC
ACTTCATTTCTCTTTAGGGCTGAGTAGCATTCCATTGTGTTCCTATGCCATATTTTGGTC
TTGTCCAACTTTTGGCTATTGTGACAAGTGCTGCAGTGAACATTGGTGTACATGTGTGTA
TGCTTTTCAGTCTCTTTGGTGTATACTGAGAAGTGGAATAGTGGGGTCCTATCCCAGCAT
TGATGGTGTGGTGGGTTATGCGTTGGGTTTAAAACTATCAGCTGCTCCTCAAGAGAAAGA
TGAAGCTTTCTGCTCCCGTAAACAATAAAAGCCTTGGAAACCCACCATAGCAGTTTTACC
CTGCTTTATGTGGTCGCTATGAGTAAGAATCCACTCAAATTTTGGTATGCCAGTTCTGCA
TTCAACTTTTCAAGGAATACCCAAACTATTATCCAGTGTGGTTGTTACCATTTTACATTC
CCACCAAAAGGATGAAGCTTCAATTTTCTTCACAGCCTTGCTAATACCTGTTATTTTCCA
TTTGATCATTACCATGCTGGTGGGGATGCTCATTGTGGTTTTGATATGTATCTCCCTAGT
GACCAGTGATACAAACCCTAGTGGCATGGTGGTTACTCATTGAGCTGCTAACTGCAAGAT
AAGCAGTTCAAAACCACCAGCTGCTCAGGAGACAGGTAGGGCTTTCTACTCCTATAAAGA
AGTACAATCTTAGAAACTCACAGGAGCAGTTCTGTCCTGCCCTGTAGAGTCTCTGAGTCT
ACCTTGACACGCTGGCAGTGAGGAAGTGACTAGTGTTATTTAACATCTTCTCGTGTGCTT
GTTGGTCATTTGGATACCCTCTTTGGTAAACCGGCTACTCAAGTCTTTTGCCTTTTTTTT
TTTTTTTTTTTGCATTGTCTTTTTACGTTTGTCTATGATTCATCTTTATATTCCTACTGT
CTGAGAAGCCCAGTGTTTTAAAGATGAAGAACATATTTCTCCATTGCTTCTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCT
CCCTCATCACAAAATTAGATTACTGATTATGGTGGTCGATTCTACTTTTCCCTATATAGA
TACTTTTAATCACTCACTTTGCTTTTACTGCCTAAACCTTTACCCAGGCCTCTTGACTCC
TATTTAGAAAGTTTCTTTGAAATACAACGGTTGTCTACTACACCAAGTCTCATGGAGAGC
AATTCTATTTTTCACCTTCCCCCTCTCAACCTCTGGGCCAGTTGCTTTTGACATCATACC
CCTCACATCTTGCTATTTTACTTTTATGTCAGGATACTTCAAATGTGCCATCTTTACCTC
AGTCACAGTATAATTTCAATTGGGCTCTTTTCCCCCTCACATCTTATTAAAAACTCCCTT
CTCGATTATTTCTGATTGAATCATTACTAAAATAGTGTACGGCTTAATTCTGGCTTGTTT
CACTCCTTTAACTTCCTGACTAAAAGAACGCAGGCATTAGCTATTTATTAGGACGTCTGC
CATTGCCATTCCAGGCCTTGCTTCCCACTCTCCCCTCGTGGATGGTGGTCCTTTCCGTGT
GTCTGTGCAGCAGCTCTCCTACTCCGGCACCTTTCCTCAGTCTCTGCTCTCTCGTCCCTC
TTCTCTGATTGTCCAGGCCGTGTACCTTCACAGAGCTGGTCTAGTCCGTGAAAAACAAAT
GTTTTAAATTAAATTCAAGCTGTAATAACCTTTCCATTTTAACATTGGTTTCATCTCTCT
ATTTGTTTGTTTTCCTCCTGAATAAATTGTTGTCGCTTTTCAAGCAGGTAACAGTGTGTT
ATGTTTATATCCTCTGGATGCCCCTAATGATGGTAGGTGTGACAGATTTCTAATGACTAT
TTGTTTCTTGATGCCTGACATTAGGGTCATGACAAGTTTTGACCAAAAATCGGTATGAGA
GTCTTCTTTGGCAATGACAGTTTGCCAAGAAGATGTATATTAGGGAGTTCTGTTTATCTG
TAGTCACTTTATTTATTTGGTATATTTGTTACTAAAATTTTCTAATATACGTTCTTCATT
TATTTGTTTTTGCTTATTTTTAATAAGATATGTTTCTTTTGCTTCAACCCCATCCGTGTT
TTTTATACAAACAAAATATGGTGCATATTCTGCAACTTGCTCTTTTCGTTTAACAATTTC
TTAGTATTCTTTCCATAGTGACATGTAGAAGCTTTCTCTGTTTTATCTGCTCCTGAAAGA
GCTCAGGTGGCACTGTGGGTTAGGCACTGAGCTGCTAACAGCAAGGTCAGCCATTCAAAT
TCGCTAGCCACTCCTTGGAGAAAGATGAGGCTGCCTGCTCCTGTCATGATTTACCGTCTC
AAAAACCCAGCGGGCTCCTTCTCCTCTTCTTTGTGCTACTCTGTGGCACTGGGTTTGGTT
TAAGATACTGAAAATGTTAGCTTTTCATAATGCTTATAACCTCTTCATACTTTGATATAA
GCACTTTTAAGATTTGTGTATGCCATCTTAGAATGAACCCTTGTAATGAAGTTCATAAAT
TTAATTAGTTTAATATTGTGTTTTACTTGTTTATTACCACTACCTTAAATTACCCATTGG
TATTTTGGGGCGGGGGGGTGGGGGGGGATTTTTAATGGAGAACTCCTAGTATTTTATCCA
TGGGTGGACAGCAGGAAAGGTAGTATCAGTTGTATTCAATAGAAGTAAATATCTAATTTG
TGAAAGACAACTCTAATTAAATGATTTTGTTTGTTTCTTCATAGGAATCGACCCTCAAAA
GCGTATTGAGTGCCTTATGGAACTTGTCGGCACATTGCACTGAGAATAAAGCTGATATAT
GTGCTGTTGCTGGTGCACTCGCATTTTTGGTTGGCACTCTCACTTACCGGAGCCAAACAA
ACACGTTAGCCATTATTGAAAGTGGAGGTGGAATACTGCGCAACGTGTCCAGCTTGATAG
CCACAAATGAGGACCACAGGTAACTACGGTTTTATTTATTTTTAAAATAAGAGCAGAAGT
TACACCTTAAAGAGCTAACTGTAAGCAGCGTTTTGTGTAATTATGCAAATTCTGAACTAA
AATATACTTAGTATGGTGAAAAGATAGCAATTCCAAACATAACTCAATAATGTATATTTT
CTAACAAGTAAGAGCTCACAGGCTCACAAAGTAATCAACTACTTGAAAGGTAGAGCCCCT
GCATGGAAGAAAACATAAAAGTCATACATGCTCGCTAGGACAAAAATCCGTTCCATTTGT
CATAGTAGCACTTAGGCAGAGGCCACTCGTCTCGTCTCCTGGAGCTGTGAAGGCAGAGTG
AGCAGCTCAGCTCCGGGGCACATATTTCAGAATGGGGGCTTTATAGTGTCTTGGTAAAAT
ATTTGCTTTTAACTTGTTTAGTATTGATCTCTCATTTTCAAAAAGACTACCAGGTGATTT
CAGTAAAAGATCCTGTTAGGAGTGTAAGTGTCTTTTAAGTTTTTGCTGCACAAAACCACC
TCATCACCTTCAAAGTACTGTCTATTACACTTAATACATTTATCAAATCTGCAATTCCAT
TCTTGGAAACACTTTTTCAAACTCATCTGTTTGGATGGCTGACAGCACCTCCCTTGTTTT
TTTTGTGTGTGTGTGGTTTTTTTCTTCACCTCTTCTAAGTCGTCAAATCACTATTCTTTC
ATGTCCCTCGCATTCCCTGAAAGCAAAAAGTCTGAAGGAGCCAGGTCAGGTAAGTAAGGA
GTATGAGGCAAGAGAGGCAAGCTGGTTTGTTTGTTTGCCAAAAACTGGAACACTGAAATG
GCTGTGTTAGCAGGTGCAGTATCGTGGTGGCTAAAGCACTCCCCCCATCTGCCACAAATC
AGGCCTTTTTTGTCACACAGTTACACGATCTTTTCAGAACCTCTAAATAAAAAGTTTGAT
CAACAGTCTGACCTAGTGGAATGAACACCAAATGCATTATGAGTCGACATTTCCGTCCAT
TCAGGAATTTGACGGATATCCAGAACGAGGTTTGTCATCTACGGACATGTCACCTTTTTT
GAAACAAGAAAACCACTCGTACACTTGGAGTTTTTCCCATAGTGCTGTCCATGTAAGCTG
TGTTCAACATCACAACAGTTTCTGAGACATTTTTCCAGAGCAGGAAACAAATTTCACAAC
CACACACTGTTCTCTTAAATCAGCCATCACAAGAAATGAGGTTTGAGCGAAACCGCTTTT
ATGAAAAAATTCACTGTGACCAGAGAGAACCTTCCCAGGCAACACCAGTGGGTACACTAA
CTCAGAGCAAGTTGCTTGAGGCTCACATAGCAGAGCTTTTTCCATTTTATGGGGGTTAAC
CCTTGTACAAAGAAGGCTCCTTAACTCGGGAAGTACTCTGTTAATTACTCGGTTGCTGAG
AGAAACCATCATGTTAAAGCCTTTCATGCAACCTGACCAGCCCTGGGTGGTACTGTGGGT
TAGACACTGGGCTACTAATCACAAGCTCTTCAGTGTAAACGTACCAGCTGCTCTGAAGAA
AAAAGATAAGGCTGTCTGCTCCCATAAAGAGTTTACAGTCTCAGAACCCTATGTACGATC
ATTCTGAGTCCAAATTAACTTGATACAGTGGAGTTGGTTGGTTGGTTGGTTATAGCTGAG
TACACTATCATTAGACTTCAGTTTGGCATGCATGCAGCAAACTAGGATTCTCGCAGGTTT
CAGTGTGCGGATTCTCAACCCTCACAGTTTTACCTCTACATATTTTGAAAAACTTTAATG
CACTTTCTTTTTCAAAATAATCAATTTGCTGGAGAACACTTATAAGGGATAGCAGTAACC
CAGAATTCTGCCAGAGATGTAGCGATTGCTTTAAACAGTTTATTGACCTAGGAGTTTTTG
GTAGAATTATACCTAATTATACCTATTAATAAGTTTTAAGGAGCCCTGCTCTAAGGTAAA
ATGAAGCTTTCTTATCCCATAAAGAATTACAACCTCCCAAACTTAGGAGCACATCTATTT
GACCTAAATGATTGCTATGAATCAGAATCGACTCAGTGCCAGCAGTAAGTGTGGTTTTTC
AGTTTGGTGACATAGGTTAAATGTTGGGCTTCTAACTGCAAAGACACGGGTTCAAACCCT
CCAGCTGTTTCATGGGAGCAAAAGGAGGCTTTCTGCTCCCATAAAGATTTATAGTCTTGG
AAGTCCTACAGACCAGATCTTTCTTATAGGGTCGCTATGAGTTGAATTAACTTGACTGTG
GGTTATTAATAAGTTTTAGTAATTATCTGTAGACCTAAATTTTATTCCTGTCATTTTGCT
TGTTATGAACATACTCAGAATTCAATCTTAATTTAGTCGTGTCTTATTTTTATTTCAGGC
AAATCCTAAGAGAAAACAACTGCCTACAAACGTTATTACAACACTTGAAATCTCACAGTT
TGACAATAGTCAGTAATGCATGTGGAACGTTGTGGAATCTCTCCGCAAGAAATCCTAAAG
ACCAGGAAGCATTATGGGACATGGGAGCAGTTAGCATGCTCAAGAACCTCATTCATTCAA
AGCACAAAATGATTGCTATGGGGAGTGCTGCAGCGTTAAGGAATCTCATGGCAAATAGAC
CTGCAAAGTATAAGGATGCCAATATTATGTCTCCTGGTTCAAGCTTGCCATCTCTTCATG
TAAGGAAACAAAAAGCCCTCGAAGCAGAATTAGATGCTCAGCATTTATCAGAAACTTTTG
ATAACATTGACAATTTAAGTCCTAAGGCATCTCATCGTAGTAAGCAGAGACACAAGCAAA
ATCTCTATGGTGATTATGTTTTTGACACCAATCGGCATGATGATAATAAGTCAGACAATT
TTAATGCTGGGAATATGACTGTCCTTTCACCATATTTAAATGCTACAGTGTTGCCTAGCT
CCTCTTCATCAAGAGGAAGCTTAGATAGTTCTCGTTCTGAAAAAGATAGAAGCTTGGAGA
GAGAGCGAGGTCTTGGCCTTGGCAGCTATCATCCAACAACCGAAAACCCAGGAACCTCTT
CAAAGCGTGGTTTACAGGTTTCCACTACTGCAGCTCAGATTGCTAAAGTCATGGAGGAAG
TGTCGGCCATTCATACCCCCCAGGAAGACAGAAGTTCTGGCTCTACCACCGAGTTACATT
GTGTAACAGATGAAAGGAACCCACAGAGAAGAAGCTCTACTGCCCATGCACATTCAAACA
GTTGCAACTTTAATAAGTCAGAAAATTCACATCGGACATGTCCTATACCTTATGGCAAAT
TGGAATACAAGAGATCTTCAAATGATAGTTTAAATAGTGTCAGTAGTAGTGATGGCTATG
GTAAAAGAGGCCAAATGAAACCTTCCATTGAATCCTATTCTGAAGATGATGAAAGCAAAT
TTTGCAGTTATGGTCAATATCCAGCTGACCTAGCCCATAAAATACATAGTGCAAATCATA
TGGACGATAATGATGAAGAACTAGATACACCAATAAATTATAGTCTTAAATATTCAGATG
AGCAGTTGAACTCTGGAAGGCAAAGCCCTTCACAGAATGAAAGATGGGCAAGAACCAAAC
ACGTAATAGAAGATGAAATAAAACAAAGTGAGCAAAGACAATCCAGGAGTCAAAGCACAA
CGTTTCCTGTGTATAATGAGAGCTCTGATGAGAAACACCTCAAGTTTCAGCCGCATTTCG
GACAGCAAGAATGCGTTTCCCCATTTAGGTCAAGGGGAGCCACTGCTTCAGAAACTAATC
GAGTGGGTTCTAATCACGGAACTAATCAAAACGTAAACCAACCTTTGTGTCAAGAAGATG
ATTATGAAGATGATAAGCCAACCAACTACAGTAAACGTTACTCTGAGGAAGAGCAGCATG
AAGAAGAAGAGAGACCCACAAACTATAGCATAAAATACAATGAAGAAAAACATCATGTGG
ATCAGCCTATTGACTATAGTTTAAAGTATGCCACAGATCTCCCATCTTCCCAGAAACCAT
CATTTTCTTTCTCCAAGAGTTCCTCTGGACAAAGCACTAAAACTGAACAGCACATCCCTT
CAAACAGCGAAACCGCTTCTACACCTTCAACTAATGCCAAGAGACAGAATCAGCTTCATC
CAAGTTCAGCACAAAGTAGAAGTGGTCAGACCCAAAAAGCTGCCTCCTGCAAAGTTTCCT
CCATCAACCAAGAAACAATACAGACTTACTGTGTGGAAGATACCCCCATATGTTTTTCAA
GGTGTAGTTCATTATCATCTTTGTCTTCAGCTGAGGATGAAATAGGATGTGACGGGACAA
CACAGGAAACAGACTCTGTTAACACTCTGCAAATAGCAGAACGAAAAGAAAATAGTGCAA
CTAGATCAACTGAGGATGCTGTGAGTGAAGTTCCAACAGTGTCTCAGCACATAAGAACCA
AATCCAGCAGACTCCAGGCTTCTGGTTTGTCTTCATCGGAATCAACGAGGCACAAGGCTG
TCGAATTTTCTTCAGGAGCCAAATCTCCATCCAAGAGTGGTGCTCAGACACCTAAAAGTC
CACCAGAGCACTATGTTCAGGAGACTCCACTCATGTTTAGCAGATGTACTTCTGTCAGTT
CACTCGACAGTTTTGAGAGTCGTTCAATTGCTAGCTCTGTTCAGAGTGAACCCTGCAGTG
GAATGATCAGTGGTATTATAAGCCCCAGTGACCTTCCAGATAGCCCTGGGCAAACCATGC
CACCAAGCAGAAGTAAAACCCCTCCTCCACCACCTCCTCCTCCTCAGACAGTGCAGAGTA
AGCGAGAGGCACCGAAAAATAAAACGCCTAATGCTGAAAAGAAAGAGAGTGGACCTAAGC
AAGCCGCCGTAAACGCTGCAGTTCAGAGGGTCCAGGTTCTCCCGGATGCTGACACGTTAT
TACATTTTGCCACAGAAAGTACTCCAGATGGATTCTCTTGTTCATCAAGTCTGAGTGCTC
TGAGCCTCGATGAGCCATTTATCCAGAAAGATGTGGAATTAAGAATAATGCCTCCAGTTC
AGGAAAATGACAATGGGAATGAAACAGAACCTGAGCAGCCTGAAGAATCAAATGAAAACC
AAGAAAAAGAGGCAGAAAAACCTACTGACTCTGAAAAGGATCTATTAGATGATTCAGATG
ATGATGATATTGAAATATTAGAAGAATGTATTATTTCTGCCATGCCAACAAAATCATCAC
ACAAAGCTTAAAAATCAGAGCAGACTGCTTCAAAAGTACCACCGCCCATAGCAAGAAAAC
CAAGTCAGCTGCCTGTGTACAAACTTCTACCAACTCAAAGCAGGTTACAAGCCCCAAAGC
AAGCAATGCCGAGGGCGTTCTGCATAGAAGGGACTCCCATAAACTTTTCCACTGCTACAT
CTCTAACCGATCTAACAGTAGATTCTCCTCCAAATGAATTGGCTGCTGGGGAAGGGGTTA
GAGTAGGGACACAGATGGGAGAGTTTGAAAAACGAGACACCATTCCTACAGAAGGCAGAA
GTACAGATGAGGCTCAAAGAGGAAAAACTCCATCTCTAATACCTGAATTGGATGACAGTA
AGACAGAAGAAGTTGATATTCTTGCAGAATGCATTAATTCTGCTATGCCCAAAGGAAAAA
GTCATAAGCCTTTCCGTGTGAAAAAGATAATGGACCAGGTCCAACAAGCATCTGCATCTT
CATCTGGAACCAACAAAAATCAATTAGATGGCAAGAAAAAGAAACCTACGTCACCAGTAA
AACCTATCCCACAAAATACTGAATACAGGACACATGTAAGAAAAAGTACAGATACGAAAA
GTAATACAAATAGTGAAAGAACTTTCTCAGACAACAAAGATTCAAAGAAACAGAACTTGA
AAAATAATTCCAAGGAGTTCAATGATAAGCTGCCAAATAATGAAGATCGGGTCAGAGGAA
GTTTTACTTTTGATTCACCTCATCATTACACACCTATTGAAGGAACCCCGTACTGCTTTT
CACGAAATGATTCTTTAAGTTCTCTAGATTTTGATGATGATGACGTTGACCTTTCTAGGG
AAAAGGCTGAGTTAAGAAAGGGGAAAGAAAATAAGGAATCAGAAGCAAAAGTTACTAGCC
AAACAGAACTAGCGTCAAACCAGCAATCAGCTAATAAGACACTGGCTGTTTCGAAACAGC
CAATAAATCGAGGTCAGTCTAAGCCCATACTGCACAAGCAATCCACTTTTCCCCAGTCAT
CCAAAGATATACCAGACAGGGGGGCAGCCACCGATGAGAAATTACAGAATTTTGCAATTG
AAAATACTCCAGTTTGCTTTTCTCGTAATTCTTCTCTCAGTTCTCTCAGTGACATTGACC
AAGAAAACAACAACAGCAAAGAAAGTGCACCTATCAAAGAGACTGAGCCCCATGACTCAC
AGGGAGAACCTAGTAAACCTCAGGCATCAGGCTATGCCCCTAAATCATTTCATGTTGAAG
ACACCCCTGTGTGTTTCTCAAGAAACAGTTCTCTCAGTTCTCTTAGTATTGATTCTGAAG
ATGACCTTCTACAGGAATGTATAAGTTCGGCGATGCCAAAAAAGAAAAAGCCTTCAAGAC
TCAAAGGAGATAATGAAAAGCATAGCGCCAGAAACATGGGAGGTATATTAGCAGAAGATT
TGACACTTGATTTGAAAGATGTTCAGAGACCAGATTCAGAACACGGTTTATCTCCTGACT
CAGAAAATTTCGATTGGAAAGCTATTCAGGAAGGTGCCAATTCCATTGTGAGTAGTTTAC
ATCAAGCTGCCGCTGCTGCTTGTTTATCTCGGCAAGCTTCATCTGATTCAGATTCTATCC
TTTCACTGAAATCAGGAATATCTCTGGGGTCACCATTTCATCTTACACCTGATCAAGAGG
ACAAACCCTTTGCAAGTAATAAAGGCCCACGGATTCTAAAGCCTGGGGAGAAAAGCACAT
TGGAAACTAAAAAAATAGAATCTGAAAATAAAGGAATCAAAGGAGGGAAAAAAGTTTATA
AAAGTTTAATTACTGGGAAAATTCGATCTAATTCAGAAGTTTTAAGCCAAATAAAACAAC
CCCTTCAAACAAACATGCCTTCAATTTCTCGAGGTAGAACAATGATTCATATTCCAGGAG
TTCGAAATAGTTCTTCAAGTACAAGTCCTGTTTCTAAAAAAGGCCCACCCCTTAAGACTC
CGGCCTCCAAAAGTCCCAATGAAAGTCAGTCAGTCACCACCTCTCCTAGAGGAGCCAAGC
CACCAGTAAAGTCAGAATTAAGCCCTGTTACCAGGCAGACATCCCATGCAGGTGGGTCAA
ATAAAGGACCTTCTAGATCAGGATCTAGAGATTCCACTCCGTCAAGACCCACCCAGCAAC
CATTAAGTAGACCTATGCAGTCTCCGGGTCGCAATTCAATTTCTCCTGGGAGAAATGGAA
TAAGTCCTCCTAATAAATTATCTCAGCTCCCGAGGACATCATCCCCTAGTACAGCTTCCA
CTAAGTCTTCAGGTTCTGGGAAAATGTCTTATACCTCCCCAGGTAGACAAATGAGCCAAC
AGAACCTTACAAAACAAACAGGTTTTTCCAAGAGTGGCAGTAGTATTCCAAGAAGTGAGT
CTGCCTCTAAAAGCCTAAATCAGATGGGTAACAACAATGGTGCCAATAAAAAGGTAGAAC
TTTCGAGAATGTCTTCAACTAAGTCTAGTGGGAGTGAATCTGATAGATCAGAGAGACCTG
TATTAGTACGCCAGTCAACTTTCATCAAAGAAGCTCCAAGCCCAACACTACGGAGAAAAC
TGGAGGAGTCTGCTTCGTTTGAATCTCTTTCTCCGTCTTCTAGACCAAATTCTCCCACTA
GATCTCAGTCACAGACTCCAGTTTTAAGTCCTTCCCTTCCTGATATGTCTCTGTCCACAC
ATTCATCTGTTCAACCTGGGGGATGGCGAAAACTCCCACCTAATCTCAGTCCTACTGTAG
AGTACAATGATGGGAGGCCAGCAAAGCGCCACGACATTGCACGCTCCCATTCTGAAAGCC
CTTCCAGACTCCCAATCAATAGGTCAGGCACCTGGAAGCGGGAGCACAGCAAACATTCCT
CATCCCTCCCTCGAGTAAGCACTTGGAGAAGAACTGGAAGTTCATCCTCAATTCTTTCTG
CTTCATCAGAATCCAGTGAAAAAGCAAAAAGTGAGGATGAAAAACATGTGAACTCTATTT
CAACAAGCAAAGAAACTAAGGAAAATCAAGTACCCACAAAAGGAACATGGAGGAAAATAA
AAGAAGGTGAAATTTCTCCCACAAATAGTACATGTCAAACCCACTTCCCTCAGGTGCTAC
AAATGGTGCTGAATCTAGGACTCTAATTTATCAAATGGCACCTGCTGTTTCTAAAACAGA
AGATGTTTGGGTGAGAATTGAGGACTGTCCCATTAACAATCCTAGATCGGGAAGATCTCC
CACAGGAAATACTCCTCCAGTGATCGACGGTGTTTCAGAAAAAAATCCAAATGTTAAAGA
TTCAAAAGATAATCAGGGAAAACAAAGTGTGGGTAATGGCAGTGCCCCTGTATGCACCGC
AGGTTTGGAAAACCACGTGAACTCCTTCAGTCAGGTAGACAGCCCAGACCCAAAAGGAAC
AGAGGCAAAACCAGGACAAAATAATGCTGTCCCGGCACCAGAAAATAATGAAAGCTCTCT
AGCTGAGCGTACCCCATTCACTTCCAGCAGCTCAAGCAAGCACAGTTCACCCAGTGGGAC
CGTCGCTGCCAGAGTGACGCCTTTTAACTACAACCCAAGCCCTAGGAAAAGCAGTGCAGA
CAGCACGTCAACCCGGCCTTCTCAGATCCCAACACCGGTGACCACCACCACAAAGAAACG
TGATTCAAAAACGGACAGCACAGAGTCCAGTGGAACTCAAAGTCCTAAGCGCCATTCTGG
GTCTTACCTTGTAACATCTGTTTAAAAGAGCTGGAATGATGAAACTAAGAAAATTATATG
TTAATTATGACTGCTATGTAGAAATTTTGTTTCAAATGAAACTTTAAAAGACTGGAAAAT
TTTGTAAATAAGTTTGAATCTTGTTAGAGGGTTTTGTTCTTGAAGCCATATTTGATAGTA
TACTTTGTCTTCACTGGTCTTACTTTGGGAGGCACACTTGATAGGAAGAGAATGGTAAAG
CCAAGTATATTTGTACAGTATGTTTTCCATGTATTTAAGTAGCATCCCATACCACCATCC
TTTAATTACTGCCTGTCTTTAAATAACACTACAGATAGAAGATATGATATGTTGCTGTTA
TCAATCATTCTAGATTATAAACTAACTTCATCAGGGAGAAATTAGTATTTATGCAAAAAA
AAAACAACCACCTGTTTTAGTCCTTGTGAGTTCATCTAATGTCATAATTAATCATGTGGC
TGTGAAATTCACAGTAATATGGTTCAAACCATGAACAAGTTTACCAAGCCTGCTTTGCTT
TACTGCATGAATGAAACTGATGGTTCAATTTTCAGAAGTAGTGATTAACAGTTATGTGGT
CACATGATGTGCATATATAGCTACAGTGTAACAACACAATTTTGTGCTAAAAAAGAATCC
GTGTAACTGTAAAACATTGAATGAAACTATTTTACCTGGACTAGATTTTATCTGAAAGTA
GGTAGAATTTTTGCTATGCTGTAACTTGTTGTATATTCTGGTATTTGAGGTAAGATGGCT
GCTCTTTTACTAATGAGACACGAGTCGTGCGGGTCTCAGCAGAACTAAATGAACATTTCA
GAATAAATTATTGCTGTATGTAAACTCTTATTGAAATTGGTATTTGTTTTGAAGGGTCTT
ATTTCACATTTGTATTGATAATTGTCAAAAGGACCTCTTTTAAAAACTTCTGCAAATTTT
TTTCTTCAAATTCTATGCATTAAGAGTTAAATTCCTCTTACTGTAATAAAAGCAATTGAA
GGAGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 89717..89801, 93482..93683, 100038..100146, 100932..101045, 109790..109873, 115893..115997, 122838..122936, 126759..127137, 129308..129403, 134154..134269, 134272..134292, 134874..134951, 135201..135317, 141524..141738, 144118..146947, 146951..150040, 150043..150684
1001..1135, 89717..89801, 93482..93683, 100038..100146, 100932..101045, 109790..109873, 115893..115997, 122838..122936, 126759..127137, 129308..129403, 134154..134269, 134272..134292, 134874..134951, 135201..135317, 141524..141738, 144118..146947, 146951..150040, 150043..150681
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved