Echinops_telfairi Locus RCOR3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RCOR3
Echinops_telfairi
RCOR3
GeneScaffold_2641
SNORA5
40017..40159
50328
CACCTGTGGTAACCATTGGTCCATTCTGGTTTCTGTTTGTGAGTAGTAGTTTTCCTAAT
GCATATTCAGCACTCCCACAGTTAAATTGCTTTTAGAAAGAGTTGTATGTACATTATCAC
GATCAGTTCTAGTGCTCCCTCCCCAGTCTCACATTCACTGTTTGCTCCCTAATTCACCCA
CCACCCCCAAACTCCCAAATAGACCATTGCAGCAGTTATTGTCTATACATACATCCATTC
CAGTGCATCATAAACTGGGAAGCCTAACAATAAAAAATGAAAGAGATGAATAATTTTTAT
TAAAATATACAGTAGGAAAGAAAAGATCAACAATATTTAAAGGCTCAGAGAAGAAATTTC
TGTTATAGAACACGTGAGAAATATTTGAGCCTAGAGCAAATTCCGATTGGGTCAAGAGAG
AGGTCAATTGACCCCATATCATACCATGGTTCGATCCACCATAATCAGGTTTACAGTGAT
CTCTAATAGTAAAACTGCTGGAGTTCCTCCAGAGGCCTTATTGACTCTTTTTGGAATGTA
ATTTTATAAAATGGAAAATTATTTAGAAAGGAATAGCTGGCATGCTCTTAACAAGAAGTA
AGATTAAATCCAAAAATTATTAAAAACAAAAAAACTACTGAAATCTGCGGCCCATTTAAA
TATGGGGCAAAACAGCATCTGAGGCATTTTGTGTAAGTTTGAGAGGAAGTTTTTAATGAC
CTCTAATGTAACAAAGATTAAATCTGCTTTATTCTCTATTAAGCAAAGATGGTTTACTTC
AGAAAAGAAAATGTTTCAGTTGAAGCCAGTGTTCATTTTTCATTTCCATATGTAGGACAT
TTACCATATTTAATGTATATCTTTGCTTTCCATCTTTTTTCCCTGTACTTTGTTTTTCTC
TGCAGGTACTGTACTAAAATAGAAGCTCATATCATTATACTTAACTTTGAAAGAGAAACC
TTTTTTATTCATATTCACAGTATTAATTTTTTTCCCCAGGCTCTACAAAGTACACAGATA
AAGACAATGGAGGAATGCTTGTCTGGTCTCCATATCACAGTATCCCAGATGCCAAATGTA
AGTTTGCTGCTATTGAATATTTCTGTGAACAAAAACAACCTAGTAGTTGATTAAAAATCT
CCTTCTGTTTGTTTTTGGACCTCTCAGATTCTCAGAAGAGGAGTTTTATCTTTATTGTTT
TGTTTTTGTAATGGAGGTGGTTCTATGAGAGTGATTTTTCCTTTTGAAAGATAGTGGGTT
GATCATTCCAATTTGTGTCAGGCCCATGAAGAATGAACAAACCTAGCATCTGCTGGCATT
CCTACTTAAAGCATCAAGCTGGGGCGGGAGTTACTATGTAGACAGCCGCCCAGGCATTTC
TCAGTTTGTGGAGCTGTAAAGACGTGCCCTCAAGCGGCAAAGAGCCCACTGTCATTACCA
TTTTAACGAGGAAAGGGGAAAGAACTGACTTCAGCAGCCCTCAGTCATCTTGTGCTCTCC
ATTTCTGGACGGAGACCTTCAGGATCATTGACTATGCACTGGCTTTAGACTTCAGTGTGA
TGTAGCGGACCCAGTCCCTTGCGGCACATCAGATATAGGAAATACGCAGGTAACAACGCT
GAAATACCCACCCTCCGTTTAGTTAATGTTGCATTTATAAAACTGTATGGAACAGCTATC
CTGGTAGCTGTAAAATAAGCTTGATTTTCTAAATAGTTATTAACATCCAGAAGATGTCTC
ATGGTGGCCATGTAGTCCCCTGAAAATGAATGATGTCCTAAGTCTAAACGTTTGTATTGA
TGTATTGAGAGGACTTGGAATGCGTCTGCTGAGTGTGCTTCTGCATACCAGGTGGTTCTT
CTCGAAGAGAATTAGAACACCAGCAAAAAGTTTAGCTGATAATCTAAGAATCATGCCCTT
GAGGCATTCTTAACAAACTGGACTTGTTCCGCTGGACGGAGCACTGTAAAACTTGAAACA
GACTCTGGTGCAGTCCACAGTATGTCTGAGGTTTCCGTTGACAAACTACACATTAACACA
TTGAATTTTGCTGTTTTTGAACTTTGGGGGTTTTGCGACGTCACATTTCTTGGCCGAGTG
GAAAGCAAAATTTAGAACGTGGACACGTCACATAATGTTCATTGGACTACTCATCTGAAG
ATCCAGAGCAGTGGATATTCAGCCCTGGCTGTGCTTTAGGATCTAAAAGCTACTCCATTC
TGGTCACTGTCCCAAACTTACGTTAACGGCTTCGGGGTAGCAGCTGGACATTTTATGTTC
AAGGCCCCCCAGTGATTCTAATGCATAGCCAGGCTTGAGAACCATAGGTCTGTTGATGGT
GTTGAGCCTTCTGTTGACTATAGGACGCTTGTGTGACTTAGCACATATGTAGAACCGAAG
TGAGTGACCCATAGGTGCTATGGGTTCTAAAAGTGTAGCACAGGACTTTTCTACACCTAA
CGCTTAGGCTGGAGAGTTGTAACATCCATAACAATAGCATTATATTAGCATTATTGTTAT
AATGGCATATTAAACTACTGACAGAATAATAATGAACACTTAGAAAGGTCTTATAATGTT
CCAGGTGCTATTCTAAGAACTTTGCATATGATAACTTATTAATCCTAAGAAGAGGGGGCT
GATTTTATTGCCATTTTAGAATGGGGAAGTGAAGGTACAAAGAGGTCAAGCAGCTAGTGA
TCAGGAGGCTCTTAAACCCAGGTAGACAAGCCGTCTAGGTTCAGAATTCTTAATCACTGC
TTCTCAAAAATAGATGAAAGCAGATATAGATGTGTGTATATGAGTGAGTGTTTATAGCCC
AGTGCTTTTTGAGTTGGTTCCAATTCATAGCATCCCTATAGAGCTGCCCAGAATGTTTCC
AAATCGTTACAGAAGCAGATTTTTCCCTACATTCTGTTGTGTAGTTAGGGGGTTCAAATT
GCCAGCCTTTCCATCAGTAGTCCAGTGCTTAACCACTGGTCCACCAGGGGTTCTAAACCC
ACCAGAGTGTCATGTATATGTACACGTTTACTATAAAAGGTCAGGAAAGAGTGGCTGTTG
GACTTAACACAAAACTGAATGTGAATTAGCAGACTTCTAAGCAATGAGCCTTTGAAATAA
TATATCATCAGTGAAACAGTGCTCGTCTAAATAATTCTGTTGACCAGATTACGTATGGAG
GATGAATAAAAGTACTCAAACATCCTTTATATAGCAAGCAGGCAGGAAGAGCTGAAGAAC
ATTTTAGGGATACTCCAGAACCCAACGTACTGCTGTTGAGCTGATTCTGACTTAGAGCAA
GCTTGTAGGACAGAGTAGAGGAGCCCTGGTGGCCAAGTGGTTTGGGGTCAAGCTGCTAAC
TGAAAGAGGAGCAACTCCAAACCACTGGCTATTTCCATAGAAGAAATATGAGACCTACTC
CTGTAAAGAGTTACAGTCTTGGAAAACCCACAGAGGCAGTTTCTGAGAAGGTTGCTGTGA
GTCAGAATCAGCGCCTTAGCAGTGAGTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGCTACATGATCATAGAGATAAATTATGCTACATAAAATT
TGGATTTAGTGAACTTTTGATCCTATTTATATAAGTGACAGTCTCTTTGTTATAACATTT
CAATTTCTAGGTTGTGAATTATTATATTTTGTTGTATTAGAAAAGTTAGACCTGGACAAC
TGACATGAATGAAAATAATTATTTCTCATCATTTTGTTACAGTGGACGAGTATATTGCAA
TTGCAAAGGAAAAACATGGCTACAATGTGGAGCAGGTATGTAGCGAAAACAGCAGTCAGG
CTTGCCTCACCCCTTTCCAATTACAAAGGACATCTAACGATCATTTCTAGCCTCAGAAAG
TGCATGCACATAAGTTCAGCTAATTTTATAGAGAAGAAAAATGTTTTAGCAAAAGTCTGA
CTTTTCGTTATTATGAATTTCACTCTTTTAAACATTATTCCTCTCAAAAACTTGAGCACT
TTTCTCACTGTCTTTGGTTTGGGTTCTAAAAGCATGCAGTAACAGATATTGCTCCAAATG
AGAAGTATGTTTTGTTGTATTTAGGGACAAGTATACCTGAATAGAATTTAATACCATCTA
TACTTGTGTATAAGCTGCTTTTTCAGCACTTTGTTTATGCAGTTTTTGTGGTAAAATTAG
GTGCCTCGGCTTATACTCAAATATATACGGTAAGTCTTCCATTCAAAAATAAAGATTATG
GATAATTTTTGTTTTGCTTTTTGATCCAAAAGATCTAAAAGTTATGCTTGTCATTGAAAG
AAAAAATTTAAGAGTTCTTAATTTTGATTGAAATAATTCACAAGGGGTTCTGACTTTTGT
GTTTCTGTTTAATGACTTTAAAAACCATATGTGTGTGCGGGCAATGAGTGTACAAATGCG
CTTTACACAATTGATGTGTGTATGGATTATGATAGGGTTATATGAGCCCCTAATAAAATA
ATTTAAAAAAACAACATGTATGGTTCACTGCTTCTAATTATGAGTGAGTTTGAGAACGTG
GCAAAAGAAAAATAAAGATTCTAAATCCTATTTCTACTAACTATACCAACTTTCATTAGA
ATTAATAGTAAAATGATTTGATTTGCTTTTAGACAAGTAGTAAGGTGTCATAAACCTGGA
TTATCAAGATCTCATTTTTTAATACTTGGTAATATGGTTACGTCATAAACTAAAATCATA
TAATCTGTGAAATTGAGTCATTTCTTTCCAAATGGAGTTAATTTTTTGGTGTGGATTTTG
AAGCCCTTCATTTTATCCTTTGTTTTTAAGCCTTTTTGGTTTATTAGAACATTTATGTCT
TTCAAATGTGCTGTGTGTTTTAGATTTTATCATCGTTTTAAAGGACTGTAATCTAAGTTT
AGAAGATGTCCATTCAGGCTTTCTAGTTACTTGGCAGTCAACTCACTGAAGTTAGTGATA
CGGCTCAAGGCAAATCTCTGTTGGTGTTGGAGTAACCTTTAGAAATATGTATTAGAATAG
TAAGTTGTGAACATTATAGTTGAGGTATTCTTCTAGTGTTTTAATCCATGATGTATTTCT
GAAAAGTTAAAATTTAAATATTTCTATACTGAATTTTCTCTTAACCAAGCACTTTTGGTT
TTGTGCTGTAATTGGTAGTGACAAGCTTCACTCAACTATTGATTTACTGAGAATTTACCT
TTTAGCATTTTTTAAAGCTTTGACAAGTGGATAAACATGGGGGAAATTCTGATCTGAGGC
TACAGCTCTGCTTTGCTAATTAGTCACTTTCCGTAGCTCACCCTTTTTCCTAGATTCTGC
AGCAAGTACACTATGTCAGGATAGTCACTGTTCTGAAGCCCTGATTAAAAGAAAATAACT
AAAAGTGCTCTCCTACTTGCTTACTCTTAATTAAAAGCCCCAAACTGTGAGTGTGTTTTC
AGTTGAATTTGCAGGCTTAACCTTTTAACCGAATTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGCTTATTTTGACTTAACTATGTGTGTAATAGATGTTAACTGCTAACCTA
TTCGGGGGGGTGGGGAGTTAAAAATTCCCATTCTTTTTTTTTTTTTTATTCCCATTCTTA
AAATAATTTTTAAATATTTCCTTTTCTCAACGAATGTATAAGTGTGCTTTACACAATTGA
TGTCTGTGTGGATTGTGATAAGAGTTGTGTAAGCCCCAATAAAATGATTAAAATGTATAT
ATATATTTCCTTTTTCTTTAATCAATAGAACGCTTTTTCTAACTTAAGTTATTTGGGTTA
TAAACACCCAGTATAAAAATTAATTATTTCAATTTTGTCATCAGCTACTGCTGCTGTTTG
TTTTTTGTTGTTAGTTTAAAGGAGAAAAACTGGAGATTTCAGGCACTTAAATTTGAATAA
TATGACAAAACAGTATAAACCTGAGAGCTTGGTACAGTAAACAATTAACTTTAGCCCAAG
TGGATGGGAATTATGCAGTGTTCACAAATATATCTAGATGCCTTCCGTAACCAAAGGAAA
CTTTTTTTACTGGGAGTGTATCTCCCTGTTGGCCAGTATGGCAGATTAGTGCATGGTATT
TAGTCAGATTATACACAAAAACTGTGTTTGCCAAATAAAATCAGTTTGCACAATGTATCA
TTTTAAAACCTGGGTTTAAAACAAAGTTCTTTTTTTAAGTTTACTATGAAAAGACTTGAA
TGGCTCTTCTTGAAAAAATTGTGCTAAGTAAAAGAGGCCATGTCTTATGTGAATCCATTC
ACCTGAAATGTCCAGAGAAGGAAAATCTGCAGAGATAGAAAGTGGTTGCCAGGGCTTGGG
GAGGGAGGAATGAGAGAGGCTGCTAATGGGTACAGGACTTCTTTATGTAGCAGACGCAAT
GTTAGGGAATGCGTTCCTATGGTTACATAATATCATGAATATACTTAAAATCTTTCAAGT
GATGACTTTTATGGTATCTGAATTATTTTAACTTTTAAAATTCCCAATTTATAGAGAGGG
AAAACAGATGCTGACCACCACCAGCATGACTGTGGTGGGGAACTCCTGGGGCCACTCTCA
CCATTACACTGTGACCCTTGCCCCTCACAGGACAAGTAGGAATGTTCCCTCAGAAATGTT
GGTGATGCTGGGGTGGCAGAGAGTACTCGATGACTAAATAGGACTAGTTAGCTATGTAAA
TCATAAAGATATTCTAAATCTTTTGCATTTATGCTTTTATTTGCTATGTAGCTGATTGAA
AATATGCTTTGTTGTTGTCTTTTTAAAGCTTCCAGATAAAACAATTGCAAGCCTTGTGAA
ATACTATTATTCCTGGAAAAAGACGCGATCTCGGACAAGTTTGATGGATCGCCAAGCTCG
TAAACTAGCAAATAGACATAATCAAGGTGACAGGTAGGTTCGGTGCCTTTCTGTAATTAC
ATTGTTAGGGACACTGCATTGGATTCCTTATACCTTCAACATCAGAAAAAATATCACAAC
ACGTTATAAATACTTGCCATCCTTACATTCTGTTTCTACTCTGACAGGAAGAGCCAAGTG
GTCAGAAATCTTAAAGAGTAAGAATTCTCTTCAACCCTTTAACTTAATCATACCAGCAAA
CATCCCATCTGAGTTATACTTGAGTTGTAGTTAGCAGTAATCATAATTTTTTTAGTATTG
TATAGTCAATACATATAGTTAGAATATATTAAGGGGGATGGGGAGAGGGGGGAAAAATGA
GGACCTGATGCCAGGGGCTTAAGTGGAGAACAAATGTTTTGAAAATGATGAGGGCAATCA
ATGTACAAATGCGCTTTACAGGATTGATGTATGTATGGATTGTGATAAGAGTTGAATGAG
CCCCTAATAAAACTATTTTAAAAAAAGAATATATTAAAGGATATATTCTTTGGAAGATGC
TCTTTGCACAGTTACCTGAGTAACTGGAAGTCTGTGCTATTGTAGCCAAACCTTTCTCGC
AGTAAAGATAATTTTACTTGGTTTTGCCTATCTTTATCCTCTAACCAGAAAATTGAAATA
TGTTTATGTTTTTTTTCCCCCAAATGATCAATTTGTTTCTAACCCCATTTCCAGTGGGGG
GGAGGAGTGTCTATGTTTCTCTCTTTTAGCTAAAAATGTTTGCTAAATGAGTCTCTAAAC
CCAAAAGGTTAAATGTTTTCTTTACACAATAAATAACTAAATTACAAGTTCATCCTCCCA
AGGACAAGTATTGTTCTATTGGAAACTAATAGTAAAAGTATTAGAGTTCGTTAAAGTTTG
ATAAGAACGTTGGAATAGAACTGAAAGGAGAGAATTAAGTTTACTAATCTTCATTTCTTT
TCAGTGATGATGATGTGGAAGAAACACATCCAATGGATGGGAATGATAGTGATTATGATC
CTAAAAAGGAAACCAAAAAAGAGGTAATGATAATTATTAAATAGAGTGCTTGTCATTTTT
CTATAAATCTACTCATATAACACATACAAATATTTCTACCAAAAAAAGTCTTTAATATAC
TAGTTAAATAAATCAGAACCCTCCTGATTCTGCCTCGTGGACTCCATGTGTGTGAGAGTA
GAACTGTGCCCCAAAGGTTTTCAGTAGCTGAAGTTTCAGAAGTAGATAGCCAGTCCTTTT
TCTTCGAAGGCCACTCTCTCAAAAAACCAAACTTGCTGCCATTGAGTCAATGCCAACTCA
TAGCAGCCCCATAGGATAGGGTAGAGCTGCCTCTGTGGGTTTCTGAGACTGTTTATGGGA
CTAGAAAGCCTCATCTTTTGCCGTGGAGCACACCCAGTGGTTTCAAACTGCTGACTTGTG
ATTAGCAGTCCAAATCATAACCGCTACAACCAGGACCACTGTGGATATACGCACACCCCC
AAGCTGGCTGCTGACAGTGTCATTGGTTTTCCCTGTTCAAGGACTCCCAGTTCAAGAGGT
AGGATGTGTCCGTGCTAGCTGGAAGCGTTTGGGTCTGAGCACTCCAGAACTTCAGTGAGC
CAGTCATCTGGGTGGGCTTGGTGCTCTCATCCATCAAGAAGTATAAAAGTCCTGCCGTGG
ATGACCCACGTTCTGTAATCCGTAGGAAAGCTACAAATGAGGGCTTAAAAGTAAGCATCC
TGATTTTGTTACCTTGTTATCCAGTTGTAGCTACTTAGAAGTTAGCGTAGCTGCAAGGGC
CCTGGAGGCACAGCTGTGAAATGAAAGGTCAGCTGGTCAAACCCACCTGCCATCTGGGGG
AAGGATGTGGCAGTCTGCCCCTGTAAAGGTTATATTGCTCTTCTATTGGGTTTCTGAGTA
AGAACTGACTCGACAGCAATGGATTTATTCATTTGGAGTTAACATACCTGCCACTAAGGT
ATATTGACGCAGCAGACACTGAAATGCTACACATTCTGGACCACACATGGATATCACATA
AAACTTGGCAGATAACTTCTCCTACTTCAGGGCAGTATCAGGCAGGGAACTCCCATAAAG
CTCTGATGGCATAGTGGCGTGGTATACATTGGACTGCTACTTGCAAGGTCCATGATTCAA
AACCACCAGACACTCTCGGAGAAAGATGAGGTTTTCTATTCTCAGACGGCTGCAGTCTCA
GAAACCCATGGGGGCAATTGTACCCTGTCGTGTAGAGCCCCTATGAGTCACAGGCAACTC
AATGACAGGGAGCTTGGTTCTTTGTTTTCCCTAACTTCTCTACTTCCATACTGCTCTTTT
CATCGCATTGTTTGAACTTAGAACTTTCTAACTATTAGAGCTCCTCCACCGAGGAGGAGA
TAGAAGAATCTCAAACTAGAAAAGTACTCTTACTCTTCGGTATAGTTAAAATAATGGTGA
CGTAAAATCAGTAAGAAAGGCAATGTTAGGACTCATACTACTTACTACGGCAAGGAGTTA
AATCACAAAAATGGTCCAAGGGTTGGCATATAAGAGCTTGTGAGGCATAGGTGTAGCTGT
AAAATCTTAAAATGAGTGCTGAAATTGGCGACAGTAGATCTGAGTCACATAAACTTAATG
TGTACCAGCTATATGACCTCATCCAGTGTAGACTCCATCCCGCATGTTACTTAGTGTCAT
GGCCCATGCTGACCCCTCCCCTCATCTTAAACTCTTCCTCTATGAAAAAATTTTACATCC
TTCTCTCTTCAAATTCATATTTTTCTGCTGAATGTTCCTAAATTCTTTAATTCATTTATT
TCTTTCTCCCTCCAAATCTGCCAGCCTAATCCTTATGTCTGTTTCCCTGAACCATAGGCC
CATTGAATTGCTCTCTTCTCCCCACCTTGAGCTCCCATTTTGTTTCTTTTCCTCGCTCCC
TTGCCCAGGCCTGTAAACCTACAGGGCTGGCGCACTTATTCTTCTTGATGTGAGAGGCAC
AGGCCAGGACAATGGCCTAATTATATAAATTGTTGCTGCTACAGAAAGTAGTTTTCAATC
TTAGTGTAGTCCTCAGTGCACCTTTCTCTCTCTTTTTAAAAAATAATATCATTATACTTC
TCCACGGGCCCTCTCTGCAGAGTCCCTCCCATGGGTGCTACTTAATTGTCATTGCCTTTC
AATTTTTAGCTTCCTTAAAACCTGACTCTTTTCCTTTGGTAAGATGAAAATAAAAGGATT
ATTCTGAAAATCAGAGGTATCGTGTATTAATGTAGTATCCATGGTGGAGTATATCTGTAA
TAAATGTTGCTGCTGTCTTAGTCTCTGTTTTGAATATTCATTTCTTTCTACTCTTCGCCT
ACTACTCCCCCGACCCCCCTCATAAAACTTGGCAGGTAACTTGACCTTCTACTTCACAGA
AAATGTCAGGCAGAGAGGCACTCCCTGAAATTATAGCACTTTATCCTAACCTCTGCTTGT
GCAGTTAGAAAGTTCTAATTACCGGATTTCCCCACCAAACTGAACTCTTTGAAGCCAGGA
CTGAGTTAGTCATCTTGTGCCCCCAGCATTTTGTATATGGCAGGTAGTCAGTCTCTCTGT
GTTTGTGGAATGAACCGTCTGCCTGAATGCCGCCTGCCTTCTCTCTGGCTCCACAGCAAG
AAGGGCCCTTTCTCTTGTTCTGAACCATCCCCACTGCTTGTGTGGCCTTAGCCAGCCATT
TATATCTCTGGGACTGTCTCCCCACTTCTTCCATCTTCTGCTCATATTTTTAACCTTTTC
ACTATAGCTGAAGTATGTTCAGCTCTTCCATTTAAAAACAAAATTATCTTTGCACCAGCC
TTCGTGCAGGAACTGAGCTCCTTCACTCTGGAGTTGGCTCCAATCAGGCTGCTTCTGTCC
TCCTGCCTCCCACACTGCTGGCAGGGGTCACCAGTAATAGCCTGACTGCCACATCCCGTG
ATTACAATCACTCCCTCTGGCATGGTTAAGTCCCAAGGACCAGATTGTTATGTAAAATCT
GTATTCTTGGGAGAGATGGGGACCACATCCTCACTTCAACACTGATTTCTTCCCCAGTCC
CACCACTCATTGTTCACAGGTCCCCCAGTGCATCCCAGGAGGTGTGTGGTGCAGGCGCAC
CCTTCCCCACCACTGCAGAGCCTGTGGTGGTCGAGATGGTGAAGTGTGGCCCAACTCTGT
TCACTGTTGTCAGGGAACCCCCTTGTCCTGCATTGCAGGCTTTCCTGGCACCTGGCCCTC
TCCAAACCAACCTCTCCATCCCCTTTGCTTGGGTCTTCATCCAGCCCTCCTCTGCCTCCC
TGTGATGTCTTGTCATTTCTCGCCCCACAACCTCTGTGGCCAGATGGAGACATCGCAGAT
GACCAGGAGAAGATGCCACATCACTCATGTGACCTCCAGTATTATCGTGTGGGGCAGCCT
GCAGAGGGCGCCGCAGGCCCAGTCACGGACCTGCGTTGGGCCCAAACCATTGGAGGCACC
TTATTGCCGACAAATTTTTTCAGTTATTGGAAATGTGAAACGTGAGATAATGAGATAATA
GCTGTTAACTGTGAGATTGGTGTGTGCCCTATTTGCCCTCTATCACTTCAATCTGTCCGC
CCCTGCTTTCTTCCTGAAAATCTGTCCCTTTGACACTAGCATCTGTGGATTGCTGTCTCC
TTTATCAGGCATTATGTCTCCGTTTTGGTGACTTCTATTTCACTCTGCATTTTAACTGTT
TATAACTCTCAATATAACTGTAGGATTTGTCATCTTTTCTTCTTTTATTTTTTTCTGAAT
GAATACACCAGTTCTGTCCTAGCTTAATTCCATACCTCAAGACCCTTCACACTGTCTCTT
TAAACCATTGTATACCCGATTGCTAAAGTAATCTTTTAAAAACCATATCAACACTTGAAA
CTCCTTCAGGGCTTTGTCTGTAGGATAAACATAAGCTCTTTACCCAGTCATTCCCCACTC
TACTACACTGCACTTCAAATTACTGGAAGTGTTTTACATGTGCCTTTGCATTCCCTGGGC
TTGTGTGCTATGGTTATGTTGCTCTCTCCTTTCTCAACTCTGCTGAGAAAACTCGTAACT
ATAAGATCTAGCTTCACTGTCGAGTCATCCTATGCCCTATATGGTCATACTGCCTCTGTC
TCTTAAATCTGTTACAGTACTAATTGTTTACTCAGAGCATCCCTTTTGTACTGCCCATTG
CTGGGTGGTGAGCTTTATTGAGCAAGAATTGTGGCTTACCTACTTTTGCAGTCCTAGGGT
CTGGTACATAATAAGCATTCAGTAAAACTTACTGTAGTGAATAATAATACATGTCATAAA
CTCTAACTGTTGAACCAGATAGGAGGGATTTAGGATTTGGTTTCGGTTATCTGAAATACG
TAGCTACGTGAGGTACTGTTTCCCTAGCTCTGTAAGGTGATGCATAGTTGTTGTTTTGTC
TGAGATCTCATCCTGTTAGCAGATACCGTGAGAGGGATAGAAATTAAAAGTATGAAAAGG
ACACTACTGCAAGGCTGTGTTCCAGAGGTGGCACTGCATGTCAGCGGCTTCATTCCTGTG
TCTGCTTTTTCGTAATTGACATAGACATCAGGAAGGGGAAGATGCGAGGGGGCCTCAGAA
AGTTCATGGGGAAGTTTTTATCTTGTAATTCCATTTCTCTGCACACTTGGTGAAGCCCCC
TCGTACTACATTCTTTTTACTATCATTCTTCATAGCTGCTACTGTAGGTTACTGACACTT
TCCATAACAACTTTTCTTTACTTTTGAAAATTAATGAAATGTAACACCAGCATATCATCA
CTGAGAAAAACGGGGTTTTCTACTCCCTAAAAGAATTACAGTCTCAGAAATTCCCAGGGG
CGATTCTACCCCATCCTACAGGTCTGCGAGGAGCTAGCACTTCCTCGGTGGCAGTGAGTT
TGGTTGACCTGTCACTGCACTTAGGAAACCCAGTCTTGTGTATCGTAAATTGCATCCCCT
CTTTTCCTCTTCAGAGGGACCCATTATCCTAAAATTTGATCAACTCTTGTTTTGTTTTTA
CAGAGTTTTAACACATTGCATGTATTTCTGAGCAATGCATCATTTAGTTTTGTTCACTTT
GAACTTTATTTAAGTGGAATAATGTATGTGCTCTTAGAATCATTAAATCTATTCTTAGCT
ACTTTTTTTCTAACTCTCAATGTGTGTTTGCAATTCACTTTCATTATTGTAGTATTCTGT
TGTGTATATAGACACCAAAATTGACCTCTTTTCTTATTAACAGACATCATTTCCAATTTT
TTATTACTATGAACAACACTGATAAGAGCATGTCTTAGATACACATTCTTAATAATTTCT
TGAGGTCAGTGGTTCTCAACCATGTTTTCCTTGGCTTCTTGGAGAAGGCATTTATAAATT
ATAGGCACATTTTCTTGTTCTCGTGACCAGGGGACACCACTAGGGTGCAGTGGGCTGGGG
AAAGGGATGCCAACTCTCCTGAAATGTGCAGCACAAATTGTTCCAGCAACATTTTTCAGT
AACTTAGCAGTGCAGATACCATAGGATTGGAGTTGAATTACTCTGCTTTGAGGGTACAAC
TATGTTCAGCTTTTCTAGGTAATAGAAAATTGGTTTCCATGTTCTTCTACTGGACTGTGA
GAGTGCGTCTTGGCTGCCAGTATTCAATATACTTCAGATTTTAAATATGAATCTGGTAGA
GTCAAATGGAATCTCCTGGTATTCCTAACATCACTCATTAGATTACTAGAGAGACTGGGC
ATTTTTCCATGTATTGGGGAACTTGCCTTTGTTGAAATGTGTGTGTGCTTTAACCTCCTT
TCCTACTGAGTCTTTTGTCAAATAGAATATACAATTATTTTCTATGAAACTCTTTATTAC
ACTAATTCTCTGGTTAAATATGTTAGAGAATTTTAAGCAGAGTGTATATTTTTATTCACT
TTGCATATTTTTTATTTCTTCTGAAAGTGTGTTACTTTTTATCTTAATAATCTTTAGTGA
TAGTGGAATTTTGTTCGTTTTATGAGGTTTGTTTGTAGTTGCTGGCTGCCACCAAGTCGG
TTCCAGCTCCTAGCGGCCCGCTGTTCAACAGAGTAAAATACGCCCAGACCTGGGCCTCCT
CACAACTGTTATGTCTGAGCCCATTGTTGCAGCGATCTTTCGGTTCACCTCATCAAGGAT
CTTCCCCTTCTCCACTGCCTCTCTACTTACTAAGCATGATGTTGTCCTTTTCCTGATAGC
GTGTCCAAAGTATGTAAGATGAAGTCTCACTGTAAGGAGTAGTCTAGCTATACTTCTGGC
AGGCTGCAGTATTGTCAGTATTCTTCAACAATGCTATAATTCAAGTGCATCAGATTTTCT
ATGATCCTCTTTATTTCTTGTCCAGCTTTCTCATGCATATGCAGCAATTAAAAATGCTAT
GATGGGGTCAGGCACCTCTGACTCTTCCAAGTGACACCTTTACTCTTTAACACTTGAAAA
AGGTCTTGTACAGCAGACTTGCTCAGTACAGTGCATTGTTTGACTTCTTGACTGCTGCTT
CCATGAGCCTTGATTGTAGATACAAGCAAGATGAAATCCTTCACAGTTTCCGCCTTTGGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCTATTTTTAAAACAATGCGTTGAAAGAGAGTACTGAAGC
TTTTCAAACCTGTACTTGGATAAATGAAAACAAGTGAAACGATAAAAAAAAAAAATTTCA
TATAATGGTACATTTAAAATGAAAGTTGGGGTTTTTTTTAAGTACTATTGTAATAAAGAA
ATGCTTCTTAACACATTAACACCTTATGTTTATCATTAAAATTTCTTGACCTCGTCTGAG
GTATAAATTCACATCTTATTCGTAAAGAAATGTACCCCAAAGATGGACCTGCAGTTTAGA
TATAATTCTGTGTTCTTTTTACCTTGAGAGACATGAGTCTCTTTGAACAATTCTAAAATG
AGAATGAAATATTCTCTTTTTTTGCCATATGGTCTAAAATAATTCATAATTTGTCCATTT
TTATATTCTTTAAAAGCTTTGCATTAGTAAGTTAGCTATCATCCCATCACCACCACCACC
ACCCTTTATTGCTGAGAGGAAACTTAATGCAAATAGGAATAGTTTTGATTCAATTTAAGT
TTCTTGTTCATATTTATTCATAGACTTCTTGCTGTAGGAACTGATCATTTGTGGATAAAT
CTAGGATACTTTGTTGCTTGATGTTGTACCCTTTACCCTCCACCCACCAAGGTTGATGAG
CTGTATGTGGATGTGTTCAAACATGCACATTATGTATTTGGTTAGAAGGGCTTTTAAGGG
TACATAGTGCAATTACTTCTACTAGCAATGGTAGATGTAATTCAATTTATACATTTGCTT
TTTAAAAACCCAGTGACTTACTCTGTCGTTATTCTCTTAGGGTAGTACTGAGCAACCTGT
GCAAACTAGCAAGATTGGCCTGGGAAGGAGAGAGTATCAGAGTTTACAGCATCGCCATCA
CTCTCAGCGCTCTAAGTGCCGGCCGCCTAAGGGCATGTATTTAACCCAAGAAGATGTCGT
AGCTGTTTCCTGTAGCCCCAATGCGAGCCAACACGATCCTGAGGCAACTGGACANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTGTTCCCTGGTCCTCTCCCTCTGCAGAGCAGAGTGT
TTTCTGTGCTTCACACATGGTGGAGTTTTTCCTGTGCGCACTGTCTATCGACTCCTGGCG
CCAGGCAAACACCAGCCCCCACATACTCCCTTATACCTCTGGGTTCCTGCTTTCTCATTG
ATTCTGGCATGGCAACTCTCTCCTCACTTCCTGCCTGCTCAGTGTTGAGTTTAAAATACC
TGCTCCAGCAATAGTAGTGCTGCACTCAGAGGGTTTCTTGGAGCTTCCAATCTGCCATGC
TCCTTTGAGCTGGGGTTTAAACACTGAAGGTGGGACAGGCTTCAGTAAACAGTTGTTTTA
TGAGGTTTATTTGGAACTCCTTTTCTAAACAGCTAGATTATTAAATCTGTCCGTGAAATA
GCCCTCAACCTGTGGGCATAGTTTCTGAGTGTATGCCTGTCTCCAAAGCACAGGTTGACA
TTGATTTTCATTCCACTCTTGCAGAATATTTCAAGAAATTCAGTCAAAAATAGAAATGAA
GTTCTGGTGTAGGCTGTGAAACTTGAAAACATTGTGCAGAGTGAAATAAGTCAAACATAA
AAGAACAAATATTATGTGATCCCATTTTAATAAAATATCCACCAGAAGCAAAAACAGAGA
CCAAAGTTCACTAGTGTTTCCCAGGAGCAAGTGGGAGGGGGGAGATGGAGTTTGGGTTAA
AGCTAATAAAACATTTGGAAACGAGTAGTGATCATTGTTGGCACAACATGACAAACATAG
CTAATGTCATGGATTTGTACACACAGCAGTGGTGACATGTTTTGTTTCATCTGTTGGACC
ACAATAAAAAATATGGGGGAACAAAAAAAGAACAATACATACTGCAAACCGTGTGTCTTG
TTCACATGACATTAATTATGTTCCTGGTTGCAGCGTATGCAGCTGGTGTTCAGCGGGCCC
TCACTGGTACAGCACAGTGGCCTGAGTCTGCTGGTCGGTCTATGCTTCTCTTGCAGTAGT
GGCTGTGTTATTTTCTTGTATCAAAGACTTTCCTTATTTTTTAATTTTTTAAAACATTTT
ATTAGGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAGGGGATGATATGTACTTCC
GATATTAACCAAGCTTCTCTTACAGTTGTTGGAAGTTATATGAGATGATACAAGCAGATT
GCTGAACACAGTGCTTGGTTCACATTGTTTATTCTAATCATCACTATCGATAGTAGTAGT
ATGAGTGCTAGTATAAGAATAATGGTAAGGTATTTGGGAGAAATTAAGCAAGATAATATG
TGTTAAGTGCTTAGACCAGTACCTGGTGTATAAGTAAATGCTAGATGAATGGATGTTATT
AGATTTCTGGCCTTTCTTGGTCTTTTCTTGGTTGTTGGTTTTTTTGGTTGGCTGCTTTTT
CTTGTTGTTGATTGATGTTCCTATGTTAAATCAACACCCTCATATTCTCTTGGCCTCAAT
CAAGCAATCTTACACGTATGATATGCCAGTGATTTCTGAATCTACTTCCCCTCAGCTCCC
TAGCTGTACTTCCAGTTACCTGCTAGACATCTCACCTTCCAGAGACACTTTTTCTCTATT
CTCACTGTAATTTCAGGGTCCTCTTTGATTATTTTTGTTGTTTTTTCTAGCCACGATTAT
TCACCCAATACAAACTGAAGCAGTAATCAAGCTATGTGAGTTTTAATTCAGAGATTTTCT
TTAAATCAATCCTGTCATTTTTATTCCATTGCTAATATCCTTCTTTAATCCCTTTATCAC
TGCTTGTCTGCAGATAACTTTCCTGTGGATTCTCACTGCTGTCCACTTCTCTTTCAGCTC
CATGGTAACATTGCTGCCAATGTTATTGTTTTAAAATACACCACTGATTGCCCTGAGCAG
GTTGCAGCAGAGGCCAATAGGAACCCATCATGTACCATAGATAAGAAGGTCATGTTAAGA
AAGGTGAAATGCAAGGGTGAGAGATTTGCAAGAGTTAAAGGCAACAGAGGCAGATTTTTA
AAAACCTAAGGAAAAAGAAAGTTGAAATTTATCCAGAGTTAGGAAATCACCAAATCAAAA
ACCAAACTCACTGCCGTCAAGTCAGTCTGTCTCTTAGTGGTCCTGTCGGCTGGGGTAGAA
GCACCCCTGTCGGTTTTGAAGGTTGTAACTCTTTACAGAAGTAAAGGGTTACCTCATCTT
TCTTCCTTGGAGCAGCTGGTGGTTTTTAACTCTTAAAGGGAAACGCAGGAGACTGTTTTT
AGGGTTTTTTTGTTTTGTAATAATTGCTCTGCAGAGTATGTTATGTGTTCTTAGCCTCTC
ACAAGGAGCCCTGGTGGCACTATCTGGTAAGCATTAGACTGCTAACTGCACAATCAACAG
TTAAACCCAGCAGCTGCTCCAGGGGAAAAATGAGACTGAGTAAAGGTTTATAACCCTATC
AATTCAGTGGCCCTGTGAGTCTAGCTTGCCACTGCCCACCCATTGTTGCAGAGCCGATTC
CAACTGATAGCAGCCCTGTAGGACAGTGTAGACCTGCCCCTTAGGGTTCCTAAGGCTGCA
GATGTTTACAGAACCAGGCTGCCTTATCTGTCTCATGCAGAGCAAGTGGTAGGTTTACTT
TTGGTTATTTAGCCAAGTGCTTTAACCCCTACACCACCAGTGTTCCTCTCTACCTCAGTC
TACTTAAAGATAATATTTTGCATTTCACATACAACATAAGAACCTTGCAACAGTGTACTG
TGAGACTGAGGGACTGTCCTCTGTCTCAGACGTATTCAGACTTCTCTCTGTTGACCCTGA
CTACTCCCCAGACTGCTCTTACATGGCTCTTTCCTTCTCCAGCAGATTTTCTAAGTAAAT
ATACCACATTACCAGCCAGCATTGACTCTCTTTCTAACCCTTAGAAATCTAGTTTCTGCC
CCATACCTACCACATTGAAAAAGCGATTTCAAGATTGTTTATGAACACGTTGTCAACTGC
ACTCTTTATTCTTCTCTCCCTTGACTGCTTAATCATATTGACACTGTCAGCCATTTCTTC
CATCTCAGAACACCTTGTCTTTGACTTTGTGACACTGAATGCTCTTGAGCATGCATTCAA
TTAACTGCTTCGTCTCCTGTCAAACCATGAATGTTTACCTAGGACTCCCATCCTCTGGAT
CTTAGCATTTCATTCTCTTTAGAAAGCAGCTGACAAAATTGGCCTGTAAGATTGATAACG
TACTCAATTTTTTAAAAATAACGAATCACGTGCTTGTTCAGTGGGCTCGTCCTTCTCTGT
ACTACTACTACTGCAGGTTCTAGATTCTTGGACTATTTTTACTGACTTTAAAAAGACTTT
TTTTCCCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACATATAGATCCTTGT
AATCAGTTCCTACTTTCCACACTGCACCCTCCCTCTACCCTCCCAGTATCTCCACTCACA
CCACTGGTCCTGAAGGGATCATCCACACTGCATTCCCCGTGTTTCCAGTTCCTGTCTGTA
CCAGTATACATCCTCTGGTCTAGCCAGACTTGCAAGGTAGAATTCAGATCATGATAGTGA
TGGGGAGGAAGCATTTAGGAACTAGAGGAAAGTTGTTATGTTTCATCTTTGCTACATTGC
ACCCTGACTGGCTTGTCTCTTCCCTGAGACCCCTCTGCAAGGGGATCTCCAGTGGCCTAC
AAATGGGCTTTGAGTCTCCACTCTACTCCCCCCATCATTCACTATGATATGATTTTTTGT
TCTGATGATGCCTGATCCCTGATCCCTTTCACACCTCGTGGTTGCATAGGCTGGTGTGCT
TCTTCCATGTGGGCTTTGTTGCTTCTGAGCTGGATGGCCACTTGTTTACCCTCAAGCCTT
TATCAGCACATTTTTAAGGCAGTTTTTGTGGTGAAATGAGGTGCCCTGGCTGATATTCAG
GTTGGCTTATATGCGAGTATGCATGGTACCATCTTTGTAAGAGGATTTATGGAACTTTTA
AAACTAGTGTGTGTTTAAGTGTGCTGCTATTGTTATCAAGTTCTTATCTTTTTATGTATC
ACTGATGATGAGTTGGGTGGTGTCACCCCTTTTTTTGCATGGAATTTTGCATCGTATGGT
AACTTAAAGAGCACCTACTTTGCAAATGATTTTACCGACACTAAGGTTGATGTATGGATT
GGGTGGTTTATATAGAAACCATGAGAATATTTTTCCACTATAAATATCTAGCACCTCCAT
TAGTATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCTTGTAAAGAGTTAGAGTCTCAGAAACTCACAGGGACAGCCCTACCCTATCCTGTAG
AGTTGCTATGAGTCAGAATTTACTCAGTGGCATTGCCTTTATTTGTTATTGTTGTTTATT
TGTTTTAAGGTTAGTTCTCTTTGGTTATACAAGTCATTTAAGGACTGTGACCCACAGACT
TGATTGATATATATATGCATCAGTTGAGTGAATGATGTATCACAATCCTAAGTGTATTAA
GTATTTCTGTCCTCTTCAACTAAAATTTAAGAGGATTTTGGTTGCCCTCTTAATATATTC
AGTACACAAGCATTTTCCTAAGTAATTAATCTGATTCACATTTTTGTTTTTTTTATTTTT
GAAGGTCCAGAATGCTAAGCAAGTTAACAGTGCACTTAAACAGAAAATGGAAGGTGGAAT
TGAAGAATTCAAACCTCCTGAGGTATGTTATTGAAGGATACATATAATTAAAAGGTGAAG
CCTTGTGCTTTGAGTGATCCTGTTCAACTCATACTTTGGTCGTATATGCCATTAATGCTT
TGAAGCCTTCATACTACAGATCACTTGCTGTGTTTGTTTTGTCATTTAGACAGTTGGTTT
TTGATCCTTGACTAATGCTTTTGGACTTAAGTTCAACCATTTCTTCCCTACCTTTAGCAA
TTCCTATCAAGCACAGTAAATTCGGCAGGTGTCTGTAGAGTAGGCCAGGGCATATGAAAC
GAGAAGAGAAGGTCATCAGAGGAGCAAACCAGTGCAGTGCTTGCCCCACAGCAAGGTTTG
CTCAAAGGCTTTACCTGCTTGGGTGAATTGGTGACACAGTAAGGAAGTAAACCCCGAAAT
TGGAGTATATTATAACATGTTTAATTTTTATTTTAAGGTATTTGTCTTTTGATTCACAAT
TCTCCCATTGGATTTCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGGCTAAGTGATGCTAA
TGAAAAACACATCACTATGATATTACACTAACCCTACAGGTAACTGACATGTAAGCACAG
TTAAGGAAAATGAAACATAAAGGATACTACTTTACTTTAGGTTGTATTGCTGTAACAAAT
GTAAAAGATAAAAGCAGAAACTTTAAATGCCTATCATCTCATAATTTTAAAGTGAAATAA
AATAAATGCAGCAACAGGAAGAAACAGGGACTGCTGCAAAGAGCTTTCTGCAGGTGCACT
GAAGGAAACGGAGAAGTTCCTCAGGACACATGTCTCGCCAAGACTGTCTCAAAAAGAAAG
CAGGCCGGAGTCACTTACAGTCATTGAATAAATTGAAGTGATAGTTAGCCTCGTTCTTAC
AAGAAACACAAAGCCCTGGTAGTTTTATTGGGGAAAGTCTACCAAATGTTCAAGGAAAGC
AAAATTCTAAAACAACATTTCCAGAAAGTTACAGGACAGCCCCACTCACTAGCATTATAT
TAAGTAAGACATGAAAGTGCGATGACACATTATAACTTTCTTGTAAATGGCCTCATTTCA
GCCTCACATACTGACAGAGAAGTTGGCTGAACAGACACTGTTGTTTTACATAAGGAAATG
GGGACTTGGAAGGAGTGTTGCACTTGTTCAAGGTCACATGTCTAGTATCTGACCAAGCTC
TGGCTAGATTTCAGTTTTTTAAGAGTCTGGGTTGGAATCTAAGATCAGCATGTTTCATGC
TACCTCTTAATTTTGGATATAATAGCAGGAAACATCAGGCACTTAATAGTCATTGGATTA
GTAATTATCAAATACTTATTACATATTTTGGTTTACTATAAAAATAATGATCAAAATAAA
ACAACCACAATCACCATATTATTCCTCTTGCTTTGTAAGGGGAAAGAGTAGTGTGAACAG
ATATATTTCAAAGGGCTAGCTGAATAAACGTATAGACTTGAGAAAATCAGGTTTTTATCC
CCCTAGCATTAGATTTCCTAATCAAAGTAGGTTATTAGACTTTGGAATAATTACATAGGC
CTTTAAATGAAGTAAATTATCTGGAAGTGAACAGTTTTAAGATGTTTTACTTAAAATTTG
CTCGTGTTTGTTACTTTCTTTAGGGGAAAAATTGGGTAATTTCATGTCAGGTGCTACATA
GACACTGGACAGTGTGTGGGAGATGAGGAAGGTGAAGAAGATGTGGATTTTCCACCTTAA
AACAAAAAACATAAATTTAGATGTTATAAGGCCGATGGTAGATTTGTAAGTAAAATACCA
TAGGAAAACAGAGGTGATATTACTGAGACAACAGGGAGACTTTTTCCAGAACACTCCAGG
CAGAGAGAGTAACGTAAGCAATGGTTTGGTGTTGAATGGTCCATTCAAATTATAAAATCA
GTGGGGAAAATTTAAAACACCTTTTAAAAAGTCAACTGGTATTCCCTGAGTACTTGTTAC
TTGCTCATTATTTTGCTAATTAATATTAAGAATTTAAAAGAAGTGTAAAACCATATTTTC
TCAAGAAGCATGCTGTCTACTGAGGAAGGCAAACTGTAATGCCGAGAAGGGGTGACCCTA
GTGTGTGAGGGAGCTGTTGACAAGCTTGAACAGAGGCTTCATTGTGGTAGGAATGAGTGG
GCAAAGTCCAGAGTTTGAACTTCCTTATGGTGGCTAGAGAGAGAAGTTTGCCTTTTGAAT
TAAGTCAAGTGGAAAAGCTGTACAGTTTTGGCAACAAAGGCAGGATGTAATGAAAATTTT
TAATTTGGGGAAAATACCCTGAATGTATTATGCAGAATAAAATGTAGGAGGAGAAAAACT
GCGTTGCAGCTACAATACGCAGTGTGTGAGTGGTAAAGTAAAATGGTAGAGGAGGACCAG
ATAGGCTAGACAAGCAGTCATCACCCAAATGGCATTTCAAAGGAGAAATGAGTGTGATTT
CTTCAAAGTATATGAGAGTGTTGGGGATGAAGGATGGACACTGTTTTGTTACACTTCAGT
TTGTTTAGATAGAGGTGGGTAGGCAGGGGACAACAAAAACTACTGAATGCCAAGAAGGAA
GAAGAATTATAGGTGAGAAAAGGAGTATTTTTGAAGCTAGAAATTTCCCCGTCTGCCGGT
ATTTTCGTTCAGAGTGAATGGCAGTCTTTTACTATGGATGTTAGATACAATTTCCATATT
GGGTGACTTCTTCCAACCCAAAGACAGTATGAGTTTCCTACTGACCAATAAATAAATAAA
TAAAGCAGGAGATAGAGTGGAGGGAGGGGGGTGCAGGATGTAGGGACAAGGTAATTATCA
GGGAAATGATGTGATAACAATTCTGAATTCACTAAAGGTATTCAGAAGGCTTAGCCCTTT
TATATTACTAAGTTTCAAAGAAGCATTTCCAATCAGGGTTTGCTGAAATAATGTACGCTC
AAGAGTATACCTAGTGAACCACAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGTACAATTCTTATCA
CAATCCATACATACATACATCGTGTCAAGCACATGTGTACATTTGTTCCCATCATCATTC
TCAAAACATTTGCCTTCTACTTGAGCCCTTAATATCAGCTCCTCGTTTTTCTCTCTCCCT
TCCCACTCTCCCCTCCCTCATGAGCCCTTCATAATTCATAAATTATTATTTTGTCATATG
TTACACTGTCTGATGTCTCCCCCCACCCTCTTCTCTGCTATCTTTCCCCCAGCGAGGAGG
TTATACGTAGATTCTTATAATCGGTTCCCCTTTCCACTCCATTCCCTCCACCCTCCAGGC
ATAGCCACTCACCTCTGTTCCGGAAGGGGTCATCTGTCCTGGATTCCCTGTGTTTCCAGT
TGCTATCTCTACCAATATACATCCGTCTAGCCACATTTGTAAGGTAGAATTGGGATCATG
ACAGTCGGGGGGAGGAAGCATTTAAGAACTGGAGGAAAGTTACATATTTCATCGTTGCTA
CCCTGTACCCTGACTGGCTCATCTCCTCCCCACAACCCTTCAGTAAGGGGGTGTCCAGTT
GCCTATCAATGGGCTTTGAGTGTCCACTCTGCACTCACCCTCATTTACAATGATATGATA
CTTTGTTCTTGGATGCTTGATACCTGATCCCTTCGACAGCTCATGGTCACACTGGCTGGT
GTGCTTCTTCCATGTGGACTTAGTTGCTTCTGAGCTAGATGGCTGCTTGTTTATCTTCAA
ACCTTTAAGACCCTAGACGCTATATCTTTTGATAGCCTGGCACCATGAGCTTTCTTCACC
ACATTTGCTTATGCACACATTTGTCTTCAGTGATCATATTGGGAAGGTGGGCACCCACTG
ATATGATTTTTTGTTCTTTGATGTCTGACAGCTGGTCCCTTGTATACCTCGTGGTCAGAC
AGGCTGGTATGCTTCTTCCATGTGGGCTTTGATGCTTCTCAGATGGCCGCTTGTTTATCT
TCAAGTCTTAAGACCACAGACACTATATCTTTTGATAGCCGGGCACTATCAGCTTTCTTC
ACATTTGTTTATGCTCACATTTTTCTTCAGCAATCATGTCGGGAAGGTGTACATCATGGA
ATGGCAATTTAATAGAACAACGTGTTCTTGCATTGAGTAAGTACTTGAGTGGAGGCCCAA
TGTCCATCTGTTGCCTTAATACTAAACCTATAAATATATGCACGTAGATCTATTCTTGCC
TTTTGAGAGGTTGTGTCCTCTTGTATTACTGTTATGTTTTCTTCTCAGCTATAATTTTCT
TTCTATCCTAAAATATTGCTGTTCTTGTCCTCAGAATTCATTTCTCTTTCTTCCCTCCTT
CGGAGATACCATACAACCTCAAAAATAAAACCAAACTCATTGCCATCAAATCTGTTCCAG
TTCATAGGAGCTCACAGGGGCATCTCTGCAGGTTTCCCAGACTATTCATAGCAGTAGAAA
AAAGGCTCGTCCTCCATAGAAGGGTTAGTGGTTTGGAACTGCTGACCTTGCTACCATGGC
TCACAACTCAGTGTATTAAGGTCACATTGTATGTATCTTTAAATGATACACAAATTCAAC
CATAGGCACTCAGTCAAATAAAAAGAAAGGGTATGTTTAATAATAACAGTTTTAGTTGTA
CTGACAATTCTGTCTGGATGCCATTTATTGAATGGATACCCAGAGTGTGCAATTAGGAGC
TGGAAACTCAATCTACTCCTCTTCACTTGGTTTTACCTTCCACGTGCCTCTTGTGTGAAC
ATCTCATTGAACCAATTGAGATTCTCACATTTAAAATTCTTTTTCCATATATCACTTCCC
TGAGTTCAAGCCAAAGACCCTCTTTGAGGGTAAAACCTGACAAACTAGTGGTCCATTCTA
ATGCAGGAAAAATGCCTGTGTTCACTCATTGAGCGACTTTTATAAGACTGCTTCAAAGGC
AAGAGACTTGAGAGTGGAAGGCCGGGTGAGCACCTTTTTTCCTTTTCATTTGAGACTTTA
AAACCCCACATCCGAGTTAGATACATCTCCATTGTACTCCCTTATGAAATGTTCTCAAAT
CTTTCAAATATGTGTTTGAGTAAATTAAGATCATAGCGCTCCCAGTGAAAGCTGTCATCT
GAATATGCCTCACCTTCTCGCACCTCCCAGGTGAGCATTTCTTTACTTCTTAATGGCATT
ACTCTGTTCCCATATTTCCCAGCTTAAAATCTTATTCTGGTTAGTCATTTGCTCACTTCT
CACCTCCCCACTCCCCCTCTCCCATCCCTCCCACCCAAAACTGCTTATTAAATTCAGTGT
GAATTTAACCAACTTTGTATTAGTCTGGGTACTTTGGAAAAACAAATCCACAGCAACTCA
TGTATAAGAGAGAGTTTTATGTAAAGAAAATGTGCATCACGAAAACATCCCAACCCAATG
CTGCCCAAGCCCACAAATCCAACATTAACCCATTAACCCAACACCAGTCCACAAAGTGCT
CCACCTCACAAAACAGAGGCAATGATACCGACTGCAGGAGGAAAGCTGAGTCAGTGAACG
AACAAGCATCTCAGCACTAGCAGGGGTCTCCACACGGCTGCTCCAGCACCCAGGGCTGCA
TCGGGGTAGGTCCATGTAGCTTCTCCTTGGGGATGTCTTGTAGGAAGTCAATCTTGCAAG
CTGAAACAGGGAACTGCTAAGGCAGCTGCACCCGGTGCAACCATCACAAAACAAGAGACC
CGAGAACTAGAAAGGCGAGGCTTCACCACCCATTTATCCCTCCGCCTTTCAACTAGCCCC
ACATGTGATTATCGGCCAGGCTGGCACAATTAACTAACTCAACTACCCTACCAAAAGTGG
TCCTTAGCATATTTTACTTAAGTTAAATATTACCAATTTCCCCGACAAGTTCTTGCCATA
AATTCTGTTCTCGTCACATGGAATGCCTTCTCATCTATTTTTACATTTTTTCCTATTGTA
AATCCCATCTCAGTCCCCAGCCTGTACAACTTTACCATGCTCCTTTCCCTCCTCTTCAAT
CACGGTGTTTCTCCTTTCTTTAAATTCCTAATATATGTAGTAATGTTTACTTTTAGCTCT
AATACTTGTGTTTATCCAAAGTCCTGGTTAGATTATAAATGTTAGGCAGTTTAGATACTA
TATCTTTATTTTGTGATCTACATTGTAGACATACATTTAAAATGTACTTGTTGAATGTTT
AAAAATAAATTTTTTTGCAGAGTATTTTATTTCTTCGGTTACTTTGGCTCCCTTTTCATT
GACAGGAGCCCTGGTGGTGTAGTGGGTACAAGTAGGACTGCTGACTGCAAAGTCGGCAGT
GGCAAACCACCAGGTGCTCCCAGCACAGGAGAAAGATGGGCTCTCTTCTCCAGAAAGAGT
TAAAATCTTGGCAACTCACAGAGGCAAGTTCTACCCGGTTCTATAAGGTCATGAGTTTGG
TTTTTCATGAATAAAAGGAGCCCTGGTGCCATAGTTGGCTGGGCGTCGGGCTGCTAACTG
AAAGGTCAGTAGTTCGGACCCGCTGGTTGCTCTGCTCCCATAAAGACTCACAGCATCATA
AACCCCAGGAAGCACTTCTGCTCTGCCTTCTGAGGTCACTGTAAGTGAGAGTTGACCTGA
TGGCTGTGGATTTGGTTTTGGGGTTTCGTTAATGATACTTTTCTTATAGTTCTGTCTTTC
AGATTTAACAGACATCAGTTAATCAAATTCCGTTTTCTCAGGCACTGTATGTACTAGGTG
GTTTTGACATATATTCTAAATATATCCTCATGTTTAATTATATTGGATCCTCTGTGCCCA
AGTATTCTTTATATCTGTGAGAAGCACCAAGAAGCAAAGGTTGCCAATAAGAAAATACCC
ACTAATGAACTGACCCCTTATCAAATTGGGATCTGTTTACCAGTGCTCTGTAATTACTCT
AGTGTTATCTAATCCACCACATCACCATCTTCCTGTCGCTCTCTGACCAATACTGTATGA
CTATAGCACACATCAAAATGAAATCTCCATATGACAAAAGATGCAAGGCTTCGTAACCTT
TGTCAAAGTGCAAGAGAACGAATGACTTACTTAAATCATTTGCAAATGGGTGACATATGG
GCATCCAGCTGAATTCGCAACTTAGGGGAAAAGAATGATGACTCAGAGCCAAGAACTTCA
AAACAATAGCTTACAGCTATTTGGCCAGTGGGGGGTGGGGACTATTGCCAAAATGAACGG
ATTGTCTTAATTTTAATTTTCATATCAAATTACATTCAACCTTTTATTTTTCCATCATTC
ATTATGAAATTTTAGCCCTGTTTTAAGGAGATCCCCGTAACAACTCTCCTGTTTCCTTCC
TCTCTTTGTACTGTTGTCTTTTGCCTCGATGGGGGCATCTGGCCTTAAGGCCATCTGGCC
CATTTGCTGTACCTTTTTCATCTCATCTAAAATCCAGTGCTTTCTGCTTTCAGTTGTTCC
CCTTCCAGTCACTTATAGTAAAAAAAACTTCTTCTATTTTTGTTTCACCTACTGCTTCAC
TCTTCATTCATAGTGAAGAAGTCGGTGTTATTCAAAGTCCCTACGTACCATAGACACTCC
TTTGCCTAAGACTATTTTAGGTGTTGAGGCAAGACCTGCACACCTCTGTCCACTCAAAGG
ACACCTCCGTTACTGTTTCACCCAGCATAATCTGATCGTAATACCCAGCCATTTTTTCTC
AGAAGTTACTACTATAAACCTCTGTTATTTCCATCCTTCTATCTACTGTCACAGGTCTTT
GATTGTCAGGTGTCAAAAGGCATATACTAATAGAATTTGACGAGATATTTCATAGTATGA
TAATAGACATATCTAAAACCTAGGGTGTTTCTTAAAAACAAAAAGTCTTTGCAGCTGTGT
CAGATTCAGTACCACCACCACCACCCACACACTCACACCCTTGGCAGGCACTGTCCTCAA
CGGCTGCCACAGAAACACTGTGACTCATGAGCCCTGTTCCTTTTCTTTTGGGCCTCGGAT
AAATTGTGTTACAGACATTTAAAAAAATCTTTGGAAATCTTGCCCAGGAGGGGGATCCAT
TTTTATTAGTGAGTCCCTTTCATGTTGATTACACTACTGTTGTTCAGGGTAAGGGTATGT
GTAACACAAACGTCCAGGGAAGAAATTTTGGAGATGAGTACCTCACCAAAGGAAACAAGC
CTCCTGAAGTGTTAACGCTAGGCTGAAGTTGTATGATGGGGCAGGGTAGTCAGAAAATGG
AATGGCTGCTCTGGTGGATGATCGCCGGTTTTATCGTCTCTTGATCAGAACATAGTGCAC
ACATCATTCATTCTCCCCAATCAGTGCATTTCCCTTGCATTATCTTTCTGTGTGGGTTAA
AGGTAATGCAGAGTATATTGTTTAATTCTTCTAAAAAGTAAACCTTCATAAATTAGTGTT
TTAGTAATCTCATGTCTGTGATTTGGTGAAAGTTAAGAAAAAAAATAAGCACTTTGGAAA
AATGTCTGTCTTCATATCCTCATTAGGAAACTTCTCTTTAATTTTGTAGTCAAATCAGAA
AATTAATGCCCGTTGGACACAGAGGAGCAGCTTCTAGCAGTGCAAGGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTGCAGGTATATTAAAGATAAGCAGTTATTG
TTGTTAATAATTCTCTTTAACTTGTCATGAAAGGGGGCTCCGCCACAGGTCTCCCCTTCC
TGTAGAAACGCATCAAGAAAGGGCTCTGTTCATCTTGGTGAACCAGGACGTCTGTGGCAC
GTGAGCTGGGGTGCATTTTGGGTCCTAAATAGCACCTAAGGCATTCTTATCACTCACTGC
AATGGTGGTGGCGGCAAGCAAGCGCAAGTTGGTTGGGCCTGGGCCCTCTGTGCGTCTGCT
TCAGCATCACTGAAACGAAATTCATTCTTACTGTGGCAGTAATCAGTAGCTCATAGTTAA
AAGCATAAATGAACTATGGCATGTTTCTGCTTTCGCTAAATACTCTTTCCGTACAGAGTT
TCTCTGCTTGATCAATGTCAGGCACTACCAATATTGACCAGGTGCTTCACTTTCCAGTGC
ATCTTACCTTACTTAAGAGATGTGCCCCAAATGCTTAGATACCTGATTTTGAAACCACAC
AATGAAATTATAACATACATATGTATATGTATTGAGGGGAGGGGAGAGACTTCAAGAGAC
ATAAAAAATACATGTACATATAGTGTTTTTAAGTCACTGTAAGAATGCTGTGTTAAAGCG
TATGGCAGAAGACTGAATTACAAATATGCATGGGCAAAATTGGAAGCATAAACTTGGGTT
AACTCCTGTTCGTATTACTTAAAGAAGGGAAATGGTGTACTTAATTCATCCTTATGGGTT
ACTTGTGTCTTCTGCTCAAAATAAACTACCTACACAATTGGTGGTGTAATTTAAGGTTTT
GTTGACGTTTTCTTTCTTGGCCCACTGTGTTGAGGACTAGTATTCTTTGACCTAGGTTAT
CAAGGGTTTGAAAGATTGAGGCCAAGTACATGTGTATTATTCACTCTAGCAGTGAAACAT
AAGCCTACCCTTTAAAATATTCCCTGATACACATCAAAAAGCATGTTTAATTTTAAAATA
CTGTGTAAGTACCTTTGGGTATGAGAATGATGTAATTACAGATTGACTGATAGATGACTC
TGCAGCTTGGATTAGGAAAAGTGAGACTTAGCCAGCAGTAATTGAAAGTGTCACAGGCGG
GTGCCAGCAAGATGGCATCAGCCTTCCCTTTTAGCCCATGCCACACAGCAAGTCTTCATG
ACGAGAGGTGCCTGGTGCTGTGGAGGCTGGCTGCATGCCAAGCACCCCGTAGGGCTCAAC
TGCTAAGTGAGACACAAAGTTTAGTTCATCTATAAGGTTCACTGATAGCTTTTTGAAAGT
AGAAAAGTAAAATATGTTTTAAAAATACAGGAGCATTTTCAATGGCTGCTTCATATTTCT
GTAGAACTCTGATGACTCATGGCTCTAAGAATTCTTTTGCATTGGCACTGGTTTTTTAAT
TCATATAAAGCCAATATTTCCCTTGATTACAGCTTACTGCCTCTACAAACTGAACCCTGG
CTTCCAGTATTAAGTTGCTTAGTGGTTAGAGTACTAATCCTATACTCAGGAAATTATCCC
AGTAAAAGGATTTTCTGACAAACCTCTGCCAGGGCAATCTGAGCAAATATTTTTCTATAC
AGCATTCTGGATTTGACATTGTTCTACAGCCCTGCTTTTAACTGGCAGTGGCCACTGAAT
TGTAGGGCTCAGGTAGAGTCTGGGCAAGGAGAAATTCAAGAGAAGGGCAGTGGCAAGATT
TATATATTCATAGATGGTTTGATCTGTGTGTGTGTACGTTATCTCAGCTTGCTAATATTA
AAAGGAATGAATGCTAATGTAGAGATAACCAGACATTTCTCTGTGCTTAAATTATCATGG
TTTTTCCTGCATAGTTTAAAAGTAATCCTTATATTTTACTAGTAGTCATTTGTACCAAAA
TACACATATTTTTAGGCTTTTAAAGGTACTTTCCTAATACTATGTTCCTGTCTGTTTTAA
TTTATTTATTTTGACAGTTTGGGATCTTTGTTTGGAGTTGTGTTTTTTTTTAACAATAGA
AAGTTACTTGTGTCCAAAATAGCGATTTTAGAAAGAATTAAAAGGTGCCTGCTTTGTCTC
ATGTACTCACACATGTATGTAATGTTCAGATGTGTGTCTTAGAATGAGTATAATCACGTA
GCAGCGTCACCTCTACTAGAATCTATTGTGTTTGTTTTAACATGCAGAATTTGCTGTCCC
AAAATCCTTATCATAGTTATTTTTGTTTTTTCTTTTCCTTCTTCTGTTTACAAACTGTTT
ATATGGTTTTACTCTAGTGGACCATTTAAATTTCGATATTAAGGCATTTTACACTTAGAC
ATTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAAATAAATACT
AATAATCGTTTGTGTTTGTACAGTGGACTCTACTAAAGCCAAACAAAATATGTTATAACT
CCTTGGGGTTTAAATATGTACATGTGCGCTTCAAAAAGTTTGTGGAAAAACAATGTCTCA
TCCTTTAATTCCATTTTTCCATGAACTTTTTGAAGTTCCCTTCTATTTCACACCTCACTT
TCCTGGCCCATTCACTTTATATTGGTGATAGCTAAGGACTGTATATTTAAGTAAGTTTAC
TCATCTTGCTCCCCTTACATAGAAGGAGAAAGAATCCTGCTCAGGCTAAATAGGAAGCTT
TGCACTTTGTTCATCTGTTACTGTATTATGTTAACTCTAGTTCAAGCTGTATTAGAATAT
TATAAGAACAGATAATTTAATTACTCTTACTTTTTTTTGTGCCAAGAGTAGTATTTCTAA
AATTTCTGTCACTTGTTCCAACTCTATTTATTTTTTAAATTTTTCCAACTTTAAATACCT
ACAGTTTCTATTTAATGAATACTGGGTTCAAACTGAAACCAATTATGCCCTTCCCATACT
TGTATTAGTGGTGAATTATTATCCTGTTTGCAATTCACACTTGTTATTTATATACCAAAC
ATTATTTGGTAATCAAGAATTAAGAAAGGAATTAGATTTTAGGTGTGTGTGCTTTGTTTT
TTTCACATGTTCTAGGAAACAATTGGCTTGTTTTTTTAAAAAATCTCAACATTTTTAATG
ATAGTACAAATAATTTATTTTTATAATATCTGGCAAGCAATGTAGTATAAAATATTTGCC
TTTTTATATCTTACATGTGTTCATTTTCTATTCATTAGTGCTTTAAAAAAAGTATATTTC
CCAATTAAAATATTTGCTGCTTTATAATAAACAACAAATATCCAGTTTAATGAAGATAAC
TTTAATTTCCAGTTCTTTTTACCTATTGCCTGTCTTCTCATATAAAGCAGGAAATGACAG
AACTGTTCCGGTGGGTTACGTTTATAGATAAATGTTGCTTTCTCTCTTTTATACTTCATA
GATACATTTCTTTTTGAGAGAACTAAAGTTGTAAGTCTCAAAATCCTTTTCCTAATTTTA
ATCTCATATTAAAAAAAAGCCAAAGTAGTTCATAAAGTAGAAGCAAAATCGGGTTTTGTG
AGTAATAAAGGCAGGGTTATAGCCCACTGCATGAAGAATCAAAAGTAAGTGACAATAGGA
GATTCATGCCTTGCCATTTAATTGGCACCAGTTTATTTTGGAAAGTTTTTCACTAAGACA
GAGAGAGACTTTAAGAATGGAGGGTACAGAAATGTAATTGGTAGTCCTTTGAGGCACTTA
CTTAAACTAATTCGTGATCCAATATTCCCAGCATTTTTGTAATGGAATTTAAATAACAAC
AAGGAAGATGGAGTCTCTAACCCTGAAGAGACATTTAGAAGAAGGATGTATATTTTTTTA
CTTTACCCCTTGCATAGATAACACCTATATTGTCAGCCCACTATTATAGAGATCTTTTCT
ACCTTCATTAATTCTGTAATTTCAAAGAGATTTACAGGGAGGTGGAAAGAAATGCATGTT
TCCAAATGGCTTGGGTTTGGCATGTTCTCTCTTGGTGAGAGAAGCAGTCACATTCCTGCA
GTGTCTCGTGGTGTCGGTGCTTGCAGGTGCCGTGGAGCCAGCCCCCAAGGAGCCAGTGCG
CAGCAAGACAAGACACGGTCCCGTCCCGGGCGTCCTCACAGCTGCTCTTCGATTGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACT
ATGCTTTGGTTGGGCCTGAGCCTTTGTAAAACAGAAAGGGAAAAAGAAAAAAAACACAGT
AACTGTGAAGAGCTCACTACCATCGAGTTGATTCCAATTCACATTGACCCTATAGGACAG
AGTAGGACTGCCCCTGTGGCTTTCGGAGGCTGGCTCTTTAAGATAGTGGAAAGCCTCATT
GTTCTCCTCGGTAATGGCTGGTGGGTTCAAGCTGCTGACCTTGTGATTCACAAGCCACTC
TAATTCACTACACAACCAGAGTGCTGCACAGTAGGGGTTCATCATTGTACTTCACTCCGT
GTTGATACAAGAAGTAGATTAGATGGCCCTTGTTTATTATAGACTGTAGAAAAATGATAG
ACTCCCTTCCTCCCAGGAGCAGATCGGAACTAAGGTAGTTCTGGGGCCAGTGTTCTGCTG
AAGGTCTTTGCTCTTCATTCCTTGCTGGATTAGCCTTTCAAATCATAAGTAGGGGTTCTT
CCTTCTGAAGGAGTAGTTTCCTGTGGTCTTTGGCCACTTGACCCAGTTGCCAACTCCAGC
AGAGAACCTAAGAAACCCACCTTCTAGTCAAAGCATGCTGTTTACAGCAGCAGCACTTGG
CACATGGAGGCTATAAAGAAGTCATATATGCCACTGTGCGGTTTCTCAGAAGAACTGGCA
AGAAAAATGGCATAAAACGAGAAGAAAGACAATCTCATTCCTGTTACCTGAGTATATCCT
GTTTACTCAAAACAGTAGCAAAGTTGGTGCTGATTTGTACACCGTAGGACAGTAGTACCC
TTTGACCTCATGGCAAACGGAGAAAATGAGGAAGCTTGTCTCAATACAGGGCCGACAGAT
GAGGTTGCTCTTGACCAGAACCTGCTAGGTAACCCGCTTTGCTGTGGTGTGGCCTGAGGG
GATTCCTACCTTGGCACACTTGTTCTTGCACACTGATTGAGAGGAGGGAGGGAGCCTTAC
CCAGAGTGCAGTCTGCAGTGTCATGGGGGCTTAAGATGCTGCCAACCAAGTAGGTGATAC
AAGAGTGGTGTGCATGAACTAATAAGCAGCCCAGGCATTTTAATCTGAACCCAGGTAACT
TGGAAAAGTGGGAAGTAGTTCTGGGATTGAGGTCTATAACTTGGAAAATGTGACTACATT
GCTCACAAGTAAAGGCCATTTAAAACAGTAGAAAATAAGGAAGTAGACTCTCTAAAGCAG
TGGTTCTCAACCTTCCTAATGCCATGACCCTTTAATGCAGTTCCTCATGTGGTGGGGACT
CCCCAACCATAACATTTTCGTTGTGACTTCATCACTATCATTTTGCTACTGTTATGAACC
GGGTGACCCCTGTGAAAGGGTCGTTCGACCCCCAAAGGGGTTGCAACCTACAGGTTGAGA
ACCGCTGCTCTAAAGGAATAGAGTCAGAAGAACTGTATCATGGAATCAGACTTGGAGACG
ACTTGGTAGATTTGGGAATACTTTTGCTAAACAAGTAGATGTTCTAAGGATTGTAATATC
TTCTGATTTGGGGTTGGAGTTAGTCTGAATATAATTTATTGCTAGGAATCAGAAGCTTTA
ATTCTAGGCCTGTTTAACGTTTCCATTTCTAAACTCATGTTCAGCAGGTTTGGCCATTTC
TAGGTATAAATGTAAGTACTTATGAGAATCAGTATCCACATAGAGCCCCATGTCTAGTGT
GTTTAGTAGTTACTCTTCTATGGAATGACCAGATTTTATCTTGAGAAATGGCACAGAGAC
TTGGCTATTTAAAAGGAGTTGTTTTTTACCCAATGTTCAAGTGATAAGGGAAGTGTTTGA
ATATATAACAATGACTCCTACTGTAAAATAAGCCCAGCTTTTCATGACCCAGTAAACCCT
CGAGGAAACCAGTGCTCTCAGAGTTCATACGATGGAACATCTTCTCATGAGTTTAAGATG
ATTCATTTATGTTGATAAACATTGTGAACTTGGGCCTTGGTAAACTTGTGAACTCAACAT
TACCTTACTGTTATATATATGTATCTTTAAGAGCAGAGAAAATGACCATAGTTTATAACC
CCGACTACACTGAAAATGGGATATGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTACCCCGTATTTATTTCTGCTAGCAAAGGTTTTATACATAAACAT
CATATTTTTCGTCTCCTAATCTCTTTCACTAATGAGGTACTATTTCTGATATTTCAAATA
GTAGTTATCAAATTATAAAACAAAAATTCCTGATAGCCTTGATATTTTGAGCAAAATGTA
TTTTTCTAGATAAGCTTAAGACCAAATTATTATCTGATTATAAAATTGTCTTAAATTCTG
TAATATAATTGGTTCATAAGTGAAACTAAATTCTCACATTGTACAACCCTTTTTAGTTTA
AGGTAGTAATGATCAGCAAGACAGGTGTGCTGGAAGTAGTTACCACTCTAATCTGCTCTC
CGGGCTAAAAAGCATAGCTAAGAACCCTTCATATATATAGTCCTTCGATGTTATTAGAAG
AGTTTAAACCCAACTAACTGTGAAAAACACCTAACAATTTTTGTCCATCCAATAGTGATG
CTTTTCTTATTTTTTAAATGTGTGGTTTCCTATCTTTCTTCTGTTCCTTGGTAACCTGGT
GGAATAGGCATGTAATCACGTTAAAGTTAGCATTACGATCACAACCAAAATGCTTTTCTT
AATGGGGACCCTTGAGGCTACTCACTCATTCCATTGAGGGGATGAAAGAGATGGTTCATT
CCCATCCAATATTGTTTACAAACGGTGTTGCTCAAATCTAGGTGACTGGCTACTAGGGAA
ATAAATGAATGTGGAATTGAGGATGGAACAAAGAATTCAATGCTTTACAATAATGGACTA
TATTTGAGAGTTCGAGAGAGGATTGGAGAAAATAACTGAGTATGTAAAAAATGGTAAGTT
CCGATTGTTCAGTTGAAGGCAAGTGGCTGGCTCGATGAAATGTCATAATCATTAGCTTTC
ATCCTGTGACCCTGATGTTCTTAGCCTCTGTCTCAGAATTGAGAAATGAGCAGAATTTAT
CAGAAAGGCTGTTCATTGCTGGTATCGTTTGTGTGTGCATGATGTGTAGTACACACAGCT
CTCCTTATTGATCCTTCACAGGTGTATTATTTACTTTGCCTTCCAGGTGTCCGCAAATAT
GGGTAAAGATTTTCAAGCTATTGCAGATGTAATTGGCAACAAGACTGTTGGGCCAGGTGA
AGAAACTTTCTTTGTAAACTACAGGCGTTCGGTTTTACTTAAGAGGAGGTATTTGCAGTA
GTGGGAAGCAGAACAAGGAACCCCAGGCTTTCTAATGGTGATGCTTCTACCTTAGGGGAG
GAGAACAAAAAAGTGGCTTCCTATGGTGCCATCAGGGAAAGAGCACCTGGATTGAATGAT
GAGGAAGGTGTGTTTTGTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1076, 4122..4174, 6152..6313, 7888..8012, 8944..9022, 17080..17243, 17245..17271, 17374..17401, 31444..31521, 40669..40695, 40698..40723, 40833..40834, 49066..49079, 49081..49128, 49130..49143, 49146..49166, 49168..49179, 49181..49190, 49192..49197, 49201..49219, 49221..49227, 49229..49263, 49266..49274, 49277..49296, 49298..49306, 49314..49328
1001..1076, 4122..4174, 6152..6313, 7888..8012, 8944..9022, 17080..17243, 17245..17271, 17374..17401, 31444..31521, 40669..40695, 40698..40723, 40833..40834, 49066..49079, 49081..49128, 49130..49143, 49146..49166, 49168..49179, 49181..49190, 49192..49197, 49201..49219, 49221..49227, 49229..49263, 49266..49274, 49277..49296, 49298..49306, 49314..49328
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved