Echinops_telfairi Locus C5orf42
snOPY snoRNA Orthological Gene Database
Echinops_telfairi C5orf42
Echinops_telfairi
C5orf42
GeneScaffold_6048
SNORA63
28623..28755
153978
GTATTAGATCAAGCAATTTGAGAGCATTAGTGAATTGGATTTGAGCAAACTATACAAAA
TATAAAGAGTTGGAAAATTTGAATAAGTTAAATTTCATTAAGGAAGACAGGAAGTCTCAG
GGAATTCCAGTATATTCACATCAAATTCTGAGTGGTGACCACCTCTGGGGACAGAGAATA
GCATGTGATTGGTACACAGGGAAGTTCAGCTATATTATATTGGTGGTAATTGTTTAAGTC
TACACCATAGGAAAATATTAGTATTTGAACAAAGCCGAGAAGTAAGTACATGAGTATTTC
CCTATTCTTACTTTACTGAATATGTAAGATAGTTCATAACAGGGAAAAACTATAAATCTT
CTGACCCACCACCTTACATCTGCTTGCATCTTACCTTCTAGCATGTGTCCACACATAGTG
TTTACATAACCATAGCCATACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTTGCATGG
TTCTTAAGGGCAGAGATCTCAAGCTCTGATTGCCTGTAAACTTAAGGTAACAAGAATATT
TCATACTTTTCCGCCTTTAAGTTTAATGCTTTTCATGTTAACAAGTGTGACCCATTTTTA
TTAACTTTTTCAAATTTGAAATGTTATCCTACAAAACAGGATGTGAAGTAGAATATAATT
TTCAACTGTTGTACCGAATTTTGTATTTGGTAGATCCCATTGAGGAGGAAGACGCAAATC
ATCTCTGTGGGTCAGTGCAAGAAGTCCTGAAAGCAGCAGTGATGGCTGACGCAGATATTC
TCTCAGACACATTTCAGCTTTTGATCAGCTCTGCCAAGGACTTCAGTAAGAGACTTTGGG
GCTTAGTGCCAGCCGGCTTGTATCTTCCAGCTCCTCCATTATATTGCCCTCAGCCAGCTT
GTCTTAGTGAAGTAAGTTTGGTACATTGAATTTAAAATAAATTTTGTCCAATTTTAAAAT
AATTAAGACTCTTCAAACTGATTAATAGTACACTGCTGTTTACTGTTGCCTAAGGAGCCC
TGGTGGGGTAGTAGTTACTAGTTGGGCTGCTAACTGCAAGGTCAGCAGCTCAAAACCACC
AGCTACTCTACAGGAGAAAGGGGCTATCTACTCCTGTAAAGAGTTACCGTTTCAGAAACC
CAGAGAGGCAGCTTTCTCCTGCCCTAAATGCTTGCTATCAATCAGAAGCGGCCTGATGGC
AGTGGGTTTGGTTTTAGGATTTGCATATATACGGACACATAGTAGCCCTAGACGACAGAG
TAGAACTGCCCCATGTTGTTAGGTATTGTCCAGTTGGTTGTGACTCATAGCAACCCTATG
TACAAAAGAGCAAAACACTGCCTACTCCCGCGCCATCCTCACAACCATTCTTAGGTTGGA
GCCCACTGTTGCAGCCACTGTGTCAATCCATTTTGTTGAGGGACTTTTTCTCTTTCTCGC
TGCCCCTGCCATTTATCCCTACCATGATGTCTTTCTCCAGGGATCTAGAGGTTGTACAAA
CAGAACAAAGGAAAACTTCATGGTTTAAAATCAGAGAAGGTATGTGTCAGGGTTGTGTCC
ACTCACCACTTATTCAGTCTACATGCTTGTAGTATTAAGTTTTTTGAGATGAGGTGGAGG
AGTCCAGCCCCCACCGCTACTACTACCCACGGGTTCAGTAATGCACAATTGTACAGTTGA
TATATATATATACATTTAAGTATATATACATTTAAGTATATATATATATAATATTTAAGT
CATCGAGAGTATGAGCGATAGAAGAGATACTACATTAATGCAGTCAGACAAATTACACGG
GTAGCATTGCTCACCTGAGCCCAGCTTGGTGGTTCACGTGGAGAGGGGGGGAANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACAATCGAGA
ATCAAGTGATGTATTGTACTGGGCAAATCTGTTGCAAAGAACTCTTTAAAATGTTAAAGA
GCAAAGATGTCGCCTTAAAAAAAAAGTCACCTTGACTTTTTAAAAATCATTTTATTGGAG
GCTCATACAGCTCTTATAACAATCCATGCATCCATTGTCTCAAGCACATTTGTACATAGT
TGCCATCATCCTTTTCAAAACATTTTCTTTCTACTTGAGCCCTTGGTGTCAGCTCCTCTT
TCCCCCACTCCTCCCCCAGTCACCTTGAATATTAAGGTGCACTCGACTGATATTTTAAGT
TGCCTTCTATGTGTATGGAAGCTGGACATTGAATAAAGAAGACAGAAAAATAATTGATAC
CTTTGAATTAAGGTGTTGGTATAGAACAGGCGTCCTCAAACTACAGCCCATGGGCCACAT
GCAGTCCACTGAGGACATTTATCGGGCCCGCCGGGTGATTTTGCTCCATTTGTTTTTGTA
CTTTAAAATAAGATATGTGCAGTGTGATAGGAATTTGTTTGTAGTTTTGTTTTTTTAACT
ATAGTCCGGCCCTCCAACGGGTCTGAGGGACAGTGAACTGGCCCCGTTTAAAAAGTTTGA
GGACCCCTGGTATAGAATATCGGGAGTACCATGGACTGCCAGAATGAACACACAAAAAAT
CTGTCTTGGGAGCAGTATAGTCAAAACGCTCCTTAGAAACAAGGATGGTGAGACTGTGTC
TTAATTTACTCTCAACATGTCATCAGGAGGGACCTGTCCTTAGAGAAGGACATCATGCTT
GGTTGGGTAAGTAGTGAATTAGAGGAACACCTCAATGAGATGGATTGTCACAGGGGTTGA
AACAGGCTCAGACATAGCTGTGGGTGTGAGAATGGCTCTGGACTGGACAGTATTTTGTTG
GGTTGGATATGTGAAGTTTCTATGAGTCAGAGCCAACTTGATGGTACCTAACAAGATCTT
CTAAAATTACTGAGCTGCTTGCATTAATCTAATTGTGATGCATCTGTTAATTCTGTCAAT
TTATTCCATGAAACTGTGGAAGTCTGCTAGGAAATAGGAACTATTAAAAAAGAGAAACCG
TTAGAGCTTTCCAGAAGTATCTTCACATGAGGCCTCCCCCAACTCGTCTAAAGAACCCTG
GTCCAGCAGGGTTTAGACTACACTATAGCTGTTTAGTACTATCTTGTCGTTCTCCCTGCT
CAAAGTAAAGTTCTTTCTTATCTATCCCTCTCTGCTAGTCTCTTGTAGCAGCCCAGGGAC
ACTTCATCTCATAGAGAAAAAACAACCCTGTGTGCCATGGGCTGAACATTGGGCTGCTTA
AGTGCAGGCTGGTAGTTCAAACTCACCAGCTGCTTTGTGGGAGAATGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNATACGTCACAGGAAGGGGTTGCACTATGTCTATACA
GCAATGAGAGGGGGTGGTCTAGGGACATGCAATGGGAAGAGGAGGGATTGGGGGTATACA
TGTGACAAGATGGGCGGATCCTAGATTTAGGATGGCAGCTTAACTTTGACCTGTTCTCTG
GGTCTCCATAGGAACCATTATCAGTAGGGTATAAACTCCTCCTACAGGAGCCTGTCCATT
GTCCCCAGCAGCAGGGAACAGGGAGACACTATGTCCCCTATGGTGTGGGGAGACAGCGGT
CTGGAAGCAGGGAGGATGTTTGTGAGCTGACCTCAGCCCACACATGCTGAACATATACTC
AGAGAAGCTGGATCATATAAAGAAGAATAAGGCACCAGGGATGGAGCAGGGATTATTAAG
ACCTACATCATGCAGAACTGCTTCATAGGAGTTCCAAAGTAGTCAGTTATTTTTTCCTTT
TTAAAATATTTTATTGGGGGCTCGTTCAACTCTTATCACAATCCATACATCCTCCATTGT
GTCAAGCACATTTGTACATTTGTTGCCATAATCAATCTCAAAACATTTTCTTTATACTTG
AGCCCTTGGTATCAGCTCATTTTTCCCCTCCTTCCTCGCATCCCCCCCCCCATGAACCTT
TAATAATTTATAAATTATTGTCATGTCTTACACTTTTTGATGTCTCCATTCACCCACTTT
TCTGTTGTCCATCCCCCAGGGAGGGGATTATATGTAGATCCTTGTGATCGGTTCCCACTT
TCTACCCCTTACCCTCCTGGTATTGCTACTCTCATTATTGGTCCTGAGGGGTTCATCTTT
TCTGATTCCCTCTGTTTCTAGTTCTGATCTGTACCAGTGTACATGCTCTGGTCTAGTCAG
ATTTGTAAGGTAGAATTGGGGTCATGATAGTGGGAGGGGGTCGAGGAAGCATTTAGGAAC
TAGAGGAAAGTTGTATGTTTCATTGTTGCTACACTGCTACACTACCCTGACTAGCTCGTC
TCCTCCCTGTGACCCTTCTGTAAGATATCCAGTTGCAGAGATAATAATATGCTCAAAAAC
AAGACAGAGCAAAACAGAGCAACAAAAGGAAACAACAACAACAAACCAATGACAGAAAAA
GGAAAAACCTGTAAATAGTTCAAGGTTTGGTGACTTTTAGGAGTATTTTTCCAGTTGAGT
GTGATGGGGTGCCACACCCTGCCCCAAAGTCTATTTTTGGTACTTCCTCTGGACTTCCTT
GCTCTGCTCTCCTTGCTGTTCTGTTGCACGCCCTTAGTATTTTGCCTTGGTGTGGTAGGA
TCAGATCAGGCTCAATTCCCACACTGTGTCTCCAGTGTTGTCCCCTGTAAGGCTATGGGT
CAGTGGAGGATGTTGTGTCGGCCATATGGTCCTCTCTGTGCATTGTCTGCTCTGAACGGG
GATATGGTCCTCAAGGCTTGGTCGGCCAGGATGTGCCTCCACTCTCTCTTCCTCCCCCTT
CACTTGCTCCCGTGTTCAGCACATTTTTAATTTTTTTTTTAGATTGAGCAATGCTTGTAA
TATTTATTCATTTCATAAACCTTGTTATACTTTTGATGAAAAACTATATTTTCTTTTTTT
TTAAATTTTAAACATTTTATTAGGGGCTCATACAACTGTTATCTCGCAATCCATACACAC
ATCAATTGTGTCAAGCGCATTTGTACATCATTCTCAGAACATTTTCTTTCCACTTAAACC
TCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCGCTCCCCCCTCCCTATTGAGCCCT
TGATAGTTTATAAATTGGTATTTTGTCATATCTTGCCCTGTCCGACGTCTCCCTTCACCC
ACTTTTCGGTTGTTTGTCCCCCAGGGAGGCGGTCACATATAGTTCCTTGTAATCTGTTCC
CTCTTTCCTACCCACTCTCCCTTTACCCTCCCTGTTTCGCCACTCACACCACTGGTCCTG
TAGGGCTCATCCGCCCTGGATTCCCTGTATTTTCAGTTCCTATCTGTACCAGTGTACATC
CTCTGGTCTAGCCAGACTTGCAAGGTCGAATTCGAGTCATGGTAGTGGGAGCGGGGAGGA
AATATTTAGGAATTAGAGGAAAGTTGTATTTCTCATCATTGTTACATCGCACCCTGACTG
GCTCATCTCCTCCCTGAGACCCCTCTGCAAGGGGATCTCCAGTGGCCTACTAATGGGCTT
TGGATCTCCACTCCGCACTCCCCCCATCATTCACTATGGTAAGATTTTTTGTTCTGATGA
TGCCTTATACCTGATCCCTTTGACACCTCGTGGTTGCATAGGCTGGTGTGCTTCTTCCAC
GTGGGCTTTGTTGCTTCTGAGCTTGATGGCCGCTTGATTACCTTCAAGCCTTTAAGACCC
CAGATGCTATACTTTTTGATAGGCGGGCACCATCAGCTTTCTTTGCCACATTTGCTTATG
CACCCATTTGTCTTCAGTGATCCGTTCGACACCTCGTGATCACACAGGCTGATATGTTGT
TCCACGTGGGCTTTGTTGCTTCTGAGCTAGATGACCGCTTGTTTACCTTCAAGCTTTTAA
GACCCCATAAGCTATACCTTTTGATAGCCAGGCACCATCAGCTTTCTTCACCACATTTGC
TTATTCACCCGCTTTGTCTTCAGCGGTTTTCAGCACATTTTTAATGTAGTTTTCATGGTA
AAGTTAGGTACCCCGGGTGATATTTGGGTTGGCTTATACTTGAGTATATATGGTAAATAA
ATAAATAAATTTTATTAAGAGTTGTATAATCATCACCACAATCAATTTTTGATCATTTTT
CTTCATTCTTGTGTCAATTGTTATTAACTCCCCTTGACCTCCAACCTCGCCTGTACTAAC
CCTAATGATCTATTCATCTAGTTACTGTCTCTATAGATTTTACCTGGCTAATGTAAGCAC
CTGATTGACAAGTTAATGAGGACATTCCCTGAAAGGTCAGGGTGTGAGGTCAGCTTTCTC
TAAATGATATGGACTAGATAGGAGAGAAAGGAGCCCTAGAGGTACCCTGCGTTAGGCATT
GGACTGCTAACCGCAGGTCGATATTTCAAACCTACCCGCTGCTCTGCAAGAGGAAGTTGA
AGCTGTCCGTTCCTGTAAAGATTTATAGTCTTAGTGGAACAACCTCCCCACAGAGGGGCC
ACAGAGAGGGGATGAGTCACCAGGGTACAGTAAAGCATTGATGAAACACACTGTATTCCT
CTGGTTCCTTGAGGCTTCCTCACCCCCCACTACCATGACCCCAGTGTTGCTTCTCAATTC
AGACTAGAGTGGAACATGTGCAGAGGTATAGAAAAGGATGGGAGCTCACGACACACAGAA
TCCAGGAGCAGGAGTGGGAATAGTGATTCCAGAAGGGTAGGGGGAAAGGAAGGGAGAACG
GGGGAATGGATCGCAATGATTGATGCATAACCATACACTCCCCCACCCCCTACAGGGGGA
AGAACAACAGAAGACATGGGGGAAGGGAGACAGCAGTCGATGTGGGAGATGAAAATAATA
ACAGTGTATAATCTATCGGGGCTATGAAAGTGGGGGGGAGGATGAGGGGAATAAAAAAGC
TGGTACCAAGGGCTCAATAGAAAGTAAATGTCTAGAAGAGAATGAGGGCAACATATGTAC
AAACGTGCCTGATTCAATTGATGTATGGATTGTGATAAGAGTTGTACGAGCCCCCAATAA
AATGATTTAAAAAAAACATTTTCAGTCTTAGAAAACCTATCATTTGCCTAAGAATTTGAG
TAGACTCAATGACAGTGGGTTTGTTTTTTGGATTTTATATAGGGGAGTAGCTGATGGACA
AATAAAAATTGATTCTGATAGGAAGTGGGAAGGAGTTAACATGTTGGGGAAGCAGCTGTG
CACAACAGTCACATTATCTTGCTATCTGGGAAAATATTTAGCTAATGGTGCCAATATCAC
TTATTCAATAAACATTTAGAATAGAGTCTACTGAACTCTATCCTGTGCTCTGGGATAATA
CAAGGATGGATGACAAAGTCCTTGTTTTTGAGGGATTTTCAGTAAAGAGGGAAACAAATA
CATTGGTTTATAGAGAATAAATTATAAATGCTATAATGGAGATACGAGCAGAGTGCTAGT
AGCACAGACAGGGCGCTTCAGAGAGAAAGGTGGCACTACAGTAGTCCAGGATTTGTCCCA
GGCTTGGAAGGATCTGCGTTATAACGTTTCACCAATGGAATTAAGAATAGTAGGCTTGAT
CTAGGAAGAAGACTTGGGATTGGGTTCAGTTTAGGCCTTTACATTGTTTGATGGCCGAGA
TGTGTTTCTGCACCACTAGAGTGGCCATTGAAATCTGAGAGACCATTGTAATTCCCCAGA
GACATCCTAAGTTGAGAAGTACTCAATATCGTTAGCTTAACGGTTATGTGCTCGACTATT
ATCTGAAAGGTTAGCAGTTCAAACCCACTCAGAGACACTTGAGAAAACAAGCCTAACAAT
GTTTATCCAAAGGTTCTGAGCCATGAAAACCCAATGGAGTCCTATTGCAACACATATATC
CCTGTGAGTCAATTTTAATGTTTTATGTTTCCCTACCACTAGCTACTAAAATTTATTATT
TTCCTCAGGAAGATGGTGATGATCTTCTTATAAAATCTGAAAAAGATTACCGCCAGAAGG
TATCTGGAATCCTGCAGCGTATTCTCTTGCTCTTCCGGGCAGCTCGGTGTTCGTTTCCTG
CAGCACAGTGGTACATTCTCCAGTTGAGGTGGGCAAGAAAAGTCATGCAGAAGGTATGGA
AATGTTTGATGTGTTTGTGTGCAGTTTTAGAACTATTTACTTATACTGGTCGTTATTAAT
GTAATACTTACCATTCTAATACTTTTGCAAGGGTCCCTTGCCTTACAAATCCATACCTCC
AGCTTTACTTAAAGTAATCTAGAGAGACCAGGTGGTGGTGGTTGTGAAGTGCTGCCGAGT
TGGTCTCGACTCACAGTGATCCCTTGTAAAACAGAACGAAACATCACCCAGTATTGCACC
ATCCTCCCAGGTGTTAAGTGTGAGCCTATTGTTGCATCCACTGGGTCAATCCATCTTCTT
GAAGGTATTCCTCTTTTTCGCTGCTCTTCTATTTCTGCTGCTGTTCATAAGGTTTTCAGT
AGCTAATCCCTCGGAAGTGGACAGCCTATTCCTTCTTCATAGTCTGTTCTTAGTCTGGAA
GCTCTGCTGGCACCTGTTCAGCTTGGGTGACCCTGCTTGTATTGAAATACCAATGACAGC
TTCCAGAATCACAACCACCACAGTATGACAAACTGACAGACAAAACAGACCAGGTAGTAT
TTGCTAAATTTCAGTAATGCCTGGTTTCAGTGTTAGCCCTTCTGACCTCCGTTAAGATAA
ACAGTGTACGGGGGTTGGGGGTGGGGTACCCGGGGGGGTACCCCCCCAAAACCAGAAAAT
AGTTCCACAGGGCAGAGCTTTTGTAGTACACGTTTTTCCTGCTAGATGAGCATCGAACTA
CTTGCTCTGAGTTAATGTATCCAGTGGTGTTGCCTGGGAAGGTTCTCTCTGGTCACAGTG
AATTTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGA
AAAGAAAAATGTTTGGAAAATATTGTGATAGCCTGGTACATGTATACGTATTAACTGAAC
CCATGGAATGTCAAAATATCTGTAAGAGCGCCAATACAACATGATTATTTAAAATAGAAC
AGAAAATTTTTTTTTTTTAATTGAAACACATAGCTGTGGGAAAAAATTTTCTATTTTTAA
AAAATTCTATAGGGGGGGGGGCTACCCCCTCATAATCTAGTCAGTTAGTTCCAGGTCCTC
CGCTGTCCAAGAAGCTTTGTCCTTGGTCAAGGACTGTCCTCCTTTTCCTCCTTGGGGTGT
TACATGTTGTTCTGTGCACACTTACGTGAGGTCAAAGTAGGTAGTGCTAGTAGTAGTGCT
CCAAATCCGTGTTTCCTTTCAGGGTTCTCCATTAGTCAGACTCTCCACCTTGTTAATCTT
CTCAGATGGGCAGTTGGGTGTGATTCTGGGGCTGCCATCTTCTTCCTGGCTGGCTCCCAC
TGCATTATCTCCCGGCAGCCAGGCCTGTGCACTCATCTGGCTCCAAGCCCATTGTGGGCC
TACTCTCTGAATGACTGCCTCTCTTCCCACTGTGGAAATACATTTTATTAGCCCCAAGTC
TTTAATTCCGCTTTGATTGAAATGAAAGTTAAAAGAGGAATCCACATCTTTTTTTGAATG
TGAACTCTTTAGAGAAACTTTAGTGAGTTACTAAATTTTTTGTTGATTAGCCATTTTTAA
ATAGAAAGTTTTGTGACTTTACATTTACCTACAAAAATATATATATATCAAGATAACAAA
ACTAGGTTCATTATCTTCTCATGACAATGTTTTTAAGATGTTTATTAAAAGAGGCAAGAA
TCTTTGCTATAGCACTTTGGATTTTAATATTGGCTTTAATAAGATTGGTTTACTAGTTTA
ACGATCTCTTGACTTGCAGCCTTGCTTTTAGCAAAATTTATTTTAAACACTTATTTGGTG
TATGGAAAACTTTTTACTTAACACTCTATATTATATTTTCATTGACAGTTGATCTTACAT
GTCAAGCCCTGACTATAAACTCACTTGCTTTGTTTTCAATATTTAGCTAGAAGATAAAAA
AGACTGTGTAGGTTCTTCAACATTAGAAACACATTTTGAGTCAGACCCTTAAGATTCAAC
AGGATTAAGCTTTATTAATAATTTTAAGATTACAGATAACCAAGAGACTACACACTGTTC
CCCAGGTCCTTTCTTGCTCCGTAAGAATGCACCTTGGACTGTATTTAACACATGAAGTCA
CCAGTGACACATGTGGATCGCCATCACACAGAGGGAGCCGTTTCAAGTGACCCAACATCT
CCCTTTTGTGTGCCTTTAGTTACATATAGGTGGAGCAGTGCTCCATGAAACCACACATTC
TAGATTTCCTTACAATAGCCAACCCATGAAACCGTCTATGTGTATTTACAATACCAGCCC
AAGACAGATTTGTACATCTGCTAAGAAAGACCACTAACTGCTTGCCAGGAAGTCTCATTA
GCGTGCTTTCTGGGAGATTTGGAAGTCACAACTTTCTCCTTGGAAGTCATCCATGGAGGG
CGAAAATAGTTAGTGAACATCCGCCAGTCTTCTTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTTCCTTTTTCTTTTTCTCTTTGTAGTCTACCTTTTGTTTTTTTTT
TGCTTTGTCACTGTTACTGTTGTTTTGCCTACCAATATAAGATAGGCATGGGAAACAAGC
CTGAAGAGAAAGCAACAGGACCAGGGGTTCTGGAGGGACCTGGGGGAAGGAGGGGACAGG
GGAAAGGAGCGGTGAGCAAACAACACCATAGACCGGGGAACAACTAGGGAATTAAAAGCA
ACAACATGGTGGGCATAGAGATCCCAGTGGTGTTTGAGCAACAGCAGTCTAGCTGAGAGG
AACTACTAAGAGGCAGAAGGGCAAACATGATGGTGAGGCAGGAGGGGAAGATAAAAGGAA
GCAGGAAAGACCTAGGAAGCAAAGCTAAGGATAGAGGTATAAACATAGGTATGCACTTAT
GTAAATATGGTAATAAAAATAGAGGTATTGGCCTATTTACATATCTCTTTATGGCAATAC
ATTGAGGAAGTGGATGGACTTTTGGCCTCTGCTCAAGCCCTCCCTCAATGCAAGAACTCT
TTGTTCTACTAACCTGGCATTCTGTGATGCTCAACCTCCCGATATGATCGCTGAAAACAA
AATGCGTACATAAGCAAATATGGTGAAGAAATCTAATGGTGCACAGCTATCAAAAGATAA
TAGCACCTGGGGTCTTAAAGGCCTAAACAAATGGCCATCTAGCAGAGAAGCAACAAGCCC
ACATGGAAGAAGCACACCAGCCTGTGAGATCATGAGGTGTTGATGGAATCAGGTAACAGG
CACCAGAAGACCCAAAACAAATATATATATAACTGAGAATGGAGTGGGGGGAGCAGTTGT
CGAAGCAGAGACCCAAAACCCATCTGTAGACAATAGGACACATTCCCTCAGAAGGGTCAC
AAGGAAGGGATGAGTCAACCGGGGCACAGAATAGCACCGATGAAACACAATATTCTTTTG
GTTATTAGAGGCTTCTTCACCCCACCCCACCCCCACTATCATGAACCCAGATCTCCCTTT
CAGTTTTGGCTAGACTGGAACATGTACACTAGTACAGATAAGAGCTCACGACACATGGAA
TCCCGGTCAGATAAACCCCTCAGGAACAGAATTGGAAGTAGTGGTACCAGGAAGTTAAGG
GGGAGGAGGCGTGGAAAGGGGAACTGATCACAATGATCAATGCATAATCTTCCCCACCCT
GGGGGATGAACAACAGAACCGTGGATGAAGGGAGATAACAGTCAGTGTAAGATAGGAAAA
CAGTACTAATTTATCAAGGGGTCATGAGGGTGAGAAGGTGGGAGAGAGGAAAAAAAGTGA
GCTGATAACAAGGACTAAAGTAGAAAGCAAATGTTTTGAGAATGATGATGGCAACAAACC
TACAAATGTGCTTGACACAATGGATGGATGTATGGATTATGATAAGAGTTGTATGAGCCC
CCAATAAAATGATTGGGGAAAAAAAGTTGTAAGAGCCCCCAGTAAATGATCTTTGAAAAA
AAAAGCCCCCAATAAAATGAGTTACAAATAAATTAATAAAATAGTAGCTTTTCATCTTTT
TAGGAAGTTTTTTATTATAGAAAATTTAAATAAAAGTATTACATATATACTCGTGTATAA
GCCGAGTTTTTCAGCACATTTTTTAATGCAGTTTTTATGGTAAAATAGGTGCCTCAGCTA
ATATTCGGGTTGGCTTATATTCAGTATATATGGTACTTTAGTATATGTAGTTAACCAGAG
ATATTTGTCACATCTAACATTCTATCACATCTAACAACAGTAATTCTTTAAATTAATATT
TATTCTTTTGACTTTTTATGATCCAAAATGTTTTTCACAATTGTGTTTCAATCTGGATCG
AATAAGTCTCACATGCATTATTACTATAGAAGTCCCCAAGACCTAGGTGGCACTGTTGGG
TAAGTGTTGGATTGCTAACCACATGCCTATCATTCAAATATACCAGCTACTTTGATGGAA
AAAGATGAGTCTATCTGCTCCCATAAAAATTATAACCTTAGAAACCCTATATAGGTTTAC
TGTGAGTCAGAATTGACTCCATGGTAATCTTTATGATAGTTGTTTAAAATATATATCAAA
GAACTTCCTAATGAAAATTTAAATATTGTTAGTTTTAAAGCCAGTTTACTACTTAAAAAA
AAGCAAACTTATTTTTAAGAAAAGGCTTAGATAACTGCATAGGAAATGATCCTTTTTACT
GCAGAACATAGGAGTAAAGAGGATATAGGCCTTACCTGATACGAGACTAACGTGTCACAT
GCGAGTCATTATAAAGGAAATTAAGAGTAGCCGAACAGCAGGAAGTTTTTGCCAGACACA
TTGTGGGCCCTGGAATTGGGCCTAATTAAGTCAAGATCATTCGGTTACTGATAGCAATAA
ACAGATTTAGTTTGCTTACAGGTAGCTCCCAGATTGGGGAAAAATTCCTTTCTTAAGTCT
CCCTTCCTCTCCCCGCCCAAAATAATATATATTTTATTGCAGTATATGGGGCATTGATAT
AGTAAGTCAATGATGTCTGTCTACTGACTACTAATTGTATAGCTGGCTTCGACTTAAGTC
TGTCTTAAGTTGAATTCGTATGTAAGTTAGAACCGTTTGGTACATTTTATATCTAACATT
AATAAGTTAAATATTTGTCTTAGCATATAGTGTACTTTTCTATACATAAACAATAAAGAT
AGGCTTCCAGATATATTAAAACATCTTTAACATAACATAATAATGTTTTGATTTGAATCT
CAAAGGCAGTAACTGTTTGTTATTACAAACCATTATGTACCTAAGATTTTTGCTGTAATT
GACTTTCTAAAGGTTGACTTGTAACTACACGCTGTATGTAAGTTGGATGCTTGTAACTCA
GAGACTGCTTATATGTCACCTCCATGGAATAGAGAGGCCCAAGATAAACTAGATTAAAAA
TAAATCCAATTATTAAGCCGCATGTATGGTATGATTTTATATATATTTATATACTTGTAT
ACAGAAGTATAAGCTTTCAGGATAAAAAAGTATTTAATATGGGAAATTGTTTTTTTTTTA
TTGAACACATTTCAACATAAATACTTGCCAATAAGTGACTTAACTAAATAGATTAACTGT
ATAATAGAACAATATAAAGTAGAGCTATATGTGTTGGCCTTGAAAAATGCCCATGGCACA
TTATGAATTTGTAAAGCAAGTAAGCAAGTAGTTTATAAAGTTAGTAACATGCTTAAAAAT
TCTAGAAAGATGTCCGTGGCTTTACATGAGGTGTTTCCAATAAGCGCTTGTTTCTTCTAT
TGTCAACAAAATAAGGACATCAGCTGTGATTGGATATTATTAATGTTCATGATCATACAA
CTTTTTTCATATTTGTGTCCCTGATTTAGGTTGCTTTAGAGAACTTTGTGCTTTGTGTTG
GATGCTGCATATCCGTGAAAAGTTGTCCTATAGTTGCAGGCAATATCAGAAAGCAAGAGA
AAATATGGGGAAGAAAAAGGTACATATCTGCACAAGAATAAGAAAAATGAACAAACATTA
CTGGGGAAATTGCTTAATAGAGTATATTGCACAAAAATTTTCCTATTGTACGCGTTATGG
TCTATTTAAATAGAAAAGGAAATGTTTCTTTTCAATATCCATTTAGGAATTTGAAGTGAA
GTTTGATTCTTGTATGGTTGAGCACTGCCTTAGTGCTGTGGAATGGGCTTACAGAATGCT
ACCTTTCTCCCGATTTTTGAATATTGAAGAACTCACTCAAGATATAATTTTGAGTCTCCT
TGGAGAACTGCCACCCCTCAGAAAAGTAGGTGAAGATAAATTAGAACAGATACTTCATTT
TACCGTCAATAAGAATGATGTTGCTCATGAAACTCACTTTTAAACCTTTTTTGAAGGTAG
CAGAAATTTTCATGAAAGCATTTCCCAATCCTGAGGACGTAAGGGTTCCTTTAAGAGAAA
AGTACCATTCCCTTCAACAGAGACTCAGACACTGTGTTGTGACAGGTATTATGTTTGTTT
TTACATAGTGTGTAAAATTGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNATCAGCTCATTTTTTCCCCCTCGCCGAGTTGCGGCCTGTTCCC
CCCTCCCTCATGAACCCTTGATAATTTACAAATTATTATTTTGTCATATCTTGCACTGTC
TGATGTCTCCTTTCACCGACTTCTCTGTTGTCAGTCCCCAAGGGAGAAGGTTATATGTAG
ATCCTTGTAATTGGTTCACCCTTTCCAACCTACCCTCGCTGACCACACTCTTATCCTCCT
TTCCCTTTTCACCTCTGGTGATCATCAAAGAATGTTTCTTTAGTGTGAAAACACTTTCTT
AATACTTTTATAATAGTCTCATAATATTTGCCCTTTTGTGATTGACATTTAATTCAGCAT
AATGACCTCCAGTTTCATTCATGCTATGAGGTCTGGCAGATGCATTGTTATTTTTAATGT
GTAGTATTCCATTCCATTATGTACCATAGTTTCTCTACTGTGCCATTGATGGACATTTAG
GTTGCACCTGCCTTTTGGCTATTGTGAATAGTGCTGTGATGAGCATGGGTGTTCTTTGTG
TGATTTTATTGATATATCAGTATCTCCTGGGATCTTTTCAAAATGTCATTTCTCATTCAA
TATATTTTGGATGGAAATACCAACTCTCTACAGGTGGACAAACTGGAGTGAATTGGTTTG
AAGCTGTGGACTAACGCATGATCTGTAAAAATGCTAAATTCAGCCTGTTAAAGTGTCATG
TAACCAGGAAGGACCAGAAATAGATTCCTGTATGTCTTAGGTTGAAACATTTTATTGAGC
TATAAGACTTTCTCTCTTTTTAGGTCCCCAAAGTGAGGAAATTATGTCTGTTACCATGCA
TTCGATCCATAAAGTGTGGGTGAAAGCTCTAAAGCGTGTGTGGAGAAATATAGGTCCTTT
TGAGACAAACGTGTGGGAACCAATGGATGAAGAAAAACCAGATGATGCTTCAGCTTTGGA
CAGGCTTTCCCTGGGGACTAGTTTGAGCAGGAGTACGCTCACAGGTCTGGGGAGTTCCCT
GCTTCACAGTGATGCTGATACAGCAGACACTTTGTCTGAAGCTCTGTCCATGGAAGGAAA
AAACAGAATACATTCCTATCACAGGTACAGTTGAGTTCTCAGTAGCTGATATTCACTTCC
TTTGGACAAATAGAGTTTTAAAATATACTTTTACAAAAATATATTTTTATATTTGATGAT
CTGATTTCTAGGCTCAGCAACCCTCACTGACTGCTACTAATGTGAATGTTATATGCTACA
CTCTCTGCGCACCAGAGTACTCGAAGTATGAAAAGAAACCTTTAAAAATCCTTTTAAAAT
ATGGAGATAGGAAATAATTTTGTCATCTAAATTTATAAAGCTAAATAGATACATTCTAGT
AATAGCTGAAAGACTTAAATTATTTTAGTAGCCATTAGAGATAAAAGTTTGGAATTATGG
GTTAGTCATAACATTTTTAAGGAATTTATCTTTGAAACTGTTCATAAATTGTGAAGTTCT
CTTATAATTCACTTTCTCCAGTGCAGTTTTTCATTCTCATGACTAAAAGATTGTATAAAT
CAACCATGATCTTAAGAATAATATCCTAATTACTCTTAAGTATCTGGTTAAATCATAAAT
AATACCGATAAAATACATACTCATGAACACATATAACATTAAAATGTTGTCCTTGTCTTG
CAAAACAGCGGTGCTTAAATGTTAGGGCAGGTTTACCCTAATGTTCATTAAGCTTCCATT
AGGGTAGGAAGTTATCTTATAATTTCAGTTTCTGTAGTGCAGTTTATCCTTCTCATGACT
GAAAGATTGTTAAAATCAACCAGGACAAAAATTTCCCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGTGGTCTCTTCTTTCTTACTCATTATTTACATTTTAATTTTTT
TTATTATTTTATCCTTACCACTTTGGTTGGTTGTTTTTTATTGTCTGTTGGGTTTTCCAG
TTGGTGAAACATAGGAGTAGAAGCCCAGAAGGAGATAGTAGCTGATGCAAGGTTTTTTAG
GGGATGTAGGGATGCTTGGTACGAGATAAGGAAGGCATGGGGATTTCAGCAGCAGACAGT
GAAGGTGGGAGGGGAGAGGGAGCAGGAAAATGGATTGTGATTACATAACTCATTTTAAAG
GCAATTTAACCATGAAAAGAAAGTTATGAAATTGATTGTGGTAATGAGTGTACAGTTCTT
CCTTATATGATTGAGCTCTTGAATTGTATGATATGTGGCCTTTGTGCCAATAAAATAAAA
AAATATTGTTCAAAGTAGACAATCTACTAGTTAAATCAAATTATTGTTGGTTTACAGAAG
ACGTTAGGGGTTATTGTGTTATTTTAAAGTTTACATGTTATCTCTGGCAAGTGGTTTTTG
GGACTATTCCACTGGCTCCAGGAAATCTAAATTCCATGAGAATTTGGAATTATGCTCTGT
ACCCTTTCCCTGCTTTGCATTAGCCATGCAGTCTGTTTTCTTTTCTTGCTTGCTCGTGAC
TCTCTTCTACTTCTGCTGCTTCTGGCAAATAGAGATCAATTGTGATGTTTTGGATGGACA
CTTGCAAGCTTTGATTGAGGTAGGATAGAAACACTGAATATGATACTAGGCCCATTACCT
AGGATGTCCCATGAAACCATGGCCCTAAGCCTCCAAACCAAAGTACCAGATCCCATGAAA
GTGTTTGGTTATAGGTGAGCATCACAAGCAGCTGTTCTTTGTTGTTGTGAAAATAAGCAT
CACACACTATCTGCCAGTTAAACTTTTTCAGGTGCTACACAGCTTAGTGACATCAGTTAC
ATTAGTCACTTGCACACCCCCGACCCGAAGATAATGGAGGCACAAAATAACAATTTAATC
CATGCAGAGTTCAAAGATGAAATTTAGTGATTAAATGATTTTTCATTTTTTGTCTTTTCA
ATTTTGTTTTATAGAAATACCTCAAGTCATATAGAGTTAACATCGAAGAGTAAGCCCAAT
GAAAAAAAGAAACTATATAATCCAAAAGAGAACGCTAAGAGAAAAGAAGACGAGAAGTCA
TCCCAAAATACAGTTCCTGTAGTAGGTGTTTGGGAATTTGAACGTGACGATGACGAATAT
ATTCAATTCCTTGATCTCTTCTTGAGTTATGTTCTTGAAAGAGACCTCCTTACTTCCAGG
GATCCTGGCATTCCATTTCTAACCAGTTTCTCGTCACATCTCAGAGAATACGAACTTAAT
TCCTTAGTTTTTGATGTGCATACAACATTAAAACGCCGTCAGGGCAAAACCCAAAGCCAG
AACGTTTTCAGAGCTGGCTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCTGGCTACATGGACCTCACAAAAAATTCATGCTAAAGGGTTTATTAAGTGAAG
TTAAGAGGTTGCAATGCAAGTGAGAAATACTCAGTATAGTTGTTTATCGGAACATGTTAC
AAAGTTCTTTCAGGTCAGCTAATAAATGCTCTAAAGGGCATACCACTCCGCTATAAACCT
CAACCCGAAGGCATTTAGCACAAGCTTTGTGCGTCAGCAAACCCAGCTCCCTAAATTAAG
TGCCCAAAGGCACCCACTCCACAAGCCAGTCTCGTACCCCAAAGCACTCAGCTTCACATG
TTCCGTGGGCTACGAAGTCCATCACTCTGTTTCATGTACTGGCTCCTGGTTCTATTGGTG
CTCCTGTGATGTCATAGCTGTCTTCTGGATCCAGGAAGTTCACTGTACAGGTATCTAAAA
AGCTCCAAAAGATGCCCTCCACTCCTGGCTCTTACTGGTAATGAAATCCTTCTTCTCAGA
GGATTCATTTTATACACAGCAGGATGGCATTCCAAGGAATCCTGTTGACAATTATCCACA
GGTGAACCCTATCAGTATCTTTCCCCACTTTTTAAAAAAAATTATTTTATTGGGGCCTCA
TACAATTCTTATCACAGTCCATACATCCATCCATTTTGTCAAGCACATGTGTACATTTGT
TGCCCTCATCATTCTCAAAACATTTGCCTTCTACTTTAGCCCTTCATATCAGTTGCTCAT
TTAGCCCCCCACACCCCACTTCCCTCATGAACCCTTCATAATTCATAAAGTATTATAGTT
TTGTCATAAGTTACACTGTCCAATGTCTCCCACCGCCCTCTTTGCTGTCCATCCCCCAGG
GAGGAGGCTATACGTAGATTCTTGTAATTAGTCCCCCCCTCCTACCCCACATTCCCTTCA
CCCTCCAGGCATCGCCTCTCTCACCACTGATCCTGAAGGAGTCATCTATCCTGGATTCCC
TGTGTTTCCAGTTGCTATCTGTACAATGTACACCCCACCTTCTTACCAGACCCATGCAGG
AAAAGGTTGCTTAGTAGAGTTAGAGGCCTTCCCTAGAAGAACCACGATAAGTAATTTGCT
GCCCTTGTAACAGTGTTGATTTCAGTTTGTTTCACCTAGGCCATTTGTGCAGTTTTGTTT
TGTTTTTTTCTAACTCTCTCACACCCCTCCCCACCCTGCCCCCTGCTTTGGTTCCTTAAA
AATAAATCAGAGTAAAAGTGCTATGAGGTTTTGAGACTGTGTCTATAAAAAAGAAAAAGA
TAATTTAAGCAATTTTAAAAGCGATATTTCAATTATGTTAATTTTCAGGTTTGGTTCAGT
TGTAGAAACCCATTGCCCTAGATTCAGTTTTGACCCACACCAACCCTTTTGTAGAACAGA
GTAAAGTGGCCCCTGGTTTACAAGGCTCTGTCTTTACAGGAGCAGATAACTGTGTTTTTC
TCCTGTGGAGTGGTTGGTGAGTTTGAACTGTCAAACTTTTGGTTAGCAACTGAGCACTTA
GCCACAGTGCCATGCGTGTTCCTCGAAGAACAATGGGCAGCTTTTACGTTTTTGTGACTG
GTGTTTCCTCACATGCTTTGGGGATCATTTCTTGTGTACTCCGTGGCCAGAAGAGGTTGG
AGACCCAAATCTAGGATGACAGGTGACTGTCAGTAGATGAGTTAATTGACCAGTAGCAAA
GAACTATCTTAATTATTTGCAAGATAAGCATTTTTTGTATAAAATAGTTTGATTGTAGTT
GTTGCAATCAAAAGAAGTATATGAACTTATAAAAAATAGTCAAATTTTTCTTGATTTACA
TAAGGATTATAAATAATAATAATAAATAGTTACAATGGGTATTTAAAAAAATCTATTGGG
AATTTTAACAGTATCTAAATTTATTCTAAAGTAACTATATTTTAAAATGGTTTATTTAAA
AAAAATAATAAAATAAAATGGTTTATTTTAAACTGAAGGGTGTGAAGTGTGTGTTTGTGT
AAGTTTGTTTTTGTTGGTTTTTGTGTGTGTGTATGACCAATTTCTGTCATCCTGAGATAA
GATGCTTGATAATTGGTATTGAAACGTGCAATCATTTCTGGGCAATTCCTACCTGAATTT
CTAAGTAAGAGACAGATGGGATGACTAAATATTATAATAGCAAACAATAGTAAAACTGAA
GGAATGTCGCCATTATCTCGTGGTCTGAAAACCATGAGGTTCAGGTATAATTTTTTGGGT
TAAATAAGACTTGCTCCTTGCTTCAGCCATAAATATTGAGTAGCAATAATACAGTAAATA
CTTCATAAACAAGAAAAGACTGACTCAGAAGTTCTGTAGAAGTTGTGGTTAATTTTAAAG
TATACAGAAATATAAGTGTTTAAAAAATAAATACTCACTATTTAAATGATTGCTTTTAGG
TTCAGAGAATCATCACTCTAGAGGTCAGGCTGAACCCGAGATTGAAGATGAGAGTGAAGC
AGAAGCCGGCTGTGCAGTTGCTCTATCAGCTATAGCTGGGGCTGAGGAGTCAAAGTACCG
AAGCGAATCTTGTCAGAATATCTTGAAGTAAGCTTTCAGTTGAATATATTAACCAGCTTG
ATGATGTTTGGACTGAAAGGGAAGAGTTGAACCCTGGAAAGTTAAAAGAATGAACTGGAA
ATGAGCACTTTATGAATGGCTATAACACTTCATGGCACATTATGTTTTCTCTTTGTTGGT
CTACCTTGTATCTTCTGAGAGAGGAGCTAATAGATCCAGAAAGTACCCTTTACTTATATT
AATTTATTTTCTCTGTCAGAGAAAGTTGAACTAATCACTTCAGCCAGTTTTACATATGAG
GTTATTATACTATGAATAACAGTATGTTTGAAAGACAAAGCCCTTACAGCAGGAAAATTC
CTTTTGTGAAACAGGCAAACAATTTAGATCAGTTGAAATTAGACTTTTATGAAATGTTTA
GTATATGACACAGAAGGAGCCCTGGTGGCATAGTGGTTATGTGTTGGGCTGCTACCTACA
AGCTCACCAATTCAAAACCACCAGCTCCTCCACAGAAGAAAGACGGGGCTGTCTACTCCC
ATAAAGAGTTGCTGTGTACTCCCATAAAAAGATACAGTCTCGGAAACTCACAGGGTCACC
GTGAGCTGGCAACTCAATGACAGAGACTTTGTTTTATTGAGTTGAGTATGTATCACACAT
GAGTGTTTAAAAGAGCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGGTGGTATAGTATTACCAGTAAGCTATGATCCTCAAGG
TCGCAGTTTAAATCACCAGAAGCTCTGAGGGAGAAAGATGGGGCTTTCTACTGCAGTAAA
CAGTTACAGTCTTGGAAAATCAAAGGGGAAGTTCTGCTTGCCCTAGCCCTGTAGCGTCCC
TGTGAGTCGACATTGACTCGATGCCAGTGAAGTTTTTTTAATGTGTGCTGTAAAGTTTAC
CCATGCCCTGAATTTTCAGATAGACCATATCCATTCCTAATTATTCAAAGAATTGTTTTA
ATAAGGATTTGATATATTTCTTAAATCTTATCGTTGTTTCCACAGAGTAATTAATCATGT
AGTGATAGGTGTCTATAATTTGCATTAATATTAGTTTACTATCATCTTGTTGTATGTTTT
ATAGCTCAGGGTGATGAGCCAGGTAATTCATATGATGAAAGGATCTAGTCAGAACAGGAC
TGAGAGTACGCTGTAATGTTTGATTTCTCACCTTCTTTTATATTGTTATTCTAAATCAGT
TGTTTCCCTAAGTGGATGATACCACCCTCTTGGGGGCTCTTGAAAGATCCAGGAGGGCTG
CAAAAACAGATACCTACACTTTATACTAGATTATGGGCTGTAGTAAAAAAGCTTTTAATT
GGTAGGGGGTGCTGAATATATTTTTATGAAAATAGGAAGTAGGCTAAATAAAGATGGATT
CTAGAGAATGTGAAATGTGAAACTCAAAAATCAGAGACAATAATATCTATTTGTTTTACC
TTTTTTTTTCTTTGTCATGTACTATTTTAATAGCATTCCACAGGAGAAGTTCAGTGTTCA
AGAGAAGCACCATTGAAGATAAAAATGGCAAAAAACTTGACTGAGCAGAAAAGGTGAGAA
GGAAGACAGCCTGGTGTAATCGCCTGTCGACCTCACCAACGCACACTACAGAGCTCTCGT
AGTGTGCACTATGTGTCTAGTGGTGTGAGCGTGCCAAGTAAACCATGATTTGATGATATT
GAAAATGCCTTTTATTGTTTCATTGCCATCAATCTTATCAGAATAAAGTACAGATATAAA
TACAACAGACTTCATCCACTTCTAATTAGGAACCCACCTTTCCTTTTCTTTTTGGTCTTA
TTAGTAAATAGTTTTATTTGGCATATATTTCACATATCACAGTTTAATTATTCAATCATA
TCACCATCTTCCCATTTTTATTGAGTTAAAAGAATAATTGAGCCATAATATTTGCAGCCT
TTGACATAATCTTGTGTTTTTATTACTGAGCACTGAGGAATAGGACTGAGGCATGAATGT
ATGCTTTTAACCCATACTTTGCTACAAAGAGAGCAGAAGGCGGCTTTTAGAGTTTGTAGT
TTGATTTCTTAATTTTTAGAATTACCTTGGGCAAGAGAGATAACAATCAAATGTTTTTTG
GGGGTGGACACAAATTTTGTTCAGTTCTTTTGTGGCTAATTAACAAAAATGATATGATGA
ATGTCATCTGCCTTTAAAATAAATACATATTACACTTAGAAATACATTTATATTTTTATT
AGTAAAAAATACACTTGTATTTCTATTAGTAACAATTGGCCATTATAGTTTCATCTGTTT
CAATGGGCTCTTCAGTGCTCCTGAACAAAGTTATCTGCTTGCTTCATAAGGGAAATTTGC
GATCCCAGTTTAGCCTCATGTCCCTCATTGAAGAGTCTCTTGTTTTCGGTTGCTGAACAG
TCAGGTGCCCATGTAGTGTGTGAAACCAAACAAGCTCTGTTTGAATCTATTACTATGGAG
ATTAATGTAAACATTATAATTATGAGCTAAGCATTACAGAGGATTAGAGGATATTTAAGA
CTCATGGCTGCAATTAGATCACTTGTACCTTAGATAACTTGAAGAATGTTTTGCTTCCCA
GTCACATGTAATTGTTTATTAACAGTATGATTGACGGCTTTTCAACTACAGAACATACGA
TTCCTCACTCACTCTGTGATACAAGTTCAGAGATTTCTAGGTAAGCATTTTTGCCTACTG
TTCCATTTTGAAATAGTTAAGAGCCGCTTTTTTTTCTTTTAAACTAAAAACTAAGAATAC
GATGAAAGTAGCATGAAACATTGAAGGAGCACTAGATAGGTATACATTTCTGAAACTTTA
ATTATTGAAAAATTTTTCTTTAACAAGGTGTTTTAAAAACATACAAGAGACATTTAATTT
TTATCATTTTTTGAAAAAAGGTGATGGATTTATTACTGTTAATTTTCAGCCTCTAATCTC
TTAATTTTCTCTAATCACAGATCCATCCAGTTATGTACTTAAGAGTTTCTTTTTCAGAGG
TTAAACAGGGGAAGACAGTCTGATCTCCAGTGTTTAGAAGTCTTGCTGAAATAGGAGGAT
AATGTAATCCAACTTTACATCAGAGAAATCCTACATGACTAGTATTTAGTTATGCTTTCT
ACTTATGGAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTAGAACCTGAGTACT
CGATCGTGTTCAAGAAATCCTTATTAGTGTTTTAAGAAAAAAATAAAACCCTTGCTGTGA
TTTTTGCTTTTCTAAGTAAGAATTTATCTTTTGTTTGAGTTTGTTATAAGTGTCAACTGT
GGGGTTAGTTTAGAACTGCTGTGGTTTTTATGCATTTAGTGATGATCTCTAATACTTGGC
TCTACCAATCCTGAAATTAAACAGTTTTAACCTACTCTGTATCCAATTTTCCTAACTAGT
CTGGGTTATTAATTTTAGGTAGAAACAAAAACTTACTCCCACATCAAATTACATAGTCTA
TGAATTTAATCAGAATGGTTGTACAGGCTTCCAGCTCAGATACCTTTGGGGACCACAAGT
GACACCACTGGGAGGTGATCATGGTCAACTCATAGTGCACGTCTCTTTTAAAGACAGCCA
GGTACAAACTGTGCTGACTCTCACAGGTACAGAAAGATGAGCTCTAGGGTTTTCTTGCTG
AGTAATTTCTTTGGTTCGTTAATGTGCTTTTTTTAAAAATATGCTTCCACATAGTGCACA
TATTCCTCCTTCTAAGGGTGAATCTTCCTCAGTTCCACCTTTCGTATCAAAAGGAGACAA
TGCCTCTCCACGAACACCTGTGCCATCACCTCGCAAGACTCAGAGAAATGAACCCAGGAC
TGAATTACCAGACTCTTCGGATTCTGTAAGGCAAATGCTCCAAGATGAAATGTTTAAATT
AGTTCAGGTGAGCTTATCTATATATAAACAAACACACCCACTTATGGTATAAACAAGGTT
TCAAAATATTATCAAATACTGTATATACTTACGTATAAGCCGAGTTTTTCAGCACATTTT
TAATGCAGTTTTGTGGTAAAAAAATATTTGGTCAGCTTTTACTCGAGTATATACTGTATC
TAGAAAGTAGACAACTGGAAATTAAATTACAGGCATTTTTCTTTTCTGGTACTCTTGTCA
TTAAAACAATTCTAGGGCAGTGGTTCTCAACCTGTGGGCCGAATGACCCTTTCACAGGGG
TCGCCCGATTCAGAACAGTAGCAAAATTACAGTTATGAAGTAGCAACGAAAATAATTTTA
TGGTTAGAGGTCACCACAACATGAAGAACTTTCGCGGCATTAGGAAGGTTGAGAACCACT
GTTCTAAGGCCCAGTGTTTTCTCACAATGACTTTTAACTGAGCTCCTTGATATGCTGGTA
AGTATGGGGTTTGGCAGTGTATGACCTTTGGCTACACAAAGGGGAAGGAGAATCACATTC
CACTCCAGCCCAAGGCTGATTCCTAATGAGGGGAGGTCAAACATGCCTCTACCCTCTTTC
CTCTTTCCTCCTTTGCCAATTCTGATATCAACTGTCACTCTTTACATCTTGGCCGGGTTT
GATAATACAAAACCCATACAATTGTGGGCCTTATCATGGATGTTAACAGTATACAAAGCA
GGATCAGAAACGGCCAAGACAGTTCTTCAGTCAGGATAACCTCTTTCCAGCTGTGTCTGC
AGGCAGCCCTCTCTCTTTTTGGTCCTTTACCTGTCACTCACATGACCCCTTGGTCTTTGT
CCTGCTTAGACCATGTTACATGGCTGAGTTATTGCTGTTTTTCTCAAATGCCCATAAGAC
ACCCCATGGCACCATAAGCTTCAGTCCAAAGGTACCCAGCTCTGACTCCAAGGGTCAGCA
AACTTAGCTCCCCAGTTTATTGCCTAGAAGCACCCCATTCTGCGAGTGTTGGATCTCCTG
CTAAAAGGCCCTCAGCTTCACCTGCTTTGTGGGCCAGGAAGCCCACCCTGGCTTGGTTCT
GTTGCTGTGTCATTGCTTTGTGTTTCTGGCTGAAGGGTGCCCAAGATGCAGATATCTCAG
GGTCTGGAGGACACGCTCCACTCAAGGATTGCCTTTCTGGCTGGTAGATGCCCCCTCCTG
TTGCTGGGCTGGCGTAGTTATACCCAGCAATCCTCATGTTGAGTTCCAGATGTTTACACT
CAGAGCCCTCTTAACAATCATTCACAGCTGAACCGTATCATCTGTCAGCATCTTCCTCCA
CCTTCTCTTGCCCTCAGGAAAAAGTTGTTTGTTGGGAGTTACAATGCCTATGGCTAGAAG
AGCCAAATCAAGTAATCCGCTGTCTCACATATGCCCAGAGCTGCTGACCACAGGGAAGTG
GTGATGGGGAAGGGGTTTTTAATTAAACCAATCCAGTGTAGTCCTGCTCCATTCTAGGAA
TGTTATTTTGATTATCCTCCTCACTCTCCAGACAATTCCTTTAGGATGTTTATGTCAACT
GCTTCATCAATCAGGGCTAGATCATTAGTGAACACTCATATTCTCAGTGGACAGCTTCCT
GAAGGCAGAAAGCCATTCTGCTTTCTTTTCAATTCGCCTACTACTCAGCTTTCATGAGTC
AATTAGCAAGTACTGAGACGAAGGCACTACTCTTGTGGAATACTTGGATGGCTGCTGCTT
CCTTAGATTGTTTTGATTATATTCTACAATTTAAAACTTGTGTTTTATTCCAGCTGCAAC
AGATCAACTTCATGAGCCTAATGCAGGTGGTTGGGTCGTCCTTTGCTAATCTCCCGAATA
TACAGCATCTTGTACAGCAGTCTCAGTCTGTGCATTTGGTGGGAAGCCAAGTACCAAACC
CCATAAGAGGGAGTAGTGATGTTGAAGATACCGGTGGAAATCTTAAGAACAGGATTTTAA
TTAAACCACAGTCCACAGGAGAATACACCAGAGAGTGTGGCAATCCCAGCCCACATGGTC
AGCAAAGAGTCGAGCAATCCGATCAAAACAGGAATGGAAATGTACAGGTGATATATTTAA
AAACACCATGAAAATTTTCCTGGTAGTTCAATTGAGTGGTGATTTTTTTCAGTCAGTCCT
TTTTTTTTTTAGCAGTTACTAAATTCTAATGCCTCACTCCCCCCATCCCAGTAACACACT
GAACAATAATTTCAACATAAAGAATTTGTAGTATATAGATTTTAGACTTATGTGTCTTTT
ATTTCTCTTCCAGAATATTTCACATGAGAGTATTCCTTTAAGTCATTTAGAAGGCCAACC
CCAAGAGAGAAGACTAACTCCAACATCTCACAACTTACCACCCACTATGTTGTCTCCAGC
CCCTGCTGCCAATACTCACCTGCACCTTTTGTCCATGTCTGCCATTCAGAAGACACCTCA
GCTTATCCCAGCAGCGAAAATGGTCACTCCTGGTGATGGGTTTCCTCTGCTCCAGTTCCA
GCCAAAGCATGAATTCAAGCCACTTCCCTTGTCTACCGGAAGAGTTCCACCAGTTCCCTT
CAGGCCTCTGCCACAACCAAAAGAGGCTTGGGGGGTTTCAGGTTCCTTCCAGCCTCCTCT
TTCACAGAGAGACATACACACTACTGCGGCCTCCCTCTTGAATTTGAACCAGTACAATCC
TGAAGCCATAAAAAAGGCAGCTGAACAGAAGAGGTGGGCAGAAACGGTAAATACAGAAAT
GCCTGCACATCTGAACTTGGATCAGTATGTGGGACCAGAAAACTTTGCACCTCAAAAGAG
CTCTTCAAAATTTATGAAACCAGAAAGGCCATTTGAGATTACACCCGGTCTCCATGAGAA
ATCTCCTCTGAATTCCTCTGGACTTCCATTACTGCACCTGCAGTTTTAACCCTCCGTACA
TGTTCGTGTCTGCCTCCAGAGCATCCGTCCCTGTGCCCTCAGTCCCAGCCGGAATGGGAG
CTAGAGAGAGGAAGTACTCCCGATTGTCATTACTTCCTTCATATCCATCCTCAGAGAACA
CGGTAATGCGTTTTTGCAGGGTGATGCCATTGAGGTTCCCGAGTTTTTCATACCAGAAAT
ACCATGTGCCCTCTGAAAAGCCCGGGCACATTTCCATGTTTCCTTTTTTTTTATTTTTTA
TGTTCTACCTGGATTTATTTATTATTATTATTTTTAATCATTTTATTAAGGGCTCATATA
ACTCATCACAATCCATACATACATCAATGTGTAAAGCACATTTGTACACATTCATTGTCC
TCATCCTCAAAAGATTTGCTCTCCACTTAAACCACTGGCATCAGTTCCTCATTTTCCCCC
CTTATTCCCTGCTCCCTCTCCCCTCATGAACCCTTGATAATTTATAAATTATTATTTTGT
CGTATCTTGCCCTGTCTGAAGTGTCCCTTCACCCACTTTTCTGTTGTCTGTCCCCCACGG
AGGAGGTCACATGTAGATCCTTGTAATCGGTTCCCCCTTTCCAATCTACTCTTCCTCTAA
ACTCCCAGTATTGCCACTCACACCACTGGTCCTTAAGGGATCATCCGCCCTGGATTCCCT
GTTTCCAGTTCCTATCAATACCAGTATACATCCTCTGGTCTAGCCAGACTTGCAAGGTAG
AATTTGGATCATGATAGCGGTGGGGAGGAAGCATTTAGGAACTATAGGTAGAATTTGGAT
CATGATAGTGGGAGTGGGGAGGAAGCATTTAGGAACTAGAGGAAAGTGTATTTTTCATCA
TTGTTACATCGCACCCTTACTGGCTTGTCTCCTCCCCAAGACCCCTCTGCAAGGGGATCT
CCAGTGGCCTACTAATGGGCCTTGGGTCTCCACTCCGCACTTCCCCCTCATTCACTATGG
TAAGATTTTTTTGTTTTGATGATGCCTTATACCTGATCCTTTCAACACTGTCGTGATCGC
ACAGGCTGGCGTGCTGCTTCCATGTAGGGTTTGTTGCTTTTGAGCTAGATGACCACTTGT
TTACCTTTAAGCCTTTAAGACCGCAGACGGTATACCTTTTGATAGCTGGGCACCATCAGC
TTTCTTTTCCACATTTGCTTATGCACCCATTTGTCTTCAGCGATCGTATCATGAGGTGAC
ATTTCCTTTTTTTTTTTTTAATCGTTTTATTAGGGGCTCATACAACTCTTATCACAATCC
ATACATACATCAATTGTGTAAAGCACATTTGTACATTCATTGCCCTCATCATTCTCAAAA
CATTTCCTGTCCACTTAAGCCCCCAGCATTAGGTCCCTTTTTTAAAGAATGCTTCCATGA
TAGGAAATAACATATAAAATTCCATTTAATGTTATAATTGGATATTTTAAAGGATTAGGG
TTCCTATACATCAATACCAGAATTCACTGGCCTCTTTCATAAGTATTCCTTGATCAAAGA
ATAAGTAAGTAAAATAAAGCTGGACATCCATGGGTGGTGCACAAAGTTAAATTCTCAGCT
GCTGATGGAAAGGACTGCATGTCAAGTCCAGCCAGAGGAGGTTTAGGAGAAAGGCCCGAT
GACCTGTTTTCAAAAACTCAGTGATTGAAAACCTTATGGAGTAGGTCTGCTCTGACACAC
ACAGGGTTGTCGTAAGTGGGAACCATGTTGAGAAATGGTTTCATTTAACTTAATATAAAG
TAAGTGTTTTCTGGTTGTTTGTGCATGTGTGTGCATACACGTGTACATGCACACTGCCTT
ACACACACATATATAAAAGGGAAAGAACTTGTGGTTCATAGCAATTATGATGTGATTGCC
TCCAAATATGTTGTAGGCTGAATTTGTTATATAAGCCCAGATCTATCAATAGTTGTGTAT
GTAATAAAAAGTTTACTTTTTAAAGTAAAAAACAAAGGTTGAATTTTCATTAGCCCATCA
CATCACTTTTAAAGGGAACCATGACATGAATTCCAGTTGTATCTGTTCTAATGTGTAGAT
GAGTGTATGCTGTCTTAATGGGGTAAGAGAATAACTCATTTTAGGATACACTTTTAATAG
TTGAAGCAGGTTCTGGGCAGGGGCAGGGGCAGGAAAGGGTCATTCCTTTGATAAGATATG
TGCCATGTTCCTGAACATCAATGAATGGAAGAAGAAAGGACTAACTAACAGTGAAAGTGT
AGACATAGGAGAGGATTTTTTAAATGATTAGATGAGCCCCTTGCTTCAGCACATAGCTGG
TCTGTTGGATCTCCTACAGTTCATAACCCTCCCATCCCCTCAAATGCTGCCCACTATTTC
ATTGGTAATTATGTGAAGGAAGATTTTTTTTATTATGAGAAAGAGCTAACTACTAGGATT
CCAGGCTTCATGTCTGAAGTGGGATGGCTCAGTGGAAGCTGTTAGCACTCTGAAATCACT
TAAGATCTGATGTTCCTATGACTTGTCTAAGTCATTGTGTTCTATCACTTACACATTTTA
AAGAAATGCTTTGCTTAATTTTTTGTTAAATATTATGTAATTCAGGCTTGCCATTTTTAA
TTATTAAGCTTTGCTTCTTTCTTGTAGTATAAAAAACCACAGCTTATCCCACTTGAAAAC
CTCCTTGCATTTAAACAAAACCAACAGAGACAAGCACACAACTTACTTGGACAAGGCGAT
CCTGGACAAATTCAGCTTCTAAATGGAAAAATGGAATCATCTGAAATGAAACATGAAAAG
GAGAATAAAAGAAGGCAAGTTTTAAGTGAAATTTTAATTAAGAACATCATATATCAGTCA
GTTTTTTATTACAGACAATTCCTGGAATTAGAACAAGATTTGCTCCTAACTGTCTTTAAG
AATTTGTCAGCCAGCAGGCTTACAGTTGTGATAAAGACTTGTGGAACACTCAAGACTATA
TGGCCTATGATCCTTAGATACCCTGCAAGCCTGGAACTGAACTCAACCCCGTGACTTAAC
TGTAAGCCAAACAGTAGACAGGCCTGTAAGTTAAGGTCTGTCTTGTAACACCAGGGAGGT
GTGCATTCCCTAAAACAACCAACTCTCTGAGATCAAAAGGGTAGCTTTTGCTCAGGGATA
AACTTCAGAAAACAAGAAGCTGCTAGGACAAGAGAAGAACTAGAATGAGTAAGCACAGGA
AGGAAGTAGGAAAAGTTCTGTTGTTGAGATTGCACGTGAAAGTTGGATAATGAGTAAGGA
AGACCAAAGAAGAATTGATACTTTCGAGTTAGGTATTGGTAAAGATTATTGAAAGTATCA
CGGGCTGCCAGAAAAACAGACCTGTCTTGGAAGAAGTATAGCCAGAATGCTCCTTAGAAG
CAGGAAATGACCAGACATGTTGTCAGGGAAGAAACGAGTGCCATTATGCTTGCTAAAGAA
GGACAGCCAAAAAGAGGAAGACCCTCAAGGAAACGCATTGACATAGTGGCTGCACAATGG
GTTCTAATGTACCAATTGTGAGGACGGCGCAGGACTGGCCTGTGTTTTGTCCTGTTGTAC
ATAGGACCGCTGTTGGCTTGAAGGTACCTACCAAAACCAACATGTATTTGAACACTATGA
GGAAAATTCTTATTTACGAGGCTTTTTTTGGTCAATTCTGTCATAGAATACTTTCCTGCC
ATTTTAAGGCTAGATGATGCTTTTACATTTTTCTTTAAAAGAATGAGCAGGCATATATTG
TAGCACCAATATTTGGTGTTTCAAGCAATATTCCATGTGTCATCCAATTCACTAAGATAA
CAATTACTCATTATATAAAATTCTCCAGACTTCTAATAAGCAAAAGGCTAGGTGATATAA
CTTACTTGCAGGCACTAGGAAATATGTGGGTGAAAAGCTGGACTGTGTTGCCTTGAGACC
AGCAGAGCTCCATGGGAACCCAGTTGGTACCCAGTAACCATTACTGAATATTTTGACCAG
AGTCTATAGAGGAATTCTTATCAAAAGGGAGAAAAATGCATAATAGAACTTAAAATTCCC
TTGGTAGTTCATTCTTCTTGGACCCAGCAAGGCTGGATGAACCCCCTAAACTGCTGCCCC
AATACGAGTTTAACTGAATGCACCCAGAACATACCTTGATTCTTGTGCTCTTGTAAGAAT
GATCTATATGTGGTCACATTGGCAACAGCTGCTCACAGCGTTAGAGGAGAGACTCCGGAG
CAGCGAGTTCATGAAGCAGGATCAGGTCAGAACGGAGGGTGCAAATGGTTGCTCAGCTGA
AAGAGTGCAGTCAGTGTCTCGGAATTGTAGATACAGAAGCTGTTGAATTGGTGTATGTCC
TGCTGTGCATACTCTCAAAAGCAGCAACAAAAATTAAAATTAGATGGAAAAGAATTCCCC
CCCCCCCATACACACAAAAACCCATCGCCATTGAGTAGTTGCCATCTCATAACCTTATAT
AGGACTCCCAAGGCTGTGTAAATCTTGACAGGAGCAGACGACCTCGCAGCCTCTTGGGAG
GGGCTAGTGCACTGCCATCAAGTTGATTCCAACTCACAGCAACCCTATAGCACAGTAGAA
CACCTCCTGTTAGTTTCCGAGACTTGACATCTTTGCAGAAGTCGGCAGTCATCCTTCTTC
CTTGGAGTGACTGGTGGGTTTGAACCACTGAACTCATGGCCAACGGCTCAGGGCGTAACC
CACTATGCTACCACACTTGCCTGCAGTTAGTGAAAAGAGAATAGTAAGGCTATGCCTCCA
CTTAAAAAAAGCTTATGACAATGTTTTGTTCATAATGAATGTTCACTGCATGTGTTGACT
GACAGCTTATTACTGAGTCTTGCAAACATTAAAAAAATTTCACATTTATCTGATCTTAAA
ATCCAGATAGAACTCTCCCCAAAGCATCCCTTCTTTCTATCTATCCCATGTATTCCTCCC
TCAAAATAAGTCTTTCCCTTGCCTTTTCCAGACATCTTGCCATCTTGATAGGATTTAACT
GAGATGATTAAGTGTTTAACTCCAAGAAAGATAAAGGTATCCAGTCTGGTTTCTGGAATT
GGCTTAAAATAGGAAAAAGTTTAAAATCACCTAAAACGTGTGGACCTAAGCTGGGATCCC
AGTAGAAGAGCCAGTTCAGGAATAGAGGAACTAGAAATCAGTGTCATGTTTTCTTGATGT
TTTGCGTATATTTGCTTGCATGTTAGAGGGATAAATAGTTTGCTAATTTAATTATATTCT
ACTAATAATACGTTACCCTTATTTTAATAACTATCTCCCTGTAGTGTGATCAAAATGAAA
GACTGATGTTTGTTCCTTATTATTATTTGTAACAGGCAAAGACGACGAACTCAGAAAGAG
CTGCAAGAAAAAACTTCAGAGAAATTGAGAAAAGAATCCTGCGTGACTTTCCAACCAAAG
GAGTCCGTCATTAATGATAATGACTCGGAGATGAGACCCAAGGTATCCCAAAGTTATAGC
AGATTCTCCCCGGTTCACTGTGTCTTTGAGGTTGATCTGGCCTGCTGATTGCTGGCAACC
TTTGAGTGTGATAAGCAGGATCTTTTATATCATGGAGTATATAGGCCCCACTGCTTACCT
CAGTGGAATGGTGGGCGTTTAATTGCAGATGTGAGTGGCAGGTTGGTGACAAATTAACAA
CAGTAGCTTAGAGCCTCAGCCTTCTGCTTTTCCTGTCTGTGTTGCAGTGTCTATGTGGCC
CTTGGTATCGATTTACCTGTTTCCTTGAGGTACCCCTATGACTTCTCAAAGTTAGTTTTG
AAGGCTATATAACCAACAAAAATTTTAATTAAAGTCTTTGCAAACGTTCTCTATAAATTT
GGTGACAGTAGCTGTTTTTATAACAGTTTTATGGTTTCTATGGATTTTCAAAAGGCATAC
TTCTTTAGTAATTCATCAAGAACATATCTATAGGCACTTAGTTAAACTATTTGCTGAGTA
AGTGAAAGATTTTGATAGGATGGGAGTACAAAACTCTGCATATCAAAACTACCCTGCAGG
GAAGAATTATAATAATAACTGCCTTACATTAGTAATGCTCTTTTTTGCTTGACTTGTGAA
CCTAGTGAATGTGTGAAGTTACTTTGATAGAATACATAATAAGAGGTTCAGCTATAGAAT
TCTAGTAACTGAACTTCAGCTTAAAAAGTAAAAAATCTTCAGACCTATTAGGTATTTTTA
TTGAATATTTTTATTATTTACTAAAATAATAAATGCCTTTGAGTTAATTATAGACTAATC
ATTTGGGAACTTCATTCAGGAACAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACCACGCAGTCCTCCACCTGGCTTCT
CCTGCAGACCCACCCCTCGCAGTCCTCCACCTGGCTGTTCCTGCAGACCCACACCCCGCA
GTCCTCCACCTGGCTGCTCCTGCAGACCCACACCACGCAGTCCTCCACCTGGCTGCTCCT
GCAGACCCACACCAAGCAGTCCTCCACCTGGCTGCTCCTGCAGACCCACACCAAGCAGTC
CTCCACCTGGCTGCTCCTGCAGACCCACACCAAGCAGTCCTCCACCTGGCTGCTCCTGCA
GACCCACACCAAGCAGTCCTCCACCTGGCTGCTCCTACAGACCCACACCAAGCAGTCATC
TACCTGGCTGCTCCTGCAGACCCACACCAGACAGTCCTCCACCTGGCTGCTCCTGCAGAC
CCACACCACGCAGTCCTCCACCTGGCTGCTCCTGCAGACCCACACCAAGCAGTCCTCCAC
CTGGCTGCTCCTGCAGACCCACACCATGCAGTCCACCTGGCTGTTCCTGCAGACCCACAC
CAAGCAGTCCTCCACCTGGCTGCTCCTGTAGACCCACACCAAGCAGTCCTCCATCTGGCT
GTTCCTGCAGACCCACACCAGACAGTCCTCCACCTGGCTGCTTGGCTTCCGCTTCTCCAC
TTCCTAATCTACCTGGCGTTCTACCTTCCCACCTAAAGCCACTTTCTTTTCACTATTATT
AACATTGTTCTCTTTGCAGAGGTTGTTGAAGAATTAGAAAATACAAATAGAGAAACATAA
AAAAAAAAAATGAAACCTCCCCCATAACTATTCTGTCTAGAAAATAACTAGTGTGAACAT
TCCTGCAGGCTATATTTTATAAGCATCTCTATACAATGTATTTGTAAATAGATATACAGA
TATATCTGTATATGGCTATTCAAAAATAATTGCTTGTGAGCCCACTTATAACTTATTTCT
TTATATACCAGTATTAAGCTATTATAAAAATCATGTAATTTTTTCCACAAATTTTTGGAA
ACTTCCTCACATATCACTAGTTAATTTTTCTACTATGTTATTTTTAAGGATTGTATAATG
TCTTAAACGAATTCTGGTGGCATAATGGTTACTTGTTGGACTGATAACTGCAAGTCAGCC
ATTCAAAACCACCAACCGCTCCTTGGGAGCAAGACGGAGCTATCTATTCCCCAAAGTGGA
AACAATCTTGGAGCACAGGTAGCTCTCCCCTGTTGTACAGGGCTGCTATCAGTGGGCATC
GACTCAATGGCAGTGAGTTTTTTGAGTATAGTACCCTAAAGAAGACACCATACTTTATAT
TCCTTTTATTGTATCTGTCCTTCCTGGGTTGACTTCGCCTCAAAAGACACATCTACTTGA
AGCTCGAGAATAGATGACCTGCTTCCTGATGCACGTCTCTACTGGATAGAAATTGCCTCA
CGCACAGCATGCTCAGTGTGCCCTCGTTATTCCTCCTCACACTAGGATGTCTTTCTGCCT
TCTGCGCCTGGGTGTGCTGCTCCCAACCTAACCCCTGATCACAGGCCCTTCTAAAGCTCA
CCCTCCCCTCTCCCTTCTCATGGAATTAGCAATCCATTCTTGCCTGTTTTTTTTTTTTAC
CTCCTTTGCAGTTCTTAAATTTTTCCTCATCATTCCTCACTCTTGCTTAGTTCATAATTG
AACTGCTGTAACTAAATGAGGGTCTCACTTCTAAGCTCCATCCAAGTGATTGTCCTACTT
CTGTTTTTCCAATAGGAAGTCTATGTCTCTGTCCATATGGTATCTAGGTGTGATTACTTC
AGAATATCAATTTTATCTGGTTACTTCCCCACTTAACCACTTGCAGTGGATCTTCATTAG
CCAGAAGAACATTGAGCTTTCTCCTCTGGGGATATTTGGTTTTGATTCCACTGAAGTGTC
TTAAACTCAGATGTCCCCTCCTTCAGAAAATTCATTTTGATGACATCCTGAGTCACTCCA
TAGGAGCTCTGGTAACATGGTGGGTTAAGAGTTGGGCTGCTAACCACAAGGTCAGCAGTT
TGAATCTACCAGATGCTCTGCAGGAGAAAAGTGAGGCTTTCTGCTCTCATAAAGATAAAC
AGCTACAGGAAACCTGTAGGAGCAGTTCTACTCTGTTCTATAAAGTTGCTATGAATTGGA
GTCAACCTGATAGCAATGATTTTTGGGGAGGGGGGGTAGGTAACACAATACACTCCACCT
TCTTTGATTCATGTGGGCTCCAATAAGTGATGTTGGCTTCTCAATAATCTCCCACTGTTT
GGCTTTTATACTTAAGAGATGCTCCAAGGTGACGTTACTACTTCGGCTGGATTGCATTTC
AAGGCCTCTGTGAAGAAGAAAGCAATAGAAAGCCAGGATGCAAGNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNATTTTAACAGCATATTAGTTGCTCATCCCAGTTTTT
TGTCCCCAATCCTGGTATATAGTTTAGAAATTTAAAATTGAGTGTGATGATAACTTAAGT
AAAAATTTTCAGTAGAAATGTTATTGTTATTCCAAAATGCCATAGAACACATCCTAAGCC
AAATGGGAATAATGGTTTGCACTGGACTCGGAATGCTTTTAATTGCCTGCACTGAAATTG
ATAGCCTTCCGTAGAGAGGCCTGGTAAAGTCGAACTTGGAGGAGGTCTGGGTGGGGTTGA
GTGTTTGTAACTGTGTCCAAGAGGAGAGGAAAAAGTATTAGAGGATCTATTATTTGAGAT
TTTCCCTGCCTTACCTCCCTATGAATGTCATCAGTTATTGAGCAGCACCTGGAGTGTTCT
GCTCATTGTGTCTTAGAGTGTAGTAAACAGTTTCTCTTCATTAACTGTGGAACTGCTCAG
TATTGTTAAAAGCCTCTCTAATAGAACATAATATAAATATTACATACTTATACATATAAA
TTGGTATGTTTTAAAAAATATCATCATAGAACATTTGTCATAGACTATGTGAAGAATGTG
AAAATTTACCAGAATTACATCACTTTTTTCTGTTCATTCTTTGTGCATTTTACACAAAAT
CACATTATTCTTCAATATATTTAAAGCATTTAATTTTATGGCATGTGTATTATACGCCGA
TTAAACAATGTAAAAAAATAAAGTCCTACTTAGAATGCTTTATTTGCTGTGGAAAGCTAA
AGCTTTCTCTGATGGGGTGCTATTTTAAGTGTTCAAGAATAGTTTAATGGGATTTGGGAA
AATGGATGGGCTGGGACACCTGCACTTTTTCCGCTTAAAATACAGATCAGTTAAGCGGAG
AGCAAATGTTTTGAGAATGATGAGGGCAATGAATGTACAAATGTGCTTTACACAATTGAT
GTATGGATTGTGATAAGAGTTGTTTGAGCCCCTAATAAAACAATTAAAAAAATACAGATT
AGATTTGTATGATGAGGGATACCTATATTTCATGTCCTTTGATTTATATTTTGACTTATA
TTTTTACAGAACACTTCCCTGTGTCATCAAATAGTACTTTGTAAGCATAGTGCTTCTACT
AGGTATACTAAAAAATTTTGAACAAATTCTTGACTAGTACAGATTTTGTTTTTGTTTTGG
CTTCTGTACATAATTCTTCGTGGAGTATTTTCCTCCAGAGGAACCTTCTCTTTTAATCAC
TGATTAAGCTAACTCTTTTTTTCCAGCTAAGGTGGTAGGTTGGAGGAGTCGGGGTGGTGG
AGTGGGTTCCTTGTGCTGCTGAGCACAAAGTCAGCGTTGAAAACCACAGGGGTGCCTATG
GAGAAGGGTGGGACTTTCGACTCCTGTCAAGATGTAGTCATGAAAACCCCCAGGCAAAGT
TTCACTCTTTCCTATAGGGTCCCTGGATGAGGGAGAGTTTTATTTTGGAATAAGGTAGCA
AACTCAGTGTCATGGAGTCAGTTCTGACTGTGGGACAGGGGAACTGCTCCTGTGGCTTTC
TGAGATTGTAACTTTTTATGGAAGTAGAAAGCCTTTCTTTCCTCCCCATGAGTGGCTGGT
TTTTGAACTGCTGACCTTGCATTTAACAGCCCAATGTGTAACCTCCAGAAAATGGCATCT
CACTGTTCTTTTCATTTGCATTTCTTCCTGAAAAAAAGTGTGTGGAAAAATGGAATTGAA
AGATTGTGTACTTTTTCCAAGACTCTTTGGAGCCCTTTCGTATAAGAGGCGTTCTGATGT
CAAGGATGAGTACGTGCTGGAGAATGATGGGCAAGTGCTTGTTCTCCAACATGTTTGTGA
GAAAACCTCTGGAAGGCCTTGGCCTTTGCCGTTGGGCAATCTTCTAATTCTTTTGTTAAC
CCAGGTCGTCAGGGTCAGTATTTAAACCAATGTGTCTCAAAGGTGGGGATCTGACCCCTG
GGGATGGGGGTGCTGGACCAATCCTGAGGGAAGCTGCAAAAGCAGATACCTACATTTTAT
CCTGGATTATGGACTATAATACAAAAGGTTTTAATTTCCAGGGGCAGGAGGGCACTGCGT
AATTTTGTTGTTGTTGAAACAGGGCTGGGTAGGCCTGGATGTAAACAATGATAAAGTCTG
AAATCATCTTGTTAATTACTTAAAGATTAATTCAGTAAGCCGGCATCACTTCTATCCTCT
TTATGCACAATATCTATCTGTACTCAATGTATTTTATTTTTCTTGTGTTTGTAATATTCT
TTTTCATTTTCCATTTTCCCTCAAATCTCCTAACTTAGTACAAGATAAGGAAGCTGCTTC
TCAAGAACTTGTTTCTGAATGTGGTAAAAATCAACTCATTTCTTCAGCATCAGGTGTGTT
GTTTTTTCCTGTGGGTCAGCATGACTTCCTACAGACGATGTCTGCCAGATGCCAGAACAG
AGCTACCACTCCCTGTTTAAACAAGACAAACAAACAAAAAAAAACCCCAGTTAAACCAAT
TAGTTTAATGGATATATAAGTATTTTCACCTGTAATTTTTCTTTTTGTTTTTTTGTTAAC
ATATGGCTTAAATCCAAACTTTGTTTCTAGTATTCATATGACAATTATATTTTGTATATA
AAATTTTAAAGTAATGCTTTATTAAAAGTAAAATACAGGGGCTGTATTTCAAGTCCTCGG
ACAAAAAGCATAGTCAAGGTATCTATTGATCTATATCACTTCATTGTGTTGACTTTTGAA
TGAGCAAATGATTTTTGTAAAATTTAGGTGTTAAAATAGTAAGATTTAGCATTGGGCCCG
GTGCACATTCTAAAAACATTGAATTGCAACCTTGTGAAGGGTGTGAACCACTTCTCAGTA
AATCTATTAGTAAAAAGTGCTGAAAAAGACAGTTATGAATTGATTTCTTAAAATATATCT
TCATTGCTATTCTTTTAAATAAATGACAAGTTAATACATTCAAAATGGAAACAGGAAATT
GTAGCATTTTCTTGGCATGATTTAGGTACTTTATTGTGCTTGCAAATTAGTCATACAGGA
AAAGCAATAGTCTTATTCCATGTATATTCAATTATGAATTACTCTGTATTGTCATCTGAG
TAAATACAGATTTGTTTTATTTATACCTGTAAAGCTTCTACTTGGATTTTCAACAACTAC
ATTTTTTTCCTTATTTGTTCCTAGCTTATCTTTTATCAAGTTAGTGACTTAGATCCATGT
ACAATGTATTCATGATTTTTCTTTTCCCAATTTTCAGAACATGAACCCTTGCATGTTCCT
CAGCTGTTGACTCCAGATGTATATGTGGACCTCAAGTTTCCCACTACAATCTCAGAGAAA
CCTTTGTCACCTTTAATGGAAGCAAATTCGGTTTGTATACAATTTAGAAGTTCGAATCGT
GAATTAGGAGCCTTGGGGTAAGTGTAGGCCTGGCTGCTAGTCTCATTTGGTGGTTTAAAC
CCATCAGCCACTCCGTAAGACACTGTGAGGCTGGCTGTGCCTGTAAGGATTTACCGTCTC
ACAAACCTCACAGGTCTCTGAGTTGGTGGAATTGACTCGAATGGCAATGGGTTTTGGTTT
TGGTTTTGTTTACTAATACAAAGGGGCTTCAAAGCATGGAAAATAAGAATGGAATTTTCC
TATGAACTTTTTTGAAGCCTCGTACATTTTCTGCCAAAAAATTAAGTATTATACCCCAAA
TAATGTAAACTGAGGCCACAACACAGTTTTTCTGCAGCTTTCTTTAAGTTAGACACATAG
AAGCCCTTGTCTGGTTATTGATAAAAAGTAAGCTTTTGGGGGTGGGGAGCAGAATAGCCA
TTTACAGTACAAAGAGTATACGGTAATCCTTTCTGGTGGTGTATGTTTTGGCTCAGGTTG
GACACACTTACATTGATGTGATTGACATTGAAGCTGACGATCTTCAGGAATTACCTGCCA
GAGAAGAACCTTTGGATGCTAACGTGACTAAACTGTCAGGCGATCATCTAGAAGGCCCAT
CTTCTGCAGAGTTACATTGTATGGCAGCGTCACTTAATAATGCTGTGCCCCCCCACAATA
TTAAGAGTCAAGGTAATGTGTTTTCTACTTTTCAAATAAATACCTTTAGTAAACATTTTA
AAATAGTATTGTCCTCCCTACTCAGACCTCTCAGCTGCCCTCCCACAGACCCACTGTGCT
TTTGGATGTTTCTATTCACAGTGAGACATTCTCTATCGATCTTCTGACTACTCTGTTTAG
AAGTCATTATTCCTTTCATATTTTTGCTAGAATCTGCTACTTCTGGTATGGATTTAGTTC
TTAAACCTGCAAGCATGTCTCCCACCTGTCTGGATGGAAGAAGCTGGAGAGCAGGTAGTG
CAGAAATGAAGGAGCCTCGTATGATCTCACCTACACCATCAGAAGTACAGCAGAACAAAG
GTGAATGGAAAGGCCATGACTAGTAGCAATCCCCCCCAAACCCCCTTCCATGGATTACTG
TTATCTTAGCAGTAAGCACTAAAACTCGGCAGGGTCAAAAGCAAGTAGAAAAAGACTTTG
CCCTTGCTGCAGAGTGGGGACCAGTGAGCACTGGGTAAAGAGTTTTGTCTGTGGATCCAA
ATCTGAGACCCGCGGATATGTTACAAGAAAACTATGCCTCTACAGATGCATGCGTGTTTC
TCATTTAATGGAAACTCAAAATAAATATTCTGGGGGAGTTCATGAGTGCTTTGATGTTAT
AAAGGAATTCTCATCTTCCAAAAGCCCATGGAAAATGCACAGTCACTGTAGCCTGAGATC
CCACATACAGTCATTTATAGCTACCTTTGGGACTAGCTTTTACTGTGCAACATTGTTCTT
GGTGTCCCAATTGTCTTTAAGTCACAGAAATACTTAAAGATGTTTTTGGATGAAGTATAT
CTTTTGGAGCATGGGGAAAAGTAACATAGAAACTAGCTTGTGTGTATGTGGAGCTAAGTG
GTAATAATGACATAATTATGCATTCTAGCTCACGACACAGACAAATCTCCAAACTCAGGA
GGCTGGAACGGACTTTCTAGGTTTATTAAATGATTCTAAGAGAATGTTATGTTGGATTAA
ATTGAGATTTAAAAAAATGGCATGATCAGTATCTCCCTCTTCCTTAATTATAATAAATTC
TGATTGCATTTTTTCCCCAGACCTAGATCTGCTAACGTCTGAGTTCCAATTCAAAGAGCA
CAGCCCAGAGCCAGCAGCTGCAGATGATCACCTGTTGTGGAAACTGCTGCACGAGGCTCC
TGATATGTCACCTCCCCTGAGTCCTACAGCTCGCAAACTAGAGCATCTCACGTCTAAGCT
TCAGGAAATTGATGAGCAGCTACTGGCCATACAGAACATTGCTGACAACATCGAGCAGGA
TTTCCCCAGGCACGGAATGGTAGGTTTGCTTTCTGCTGAGATGCTCTCTTGGTTGGTTTG
TAAATTGAGTTACCAGATTTGTAGTGTGACTGTAGACACTTGAATTTTCACCACATTAAC
GAGAAATTTGGTTTCTTAAACTCCAAAGTTCTTAACCTCAGCACTGTTGACCTCTGTTGT
CGTTGTTGTGACCTAGATAATTCTTTGTTGTGAATCTGTCCTGGGTGTTATGGGATACTT
AGCAGTATCTCCAACCTTAGCTTGATGGATGCTGAGGAGCACCCCAGATGGAAAAGCAAT
TATTGTCTGCACACAGTGCTAAATGTGTGCTGGGGGTAAGATCGATCTGTATGGAGAAAC
ACTGGCTTAAGGGCCTGAGAAGTGAAGCCATGCCTTTTACCAAGAAAAAGGAAATATGGA
TTATTAAACCAGAATGTGGCTTTTAAGGCAACCCTGCTTGTAACTTGAGTATAATTTTAT
TCTGAGAAATTTTTGTAACTTTACAAATATTGTCAGTATATCTGAAGTTCTTCTCATTTG
CTTTAAAAGATCTTAAAGGGACTAGTAATCAATTCCTCACAAATTTTCTGTCTTTAAAAT
GTATGAATAATTATTTATAAAGACCATCTTTTTCATTTAAGAAAAATTCATAAAATAAAA
AATTAAATTTCACATATGGATAATGTTATTATCCTATTATATAACACACTCATAAGCACA
GGAATCTTCATTGAGAAAGCAGCTTTTAGGCCAGAAAGGTGGCAGCAGAGGGGTGCTGTG
GAGGAGTGCTGCCTAGCATTTGGAAGACCTGGGCCCCCATACTATATTCTGACACTCGGA
AAGCCATTGAATTTTCCTCACCTTTGCTCCCTCATCTCTAAAAGGAAACGTTTTGTGTAT
ATGATAGCTTAGACTCCTCCTCATTCTAAAATTGTAAGAATCTGTGTTCCTGTCCCTTTT
TTACCCTCATTAAAAAAGAAAAAAGTGATGGGGCCAGACCGTGGACTATTCCCACACTAT
GTCTCCAGTGATGCCCCCCACAGTCAAGGTTCAGTGCAGGACGACATGTCTCGTGGTGGG
TCCAGTCCTGCGGTCCTCTGGTCCTCTCCTGGCAAGGCACTGAGGGCATGCAGCAGAGCA
TCAGGGGGATCAGACTGATGAAACCCCCGGGAAAAACCCAAAATAGACTTGGGAGACAGA
GTGTGGGACCCCATAAGACTCAACTGGGAAACACGCATAAAAGCCAACAAACAGACCTTG
AACTATTTATAGGCTTTTCCATTTTTGTCAGTGGCTTCCTTTTTGTTATTGTTATTTTGT
GTTTGTTTTTTGCTGGTATTGTTTTGTTGATTTTGACTTCCTTTGTTGTTTTATTTGGCT
TTGCGTCTTTTTTGCACTTATTAATGTATCTGCATGTCTGTCTAGATAATTTAGGTGGGA
TAAATAATTCGGAGAGTCAACCAGTGTTAAGGGGGGGGGGATACGGGAAAAGGGGAGGTG
GGAGAAAGGAAGAGGAGGGGGGACCAACTCAGTGACAAGGGAACAACCAGTGAACTAAAA
TCAATGGAAGGAAGGTCATAGGATGCCTAGTGGGGCTCAATCAAGGGCAATGTTGCAGCG
AGGAATTACTAAACCCGAATGAAGGCTGAACAGGATGGGACAAGAGGGAAGAAAAAAAGG
AAGTAGAGGAAAGAACCAGGGAGGCAAAGGACATTTATAGAGGCCTAAATACAGACGTGT
ACATATATAAATATATATAATGAGAGGGGAATAGAACTATGTACTCATATCTATATGTTA
AGAATTAAGGTTGCAGATGGACATTGGGCCTCCACTCAAGTACTCCCTTTAACACAAGAA
CACTTGGTTCTAACAATCCGGCGTTCTGTGAAACTCACTTTCCCAACATGATCGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACTTGGG
CACCCGGGTCCAGCAGTTCCATTACTGGTCATTCTTCCCTTCTCCCCACTTACCTCCTGT
TTGCCCCACTGAATCTGCCTTAGTTTTCTAGGCATTGGCCTGTTTCGAGTGGATCTCACT
TAAGGTGTCGGTCACACCGATATCTGCCACTTGGTGTTCTGACTTCACTTAGCAAGAGGT
CAAAGGGTTCGTCCCATGTTGGTATCAGAGGCTTGGTTTCTCTTTTATGGTTGGAGTAAA
TGTGACAGCGTTGGGCTGTCTACACTTTACTCACCCCTTTATCTGCTGGTGAAAATTGGG
GGTTGGTGTCCCCCTTTGCTATTGTGAAATAATGCTTCCCTGAATCCCTACCCTTACAAA
AGTTTAAATCAGGTGAGCTACAAATAAGCAAACACTTCCTTCTTGTTTTCCCTCTTAACC
TTTTAGCTCATGTTGGATTTTAATCCCAGGTTTCTACCAAGTATTACAATAATGCATATA
TTCAAACCTATATACAGTTGTTTCCAGTATTTTGAAAATATCAATTGTGTGTTTTTTCAA
AAGGTTGAAGCAATGGATCACACTGAATTATATTCTGGCCCTGAATGTGATCAAGTACTG
CCTTCAAAAACCAGAAGCATCTCTGACGAAGGTACGCATGTGTGGGAAGGAGGATTGCAG
TCTTTTGGACAGGACCATTGCCTTTTAGACAGCTATAACTAGGAATGGCTTTCCTCTGTC
AGCTGTAGGCCTCAGCTCTAAATTTTCGCATTAAGATTATGTTTGTGATAATCCACGTGA
TTGATGCCCATCTAAGAAGCCAGTGCTATATAGCCTCAGCTGACTTTGATACCAGCAGGA
GCAATGTGGGCTGGATCTTTATTTCTGTAGCTTCTAAGTCACTGGTAACATACTCCTGAG
AACTCCACCGAGCTCAGTGCTGCACAGAGCTTGTCCACAGTCACCAGCGAAACTAGAACT
TGGGCATCTGTTTAACTGATGAAAGATTACATTAAAAAATCATTTTATTGGGGGCGCTTA
CAGTCCTATCATAATCCATACTTCCATCTATTGGGTCACGCACATTTGTACATATGTTGC
CATCATCATTCTCAAAGCATTTTCTTTCTACTTGATATCTGCTCCTCATTTTCCCCCTTC
CCTACCCTCTTCCCTCATGAACCCTTGATAAGTTTATTTCTTACTTTTATTGGGGGTTCT
TACATTGAAATATCACATTTTAATACCTTAATGGAAAGAGGGTGTATAAAATTTAAATTT
CTCCTGTATCTGTTATTGTTTATTGCCATCGAGCTGATTCCAGTCCAACTGATAGAAACC
CCATTTGATGACATATAAATGCGTTAAGCACTGGGATGCTAATCAAAAGATTAGAAGTTT
GAAACCACCAGCCAGCCACTCTGCAGGAGAAAGATGAGGCTTTCTACTCCTGTAAATATT
TACAGTCTGGAAAACCCAGAGGCAGTTCTGCTCTGTCCTACAGGGCCACTGTGAGTCGGA
ATAGACTGCCTGGTCTTTCTCCCATGGAAGCACTGTGTGTGTTTGAACCACCAACCTTTC
AGTTACCAGGCAAGCTCTTCAGGGTTTTTTTGCTTGTTTGTTTAATGATATCAATGAAAG
ATCTTTAAAAAAAAATTCATAGAAAAAATGGAATTAAAAGATGGTGGAGTTTTTCTACAA
ACTTTAAATGCCTCCTCAGTTTTTTTTAATTTTATTTTTCTTTTGGTATATCTATTAAAC
TTTGGTATCAGGGTAACGCCGGAGTCATTTGGTGAGTTCCCACCTCTTCAGTTTTGTGAG
TTTAAGAATTTATGTTATGTTAATCTTTGATTGGTAGACTATTAGTGAGGCCACCTCCTA
TCCTGGATCTTTCTTGATTGGGAAGTTTCTGATTTGTTGGGAGGTTTCAGTCTCTTCGGA
CTTGTTGAAGGTCCACTGAGATAGTATAATTTTTTCTAAAGTCAATTTATATAATGTGTG
TGTTTCTCAAAGTTTGTCCACCTAGATTATCTAATTCGATGGCAATATTTTTTCTTTAAA
AAAAAATCATTTTATTGGGGGTTCATACAACTCTTACCACCATCCATCCATCCATCCATC
CATCCATCCATCCATCCATCCATCCATCCATTGTGTCAAGCACATTTGTACATTTGTTGC
CATCATCATTCTCAAAACACATGCCTTCCACTTGAGCCCTTGATATCAGCTCATTTCCCC
CCCTCATTCCCTGCTACCCCCTCCCCCATGAGCCCTTGGTAATTCCTTTTGAGCCCTTGA
TAATTTATAAATTATTATTTTTTTGTCATATCTTACACTGTCTGACATCTCCCTTTACCC
ACTTTTGTGTTGTCCGTCCCCCAGGGAGGAAGGTAATATGTAGATCTTTGTAATCGGTTC
CCCTCTCTACCAATACGCCCTGTACCCTCCCAGTATTGCCACTCACATCACTCTTTTAGG
GATCATCCTTCCCGGATTCCCTGTGTTTCCAGTTTCTATCTGTACCAGTGTACATCCTCT
GGTCTAGCCAGATTTGTAAGGTAGAATTGGGATCATGATAGTGGGTGGGGAGGAAGCATT
AAAGAACTAGCGGAAAGTTGTATGTTTCATCGTTGCTACACTGCACCCTGACTGGCTCAT
CTCCTCCCCACAACCCTTCGGTAAGGGGATGTCCAGTTGCCTACAGATGGGCTTTGGGTT
CCCACTCTGCACTCCCCCTCATTCACAATGATATGATTTTTTGTTCTTTGATACCTGATA
CCTGATTCCCTTCTATACCTCATGATCACACAGGTTGGTGTGTTCTTCCATGCAGGCTTT
GTTGCTTCTGAGCTAGAGGCTGCTTGTTTACCTTCAAGTCTTTAAGACCCTAGATGCTAT
ATATTTTGATAGCCGGGCTCCATCAGCTTTCTTCACCACATTTGCTTATGCACCCGCTTT
GTTTTCAGGGATCATGTCAGGAAGGTGAGCATCATGGAATGCCAGTTTAATAGAGCAAAG
TATGCTTGCATTGAGGGAGTACTTAAGTGGAGGCCCAATGTCCATCTGCTACCTTAATAC
TAAATCTATAAATATATGCACATAAATATATTTCCCCATCCTCATATGTAAATATATTTA
CATATGTACGTGCCTTTATTTCAACCTCTATAAATGCCCTTTGCCTTCTAGCTCTTTCCT
CTATTTCCTTTTACTTTCCTCTTGTCCCACTATCATGCTCAGCCTTCATCTGGGTTACAG
TAATTCCTCTTGGTTACATTACCTTTGATCACACCCTACCAGGCCTCCTACACCCTTCTC
ACCACCGATTTGGATCATTTGTTATTCCCTTGTCCATGGGTTTGTTAACACCACTTCCTT
TCCCCCCACCTCCCCCTCTCCCATGACCCCCCAGAACTATTGGTCCCATTGTTTTCGCCT
CCATATGGTTCATCCAGCCTATCTTATTTAGACAGACCTGCGGAGATAATAACATGCACA
AAAACAAGACAGAGCAAAACCAAGCAACAAAACAAAACAAAACAACAACAACAAAAAGCC
AATGACAAACAAACAAAAAACCACAGCACAACAACAACCAAAAAAGAAAAGCTTGTAGTT
AGTTCAAGGACTGTTTGTTGGCCTTTAGGTGTGTTTTCCAGTCGAGTCTGATGGGGCGAG
TGTTTTCTGGTTGAGTCTGATGGGGTGCCACCCGCTGGCCCCATAGTCTATTTTTGGCAT
TCCCTGGGGACTTCGTTGCTCTATTCCCCTTGCTGTTCTGTTGCACATCCTTAGTGTTTT
GCCTCGGTGTGGTGGGATCAGATCGGGCGGAATTCCCACACTGTGTCTCCAGTGTAGTCC
CCTATAGGGCTATGGGTCAGTGAGGGATATCATGTCTCATAATGGGGCCGGCCATATGGT
CTTCTCTGTAGATTGGCTGATCTGAGCAGGAATATCGTCGTCATGGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAGGAGTCCTGGTGGTGT
AGTAGTTATTCATTGGAACTGGGATCCAAAGTCAGCTGTTCGAAACCCCTGGTTGCTGGT
GGCCTTCTACTCTGGTTGTTACAATCTTGGAAACCCACAGGGGCAGCTCTTTCCTGTCCT
ATAGGGTCGCTAAGAGTCAGCATCACTCGATGGCAGCGAGAGACTGTCATCCACAGCCCT
GCAAGCCAGGTGCTCATCATTTAAGTTCTGATACCTTTCCCACCTTCAGATTTGGATTTT
ATCTTCAGTAATCGCTTCATGAGGGTGAGCATCGAGTAGAGCCATGTCTTAAGAATGAGT
TGTTCTTAAATTGGGGCTAGAATTAAGTGCAAGCCCCAAATCCATTCATATGTCTCTAGT
TTATGTCTCTGGTTCACTTTAAAGATATTATTATCATTTTATGATGGAGAACATTATAAA
TCACCCCCCTCCCCGGAGAATAATGTAACTCTATTGATAGTATTATTAATTTAGCCAATG
GTATAGAATTTTAAATGTTGTTGAGAAAAAAGGATATTATACTTCAGACCACAACACATC
AATTGTGGAGTTGTACAGTTCCAACTCTTACAAATGGTGACTGAACACCATTTACACACA
AACAATGGGGGTTGGTGATGGGGCAAAACGTTCAATAACATTCATTCACAAAGGCAGAAC
CACGCCCACCAGACAAGTACATGTCCTAAGAAAGCAAGGAAAGCATTAACCTAGTAGGCA
TCTGCTAGCCCCAGGCCACCACGCATTGGGCACCCTCAGAGCAAGACATCCAAATCAAAG
TCCAATGCCTTCCAATCCCATAACCGTGGGAGAGGAGTCATCTGCTTCTTCTCACACTAG
AGCAGTTCAGCCTTAAGTCCAAGGGAGTATGCCCATTCCTTAAATCTGCTACAGGTGAGT
TTGAGGTAAAGCCCAGTTCACTTAATGGGGTTTCCACATCGAATCCTTCTGGCATGGCCT
TTGGCGGACATTATGTACCTGAAAATGACTAAAGTTCACTGCCTGAGTCACCAAGGCTAG
ACAGAAGCTAGGTCAAACATCGTTCACTTAGGAACACAGCACTGGAGTGTTCTCCCCTTG
GGTTCTATGTAAGTCTTGCTTCATTTTTTCCCGTGGGAGGTTGCTCCTCCCTTTTATCCA
CCAATAGAAGTATACTTACCTTCTCTGCAACATCCATGTCTCCCTTCCCCATGTTGACTT
GGATTTCCAGCAAGTTTCACTTATCACTGGTAGGAGAGTCTGTAGGAGTTGACTTGGGGT
GAACTTAACACCATGTCCTATGGCAGCAACTGAGTGGCCTTCTCCCTCTCCCAGCCTCTT
GAGGAACTGAGCCCAGCGGAGGTGAGGTCTCACCTGCTGAAGTGGTTTTTAAGATGCAAA
GGGAGTGACATGGGTCATGAGCAACAGGTAGGCTCTCCCTACCGAGCTGCTTGGGAGACC
AGGTTAGATGACACGGCCTGAGAGCAGAAGCCCGCCTTGTCTGGGTGTTTGTCCATATAG
CAGTGGACTCGCCCAGTGTTCGTCCCTTTGTGATAGACTGACTCCACCAGGCACAATGGT
TTCCAGGTCCACCCATGTCATGAGGTGTTTCATAGGGATGCATAGGATTCCATTGTGTGT
GTCTGTGTGTGTGTACCGGTTTCTTTATCCATTTCTTCTACTGATGGGTATTTGGACTGT
TTCCAGCTTCTCCCTATTGTGAGCTGCACTGCAATGAACACACCAGAGTCTAACCATAGA
GAAGAGAGAGTGGGTCTGTCTCGTAGGGTGGTTGAGGTAGCTGCCCAGCAAAGGTGTTGC
TAGGTCACATAGGATGTCTAGTCCATTCCTTTAGGTAGCGCCATATCACTTTCCACGTGG
TTGTACATGTTTACGAGCCCACAGAGAGTGTATAAGAGTTCCAATCTCCAGCACACCCTT
TCCAACACTGATTGCTCTGTTCTTTTGAATCGGACACTTTTTAGGGGTGTAAGGTGAGAT
CTTATCGTTGTTTTGATCTGCAAAAGAGATTGTGTCTTTGCGGAACCATTTACCGTACAC
AGAAACATCAGGCTCCCATTTTGGATGATATTGGTTACGACTGTCACAATGTGTCTGCAT
TCGCCTTCATTCCCTTATCGGTGCTCCCGTCCAGCCCTCTCACTTCCCTGGCCCCGCCCC
TCCCACCTCTGCTTTAGAGTCCTCAGTCTCCTAGAGATGACTTTTTAAAAGGAGCACCTG
GCTCACAGGTGATAATTGTTATTCACTGAGACAGTCTGCTCTTTGGCTAAATGGTGGCCT
CAGGGGATACTTTCAGTTCAACGTGTCTCGGTGCAAGCCCAGGGCAAAAGTCCCAGTAGT
CCCCTCATGACAACTAGCCCAGGAAGTTCAGACCTTTCGAAGCATTTGCATTCTGTATTC
TGTGCTTTTCTCCCATTTTAGCAGAGTCCACCTATTGTTGCCCTGATCAGAACAGTGCGT
AGTGGAAGTCAGGCACCATCTAGTTCTTCGGGTCTCAGAGTTAAAGGGGCTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCTGCTATGCTTTTCTGACATTGATA
ATAAATTAAAACCATGACGATGTTGTATAGGCAAGAGATAAAGCTCAGGACACACAGAAC
CCAGAAACAGGAATGGGAATAGTGATATAAAAGGGTGGGGGAAGGGGGGAGAGGAGGAGG
AGAGAGAGGGGCTACCGATCACAATGAATGGCACATAACCACAACCCCCCCTCTAGGGGG
AACAGCCAGAGGGGAATGGTGACAGTGTAAGATAAGAAAATAATAACAGTCTGTGATCTA
TCAAGGGGCCATGAGGTGGGGAGGGCAGGGGAGCTGATGCCAAAGGCTCAATAGAAAGTA
AATGTCTAGAAAAGATGGCAGTGTATATACAAATGTGTCTGATACAATTGATGCTATGGA
TTGTAACAAGAGTTGGAAGAGCCCCCAATAAAGTGATCTTAAAAATTTTCTTTATTATGT
TACAGTTTTAATTTTAACTTGTGTTAAATTAATTGGTTATATACCGTTTCCCCAAAAGTA
GGACATTCCCTGAAAATAAGACCTACTTACAGTTTTGCCTCAAGCTGAAATATAAGGCAT
CCCCCCGAAAATAAGGCCCCCCGAAGCTACCTTAACTCTGGAATCTAGACCGTGCCTCCA
TGCAGCTCACTGTTAGCCACAGTGCAGCCGTAGCAGACAGGAAGTGCGAGGTCTATTTTA
ATAAAACAATGAACAAATAAGACATCCCCTGAAAATAAGACCTAGCGCATCTTTGGGAGC
AAAAAATTAATATAAGACACTGTCTTATTTTCGGGGAAACAGGGTAGTAGCAATTAGAAT
ATGTTAAGAACTTTTAATACATCTGGGTTGCATCTGAAAGTGTTAGTTAATTGATGTATC
TTTGTTGTTATCCCCACCCCCCCTTCTTTGCTTGGGATCAGTGCATTTCCTGACACATTT
GGGTGAGGAAGAGCGAAGTAATGAAGAGAAAACTTCCGAGACTGAATTGTCTGAAACAGA
AAGTTACTCTAGTCATAAGGCCTTTGTGTCTGCATCTGCCACCTCAGCCGTCAGCCCTTC
CACTGACCAGAATACGGCTTCCACTGGTATTGCTCCTCTTTACTTCACTGACACTCCTGT
TGGGGATTTAATTAGGAAGTGTTGATGATGAAGGGTTTAAAATATAATTAAATATATTTT
CAAGTTATTCTTTTCAGGGGGAGGGTATTTAGAGATTGGAGCATTCACTCTGTGTCTTTG
CACATTTCATTATAATATTTTACTTTGTCTTCTCAGAAAAGTAAAATAAATAAGGAAATG
TGCAAAGACCTACAGTTGTTAGGTGCCATCGAGTTGGCTCTGACCCACAGCAACCATATG
CCCAACAGAACAGAACCCTGCATCGTCCCGTGCATCCTCACAGTTGTCCCCGTGCCTGAG
CCCCTGGATGCAGCCACGATGTCATCCATCGTGTTGAGGGCCTTCCCTTTTTTCACCGCC
CTCCATTTTACTAAACATGTCCTTCTCCAGAGACCGGTCTCTCCCGACAATATGTCCAAA
GTATGTCAGACAAAGTCTAGCCATCCTTGCTTCTAAGGAGACTTTGGCCTTCCTTCTTCC
AATACAGACTGTTTGTCCTCTTATCAGTCCATGGTACTTTCAATATTCTTCTCCAGCACC
TCAATTCACATGCATCACTTCTTCTACGGTCTTCCTTAGCCAGTGTCCAACTTTGACATG
CATGTAATGCAATGGAGAATACCATGGCTTGAGTCAGGTGCACCTTAGTCCTCAAAGAAA
CATCCTTGTTCCTCAACACTCTAAAGTGGTCTTGTGCGGCAGATTTACCTAATGCAATAC
ATCTTTTGATCTCTTAGCTACTGCTTTCATAAGCATTGATTGTGCAACCGTTCTCCATTC
ATCATCATGTTACCTACTAGCCCAGTTGTAAGGACTCGGGCCCTCCCTCCATTGAGTTGT
AATCCATAATGAAGGCTGCACTCCTTGATCTTCATCAGCAGGTGCTTCAATGTTTCCTCG
CTTTCAGCACACAAGGCTGTGTCATCTTGCATTGGCTCCCTCAGATCCGAGGGCACTCAA
AATGTGACGAAAGAGGAGAGGCGATGATTTCTTGGAAGACAGTTGACCGTGGTGATGTGA
GTTCCACAAAGCCTGTTGGAGTGGAGACTTAGGGTTAAAAAACAAAAGGGAAGAGCATGC
TCAGCACACCTTAGACTGAAAGAACCAAAGGAAAAATTCAAGCTCCAAGGTGCAATATTG
AAAGATTCTGTGGGCAAAATATTGAATGATGCAGGAAGCATCAAGAGAATATGGAAAGAA
TACAGTCACTGTACCCAAAAGAACTAGTCTACATTCAGCCATTTCAGAAGGTAGCATATG
AGCAAGAACCAGTGGTGCTGAAGCAAGAAGTCCAAGCTGCACTGAAAGCATTCGCCAAAA
ACAAGGCTCTAGGAACTGGTGGAATACCCACTGAAATGATTCAGGAAGCTAATGAAGCAC
TAGAAACACTCACCTATGGCAAGAAATTTGGAAGATGGCTACTTGGCCAACTGACTGAAG
AGAACCATATTTGTATGTATTCCAAAGAAAGGTGGACCCAACAGAAAGCACAAATTATAG
ACTGATATCATTGATATCACATGCAAGTAAAATTCCGCTGTAGATCATCCAACAATGCTT
GCAGCAGAACACTGTCAGGTTGCTGCCAGAGGCTCAGGCCAGACTCAGAAGAGGGCATGG
AACAAGGGGTATCATTGCCAATGTCAGGTGGATTTTGGCTGAAAGCAGAGAATACCAGAT
GTTTACTGTGCCAAGGCATTTGACTGTGTGGATCATCACAAACTATGGATAACCCCAAAA
AACAAACTGGATCACCTTGAGAAGAATGGGAATTCCAGAACCCTTCCTTGTGCTTATGCA
GAACCTGTACATGGATCAAGAACAGAACAGGGGAATACTGCATGGTATAGAATCAGGAAA
GGTGTGCATCAGGGTTGTATCTTCTCATTATGTTTAATCTGTATGCTGAGAAAATAGAGA
AGCTTGATTAGATGAAGTATGTGGTATCAGGATTAGAGGAAGGCTTAATGACAGCCTTGC
TTGCTGAAAGTGGGGAGGACTTGAAGCACTTGCTGATGAAGATCAAGGATTGTAGCCTTC
AGTATGGATTACAACTCAGAGTAAGGAAGACCCAAATCCTCACAACTGGACTAATAGGTA
ACATCATGCTAAGTGGAAATAAGATTGAAATTGTCGAGAATATAATTTTACTTGGATCCA
CAGTCAATGCTCATGGAAGCACTAGAAAAGAGATCAAAGGACTTGTTGCATTAGGTAAAT
CTGCTGCACAAGACTTCTTTAAAATGTTGTAAAGCACGGATGTTACTTCAAGGACCAAGG
TGCGCTTGCCCCAATCCATGGTATTATCAATCTCACCTTATATGCCTGTGGAAGGGAGTT
GGACATTCAATAAGGAAGACTGAAGAAAAATTGATGCACTTGAACTGTGGTTTTGGTGAA
GAATATTGAAAAAGTACCACGGATGGCCAAAAGAACAAACAATCTGTCTTGGAAGAAGCA
CAGCCAGAATGCTGCTTAAAGACAAGGATGGCGAGACTTTGTCTCACAGACTTTGGACAT
GTTGCCAGGAGAGACCAGTCCCTGGAGAAGGAACATCATGCTTGGTAAAGTAGAAGGGCA
GAGAATGAGAGGAAGGCTCTCGATGAGATGGATTGAGACCCTGGCTGCAACAATGGCCTC
AAACATAGCAATAATTGAGGGGGTGGCACGGGACCGGTGATGTTTTGTTCTGTTACACTC
AGGGTTACTATGAGTGGAACCACCTGGATGTCACATGACAACAACCACATGCACACCTGT
GTCATCCTGACACGTTCATACACTGTAGCCATGCTTCGTATCTCGGTAACATATGAAATG
TTAAATATAAGCCCTGGAAATAATGTAACATTTGATTTTTATTAAAGTTGAGAAATCTAA
TCTGTCATCAGAACTCAAAATAATGGCTGTCATGTACTGAGCCTTTGACTTCTGCCAGAC
TTTGTAGTGGTTCACATCGATCCCTGTCTACGTGTGGCCTGTAAGCCAGACGCCATTGCT
CTCCCCATTTTAAAGCCGAGGCTTAGAAAGGTTTTGTATCACTTCTAGTTCTGTTTCATC
TGAAGGTAGCATTTAAAAATATTACCCTTTAGTTCCAATGAAACCGTTTAGCCATGTGAG
TAGTAGAGTATAATAGTTGAACCATCCGCAATGGAATGATGGTTAGGTTTGGTTTTGGCT
CTCAGATATTGACAACCAATAATGATACTTTTATTCAGTGTTTATAATATTTTTAATTAA
CCAGTTTTTTAAAAGATACTTTATTTTTTATTTTTATTAAATCATTTTATTGGGGGCTTG
TACAACTCTTATCACAATCCACACATACATCCATTGTGTCAATCACATTTGTACATTTGT
TTCCCTCATTATTTTCAAAACATTTGCTTTCTACTTGAGCCCCTGGTATCCACTCCTCAT
TTTCCCCCTTCCCTCTGCATCCCACCATGAACCCTCGATAATTTATAAATTATTATTATT
TTGTCATATCTTACAATGTCTGACATCTCCCCCTCAACCCTCCTCTCCACCGGTCGGTCC
CCAGGAAGAAGGCTTATAGGGAGATTCCCTGTAATCTGTCCCCCTTTTCTCCCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCTGGTCCTGAAGGAGTTTGTCTGT
CCTGGATCCCTGTGTTTCCAGTCCTTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAG
ATTTGTAAGGTAGAATTGGGATCGTGATAGTTGGAGGTGGGAGGTGGGCGGAAACATTGA
AGAACTAGAGGAAATTGTATGTTTCATCGTTGCTACCCTGCATTCTGCCTGGCCTATCCC
CACCTGCAACCCCTCTGTAAGGGGGTGTCCAGGTGTCACAGATGGCTTTGGGTCTCCACC
CCACACTCCCCCTCATTCACAGTGATATGATTTTTTTTGTTCTTTGATGCCTGATCCCTG
ATCCCTGTGACACTTTGTGATCACATGGGCTGGTGTGCTTCTTCCTTGTGGGCTTTGTTG
TTTCTCAGCTAGATGGTCACTTGTTCATCTTCAAGCCTTTAAGACCCCAGAGGCTATATC
TTTTGAAAGCTGGGCACCACCAGCTTAGAAAGGTATTTTAGTTGGCATTTAAACAATTGC
TATTGTTTAAACAGGGCCTAAGACATGAAAACAATAATTTTCATGTTATCGGGGTCACGA
GAGTGGGAGGTGGGGAGAGTGGGGAAAAAGAGGAGCTGATACCAGGGCTTAAATAGAAAT
AAAGATTTAGAAAATTATGATGGCAATATATGTACAAATAAGCTTGAAATAATTGATGTA
TAGAATGTTAATAAGAGCTGTAGGAGCCCCCAATAAAATGATTTAAAGAGAAAGAGTGAA
TAATGAAAGTAATATGTTTGTCTCCAAATCTCTTGGAAGTGGACATGGAATAATCATTCT
TCAAGAATGAGTTGGCACCTAAAATAAACAAATAAGCAGTGTATGTTAAAGTAAAATCAC
TAAGAAGCTGGTTTTAAATCTTATGATTTTTTTCCCCTTCATAGTTCTTTTTAAATTCCA
TTTGATTTTAGTTGTCTACATCCGAGGTTAATAATTTCCATTTCCATTTCACAGCACTGT
TGTGGACATTGAGTATCGTATATAAAGCATCTTGCCTAGAAGCTGTTATTCCTGTAGGTT
CTTGGCCACTGGTACCCTATTCTTCCCTCCCAAGGGCCAGGGCTCACAAATGAGGTTATA
CAGGACTCGTGGGCTAGGTTGAAGAAAGTGTTAATTGCATTTGAGAATTTTAGCGACTTT
TCTTTTGGGGAATCACTGGAGAATTTTGGGCCGAGAAGTAAAATAAGAAAATTTTGAGGA
AGACTACACTGGAAGCAAGAAGCCCAAGTGGCCACAACCGTTGAATGCTTAGCTACTATA
ACTAAAAGGTCAGCAGTCCAAACTCATGAGCTTGGACTCCGTGGAAAGAGATGTGGTGGT
CTGCTCCCATAAGATTACAGCCTGACAGTCACTCTGAATAGGACTTCCCTCAGGACACCA
CAGCAGCAGCAACATACAACAGTTAGGAACCTATTAAATTACTCTTACCTGTGAGATGAT
GAGAGCCTGGGCCCTGTGGTAGGAAAGGAAAAGAGGAACAGACATGCCAGAGACCTTCTG
AATAAGGAACTGTCAGCACTCGAAGACTAAGTGGATAAAACGGAGAGAGAGAAAAACTGA
AGGCTGTCTGCTCTTGTTAGCGCATACAACCAGGGCTGGTGCCTAACTCAAAAGCAATGC
GAGTTGAGTTGTGATGGTTAGGTTGATGCTAAGATCAATGTTTGACCATAGGCAGCACAG
TTTAAACATAGGAGTGGAGCTTGGATGAGAGCGTCAGGCTTGAAAACATGTTTAACTGTG
CAGTTGAGCTAGGCAAGTGCATCTGTTCGCTGTGAGAAGAAACCACAGCCCACTGCTGTT
GAGTGAATCCCATTGCATAGCTACCCTAAGATAGCAGAGCTCTGTAGGGTTTCCATGACC
AAATCTTTACCGCAGCAGACAGCCTCATTTATCACCTGAAGAGTGCAGGTAGTTTTGAAC
TTCCAGCCTTTTGGTCAGCAACCCAACCCTTAGCCTACTGGACTGCTACCAGAAGAGAAA
AATGCCAAGGCCCCAACTTGGTAACAACAAGTGAGCCAAGTTTAGAGGAGGGATTTGCAA
GAAGTCAGTGGCTTCACAGTTCCGTGTGCCACCAGAAAGTCAAGAGTGAAGGCTGAGTCC
TAGGACTTTGGGACCTTTAGTACAGTCTCAAGAGTAGAAAAGGTGGGTTGGGGACAAAGG
TAGACCCCAAAAGCTAAAAAAATTAAAGATTTTTATATATAAATTAGGTTAATGAAAAAA
CTGCCCTGTAATTTTTATTAATAATGTTCTTTTCTTTTTTAAAGGTATGAATAACAGTCA
TGAGTTGCATGAGAGGTAAATATCCTAGGGGTTTTAAATCACTATTTTTCCTTAAGCAGA
AATGATGTGTTTTGGGAATTTTGTTATTCACATTTATATGAAATCGCATACTACACGTTT
AAGTGATTTAAAGACTATAATAAGTACCCGGTGGGAATGGGTGCTCCGGAACCCCCGAAG
TCTTGTTATCTTCTCTCCCTTACCCTCGGATCATAGGGGTTCTGTGAGGTACAGCTGACT
TGATGGCAGTAAGTTTGGTTGCTCTCTCTTTTTTTGGTTACTATTTTATTATAAGTAATT
AGAATACAATAGTCTACATTTGTTCCATTTGCTTTTACTAAATAGATTTTAAATTTCAGC
AGGCAAGACTTATAGAGGTTTTCTTCTGGGCCTGTGTCTGATTTATTTAGAGTACCTACC
AACATCAATTACTATTATCTTCCCTGCGCCATCCCACCCTTCATCCACCATCTACCACAC
CCTCCCCTCCCGGAGGAGAAGACGCCCCCGGACTGCATTGCTCTCACATCGCTGCTGCTG
GGTAGGAATTAACGAATGGCGAGGCTGTCACACTTTTTCTCCCTCCCCTAGTCCTCTTAA
AGCTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAATGCAGGGCTGCGTGAG
TGCAGAAGAGCAGGTTGGGCAAACACAAGAGGCTGTCAGCAGAGCATGGTGGCTTTACAT
TAGGTGACTGAGTGGATGGTAATTTCATTACCAAGACTGAGAATGCAGTGTGAGCTCTCG
AAAGTGCCGGGAGAGCACTCTTTGGAATTGGTCATAGAGATTTATTTAAGCAGGGGATGG
AGGGTGGGGGACAGAGGAGTTGGGGACAGCTGTCAAGACTGTAAGGGCAGTAGGGCAGTG
TGGAGCTGACCCAATGTCAGTATTTCCAGTAGCACCCAGGCTTGACCTTTTGTTTGGAAG
ATGCACAGGACTCCACACATAATCATACCCTTGGTTATAATTTATTACAGCAAAGGGGGT
CAAAGGAAAATCAGTCAAATGTAAAAGAGTCTTGGGGCCAAGTCTGGAGGTAACTAAACC
TAAATTCCCAAGAATCCTCTTTAGGGGGATCCCAGGTGGCCCACAATGACAACATGTGTG
CCATGTTGACTACAAGTTCAACACTCAGCCAAGGTTTTTTTACTGAGGGCTGTACATGTA
GGCCTCGTCTGCCCAGGGTGTACCAGGCTCCCAGACTCCCAGAAGAAATCAAGTGCTCCT
CAGAAGCCACATGGTTTGTTCGTGGTTTAGGCACAGGGGTCACTTTGTGCAGTTTGGGAA
TGGTGAGAACCTTTCCAAAATCCAAGTTCCCAGGTGCCAGCCAGGACCCACCCTGTAAGT
AGACCCTTGCAAGGACGGTAGTTGTAGGCCTGCTACGGCCACCCTAGTCTTTACTGGCCC
TTTTGAAGGAGAGAGAGGGAGGAGGACTAGGTGAAAAAGGACTAGGGAGGAGGACTAGGA
GGACTAGCATGCAGTTAAAAAGAAAGCTTCCGCCAGGTCAGTAGTGACCACAGTCAAGTT
CCACCAGAGAAATCTTGTGGAAATAGGGACCTGTCATATCACTGCCATGCTCAAATCTTC
CCTAATAAGCAGCATTTAGTTGCAGTGCTTAGTGCATGACAGGTATAGACCCATGTGATA
TCTGCCTGCTGAACTTGTCAGGATCCGGCACACTTCTGACAGACGTTCACAAAGAACTGA
GAAGGAGAGGAGGGAGATTCGCATCTGGATGAAAAGAAAACGAAAGGAGAGGATGGCGGA
GTACCTGGATCAGCTGGCAGAAAAGAGAGGGCGGGAGCACGAGCCTTTCTGCCCCAGGAC
CCGTCCAGTAAGTCTCAGGGGGGAGGCATTATCAAAGGGTCTGGGCCGCTTTCCTTACGT
TAGGAAAACCGAGGAAATGGCCTTACCAAACTATAGTAGGATGTCCTACGAACTAGGTCT
GTTGAGCTATTTTAAATATTGTTTTCCCTCCCAAGCTGATTATGGCTTTAGCATTAACCA
AGTAAAGTGACCAAATGGAGCTGTTCTTCAATTTTCCAGGAGCTTCAACGTCAACCCAAA
GACTGCATGAATATTAAAACCATTTTTCTAATTTAAAAATCTATTTTCTATTTATATTTC
TATTTAAAAATACACAAAAATTATGCTCCCATCATATACCAACAGAACAGTGGTATATTT
GTGTGTGTACAATTTTTGTTTTCATTGACCATTTAAACTATCTAGTATATACATAGCCCT
GACAACATTGCCCTGACTAGATGGAGTACTTTTCTTCAAAAGATGAAGCCTAGCTACTTG
GATAATCACATAATTGGGAAAATCACATTTAGCTTATCCGTAGGTTAAAGTTCATCTTTT
ACTTGTAATACGTAATAAAACGTTTTTCAGCATCACTGGGAGGAAACCATGAATGAGTTT
CCTAGGCCAGGTTGTCCCATGTAAGCACCACAGAGGGTACAAAAGAGTGCAGCTCCCCTT
TCAAAAGTGAGTGTCGCCTTGTACCCATCTGTCTCTGGGGAAAGCACGCTGAGAGTAAAA
TAACCTTTTCGTGACCTTAAGGGCTAATGAAAGTGTTTGTGTGTTCATATTCCCCTACCC
ACGGGGGTGGGGGGGGGTGTTCCAACATCACCCCCTTATAGTCAGCCAAATGAACTCTGG
GCATAGGGACTGCGTGGTTCGCAGACGTTTGTGTCAGGATTGCAGGCACTTGTTTTGACT
TGGGTGAAGTTAGAGGGTTAGTCAAGGAGTGCTGGTGGCACAGTGGTTGAAACCCTCCGT
GGCTACCTCGAAGTTGGCAGTTCAAGCCCACCCACATGAGACAAAGGTTGACAGACTTCT
TTCACCAAATTACAATCTTGGCAGTTCTCTGGGGGATCTACCCTTCTCTGTAGGGCTATT
ATGAGTTGGAATTGAGTCGCTGAAAATCGCTTTGGAGTTATAGGATTAAAAACCAAACCT
CCTGCAGTCAGGTGAATCCTGTAGCGACCCCATAGGACAGAGTACAACTGTGTAACCGGA
TTTCTAAGGCAGTCCTTTCCGAAGCAGACTGCCACATCTTTCTCCCCAAGAAGCTGCTGG
GTGGGGATTACGGACCTTTCACTTAGTGGCCCGTTGGTTTACCCTCTGTGCCGCCAGGGT
TCTCTTTAGTAAGGGAGTCATGCAATTGAAGGCGCGCTTTGGCAGTCCACATGGCTAAGT
ACAAGACTGCGAACTGAATGGAGGCTGTTGGAAGTCGCCCAAAGGCCCCTCAAAAGGCAG
GCATGACACCTGGTTCCTAGCCTTGAGAGCCATCTGGAGCATTTCTACTGTACACCTACG
GGGTTGTGCCACGACTTAGAACAAACCACAGTGATGTACTTTAAAGTTTGACATAAATGT
CCATCAAAAGAAGTAAGGATTTTCTTTGTTACTGTTTCTAAAAAAGCCCTTGATACGGTG
AGTTCACATGGACGTGTATGTAGAGGAGCGTAGCTGTCAGACTTGACCTCATTAGTAACT
CACACCAATAACAAGTTTTTCAGGAATAAGATGTGTGTATCTGTCACTGTTCTTTGGCCT
TACAGTGCATACGTTTTGCAGTTTACAAGTTGCAGTGAGTTCCCTTCAGTAGGTTTCTGG
AAAGCATTTTAAAAACATTAAAAGGCCTCATTTCTGCTTCACCAGCCGAGTTCCTGGCAG
CTCGTGCTAGCTCGGTGTGGGTGTCCTCTCTCGCACAGGTGCCGTTTGTCATTTCAAATG
CAGCCCGACCGGTGCTTATCCACGTCACTAGGAAAGTAGATGTTGCACCCTAATGATTAA
ATTGGATGTTACTTTAATTACATCATGCTTCAATTTAACATTTTTATGTTTTGTGCTTGG
GTAGAAAGCTTCATCAATAATGGTAATGTTTACACTGTTGCTAAGTGGCACAATTATGTT
TTAACCTCTTGATAAAATGGAGTAGTGAAATTTCTAATTTTAGAGGGATTATGATTTCAT
TATTTGAACTGAACAAGAGTGAACTAACTGGGTATTTCTCTACAGTTTTACCTGACTTCA
CGGGAACTCAGGCGAAGACAGAAGATGAAGCATGAAAAAGACAGGGGAGTGTGGTAGCTG
CCCCCGAGCTTGCTCTAGCTGTTCCCTCAGCGTAGATAGTACCTTCAAACAAAACAAAAG
CCATTGCTGCTGAGTGGATACTCACAACGACCCTATAGAACATATTTAAACTGCTCCATA
GGGTTTCCAAGGAGTAGACTGTAAGCTTATACCTTTCTCAGTGGCTATTCCATCCCAAAC
TTTATGACAATATTAAAAATTCTGCCTAACTATTTTTGTGGGTTTTTAAAAACTTTTATT
ATTTTTTAAGCTTTAATTTTATTCCCCGAGCCATGAGTTTTTGCTTTCTTTCATATTCTT
TTTGGGAAATCTTTTTTTTTCCGTGCAACCTCCTCTTTCTGGGTTGGGGAACAGCTTATT
TCCTTTTCATCCGGAGTCACCTCAGTGGGGCAGGGGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGT
TGCACTGGGGATGATCATGTTTGCTGCACTGGGAGTGATCATGTTTTGTTGCACTGGGAT
GATCGTGTTTGTTGCACCGGGGGTGATCATGTTTGTTGCACTGGGGGTGATCATGTTTGT
TGCACTGGGTGTGATCATGTTTGTTGCACTGGGTGTGATCATGTTTGTTGCACTGGGGAT
GATCATGTTTGTTGCACTGGGGATGATCATGTTTGTTGCACTGGGATGATCATGTTTGTT
GCACTGGGATGATCATGTTTGTTGCACTGGGGATGATCATGTTTGTTGGTGTAGACCGGT
CTGTCTTCCATGATGCAGCTGATAGGTTTGCACCACTGTAGGAGTCTTGTTTTTTAAAAT
TGTCCCCTTTTTGGTCAATAAAGAAATGAAAGAATTCTTTACTAAGGGGAGATGGGGGAA
AGACTCACTAACTTTCTGTTTGTTTCTACAAATACATTTTGTTTCTAGCAACAAAGATAT
ACTACTTTACAGAACCCCCCACCCCCCAAATCCACATTCAGATATTCCCTGTCTAGGATA
TAAATCTTAACAAAATCTTACAAAATCTGGTATACCAATGCTTGGGGACACATCCAGTCA
GGGTATCTTTTCACATTAGATCTTTTATAATTTTTTAAATTGAAAGATCATTTTATTGGG
AGCACTTATAACTCTTACAACAATCCATACATCAGTGATATCAAGCGTATTTGTACCTAT
GTTGCCGTCATTCTTTTCTGGACATTTACTTTCTACTGAGCTCTTGGTGTCTGTTTCTCT
TTTTTCCCTAATCTTCTCCCCGACACCCCTGTGACCCTTGATAAATTATTTTTATTTTTA
TATCTTACACCGACTCCTGTCTCCCTACCCCCATGGTTTCTGTTGTTCGTCCCCTGGAGG
GTGTGTGTGTGTGGTTATCTGTCGGTCATTGCAGTCGGTTCCCTCTTCTCCCCATAGGAC
TCACTACCTTTTTATAAGTTTGTCTTCCAGTATTTACTCCACATCATCGTATGACTTTTA
TTTCTGTTGTTTCCTTCTTCCTCACTCCCAAGACCATAATTCTAGTACCATCAACAATAC
TATATGATAAGCTACAGAAGTCTAATGAACAGAAGTATTTTTTTAANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACCCAAAACAAAA
CAAACAAAAAGTATATCAATGGGAATGAGGGGGAGGGCAGAGTGGAGCTCCAAAGCCCAT
CAGTAGTCATTTGGACATCCCATGTCAGAACGGCCACAAGGAACAGAAGCGCCAGTCAGC
ATGCGGTATAGCACGGATGAAACACACACCTTTCTCTGGTTCTTTAATGCTTACTAACCC
CCCCCCCCCACACCCATCCACCCCAAACATACACTACCATGACTCCCATTCTGTCTTACA
AATATGGCTAGACCAGAACATGTATGCCAGTACAGAAAAGAGCTCGCAACACAGGGAATC
CAGAACAGATAAAGGGGAGCAGTGATACTAGGAGGGAGTAAGGGGGAACCAATCACAATG
ATCGATATATGGCGTCCTTCCCAAGGGGTCAAACAGCAGAAAAGTGGGTGAAGTGAGATG
GCGGTCAGTGTAAAACATGAAATAAAGAAAAGAATGAATTATAAATTTTTCAAGGGGGTA
TGGGTGAAGAAGGGGAAGGGAGGGGGTGGGGAATAAGCTAATGCCAGGGGGTCAAGTAGA
AAGAAATGTTTTGAAAAAGATGACAACATATGTATAGATGTGTTTGTCAGAATGGATATG
TGTATGGATTGTGATAAGAGCTGTCAGAACCCCCAGTCAAGTGATTTTTAAAGAGATCAC
CTTTGAGAAACCACTATCCCAGTCAAAAACTGAACCAGCTTTGTTCCACCCCAGCTGGGA
ATTGGTAGCCCTTGCTGACAGTGAACAGTTAGGATTACACACAATAGCATATAACCTACA
ATTTGTCTAGAGGAAATGCTGCATCAAATTCAAACAAAATCAGATCACTGGTGTGTATAA
CTTGGACTGCAAAGTACTAGAGGATTTCCCTGAAACCTTCCTAGAATAAAGGAGAATATA
AGTACCTAAATAACTACCAACGATATGAAGAAGTTGAAATGGAATGATAATCAAAAACCA
TTTTTAAAAGGAAAGAAGGTGGTTGAAATACTAGTTACAAAGATAGTTTATTGGGGGTTA
CTATATGCTAAATGCATCACTAAGCAACGTCAAGTGAGTGAATTAATCAGGGGCTGTCAC
CTGGGCTTTTTGAAATATTAAAATTTATCACTGATATAAGAATCTAGGAACATAATCATG
TAATTTTTACTTTAGAACAAATCAGTATGGTCACAATTTTCCAATCAATCGACCTGGCAA
AATCAGCTATCAAACAAAACCGAGAGATAGTGCAAACGGAATCCCTCGGGAACAACAGTG
TCACGGTTCACTTTGGCAAGGAGGTAAGTCTTTAAACCTTTTACACTGGGTTTCTAAGTA
AGAGCTGTACCTCTCCAGTAAAAAAAAAAAGCAGTTATCACCTTAACAAAACACAAGGAA
TTGATAAAGCCTTAGTAGTACTGGGATTTTATTCTATTTCTTTAAAATAAAACAATCCTA
ATACCAAGGGCTCACGTAGAAAGAAATATTTTGAAAATGATGATGGCAACATATTACAAA
AGTGCGTGACATAATGGAGTTGTACAAGCCCCCAATAAAATGATTTTTTTTTTAAAAAAA
GAGCTGTATGAAGCCCCAACAAAATGATTTAACAAAATAAAATAAAACAATCCTAGTAAA
CCTTTAAAATTCTTATGCTTTCTGTAACAGAAATTGAGCCGTCCATAAATCAGTGGATAC
AACTTAGTCCCAGCATCTGTTTCTGTTTGAGTGTGTGGCTGCAGATGTAGGCACTTTCAG
AAATCCAGTCCTTAGCGTGGGGAGGCGCGAGCACACAGCCCGAGAGCCTCAGGTTGAAAT
CATGTCCTGTTTTCATTACTCTGGAACATCCTTTTCCCCAGAGACGGGCTCTCCTGATCA
TATGTCCAGTGTGTGAGACTGCGCTGCCTCAGTGTTGGTGTTGCTTCTCTGTCTCATGGT
CTCCCTGCTTCTGTCTGTACTTTTTGCGAAACAGACTTCCTTATTCTTCTGGCCGCCATG
GTACAATACCATAATTCAAATGCATCGGTGTAGTCTCCCTTATTTATCATCCAGCTTTGA
CATGCATGAGGCGATTGAGTATACCATGATTTGGGCGGGATCTAGTTGTCAAGTCTGGTC
AGCAGATTTTTTTTAAACTGCTGCTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACATTCTAT
CCCATCTTTGAGTATTTGCCTAAATTGACTAATCAACTAGAGAGGAGAATTATACTTAAT
AGTCTTAGTTCTTAACATCTCCACTTTCCATCTCCCTCATGCTCCTTGTCACAATTTAGA
AAAGCACTTCCACACTTAGGATATTCCCCTAGCAGCTGTCCACCAGAACCCTGCTGAGTA
GGCAGGGCAGCTGTTAACCCCATTTTATAGCTGAGAAAACAGTTTTAGCAAAGTTAAGTG
ACGTTCCCAGATCTTCTTAGAAAAATGAAAATGATAGTTTCAGACAGGCATAGATGTCAA
GCATTTGTTAACACATAACTATATTTTGTAGAACTAATGAAGAAAAAATGTTTATATGCC
CCATAAAAATGGGAAATAAGAAGTAGTCGAATTCTGTTATGTCTGTGTCCACGTGTGAAA
ATGGCACAGGAGCATTTTCTGACCTTCTCTGGCTGCACAAGGGAGAAGAGCATCCAGCTC
CACACCAGCCCAGGCTCGCTGCCACGAGGCGAGGGTCAGACATGCCTTCACCCTCCGTTT
TGCTTCACCCTGTTCTGACCCCAACCATCCCTCCTATGACACTCTTACTTTTCTACTAGG
TTTGATCATTTGCTGCAGTGGCACAAAACTCACAGGCAACACTCACAATTATGGGAGTTG
ATGAGGAAGGTTAACGGGATCAGAAAACATTAACAATACAGTCCTCAGTCCATAGCAACA
CCGTTCTCGGTCAGCTGCCAAGTCTCTCTCTGATCTTTAGCTGCTCAGTCACATGGTCCA
TTGGCCCCTGCCTCTGTGGGCCAGAATTTTGGTGTTCTCCTCTGCTGTCTCATGGTCTCC
TTGCCTTGGCCTCTGTGCACCCACCACTCCAGGCAGAGATTTCTGACGCGTTCCTCTGAT
GGCTCTTCTTCTTTGATGAGCCTAGGAATTCTCTCCCTCCACTTCTGAGATGATCCTTTT
GTATGTAAAGGAATGACAACCCAAACTGACCATTATTAGTGTTTCACATGCTCTGTTTGC
ATGGTCCCACTCATTAGTGGGAGTTACAAAGACAAGGATAGAGAAGAGCCATATTAGGAA
ATGTCACTTCACCCACACCACTACATCCTTTATTTGAAGATTCATTTGCCAGTTATTGCA
TCTCTCTTCAAGTATGTCAAATCCACTATTTAATTCACCTATCAAGTGTTCAGTCAATGA
CTGATTTCCAGAAGTTTTATTTAATTCCTCTTCTAGTCTCTTCCCCATGTGTGCATTAAA
ACCCCAGCCCCATAGCTTTTTGGATCAATTTGAATGCTAGAGTTATCATTCCCTATCCTA
ATTTTATGTTAGTAGCAGATACTCTGTAGATAGTTATCCTAGCTTTATTTTCTTTCTCAG
TTTCGTCTTTTGTAAAAAAAAATTAAATATCTAGCAGTATATCTAGTTTAATAGACAGAA
TGGCCCCAAACCAATGTTATCCCCCACTAAACAGCAGAAAATATGCACATTTTAATTATA
TATATTTTTAATATTTTTTTGTAAACGTTCCAAAGGTGTAGAATTTCATGATTTGAAATG
AGTTATGATCGAGTGTGGCTTGCCCATGGGAAGGAAGCACTAGACATATGCTCAATTGTC
CCATGGCAGCCCTGCCTGCGAGGGCAAAAATGAGATGGCTCGGTTTCTAGCTTGGGTGAT
TTATTTCTAGACTGTGCCCACCAACCACTACAGAAAAGGAACTGGGGTTCCTTTTAGGGT
GGCAAAGGTAGTGGATTCAATTTTCTAGTTGAGTTTTAGATTCTGTGGACAGTGCCTGGT
GATAGTTGTAAAGAAACTGAGTGGCAGTCTGCATGGTCCTCACCAGGAAGAATGCTTTCT
GCTCCTGGAGGACGGACGCCTGTGACTTCGTCAGGCCTGGGTTTCCACTGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACTTCATGGCGACCCCTGTAGGTTTCTG
AGACTTAAGTGTTGACAGGCATAGTCTAGTGTTTGTCCTCGTTCGTCCCCAGTTTTTCTC
CTTCAGCACTTCTGGTGGTTTCAAACTGCTGACCATAAGGATCGTGAGCCAATGCATAAC
CACTGCACCAAGGCCTCTGTATTTCACTCTAGATGCCAATAATGAAGTTAGTTTGACAAG
TGTTGAAGTCTAGATAACCAATTAATTGTTCCACCACCTGTCTGTTTCTCTAAAGGACAA
CCTAAAGTCCCCTTTTATGCAAAAATTCACTGTGACCAGAGAGAACCTTCCCAGGCAACG
CTACTGGGTGCACTAACTCAGCGAGTTGCTTGATGCTTGCCTAGCGGGGAAAATGTGTAT
TAAGAAAGGTCCACCCAGCAGGTTTTTTCCACTGTTGTTTTTGGGTACCCCCTCGTACAG
CACACCTAACTTCGATAGCTGTGAATTGCAGATTACTTGATGTTTACAGCTTATTATCTC
TTGTTACAGTCTGAATACTTTAGCACCAATCTTCTGTTTCTATCTACTTTGGAGCATCAG
CCCCCATACCCCACCCCACCCTCGTGTTTGTGGTATTTCTTAGCCACCGGTTGGCTTCTC
ATTTTTCTCTTTCTCTGTTCATACATTTTTTCAAAATTGTTTCTTACCATTTACTGAAAT
CCATATTTTGTCCGGGAATTTTTCAGTGGCATCCTAAAGCCCTCAGTGGTGTCTTTAACG
AGGAAAAGGTCAACCCTTTTCGATCAGAGCCCAGTTTCCATGTGGATGCTAAAGTGGTGA
CCACAGGTGCTGCTGAACGACGGTAACCTCATCCCCCTCATGGAGCCTTGGGGCAAGGGA
AAGAAAAGTCCTTCAGCTCTCCTGTTGGACCACCACCCTCCCTTTGCACTGACCCAAGAA
ACAAAAGGTTTGGAAAGTTGCTGCCCTGAGAAATTAACATGTTCATATTTCTGATTCCTC
AGGACCCTCTGGTATGCTTGTCTCCATTCACACCCTCCCCCTCCCAGTACTCACCCCTCG
CCCCAAGAATAGAAGTCCTAACCACATTTGCTCAGGTTCTGGAAGTAGACAGTCTCCATC
ATCATTGGCAACTGACTGAGCCTCGATAAGCCTCCTTTTCCTCATTTGCAAAATAGGGAC
ACTAATACTCTCCCCCCAGCACTGTTGTGCAAAGTGTTCATTCCTTCGGCAGGCATCCAC
GAGGAACCGGGGGTGGGGGGGTGGGGGGAGCGGGCCACATGTTGGGCTGCTCACGGAAGG
TCAGCAGTTTGAAACCACTCGCTGCTCTTCAGAAGAAAATGAGATGTACAGTCTCAGAAA
CCCACAGGGCCAGTTCCACTCTGCCCTACGGGGTCTCTATGAGTCAGAATCAAGTCAGCG
CCAATGAAATTGCATTCTGTTCTGTCTTGTTCATAAGCTATAGCAGGCATTATTAGCCAT
GAACAACACAGGCATGTAAATAAGATGAGAGCTCATGGCTGGACTGGCGGGAGCTACTTT
TGGCTGGTGGATAAAACAGGTCTATTTGAGAAGGTGACATGAGAGTGAAAACCCTGAAAG
ATGAGAAGAAATTGTAATGTACAAGGCAGAAGAATACTTCCAGTCAGAGGGAAGACCAAA
TTCAAAGCCATGATATAGAAACAAATTTGGTATAATAGGCATAAAAGGTAAATATGCAAA
ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGAGAGAGGGTACGTAC
TGTCTTTGTGCAGTCTGTATGCTGGGTCATTAGTCGGGATTAAGGAAGACTCGGTAACAA
CCTATGATACGCTGATACCACAGCCGTGCTTGCTGGAAGTGAAGACTTGATGTACTAAGT
GATGATGACTGAAGACTACAGCCTTCGGTGTGGATCACAGCTCAATGGAAAGAAAACAAA
ATCCTCACACCTGGACCACCGCTGAGCATCATAATAAACAAAACAACTTGAAATTATCGA
TGATTTGATTTTACGGGGATTTACAATCAACACCCATAGAAGCAGCAGTCAAGAAATCAA
ACCATGAGTTGCATTGATCAAATTGGCTGCAAAGGAAATCATTAAAGTGTTAAAAAACAA
AGCTGTCACTGAGGACTAAGATGTGACTGACCCAAGTCATGATCTTTTTAATGACCTCAT
ACGCATGAGAAAGCTAGGCAACAAATAAGGGAGACAGAAGAATCGAGGGTCCTTGTGTTG
TGGTGCTGGTGAAGAATACTGAAAGTACTATGGCCCGAAGAACCAACAAGTCTTGGAAGT
AGTACAGAAAGACTGCTCCTTAGAAGGGAAGATGAGGAGACTTTGTCTCGTATCCTTTTG
CCATGTTATCAGAAGGTACCAGTCCCTGGAAAAGGAAACTGTGCTTGGTAGAGTATAAGG
TCAGGGGAAAAGACGACGACCCTCAACTGAGATGGACTGACACAGTGGGACTCCCGTGGA
CGGGGAATCAGGCAGGGAGAATGATGTCTTTAGAACATGTGGGAGGAAAAGAACAAATGA
AAGCAGATCAGGGGAGAGGAGGGATATTTTGGTTAGGGTGGAAACAGTGGGAATGGGAGG
ACGTAGTTTGATTTGGGATGTACTGTGACATAGACTGGAGAGAACTTGATGGATTGGGTG
TGGAGTGTTTCAGGAAGAGAGCGACGGAGGTTGACTCCTGAGCATTTCTTGAGATGAGAA
AGGAGATTCCAATGAGTTTAAGAGTAAGGAACTAGCAGTGTGGTTGTGAATATGTTAAGG
TTGTATGTTTATCACACATCCAAGTGAAGCTGTCAAGCAGGCCGTCAACTCTGTGGGGCT
GAGGTTTATGAACCAGCACCATGCAGATGGGATTTGAAGCCATGGCTGTGGTCATTTAGG
AAAGGTATCAATGGGTAAGGGGACCAAAGACTAGGCGCCAGGGCCTTCTGACAGTTCAAA
GATAGAATGTAGGTGAATCTTATAGCTGTCCATTGCCGTTCAATTGATTCTGACTCATAG
GAAGGAAGCCCGCAGAACAGAGTAGAACTTGCCACAGGGTTTCAGCGCTATAAATACTTG
GGGAAGCGGTCTGCCACATCTTCCTCCTGTGGAGTGGCTGGTGTGTTTGAACAGCCAACT
TTGGATTAGCAGCTTCACTGAGCTTCCTTACACAATGCTTAGCCAAAATATTTGCTACTA
TGGTTTTGGGGGCTAATTTTTTAGACTATCTTCTGCCTCAGCATATCAAAGGTGAGGTGG
CCCCAAACCATACCCATCTTCTACCTCTTGTTTTTGAGAACCAATGGCTCCTTTTTTTTT
TTAATCGTTTTATTAGGGCCTAATACAACTCATATCACAATCCATACATTTATCAATTGT
GTAAAGCACATTTGTACATTCATTACCCTCATCCTCAAAACATTTTTTTTTTCTTATGCA
GACATCCCTCGGTTTATTGCTCCGGGCTTTATTGCTCTGCACAAATACTGCATTAAAAAA
ACATTATTTTCCATTAGACTGTAGGCCATTTATTATTATTTTTGCCCCTTATGTTTTTAT
ATATATTTAATCATTTTATTAGGGGCTCATACAACTCTTATCACAATCCATACATACATC
AGTTGTGTAAAGCACATTTGTACATCCATTGCCCTCATCATTCTCAAAACATTTGCCCTC
CACTTAAGCCCCCGGCATCAGGTCCTCATTTTTTCCCCTCCCTCCCTCATGAACCCTTGA
TAATTTATAAATTATTTTGTCATATCTTCCCCTGTCTGACGTCTCCCTTCACCCACTTTT
CTGTTGTCCCTCCCTCAGGGAGGAGGTCACATGTAGATCCTTGTAATCGGTTTCCCCCTT
TCCAACCCACCCTCCCTCTACCTCCCAGTATCCACCATTCAACTCAACTGGTCCTGAAGG
GATCATCCCACCCCTGGCTCCCCTGTGTTCCCAGTCCCTATCGGTACCAGTGTACCATCT
TCGGGTCTACCCAGACTTGCAGGGTAGAATGGGGATAGTGATAGTGGGGGTGGAGAAAGC
ATTTAGAAACTAGAGAAAAGTGGTATTTTTCATCATTGCTACATCACACCCTTTTGGGCT
GGTCTCTTCCCCGAGACCTTTCTGTAAGCCAATCTCAAGTGGCTTCAAAAGGGGCTTGGG
GTATTTACTCCGCACAAAACCCCCCCCCCCCCCCCAATTCACTATGGTAAGATTTTTGGT
TCTGATGATGCCTGATACCTGATCCCTTAGACACCTTGTGGTTGCATAGGCTGGTGTGCT
TCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCACTTGTTTACCTTCAAGCCTT
TAAGTCCCCAGACGCTATATCTTTTGATAGCTGTGCACCATCAGCTTTCTTCACCACATT
TGCTTATTCATCCGCTTTGTCTTCAGCAGTTGCATTGGGAAGGTGAGCATCATAGAATGC
TATTTTCATAGAAGGAAATATTCTTGAATTGAGGGAGTACTTGAGTGGAGGCCCAATGTC
CACCTCCTACCTTAATACTAAACCTATAAATATATGCACATAGATCTATTTTCCCATCCT
CATATATAAACATATTTGCATATGTACATGTCTTTATCTAGACCTCTATAAATGCCCCTT
GGCTCCCAGCTCTTTTCTCTATTTTCTTTGACTTTTCTCTTGTCCCACTATCAAGCTCAG
TCCCCCACAAGGGTTCAGCAAATTCTTCTTGGGTATATAAACCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
TGCAGATTCAATGCTGTCCTTTGAAATAATTTTTTCTGGGGGAAGGGACCAATGGCTCCT
TGTCAGGAACCTATTATGTTGACTTCCATCTTACCCCATGTCTTGGGTGTTTCTTCAGGA
AATCACTTGTCCTGTTACATGACGTTTGGCAATGTGGCAAGACCCTTTAGGGCTTTGTGC
ACAGAAGCACTGTTAGTTAATGGCTTTGCTAAGATCCCTTTGGGCACCACCTGAGGGAGG
CTAATTTCTTTCCAGCCAGTACTAATATACAGTAAGTAGGAAAGGGCTATGCCTTGATGT
CACCACACTTAACCTCAAGCCTGTGGCCAAAAGCATATTGTAGGGCTGTGGCCTGGGTAA
CGATGCCTGAAGCATTGTCCCTAAGAACATCCATAAGAGTCCATGAGAGGCCCAGCTGAG
GTGATCAACATTCTGTTTCTCTTCACAGTGACTGGAATCGATAGAACCCTAAGGTGAAAC
ATATGCCTCCTGTGACCCAAATACTAGGCAAAACATGGCTGCATAGCTTTGTCAGTAAAA
GTCACAGTAACAAATGAGTGATGGGGTGTAATGTATTCTCTGGTCTTTTCCTGTCAAGGC
TCTGGAGCTCCATGTCATAGTCCTCAGCACACAAAAAAATACAGACGTGCTGGGCATGTG
CCGCAAGCCATGGAGGTGTGCATAGAATATGAGAGAGAGGAAACTGTGCTGAGTCCCTGG
ACACTCCCTCCAGAGATCCATGAGATTCTGCATGCGAGCCAGGATTCCCTTCTGAAAGTA
AGTATTGTTCCAGACCTCACTTTGCCTAGTGATCCCTCTTTGTTCAAAAAGGCAATATAA
ACGCTTTTGATGATGTTTTTTAATGGGCTATTGCTATCCTGAAAGATTGCCAGGTGAGTT
TGAAGCAGTGGTGAAGGGATCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTGCCAAGCATCTAGCTGTGCTGAGATCACAGCCTGACCCCGTCACTTTACTTCAGCTG
TATAGATGAGCAGCTCTCTAAGCTTTAGGGCGCTTAGTTCAAGCGCCACTTGTTTTGTCT
CCATGCCTAGGACCCACATTTCATTGTCTTTCTCAATTTGATAGGGCTTGTCGCCATCTG
AAAAAGAAAGAGCCAGAACCTTGTATGGGGTTGAGCGGCATGGACAGCGTGTCTGACAGC
ACTGGCAGCATCCTCAGCAAGCTCGACTGGAACGCCATTGACGACATGGTGGCCGGAGTG
GAGAACAGAAGTCCGTCTGTCCACTTGGCCATGGGCCTGTGACCTGGATATCATCCATCC
TTAGTCCAAGAAGGGATAACCCCTTAGATCGGCACTGAAAGACCTGTGGGTATAAGGGAA
AGGGGAGGAAGGAGGGAGTAATGTAAACTTGTCACCTGCAGTCCAATTATTATCTGGATT
AGCCATTTCATATGGGAAAATAAACAGTTTTGATAATTTCACTTCATGGAAAAAGGGTTA
AGTATACATTTATTTTAAGGTTGGTTTTTGTTTGTTTTTTTTTTTTTGCATTTGACTCAT
CTTGGCAAAATAAAAAAGGCAATTCCTTTCAAATCAAGTTTGTATAATATTTGAAGAACT
TTCAATAAAAATCTTATTTCCTGCCTCCTTCACTACCTCTGCCTTTTGAGGAACAACCTG
AGATGGGTGGATATGATGACAAAACCCTCACTTTCAATTGAGAATAAAACATTCACTTCT
GGGGCTTTCCATCAGCATGTTTAAAACACATCAGCATGGGGGGACCACTGTGCTCGGCTC
TCAGGACGATACCCTCAGGGACTCCAGGGTCTGAAAGCAATCACCTCACAGATAGTTTGT
TCCAGTTCATAATTAAGGCAGGAGGCTCATCAGGTACAGTACTTTGCTGTCATAGCTGGA
TGCATATTTTGTCTTCATTTCAGTGGATTTTAATCCCATGCAACAAACCTTGAAATGAGC
CAAGAAAGGGAAGACACAGAACCACCGAAAGATGAACAGCCCTAGAATGTCTCCATTGTC
AGAACACAGGAAACACCCAACCGGACCTGTCTCAGAGCCACCTGCTGCTACGGAGAGGCC
CGGACTGGAAACCCTCCACACATGAAATGAAAAGCTGTTTGCCGTGTCTAGGTCTTCAGC
ATTCACCATGCTCCTGATACCAAGTGTGTCCCCAAAGCCTTAGGACTCAATCTCACTCGC
TTCACATGTTTATGATAGACTAAGTTTGCCTCTGATGAGTACCCTGCTTTTTCTTCTGGC
TTGAGTTTGGAATCCTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1150, 34028..34192, 37514..37652, 41129..41238, 41386..41544, 41636..41744, 43823..44123, 46034..46970, 49499..49501, 49504..49646, 50399..50562, 50663..50745, 52113..52192, 53245..53319, 54594..54786, 56573..56866, 57073..57702, 57704..57841, 60327..60483, 62726..62730, 62734..62735, 63035..63161, 63979..64033, 80176..80280, 83617..83729, 84236..84431, 85526..85779, 89223..89310, 96881..97045, 103064..103094, 104449..104577, 106401..106566, 108765..108823, 127479..127646, 142695..142767, 142770..142789, 142794..142822, 143904..143993, 152218..152396, 152804..152827, 152829..152978
1001..1150, 34028..34192, 37514..37652, 41129..41238, 41386..41544, 41636..41744, 43823..44123, 46034..46970, 49499..49501, 49504..49646, 50399..50562, 50663..50745, 52113..52192, 53245..53319, 54594..54786, 56573..56866, 57073..57702, 57704..57841, 60327..60483, 62726..62730, 62734..62735, 63035..63161, 63979..64033, 80176..80280, 83617..83729, 84236..84431, 85526..85779, 89223..89310, 96881..97045, 103064..103094, 104449..104577, 106401..106566, 108765..108823, 127479..127646, 142695..142767, 142770..142789, 142794..142822, 143904..143993, 152218..152396, 152804..152827, 152829..152978
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved