Echinops_telfairi Locus XAB1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi XAB1
Echinops_telfairi
XAB1
GeneScaffold_7536
SNORA13
8002..8135
24785
CAAAGGGCTTAAGCCTAGGAACAATTGTATGGACAGCGCAGGGTCAGGCCCTCTTTCGT
TCTGTTGTGCGTAACGCCGCCATGGGTCAGAACTGAGTCAATGGCCCTTAACAACTATTT
GAAAGAAGAGAAAACTGGTGCGGAGAACTTAAGTGACCCCCTCAAGGCTTACACCGCTAA
CAGAGCCAGGGTACAAAACCCTGATCGGCTACAAGAGGCCACAGACTGAGCGGTGGAGAA
CAAGCTTGAGCTGGGCTTTTTCATCAGGTGTCGGAGTCTCCGAGGGCGCTCCTAGGGTAG
AAAACTTTTTTCCGCTCCTCAACTCACGTGCTCCAGGGGTCAAAGCGTTCATCCTCCAGG
TGATGGTGGTTGTGCAGCTCACTACAGGTAGTGGCTGAATCCTGAGCGCTAGGCTCCGGG
GCCAGCGACACACGGGAGCCGAGTCCAAGTGCGTGAGGCTGTTGGTCCGTTTCGGGCTCA
GCGGGTCTCGGCGCTGCCCAGCAAACGTGGGGGCAGTGCCCTGGCTCACCCCCGACCTTT
CTGGTCCTAACCGGTTTAACCTCCTCGGCTGCAGGGGAAGCCCTAGCGGCTCCGCTGCCA
GTTCCTCGGGGGAAGACAGGGAGCCCCGCTCTACTCATTTTCTTCCAGCGGGCAAAGCCT
TGCTTTGGGGATCGCGAATCGTTTCCGCCCTCAGGGTTGACCAGGGCGTTTCCTTTCCAA
GCCCCACCCCCTGACGAGGTCCGCCCCTTCCCCGCATCCTTCCGCCTTGCGCTCGGTTGC
GCGCTCGGTTGCCTGCGGAACCATTGCACCGCCCCTGCCTTTAGTTGGCCCCGGAGTCGA
GTTGGGACGCAGAGACGTTCCGGCGCGTCACCCGGCCCCGCCTCCTCGCCCTCTCCGTGC
CCCGCCCCCTCGGCCTCGCTCTCCCCCCCGTGTCCCGCCTCCTCGACCTCTCCGTGGCCC
GCCGGCTCCTCGAGCGTAGAGTGGGCGGATCTCGAGGAAAGATGGCGGCTCCCGTGGCTT
CGTCGGAGCCGCAGGCTTCGGGGGGTTCTCAGCTCCCGGTGTGTCTGTTGGTGCTGGGAA
TGGCGGGATCTGGAAAAACCACCTTTGTGCAGGTAACCAGGAGAGTGGGGTGGGGGCTGC
AAAATAACGCACGTGAGAGATGGGGGCGAGCAGGCCTAAGGGAAAGGGGGGAAGTCGGCA
GTGGGAGGGTATCAACGCGTGGTTTGGGGGAGGGTCCCGTCAGCTTTGGTGGCATCCTCG
CAAAGTCTTCTCGGACCCTCACTCAGACTCAACTACCAGGGGGTCAATTCTGACTCCTAG
CGACCCTACAAGAGTCAAGACAGGGTTGAACGACCCTTGTGCGTTTCTGAGACTGATGGT
TTGTGGGAGTAGAAAGCTTCCCCCTTCCTGGGGAGCAGCTGGTGGTTTCAAACTTTCTAC
CTTACAGCTAGCGGCCCAACACTTAACCAGTATGCTACCAGGGCTCTAGTCTGGGTCAGT
TAGGACTCTGGTTCTGTGAACCTTCCATGCTCCGTGAGTGCTTCATCGAACTTACCACAC
TGTACCGAATTGCCGTACTGATGAAATAGCGAATTTCTAAAAGGCAGGGATTTCCAGCAA
ACGTCAGCAGCAAAGACAGTGTAAGAACACAGGCTTTTGGGGAAGCTTGATTAAGGGATT
CGTTTTGCGCCTTCTCTAGGCACCGAGGACACTGCAAACCTGGTTGACCAGCTTCCTGCT
TTCATGGACCAGTGCTCATCTTTTAATGAGGGAGACAGGCCTTCATCCTTCCTACACCTC
CCTTTCCTACCCCCAAACGAGTAAAGACTCGCGAGAGAGTAGTAGAAGATGTTCTCTTAG
ATGAGTAATAAAGTAGCGTTTTAACCACGAGCTGCATGTTGGAGGAATCGCGAGCATGGT
GGTTTGAGATAAAGACGCAGAATCCTTCACTCCTAGGCAGTAAACACATGGGCGTTCTCT
TTCGACTCCTTACTGCCCTCCTCTCTCCATTCACCTCCTCCTGTTTCCGCAGAGGCTCAC
GGGACACTTGCATAGCCAAAACTCGCCACCTTACGTGATCAACCTGGACCCCGCTGTACA
TGATGTGCCCTTCCCGGCCAATATAGGTGAGTGAACCCCGCCAGAGGGAACGGATAGCAT
CAACTTTCAGGACTTCATTTTTACTCCTTGATCTAGTTTTATTTCTCTGGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCA
AGGGGGAGTCTTTACTCCAAAAAGATGAAGGGTGGATGTGTCCCGTGTTCATGATCTTTG
TTAAGATTTAGGCTTCCCTGATTCCCAGCCCCTCACTGCTTGTTATTTGACCCCTCCACT
TCGAATCCTGGTAAACTTTCGTGAGCTCGACATATAATGAAAAGGACACTCTGTATTAAA
AAGCAATTTAATTTGGTGGGGAAAATGCTCATTTTCTCACTTAAAGGGTAGATTCTATTG
GAGTAAAAAGTCTCAGTTTTCTCCCATGGAACAGCTGGTGGTTTCCAACTGCTGACTTTG
TGGAGATCTACAGGTGAATAAGTGAATAGGTTTAGTTAGATATTACTGGGTCAATTAGTT
TCTTTTTAAACACAACGCCTGTCACTTAGTAGTAAGTAAACTTTCTTCTTGATTTAGCTC
CCTTGTTGTTGATAGCATCCCCCCCCCCCCCCAGCAGTAGAATGCATGCAGAATTAGTGT
GTTTTTTACATTTTAGATAATAGCAGATTTTGAGCAATACCATATAGGACATGTTTTCCA
CTTGACTTGCATGATTGGATTGGTGGGGTGAGACATGATAAAATATTTAAATTAACATAA
AACTTTTCACCTTATAGCAGGTATCTGCCATATAACTTGAGAGTTCCTGTCCTGACATTT
TTCATGGGTTAGTTGGCAGGTACCCTTTGTAAGTGAGAAAACCAGTGTGCAGGTGAAGAA
AAAAATGGTAGAAAAGAAATCTGATGGATGCCTACGTGGCTAGTTTCAGGTTCTGGTTGG
TGGGGACAATGCTGACCAGGTGCTCGTTGTCCTTTGGGTCATTCTCAGGGTCTTGCTTCA
TACACATTTCAATGCGCTAAGCTTTAGAAGAGATCAAAATTAAGGACAGATTAAAAGTAA
CTCATACTCCTGAGAAAACTTCCTCTGAGGAAATAGAGATGGTTTGATGGGCTTATTGAC
TTAAGACATTAAAGGTCTGAAATTATATTGTTGTTTTTTATATGGCTTCCTAATTTCTTT
TTTTCTTTTAGATATTTGTGACACAGTGAAGTATAAAGAAGTAATGAAACAGTATCCTTT
TCCATATCGGCTGCAGTGTGGACTCATTCCTGGCTCATTGATATCTGGGCATTTTATTTT
TTTAATTTGAAAGCGTGTTTTTGCAAAACCAAGTGTTTGATTCTTTTAAAGTGATTTCAT
TAGGGGAGATTAGGCCTTGTGGGTGATCAGAAATACTATTCCAGCTTGTGGTTTCAGTTT
TCCTACCATTTTCCCAGACTACCAACTGGTGTAATTCGAGGGTTGAGAAAGAGAAAGCCG
GCTTGGCGGCATGGCCTTGAAGGGCATGCTTGCTTAGTGGCCCACCACGACTTCATATTG
GGAATTCAGATATGAGTCAACTTTGGGGGGATTAATTCTTAGTACTTGTTGGTAGGTAAG
TCTAGGCTGCTGTGATTGTGGGCCACCCATATGATTCTGACTCCCTTCTGCCCCCTAGGC
TTCGAGCCACTGAATTCACCCACTACCAGGATCTTGATTCTGACTAAAGCGACCCTATAG
TGTGGTTCCCATTCTGTACATCTTTATGGGAGCGATCCAAGAGACATGGTGGTATAGTGA
GTGGTTCCACTTTGGGCTGCAGTTCCCATGGTCAGCAGTTCAAAACCACCAGCAGACGGC
TTTCTGTTACCGAAAACAGTGACAATCTTGGAAACCCACCGGGGGTCTATGATTCAGGAT
TGGTTTGACGTCAGCGAGTTTGGTGTTACGGGAGTAATAGCCTCATCTTTTCTTGCGGAG
TACCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGTCAATCCGTCTCATTGAGGCCTTCCTTTTTGTGATGTCCCTCTTCTTC
ACCAAGTATGACGTCCTTCTCCAGGGATTGGTCTCTGAGCACATGTCCACAGTGTGTCAG
ATGAAGTCTTGCCATCCTCGCCTCTACAGAGCACTCTGGCAGGACGTCTTCCAAGATTTG
CTTGTCCTTTTGGTAGTTCATTGTATTTTTCAATAGTCTTCACAGCTCCAAGACATTCAT
TCTTCAGTTTCCTTTATTCAGTGTCCCAACTTTCTCAAGCATATGAGGAGATTGAAAAGA
TCATGGCTTGGGCCAGGCACACCGCAGTCCTCAAAGTAACCCTCTACAGAGGTCTTGTGC
AGCAGATTTTCCCAGTGCAATGCGTCATTTGATCCCTTGGTTGCTGCTTCCATGAGCTTT
AATCGTGGATCCAAGCAAAACAAAATCCTTGGGAACTTAAATCTTTTCTCCATTTATCAT
GTTGTTACCTATTGGTCTGGTTGTGAGGATTTTGGCCGTCTTAATCAAGTATTGGGATGT
TAAGAAATTGTTGAAGGCAGAGTGTGAGAATCGTTGAGTGAATGACCCAGTCGAAGTACA
GCACTCACTAAGAGAGGGGCTAGTCATTGGCTATGCCTTTCCAGAATAGACGACAAACTG
ACTTACAAAGCCAGGACTTTGGGGAAGCTTTTCAAGGCATTTTTTGGGGACTGCATCTTT
GGCTAACTTTTTAAAAACGACTCTCAAAAGTAGGTGTTGCCATTCTTTGGTAATCCTGAA
AGTCAAGAAGCATAATGCTTTGTTGCGCGTCCCTTAAAACCATGGCCACGACCTAGTCAG
CTTTTGCTTTGGCTGTACCACTTCCACCTTGTGGGAGTCAGGACTTTGACTGCCTGTTGT
CTTCAGAATTGTCCTGGTAAAGCCATGTTTTGTGGTCTATCAGCAGTTCAACGAAGACAT
CCTTCAGGATTTGGATCTCTGTTTACATTTTGGGGGCGTGGGGAGCTCCGCCCTTCTCTG
CACCTGATCCGGGCACAACAGCTTTGCCATCCATGGAACAAAATGTTTGTTCCACTTTAA
TTTTTCCGTTAGAATCGTGTAAGCTGAACGAATTGAGGTGTTTGGGTGGCAGTTGTATCT
GCTGTTTTTGTTGGTCCTCTGCACGTAGGGCACGGACAAGACTGTGACTTGCTCATTGAT
GGGGATGGTCTGCCGCTGTGGGTTTCATTTGTCCCTTTTTAAAACAAGTTAGCCGCTTGT
AAATGGATTCTCTGGGGCATTGTCCCTATACACTTTTTCCAAGCCTCAATTATTTCACCG
TTCTTTCACCTAAGCTTCATAGTAAATTTGGTGTGCCCCCTTCAATTTTAGCAGAATTCA
TCTTGTTCTGATGGCTCTTTTCAGACTGATGTCTTAGCCTTTTTAGTACCTCAGGCATGT
TAAACAAGTTAGCACAAGTTGATTTTGGTATAAATTACTATTTTTTAAATCCATGGATAG
GTTTTTTATAATTAGATTTTCCTTGAACTGTTTGAAGAACCCTTGTTTAGGTCGGACACT
GGTATCCCAAGATACCAGAGGAGCACAAACATTAAGTGCAATTTATATGTCCCTCAGGTC
ATGAACAAATTAAATGTAGGTTGTTTAATTAGTGAGGATCAGCAAGGAATACAATTAGAG
TGTCTCAGTGGTTAATGTCAGCAGACTATCGTTGATAAATCTGTTTATTATAGTTGGGTC
AGGTTAGTTTCTTTGATTTTTACCTAGCCATCCTTGAAAATGATAAATGAATGAAGAAGG
CATTGATAGTGGATGTTCCCTGTAAAGGCTATGTGATCTGTACTTGTCAAGGATTGGGTT
GCCAATACCCCTGAATGGAATATCTCCGCCATATGCTGTTTGTGTGATTGATATCCTAGA
TATCAGTTGATAATCTGTAAACCATTTGAATCCTCAACCTAATATCTAGATATGGACTTG
GGCCCAATGGTGGCATAGTGACCTCACTCAATCTCTTTGCTACCAGATTCGATCAGGTAT
GTCTGACTTAAACTCATGTGGACAAAACTTGTGATTTTTAAAATGCCTTGGCTTGAACTC
TCTTGAGAAAGAGCAATACACTAGAACATAATTGAAGAAAATAAGGAAATGCTTTGGTAG
GTAAGTAAGTAGGCTTCGAGAAGATCAGTGCTGTGAAGTGTTTCATAGTCAATATTTGTG
ATAGCTGATAAAACACAAAACAGGCCTTTGTGTTGCCCATTCACTTTCGGAAACTTGTGA
ATGTGGTGTCAAAAAAGGCATAAATCAAATTCTTTTGCAGCCATTACTGCCCTTGAATTT
GGTTTCTTTGGCGTAGGCGTTGCATAAGGAACAGTTGATACCTTTTACAGTTGTTTGTCA
CTACGCTGAATTGGAGTCTGCCAGAATTGAATGAATGGTTTCCCTTAACCAGTTTTAGGA
AAAATAAATTAAAAGTTACAAAATTTTCTGGAATGTAAACAAACAAACAAACCAAAAAAC
ACAAAACCAAGATACCTAGGTTCTTAGGTCTTAATGGCTTTTTGTGTTTGTGGATGGAAT
GGTGGGACGGACGGGAGTGGGATGGGCCACTTGGAATGGAAATGGGGCATGGGGCGGAAT
GATAATGGGGATTTTCACTTGTGGCAGGTATTTGTCATCCTTGTCAGAATAACCATTCAT
ATACTACCCTGATGTGATTTAATGAGTCAGGATAGTAGCATTTTATGGATGTGCCAAGAC
AGAACTTGACAATGATAGAGTCACTCTCCAGCCTTTCGTGTCCTTGTGCTGTGCACAGGG
TGATGTGGCAGTGTGCTGACGTGGATGTGTTTCTGTACATCAGTGAGTATATTGATGCAC
TAAGGTTAAGGACACTGGCACTCAGCAGGTACTCCACCCGAGAAGGCTCTGTGATTTTGC
ATTGGCACCTGATCTTGTATTATTTTCCTCTTAGGTGATGAAATTTATTGAGAAGGCCCA
GAACATGTACAAGTGAGTAGTTACAGTTTAACACCTATTTTGAATTTCTATAATTGGCGT
ATTAGTAGGGGTTGGGAAAGATTCTAGGAAACTATCAAACCCTGAAAGAGTTAAGATTGC
GATGAAATATTTAGAAGAGGAAAAATAAAATAAATCATTGAGATTTGAACCTGTAGAGCT
AAATCGACTATTATCCCATCCCTAAAGTTTCTTTTACACCTTTCCAACCCTTCTTTACAT
GGGTATAGTTTATAAGATTCAGGGAATCATAATTTTTTTTAACTAAAACATTATCAAAAT
ATAAAACAATACTTCCTATTGTCATTACCTGCAGTTACCCAATGCCAGATTCTTAATCTG
TTTTTATTTTCTAAGAAAGAAAATTCATTGTTTTTCTAAAAGACATGAGAGGGCATCAAA
AAGTTGGTGGAAAATTTCAGTTATCTTTTAATTCCACTTTTCCATAAATTTCTCTCTCAG
GGAATTTTTGACAATATCATTTAGCAAATGTCTGCAGTTCTTTACATAAAGCTTTCTCTT
CTGTTTTGTCAATTGTTATTCTTCATTTTGGAGATCTTGAGGCTTGATATTTTTGTAATG
GGCTGAACACACTGCCATGGAGTCAATTGCGATGCATAGAGAACCCATACAGGGTTTTCA
AAACTGTAAATCCCTGCAGAAGCCGACGGCCCCATCCCTGTCTTGGGGAACTGTTGTTGA
GCCGGAACCACTGAGCGTGCAGCCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCACGCTGAATGGTAGCCTCATAGTAGCCATAAACTTTTGAAGCCTATCGTATCTGC
TCATATTAAAGAATTCCAAACCACGCACTACTGAGTAAAAGAAGAAACAGTCATTCTGAT
TCCTACAAGAAATAACTCGTTAATATTCTGTGACTAGCCTACCATATTTCTACGCCTACA
TCTATCGGTAGAAAATCGAATAGGATGCATTTCGTAAATACAGGACATAACAAGAGATAC
TTTGTTTATTAAATAAAGCCTTTACTGAGGTATTGTTAACATACCATAAAGCTTACTCTT
TTAAAGTATACAATTTAGTGGTTTTTAGTCACAAAATTATCAGTTGTCATTCCTTGACAA
AAGAAGCCCACCTATCATTAGCCGTCACCCCCTATTCCAGCCGCTGACAATCACTTTCTG
CTCTATGGGTTTATCTGTTGGGGACATCTCATGTAAATACCCATCGTTCATGTAAATACC
ATCGTCATACCACATGTGGGCTTTTGTACTTGGCTTCTTTCACGGAGCCCAATGTAGTCA
AGGTTCATTCTTGATGTTGCCTGGAACAAGACGTACTTTTACAGCTGAATAATAGTCTTT
GTTTGGATATACCACACTTTGTTTATCTTTCATCAGCTGATGGACATTTGTATTGTTTTG
AATTTTTGTTTCATGTGAATAATGTTGCCATGAAAATCCTTATGCAAATTTTTGCGTGCA
AGTATGGTTCAGTGCTCTTGTGTATGTATTTAGAAGTGGAATTGCTGGATTCTACAGTAA
TTTGGTGTTTAGCTGGGGAACTGCTGGAATGTATAAGGGTTTCAGTTTCTTCCTATTCTT
GCCAACAGTTGTAGTTACTTGGTTTTTTATTTAAAAAAAAAAATCTGGATACACATCATT
CCTACTTTTTCTTTTTAAGGTTTTTGGTTAGCTCTAGCTGATAACCAATTGGCAGGCCGA
TGCGCTGTTAATTATCCCCAAACTCGCTGCCATCGAGTCCGTCAGGACACAGTGACTCCT
ATGAGTTTCTGAGACTGCGACTGTTGACAGGAGCAGAACTTTCTCCCTCGGGGCTGCTGG
TGGTTTTGAACTGCCAACCATGCAGACCGCAGCCCAAAGCGTGTTTAGTATTTTTTCATT
TTACTCTGCCCCCACAATCAAATGAGTTCAGTGCTCATGTTTTTTAAAACCACGTTTTTA
TTTCTACTGTCTATATTTTAAGTTATCTCTTAGTTGGTAGGATTTCAATGACAGGAAATT
CAATCGTGGTTTCCCCTGAGTTCCAAATATCTACCTATATTTTGAATTTTGTGTGTGATA
TTAGAGCCGGACATAAAAGTCACATTTTCTTTCTCAAGCTTTTTCCGTTTTATTGTTGAA
GTGTACTCATTTGATCTATACATGCCTGTCTTTTGCCTCACTGTTGAACATGCCATATGA
AAACATCTAGGAGCATTATATACTCTTTCAATCAGATTTAGTTCTTCATTTCAGGAGTTT
TCTTGTGTTTTATCTTGAAAAGCTTTTTCAGGGACTTCAGTTAACCTCTACTGTGGGTTT
TATTTATCCGGCTTTCCTATCTTTTGGATTCTCCCTAATTGCTGTAACTTCCTTGCTTTT
TCACTTTTTAATCTATGTTAATATGTATTATTGAGCATTTCGGCAGTACAGGTCTGGGAC
TAGGGTGAGGGAAGGGAGAGAGGGCCCTGTTGAGTGAAGTCCCAGGACCTGCAAGAACTG
CCTAGACATTCCGTTTCCTGTGGTTTAGTATGCGTCTTCACCTCCGAAGTCCTGCTTGGA
TTGCATTTCAAGGCACAGATATTTCAGGCAAATTATGTTTGTCTGCGACCTGAGGGAATG
GCCAGGGGAAAAGGAGGGCTCAGTATAGGGTTGGCAGTCTTTATTGAAAAACCTTGATTT
TGCTTTTTCCCTTCGGATTGTGTGAGGTGTGCTACAATCATGTTGGGGCGGGCACAGTTT
CCTGAGAGGAGAGCCAGCCTCCCTGTGGCTTGAGCTGGTTTCCTCATGGCTGCCGGCGAA
CCGGCTCCATATGCTCAGTTGTCTATTTCCAGACTTGGGGACATTTGTTAGAATTCTTGG
CAATTTGTAAGCTTACCAGTCAAGCTTCCGGGTGTTGATGGCGGGTTTAGGAACAATCCT
TAATTTGTCTCTCTGCTCCAGAAGGTTCTCTTTCTTTTGAAGTTTATAGGACTCAGTAAT
TTTTTATTTCAACTTTGCTTATTCAAGGGTTTGCCCTCACCTCTATTTTACTATTTAAGC
CCCTGACCGCTTTGGTGTTAAAAGAATGAGTAGCAACNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTGTCTTT
GATAATAGAATATATGTCAATAATTGCAAACGTTTACACACTAGTTTTAGCATCCATTGT
TAGCTTTTGCCTGAATAATGATAAAGGTTATCAAGTGATGCTTTCTCATGCCATCTTTTT
TTGTTAGCTGCCTTTTGATTGAAAGGAAGAGCTTTTGGTTCTACTCCATTTTTTTTTAAT
TGTGGTAAATTACACGTAATACAAAACTGATCATTTTAACCAGCTGTCAGATGTCATCAG
TGATCTTACAAGATGGTTGGTGAAGAGATTTACATTCTGGTTGGCTTATCCATTTTCATG
CAGTGTACACCTAGGAGTAGCACCATTCCCCTCTGATCCCTTAGAGCTTCTCCTGCCGCT
AGCATGACCAGCACTTGAGGAATGTGGTTGGATTGGGCCGTGAGCAGATCCCCTTACAGT
CTCAGGTTACCGGATAAGTAGTATTTAAAAGACAAGTAAGATACATACGTAGTATTTTGT
GTGATGGGATATCTCTCGGCAGTGCACACGTTTTAACACTTGTAATGATCTTTCTTGACA
CAGATATGTCTTGATCGACACACCTGGACAAATAGAAGTATTTACCTGGTCAGCTTCTGG
GACAATCATCACTGAGGCCCTGGTGAGCGCTCCAGGGCCTGTTTCGGGAAGTAACTGGAG
GACTAGACTGCCTGGGATTTCATATGAGGGGGCCGGAGAAGCTCTGCGTTCCCAGCCTAG
AGTGGCTTTCCCTTACTCCGGAAATTGGGAGTTGTTTGGGGGAAAAGTCATGAGTCCTCT
GACCAGGCTTTGGTTATTTTTGTGGCTTTAGGCATCCTCATTTCCAACAGTTGTCATCTA
TGTAATGGACACATCACGAAATACCAACCCAGTGACCTTCATGTCCAATATGCTCTATGC
GTGCAGGTAATTGGTTGTGGGCATGGGAGTCCAAGGCATAGGTCTCCTCCTTTTCGCGTC
TCTCCCTTTGCTTCTGTAATGCTACTTAGTCCCGAGTGCTCACCCCCAGATGCGTACTTC
TTCCGATTTGCCACTCCATGTCGTAATTGTGTTGGGGAGGTCAGAAAGGAAAAGAGGCAC
CCATGGCAAAGACGTTTTCTACAGCGATTGCCGATCTTCCGTAGCTTGTTACAAAAGTAG
GTGGTATATGACTATGAGTCTTCTGGTGACTACCCCCAGGTGAATGGAATCCAAGTGTCA
ATAGAACAGGGCTCCCTGGTCTAAATGCTGTTTTTGTGTGTTATGATAAGTAGGATGAAA
TTTTATGTGAGGAGAGACTGAATAAAAAGATGCATCTGGGACTCTGAAACACAGAGGTCT
GCATTAATGACGGTGCCGTAAGATGAGAATGGACATGCCTTCACTAAGCTGTGTCTCCAA
ATGCCATGCACGCTGTCTCTTCTGATAATAGTTAGAAAGCCCCTTCTGAATAGAAGGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGTCCCC
TGTGCTGTGGTCCTTAGACTGCTCACTGAGGGTCTGCCTCCAGCAAGAGAACGGAGACCT
CCTTGTAATTTTATATGCTACGTGCCAGCTTGAGCTCTCTGTGCTTTGTATGGGAGAAGA
GGGAATGAGGGAAGAGGAAGATACGGATGATGTGATACAAACTTCTGATTAAGAAAACGG
CCTTTGCCGTTGTTGGCTGTCTAATCTTATTGCCGCTAACTGTCTTCTCTCTGGTACAGA
CTGACATCATCGATCACAGTTTTGCAGTGGAGTGGATGCAGGATTTCGAGGCTTTCCAAG
ATGCCTTGAATCAAGAGACTACATACGTCAGTAACCTGACTCGTTCCATGAGCCTCGTGT
TAGATGAGTTTTACAGTTCACTCAGGGTAAACTTTCTCTCCTGCTCACAACTGATGGTCT
CGCTACATTACCTTTTTAGCCTTTGAACTCGCTTTGGACCAACATTCGAGGAAGTTGGCT
ATCTTCTGACACATTTTCAAGCACGATTTATTAAACACTGGAGGTTTCTGTGGAGGCCTG
GTGGTGCAGTGGGTTAGCTGTTGGACTAGGAACCACGAGGTCAGCAGTAGAAAGCACCAG
ACAGTCTGCAGGAGAAAGATGAGGCTTTCTGCTCCTAGAAGGAGCTACAGCCCTGGAGAC
GCACAGGGGCCGTCCTCTTCTCTCCTAGAAGGGTCTTAGGCGTTGGAGTCAACTTGAGAG
CAGTGAGCGTGGAGTTTGGTTTGGTGTGGAGATTGAAAAGACCAATGAGCCCAACACCTT
TCCTCAGCACTTACGATCTGGCTAGGAGAGAAAAGAATACACAGAATTGAAGCCTGAGAG
AGTAGCATGGTCAGTACCTGTAGGAGAGGTCAGAAGTTGGCTGTGATAGCAGTGAAGGGG
CAAGTCCCCTTCGAAATGATGTTTTGGAGGCAGTAGCCTTAGAGTGACGCCCTGGAGGAA
GGATAGAATTTGTGTGAGCACAGGTGGGTGTGAAGGGCAGGGAGCACACAGTCCCCGCAT
TACAGACATCTAACTTCCGTACAAGCTGAAGGACCTAACGTGTGACGCATACTTACATAT
CAGCCCCTCTAAAGCTGTTATATTAAATGTTTGGTGGTATATAATAAGTGAGTGCTACTT
TACGATGTCCATCAAAACATTTTTATTGCCCTATTATTTTAAAGATGTTTCAGTGTAGAG
TGTTTCTTTAATATTATTACACATGGAAAGGTAATTATGCACTAAGCCAAACATTTAACT
GATGTTAGATGTGAAATGTTCCTAACTGTTCTGGCCTAATGTGCAAATTTGACTTAAAAG
ACATTTGGGATGTAAATGGGGGTGGGATCCAAGGATAGTTATATCTTTCTAAGCAACGGC
CTGAGATACTAATTTTTACAGAGAATAGAGTGGTGTGGTATGGAGTCGATAGCCCTGATT
GATACCATAGTAGTTAAGTCCGAATTATTTCCTTTCCAGGACCTTATTTTCTATAGACTT
ATTTCTGTGTCTTTTGACTAAACATGTCATGTACCTAAAGTGTCTAAACTGCTTCTGAAG
GTTTTCTGACATTTGAGTTGAGTAATACGCATTAATGAAAAGTACCTTGTTTCCTTACTG
GCGTTTATCATGTTTTGGCAGGTGGTCGGTGTCTCTGCTGTCCAGGGTACAGGCTTAGAG
GAGCTCTTTGTGCAGGTTACCAGTGCTGCAGAAGAATATGAAAGGTGAGGGGAAAGGGCC
TCTTCCTGAGGGCATTCTTGGAATTCTGATTGAATAGCAGTTTTACCAGACAGAGCACTT
AGGTTTTTATGGGGTCTGTGATATATTTGCCCTGCACGTGTGTATTGGGTCTGACCACAT
GTCTGGGCAACAACTCCCATTATCTTTCTGAAAAAGTTTAAGTCAGCGGTTCTCAACCTG
TGGGTCACGACTCCTTTGGAGATCGAACGACCCTTTCACAGGGGTTGCCCAATTCATAGC
AGTAGCAAGATTACAGTGATGAAGTAGCAATAAAATAAATTTTATGGTTGGGGGGCGTGG
TCACCACAACATGAACTGTATGAAAGGGTCATGGCATTAGGAAGGTTGAGAACCACTGGT
TAAGTAGGACTTATAAAAGTCTTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAAAAGCCCTTGCCTTAATTGAGTGAATGAACAGTTGTATAGATGCGATGAGAAAA
AGAGAACGAGAAAGAATGAGTGAAATTCTTTAAAGTGAACATTAAAGAATTAACAAAGGA
GTCAAGCCCTTTTACCAATGTGCTTTTCAGTTTAATTAAGTAGAATTCCTAATAAGAATT
CTTGATTGTTCTTTGTCCTTCAGAAATCTTTATCAAGCCTAATCCTTTGACACTAAAAAA
ATATTCCCCGTAACCTTCTGCGCTGATGCCTCTGATTTGAACTGAGCTGGAGCAGCACGT
CGCCTAGAGCCTCGTGATAGTTTCATGTCAACTTGCGTAGCACACAGGATCTAACATCGT
GTGGTCAACTCCATGATGAACTCTTTTTTTTTTTAACCCAAAGAAAAAGACGCCTTTTGT
TTTCATCTCCAAACAACAAACTGTTGACTTTTTATTCTCCCAAAATAATCATGATTATCG
TGCACAAAAATTGGCATTTACAATTTACAATGCATCTTCAAAGTATTTACCTTTAATGGG
AAACTTAGCAACATAGTATCTCAAAATTAAAATGTTAAAAAAAATCCATCTTGTTGCCTT
CATAAAACTAAAGAAAAGCAAGCATAAATCAAGAAAATCCATTCGTACTTCAGGTCCTTC
TCCAGGAGCAGACTTTGTTGTTATTTCCATTTAGCAGAATCGGATCCAATTTAATAATCT
CCTGATGTGATTTCAAATTCAGTGACACCTCCCATTACCATATTGACAAAGTCATCAAAA
CCTAGAAGTGTGCTAACAGTTTCCTTATCACTCGTCATCACAATGTTAATTCTTGATCCT
GTACATTTGTCCACAAGCTCTAGGGGCAGCACCTGCGATGGGCTGGTAGTAGCAGTAGCC
ACCAAGGCCACGCCAGAACCAGAGCTTGCACTTAACCATTATGTCCTAATCCAGGAACAA
TCTGTTCTTAGGATGTGGCTCTGCTCAATACTTATCCCCATGAAATACTCAGGACTACTG
AAGATACGGATGCCATAGTGCAGTGTGGTGAAAAAATCACATGGTGTCCAGCCATCAGAA
AGATTAACATAAAAACAAAACAAAACAAAAAGATTAACATTGGGGGCTCTTAAAAACTTG
ACCTAAATTTAAAACAAGAGGCCATCCAAATCAGTGTGCAAAAAAGCCTATGCAGAAGCA
CGCCATCCTGTGTGATACAAAAGTAATAAATAAGAAAACCAAAGATCAGAGGAGGGAATT
GTGTTGGAGCTTAAATTCTGAGCACCTGGTTTGCAGAATCCTTTGGATGAGTGCCAAAAT
TAATTTGCAGAGTCTCCATGGGGGTTAAGTCTCCATTGAATTTCCTTGGACCATTGACCT
TGGATGTGAATAGCGTTGTCCTCAGAGAGAGTGCAGTGGAAATTGAATCGCTGCCGATGT
AGATTACCTATATACTTGAGTATAAGCCGACCCGGATAGCAGCCGAGGCACCTAATTTTA
CCACAAAAACTGCATTAAAAATGTGCTGAACAACTCGGCTTCTACATGAGTATATACGGT
AAATTTTAACATCTTACTGTTTGCTTTCTCATTTGACTCATTTTAAATTTGTTCTTGTTT
TTATTGTGCTTTCTTTTGGATGGAAGGTTTTTGTTTCATTTGGTTATTGGGATTTTTTGT
TTGTTTGTTTGGTGTGGTTTTATTTATATGAAATCTGAGATAAGTAAATCTGTAGACAGT
AGCTAGATTAGTCCTTTCTTAGAGTTATGGCAGGGGGGGTTTGGGGAAAAGGGGAGCTAA
TACAAAAACGAAGAAAATGTTCTAGAATCGATTGTGGTGGTGACTGCACAAATCTTTACT
GTATCCAAACTATTGAGTTGTGTGGTACATGAATTATATGCCAGTAAAAAACAAAACAAA
GTGTACGTTCAGAAACAAGCAGCAGCTTGAGTTTGCCATGCTTCTATGACCGAGCATAGA
CTTGGATTCAGACAGGTGTAGGCTGGATTTCTGACTTAATGGCACGTTTTCCTCATTTAT
AGACTAGGAATATACTTTTCGCTAAGATTGTTTTGAGGAGTATTTGAGAAAATACATATA
AAGCATCTAGTATAGTTGCTGACACGGAGTAAGCACATTTCATAATAAGTGGTTATTAAT
ATTGTCAAGGTATTAACCTTGAATTCCATTTACTTAAAAGAAATTGTTCTCAGAACACCT
GTATACTCTCTTAGGCCCATAGCTTAACTCTAGACTGCTTATTAATATGCTGCTTTGGGC
TTCTTATTTAGCAAAGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NATACTGTTCTGGATGCAGAAAGGCTCCTTGATATTTTTCTCCTGTATTTAATTTTTAAA
AACCCTATTTTTCTTTGTGCTTCTGTGTCCCCCACCCCTTTCCCAAGGTCCATTTCAAGG
CTTGTACCGTGTTTTTCTAGTCAGGAGAGAGCGTAGTTCACCGCTTTTGGCCCAGATGAT
CCCGGGTCCTGCCTCCTTGGGCTGCCTTAGACCTTTCGCTGCAGAGTTTTCCACTACGTT
TCTGCTCCGTCTAATTCAGCCGAAAGCTCTGCTATATAGGCTGGGCCCAAACTACTCCCT
CTCTTGGTCCCCAGGTCAGGTATCCCTGATCCGCTGCAATACTTAATTGTCCTCTAGTAT
CTGTGTAATTGCCTGACTTCACTTAGGAATCTAACATCGAACTTGAGGCTCCAGGAAAAT
CAGCTGTTTTCTCTCTCTGCAAAGGCCAATACCCAGAGTCAGCAGCAGAAAGAACAATTG
GAGCGCCTTCGGAAAGACATGGGTGCTGTGGCCTTGGACACGGGGACTGCCCCAGGTATG
GGAGGGTCTCTTGGTGTCAGAAACGAGAGGAGAGTGCACTTCTCTCCACGTAGCAGGAAT
ATTGCATGCATATGTATGTGTATGTATATTAAAGAGGCAATGATAAAATGTATTTTTTAA
AATGATTTGGAATGGTGTAAACACCTGAAAGATATATACACCTGCACTTTGGGGCTTAAG
GAAGTTTTTGTCAACATTTTTTAACACCATCCTAATTGTGTTTTTAGTGTTTATTTTGAC
CTAACTTCAGGTTTAAGAGAAGTGATGCATACAGTACAAGCATGGCCATACACCACTTCA
TCCAGTTACCTTAAACATTACCTACTTCACCCGGTTACCTTAATTAAACATGGCCTTTGT
ACCTCACTTACACATCCTTCTGTGTCATCAATAACATATAGTACTTACAAGTGTATATAT
TTATATGTAAGTTTTTATGCTCATAAAGATATAAACATATGTATTTATACTTTATATATA
CACAGATGTTACTAGTTTCCGAATCAGTTAAGAGTACATTAAAATGACTTACCTTTGCTC
TTGAATCATTCCAAAAGTTTTCTTAAACAAGGATTTTATCTTAAACGAGGTGACATCTGA
AAGTTTGCTTTTTCATTCCATTTTCCATCAACGTTTTGAAGCCCTCCTGCAGTTGTCTAG
TGCGCAGACCTTCTTTCCATGTTGGACCTGTAAGCATTTTTTCCCAATGGAAAACCCTGA
CTCTGAGCTGCGTCCCTTTGCCGACCGTCTTCCGTAATCTGGACCCGTTCCTCATCGTTT
CTCTGTGTCCTGACGCTTGGTGACTTTGAAGCCAACAGTGGAGACCAGTGATTTATTAAA
TTGGAGATAGCTTGTTTCAGCAAAATAAGCAACTCGTACATCTGATATACATCTGTGGAC
CTTGTGCCTCCGTCCATCTCCACATGATTTTGATGGACTGCCCTTGGATTAGTAGTGCAA
GGCTGTGGCAGCTCAGTGCAGCTCTGCATCTAAATTGGATGTGCTTTGGTTTTGTCTTAA
CACTAGCATTTTCTTTCCCCCTTGTGCATGTTGCTTTAAGGAGTGAAAGTTCTATCAAAC
GTGTTTGCTGTCCTCCTGTGTCTAGAAGAGACGCACAGAACTCACTGGGAGGAGGAGATG
CTGGGAACTGGCTGGCTTTACTCAGCTAAGTCAAAGCCCTCCTGTTCATACTTGTTGCGC
ATCTCTGTAATCTCAATTTCTCTGTGCCATGGGCCTGGGGAACATTCATGCATACACCAA
ATATTAAATCTGCTGCAAAGGGCCTGCTATGTTCACAACTGGCTAACTCTCCTGTTAAGG
GTTGGGGGATTGTCAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCATTGCACTCCC
TCCCCCAGCACCTGAAGGGCGCTCAGATGTCTCACATTCTTGAATAGAGTGGTCAGGCAC
TTGTATTTAATCACAAACACTTTTACCTTGTCAAATTATAATGGTAGTGACTGATTTAAA
ATGGCTTTTTGGTGTGTGGAGTCACGTAGTCATGACGTGTGTTTTCGCCAGACAGCGTAT
CTTCTGTGATGGACCCTTCTGACTTGATCCTGACCCGAGGAACCTTGGATGAGGAGGATG
AGGAAGCAGACAGTGACACCGATGACATTGATCACAGAGGTGAGAGGAGCCCGAGGTGGC
TCACAGAGACAAAATTACTGCTGATCCCACAGTATTTGCTCAGAAGCCTCTTCCTGGGAG
GAAATATGCAGCCAGTAGAGAGGAGAGTGTAAAGGATACAGCACTAAGGAAGCTTAGGAC
ACGGAGAGTCGCTAGCCTTCCTAGGAAGGGATTCATATTAACATGCGGATATGCTTTTAT
TGGTCTTACATCATCTCATCTTTTGAGCCTAACTCAATTTGAGGAGTTCAGGATTCTGGT
TTGTGGGTTTTGCTATTGTTTTGGGAATATGAGGGGACTTTTAAAAGTTCTTGGAAAAAT
TACATTATCTTTTCTTTCCATGTTCCATGAACTTTATGAAGCCCTCTCTTATAAATAAAT
AGTCCCCAATCAGCCAGAAAGGGTTGTAACAGTGAGGGTGCCTGGGCTCTGGCTACCAAT
CAGTATTCTACTTGGCACGGTTTTATGGGCTGTGAACAGACACCATTTCTTGAAGTAACT
CTTCAGATTTCGGTCCTCGTACAACCAGGAGCAGTGCTTCCTTACTCCTCTATGCTGACA
TGTAATTCGCTTCATTTAGTCAGATTTATTGGTGTATAATTTATACATCGTAAACCTCAC
CCCTGAAAGTTCCTTCCTCCCTCTTTAGACCGCTCCGGCAATGCTTGTTCTGCTCCCTGG
GCCTACACTCTTTCCTTTTCCAGAATTTAATCTAAGTAGAACCACATAGTACTTGGCTTT
TCGCATTTCACTTCTTTCACACAGCAAATGTGTTTTCCCCATCCTTTAGAAAGTTTGTGT
GCACTTTGTATCATGAAGCAAAATGCTGTTTTTGAGTAGGTGTTTTGCTTGAGTTTATTG
TGTAATATTCCATGATTTGGATGTACTACAATCTATCCATTCTAGTTGCGGGATGTTGAG
ATCATTTCCAGGTTTTAGCTAGTATGAATAAGGCTGCCGTCAGTATTCACAAATAGGTCT
TTGTGAGGACCTTCCCTTCCTCTTGGGAAAATGTACCTTAGAACTGGGCTCTCCTTATTG
ATCCCTCCGAGGTAAGCATGCTCCCTGCTCAGGAGTAAAGAAACTACATTTTGGGCCACC
CGGTTAACTGCATGTTTCCTTGCCAGCCGTGAGCACTTTTGTTTTTTAGGCGGGAGGGTG
TCAGCAGCCCTAACCCACCTGTCTGATAAGATTGACAAAGCACTCCTCTCTCCCCTGCAG
TTACAGAGGAAAGCCGGGAAGAGCCATCGTTCCAGAATTTTATGCAAGAGTCAATGGCAC
AGTACTGGAAGAGAAACGACAAATAGGAGAGACTGGAGGAAATATTTCGTCAGTAGTTTC
TTGAAGTCCAAGGTTTTGAACTCTGTACGCAGGCACTCTCCTGCCCTGGCGGGGGTGGAC
GCAGAGGTCCCTTATTAGAAATACATCTGAGACTTGGATGAAGCCAGGGCTAGAAGGCCC
TCGACACCTGGAAGGCAGACGCTGCTTTCTCTTAACTTTCCCTTAGGCAAGGATGTACCT
TGGATGCTCTTGGAAGCTGATGTCCCTTCAGGCCTGAAACAGCTTCAAGTTTTATTATTT
AGAATTCAAATACCTTTGCTGCTGATGGACATGTGGATGAGAGTGCTGTTACTCTGTTGA
CTTCAAGTCTTTTTGGTTGGATCTGTAGCTTTTACTTTCCTGGCACCTGGCTCTAGACCC
TACGCTATGAATTCCTCTGTTAGGAGCCAGGGGGAGGGGGAACTTAAGCTTGCTCAGGAG
CAGTGGAGTCTCCTTGGCGACCAGTCCCTGTTGGTCTGAAATGTGACTCACACTGAGCAG
ATCATTGTAAGACGGCAGGGCTGTTGGAGACAGGATTAAAGCAGAAGAAACCCTTTGATG
ACTTGGATAAAATGTTTTCCAGCTCATAAAACCTGACCTGTTGTGATTTCAGATTGGAAA
ATTCTATCATTGCAAATAGATGTTTCCTGTTCAATAGGGAGGCCACATGTCCAAACCTGT
CTAAAGGAAGGAGGTGATGTTTGCCAGTCCTTTGTGCATACATATCTAGTGACCAGGCAT
ACAGCCAGGCTCTTTGTATTGTATTTTGAACTTCTGAAAGTTTTGTTGGTGATTTACTCA
ATGCCATGGATTTGGGTCGTGTGCATATCCCATGTTTCACAGCCATGGTAAGGTCTGCCC
TACCTCCACATTTTTTATGGCATCTTAAAACAGTATTTCTTTCTAGAATAGTGGTTCTCA
ACCATCCTGATGCCACGAACCTTTAATACAGTTCCTCATGTTGTGGTGACCTCTAAAGGG
GTCATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1111, 2032..2125, 3911..3950, 7729..7795, 8734..8771, 12783..12861, 13051..13145, 14011..14056, 14639..14785, 16041..16123, 19520..19559, 20604..20694, 22371..22478, 23700..23785
1001..1111, 2032..2125, 3911..3950, 7729..7795, 8734..8771, 12783..12861, 13051..13145, 14011..14056, 14639..14785, 16041..16123, 19520..19559, 20604..20694, 22371..22478, 23700..23782
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved