Echinops_telfairi Locus ENSETEG00000001360
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000001360
Echinops_telfairi
ENSETEG00000001360
GeneScaffold_6905
SNORA73, SNORA4
23859..24060, 35721..35862
58867
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGCCGAGCCGAGCCGAGCCGGGGCCCGCCGCCCTTCTCCTCCATG
AGGCCCGAGTGAGGCGCAGCGGCTAGAGCCGGCCCGCGGCGCCCCCCGCCCCCTCTTCCG
AGCGCAGCTGCCGCGGCTCCGGAAGGAGGAGGAGGAGGAGCATGTCGGACGGTTTCGACC
GGGCCCCAGGTGCTGGTCGGGGCCGGAGCCGGGGCCTGGGCCGCGGAGGGGGCGGGCCTG
AGGGCGGCAGTTTCCCGAACGGAACGGGGCCTGCAGAGCGGCCGCGGCCCCCGCCGCCGC
CGCCGCAGCCCAAAGCCCCGGGCTTCCTGCAACCGCTGCCATTGCGTTAGCCCAGGACGG
CTCCGCCGCCTGGGGCCCAGGGCGAGGTCCCCGCCGGCCCCCAGCGGCCCCCCGGGCCCG
GGGCGCTCCCAGGTACGGAGGAGCTCTAGGGGAACCCCGTCCTCCCCGGGCCAACGCCTC
CCCACGGGCCTCGGCGCGTGCGCGGGCTCCGGCGCGCTCCTCTTCTCATCACTGCCTCCC
TCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNTTAGTATGTGTTCATCTTCAGATGCTCCTTGAAGCCCAACGCATATGG
TGGCAACACTTTGAGGGAGGGAGGGCAGGGTAACCATTTGTGGGTCTGGGTACTTTCAAA
GCTTTGGTGTAAATTTTCTATAATGAGGAGAGGCTAAAGCTAGACTGGAGTCCAAACTCA
TTTCTTTATGCATGCAGGCAGTTGTAGGCGCTGTGGATATTTGTGAGGAAGTCACATCTT
TGTTGTTTGTTTTAGGATTTTTTTTTCAAGGGTTGGGGTAGGGCTTGATCCATAGGATCT
GAAATAATATATTGAAAAGAATTGTAGTTCCTTTAGGTGTTAAATTTGGTAGCATTGTTG
GAGAAAGAGATGGGAGATCTTTAATGGTTCATAATGAGTCTTTTTTTAAATCTATAAAAT
ACTTTCCATGCTACCATTTCTACTTATCTTTATTTTCTTTGGGAGTCCTTGGGTGATAAA
CATGGTTAACATGCTCGGCTATTAATGGAAAGATTGAAATTCAAGTCCCCCAGTGGAGGA
AAAGGCCTGGTGATCCGCTTCTAAACAATTGGCCATTGCAACCCTGTACCGCACAGTTGC
TGCCATGTGTCCTCAATGGTGACTATTTATAACCTTTAAAATGTCCAAGGACTTACAGCT
TAATTCCTTGAGAATCAAAATATCTAATACTAGTCCATATTGTGGTTCTTAACAGTTAAA
GGTTGGGTTTTGATGTCAGTATACTGTTCATTGATAGATAAATAGGTGGAAAAGGGAGCC
CTGGTGGCACTTTGCTTTAGGCATTGGACTGATAACCACAAGGTTGTCTGATCAAACCCA
CAGGCACTCTGCAGGCTTCAGAAACCCAAGAAGCAGTTCTATTCTGTCCTATAGGGGCGC
TCTGAGTGGAAATTGAGTAGGTGGCCGTGGAAAGGGAGAAAAAAGTATAAATTTTGAAGA
TTTTAAAACACTGAACAGTATGCGAGACTGGCATATATATGAACAATGTGAACAAATATA
AACTGAGGGTTCGTTAAGTCATTGATATTAAAAATAACTCAAATTTGAACTGTGTAGAAG
AGTACTTGTGTTGTGATAGCAAGTTATCTTTACCTGTTTCAGTTGGCTGCTTTTCCAAGT
TGCTTTGGACTGTTACTGGTCCCTCAGATAATCTAACCAACTTTCAAGTTTCAGGAAATT
AATTTTACAAAGATAGGGCCACTGTTTATCCTGATTCTTCCTTTCTGTGTTGCAATGAAC
TGAAAAGCATTATGAGATAAGAAAATGGAAGAATTGTACTTATTTCTCTTTGCTCTTCTG
GTTTCTCCTCTCTGTGATCTCAGTTTGTGAGTAGGTGCCTGGTCCTAGATTGTCAGCATG
AGGCAGGAGTATAGCCTGACAAGTTAACAACTGTTTCTGGGGTTGTCCCCAAAAGAATTC
TTAAAACCAGGTAGTTGTACCATTTGAAGTTGAGCCTTTTGGGGTCTATGACATAGTTGT
ATAGTGGCTACATTGCAGTCCTGGAACTGTCAGGCTTGACTGGAGTTAGGCCAAAGGCCC
CAAGAAAATTATCTTTGGTAAGATGAACACACTGCTGTGTGTGAAGATATTGAGAAGAAA
GACATACGCTGGTGAGTTTAGGAATGTATCTGTGAGAGTGTATAAAAACAAAAGAGTAAA
TCTGGGAAAGCAAAGTTATGCAGGAAAGGAATATTACATAGTTCAGCTTTAAATGGAAAA
GCAAAACTATTAACTGTGGTAAACCTTACTAGTTAGTGCAAGGAGTGGGAAGAGGGAGTA
TGTGGAGTTGGGATAGAGGAAAGCAGTATGAAAGCTAAATGCTAATCTTCCAGAGTGGAA
AATCAATAAGAAAGAACAGTTAGTCAGAAAAACTTCATTGCATGGAGACAGATTAACAAA
CCTTTTCCAGTGGAAAAGAATGTAAGGCAGTTATGTATGAGAGTAAAATTGAAAGCAGAA
AACTGTTGAACCTTAACCTTTATTGAACTTTTAAAAGTCTTTAACCAAGTAGGTGGTAAT
TTTTAAAGGAAACTAGGCAATGTCATTGTGTGTGTGTTCAACATGAATGGGCTTCAAAAA
AGTAATGGATTTTTTCCCACAAACTTTTTTAAGACCTCCCTCTTGTGTGTTCTCAGGAGA
AGCCAGTCTTTCTTCTTTAATGACGAACTTAAAAGGTCTAGGAAATAATGGGGAGCAGGG
GGTGAATTAATGTATTGTCAGGTCCTCTTAGCACTTGACATATACTTAACTCATTTGAAC
TTAAATGATTGAGAATATATTACTCTATAGGGACAGCCTTGAGGCACACAGAGATGGTTT
GACTTGCCTAAGGTCACCACAGGTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTTAAAAGTAAACTTCTTCCTGATGTGGATACTCTGGAAG
TCACTCTCCCCGGGCTCTGTCAAGTGGCACGGAGGAGCACAGGGCTCAGTGCCCCGTGAT
GTACAGTCCTCTTCCACAACGTCGGAGATCAAGCCAGCCTTGAGCCTGTGCCTGCATATT
CCTACAGCTTCTCAGAGTCCCATGGACAGTGACTGAGGAGACAACCACGCAGGAAACAGC
CCTCTGATACACCCCTCCTGAATCTAGGTTCTATTCCATGATGAGTTAGTTAGATTTAAA
AAAAAAAAAAAAAAGTAAACTTCCTAAGGGTGATTTTGACTATATTATCAGTTGTTGATC
TGTACTATTTTTCTCAGTGTTATATTCTTAAAAGTAACTTGCCTAATTTGAGTTTCTCTT
TACCTTAAGTGGTTTTGTTTTTTAGTATTCTTTAGATCAGCAGTTCTCAACCTGTGGGTC
GCGTCCCCTTTGGGGGTCGAATGACCCTTTCACGGGGGTGGCCCGATTCCTAACACTAGC
AAAATTACAGTTATGAAGTAGCAATGAAAATATTGTTATGGTTGCGGGGTCACCACAACA
TGAGGAACTGTATTAAAGGGTCTCAGCATTAGGAAGGTTGAGAACAACTGCTTTAGATGT
TAGTTTTTGTGCCTGGTAGCATTAATCACATCTTTAAGAGTTAAGAAACAAAACAGAACA
AAAGAAGAATTGAGAAATAGACTCAGGAAGGTTAGCGATGCCCATCGGCAGAAAGCAAGG
GGCCTAGAAATTGTGTTTTAGACTAGTAGGCCTCGAAGTCTGTTCTGTACCCTTCAGAAA
TAAGTTATCTGATATTATTTTCCTTAAAGCCTTTTATTGTTAATTAGGTGGGGGGTTTAT
ATTTCAAACTGGCAAATTTTTTCTCATTCATAATTCTTGCTTTGCAAATGGGTACATATA
TATATTTCATGCAAAGATGAGTTTCGCATGGAATAACATGGTCTGTGGGTTTGCTTTCTG
GTGCCAAGGAAAATGCTGGAAGAACTTGGTCTAAATATTTGTTCTTTGTACTTGTGATCC
TTGGTGTAAAGTTGGGAGGACGATGAAAATTGATTTCCTTATGATTAAGAATTAGGCTCT
TCTTGGTAATATAGTCAGTTATAAAAGTGTTGCTGTAGTAACTTGATATATTGTGTCATG
TAAAACTCTCTTCTTTTTGAAAGGCCACATCTATCCCAAACTTCTCCTATCTGGGAGCTC
GTCTGTGCAACTACCTGTCGCATCATCTGACAATTAGCCCACAGAGTGGCAACTTCCGCC
AGTTGTTACTTCAGAGGTCAGTTTGAATGTATGACATTGAAGGAAATAACTAATAAATGT
ACTAGAATTTGGCTATTCCTCTTCTCTAAAGATGGCATATAGTAGAGAGTTGCAGTGGCA
GGTAGGGAAGACCATTGTTATTTATAATAGTATTAAATATTTCTAGCCAAATATGTCCAT
TTTTTTTTCTGCTGTCTTTATCTTTGGCTTTGCTTTTTCTAAAGATTCTCTTAAATGGTC
ACTTACGTATTTTCTCATACTGTCGGTTTCAGTAAGGATATCAGTTTATTTCTTACCACA
TTTTCATATACAGTACTACTTTTTTGAATAGTCTATTCTTTCTCTTTAGATTTGAATTGC
CACTTTTATTTTGCTGCATCTTTTATAAATTTGGGTTGAATTCTGGACTGTTGCTATGTC
CTATTAATCTGTTTTGTTTTGTTACCATACTATTAAATTACTCCTAAGTCCTTTATATTT
ATTCTGTTTCCTTTTCTTCAGTTTTTTTTTAAGTGTAGAATCTTTGCTGTTCTTTCATGC
TGCTTTTTTCCCAATAAACTTCAGAATCAGCATGTGAAACTACACAGATAATCATGGTGG
TACTTGTGAGGACTTTGGGGGATAATTGAATTCATAAGCTTATTTGGAGCGAACTGATTT
TTTACACGTTTTGTTGTCTTACCCAATAACCAGGTGGTCTTAACTTTTGTTAAGGCTTTT
CCATTAGTTCTTGGAAGACTTCTTTAAATGATTACAAGTTACTCCTTCATATAGTTAACT
GCAGTGGAATCTAATAGACTCTGAAACTGGGCCCAGAAGACATTTGAAAACTAAGCTTTT
GATGAAAGTACATGCATAAAATATGGGAGATGTCGACAAAGATGGGCTCTTGTCTCCTTA
TAAAAATTCCAAGTATATCAAAGACTTAAATAAAAACTAATGAAACGGCATATACTGGAG
AGGGAGGGGGTTGGCAAACAAAAATCTTTGGTTGGTGAAGCCTTTATAAGCAAGGGATGC
TAACCACAAACCCTTAGACTAGAGATTAATGTGTTTAACTACATACACTGTTGTATGTGG
TAGAGTGAGAATTATCCCACTCATGGTGACTTGATAGATTCTAGTTTAAACCAAACCCAC
TACCCTTGATTTGATTCCGACTCATAGGAAAGAGGAGAGCTTCCTCTGTGGGTTTCTGAG
GCTGTAAATCTTTACAAGAATAGAAAGCCTTATCTTTTTCCCACCAGAACGGCTGGTGCT
TCCATGAGTTAGGTTTAGCAGCCTAACTCATAACCAACCATGCCAAACAGAAAGTGGAGA
AAATGTTTAACACTTGACAGCTGATTTCTGTAATACAGAGACACACTTAGTCTTCAGCAT
GACTAAGAAAAGACAGGTGTCTCAGTAAAAATGTTTGGAATAGCTTTGACTAGATATGGT
TCAGGAAAAAAAAATTAACTTATTATTTGGTAGGCCAAATATTATTGGAAACCACTAGCT
GTTCCATAGGATAAAGACGAGGCTTTTTAGTCTTATAAAGGTTTATTGTCTCAGAAACCC
ATGGACGGTTCTACTCTGTCCCATTAAAGAAATGCAACTATCGCTTCTCAAAAGAGACAA
AGGAGTACTTCTAGGAGGTCAGATGGCAGAATGAGTCACTGGTATCCACCAGGGCTGCTG
GCTGTGTCTAAGAGCCACTTAAAATATTAAAATGAACCTCGTTCCCATGGAGTCTATTCT
GACTCATAGCGACCTGATAAGTTAAGAGTATAACTATTCCTTAGGGTCTCCGAGACTTTA
AATCTTCACAGAAACAGACAGCCTCATTTTTCTCCCATAGAGCCGCCAGAAGATTCGTAC
TCTTGACCTTTTGGTTTAGCAACCCTCCGTTTAACTCAGAACACACCCAGGCCCCTGGAG
CCACTTGAGACTTAAAATGGGACTCCAACCCTACGCTTACCTTTAGGATTTTCATGTAAT
TGGCTGAGGTTAGAGCCTGAGCATGGCCTTTTAAGCTCCCCAAGTGATGCTCCTGCGTGC
AACTGTGATCGAGAATTACCCTTCTGGTGCTCCTACTCCTTACTTTGTGTGGTTATAGGA
TGTGGTTCTTTTGACGATTACAGAGGAAAACGTGAGTGGTACAACAAACCAAAAACCCAC
TGCCGCTGAGCTGATTCAGACTCAGCAACCCTGTGAAAAAGTAGAACTGCATCATCGAGT
CCCCAAGGCTGTAATCTTTACGAAAGCCGTATCTTTCTCCGGACAGTGCTTGCTGAGTTC
CAGCTGCCAACTTTTTGTTCAGCTTCTGAACACTTAAGTTCTGCACCATCAAAATTCCTT
CAGTGAAAAGGAGGACACAATTCTAATACATAATTTAAGAGAGAGAGAGGTGTGTGTGTT
TACATACATACATACTTTGGTAAAAACGGGAAGTTACCTCATTTTTTTCTTTGCTATCAG
TGACATTACAGGGACATTATAGTTAACTTTTTTCTTTATATTTCTGTTTTAACCCTTCTG
AAATAAGCATATATTGCTTTTGTAATTTGGATATCTTCAACTTTAAAAGGTGTAGAGGTT
TTCCTTCTCACCTAGATAATCAACCATGGACAGAGGTAGGAATTGAAATTTGTACATACA
TGGTTGTACACAACATTGTTGCTTTTACATGCATGAAGTCCATTCTGACTCAGTGACCCC
TTGCACCCTGTCCTGTGCCATCCTTACAGTTGTTCTTACGTTAGAGCCCATTGTTGCAGC
CACTGGGTCAGTCCACTTGGTTGAGGGCCTTCCTCTTTTTTGCTGCCCCTTTCCTTTTCC
AAACCTATGTCCATCCTTCTCCAGGGACTTATCTCTCCTGATAACATATCCAAAGTATGT
GAGACAAAGTGTTGCCATCCTCACTTCTAAGGAGCATTTTGGCTGTACTTCATCCAAGGG
AGATTTGGTTGCCCCGCTGGCAGTCCATACACGGTTCTTAGCCACTTTCCATGTCTCAGG
GTACTCTAAGAGTCATAGCCTTGGCATTTACAAAACCAAAAGGTCATTTCATCCAAGCAC
TGACTGCAGAGTTGTAAAGGAAAGAGCAAGAAAAGGAGAGCAGCCCGCACAGTGCTTGGG
TATCTGTGTCGGCAGTAATTAACAGTCTTTCCATTATTAACTAGGGTGTGCTATTTATAG
ATGGCGAGACTTTTTTCTTATGGGGCGCTAACTTAATATGTGCGCAGGAGTAATATCTTA
CTGTACCTAAGTTTAAAAAAAAAAGAGAGAGGGGTTACATGTTGATCTAGCTTTGTAAGG
ATTAGAATTAGCTACATAGGCGCAGTAAGCTGTGCTGGGAATATGTTTGGGTCACAAAAC
TGACCCAGTATAAATACAGTCTTGGACAAAATGTGATTTTTTTTTCCCCCGATCTATTTT
TTAAATAAAAACTCAAAACCCAAACTCAATTCTGACTCATCGGTGACCTCAAAGGACTAG
ATAGAATAGCCCTTGAGAGATGTCTGAGACTATAGCTCTTTATGTGTGGCTGGAAGTTTC
AAACTGCTGACCTTGTGGTTAATAGCTCAATGAGTAGCCACTCTGCCACCAGGGCTCCTT
TTAAACAAAGCCAACCTAAGCTGGGTCTGTCTGCATGGAAGTCATCTAGTTTCCACAGAC
ATCTTCTCTATCTCTAAGAGAAAAACTGCCATAATCAATTTTAGAAAATAAACAACTTTC
CCAGAGTTTTCCCACTAATTTATCAATAAGCTCTGAGAAGCGGGTTGTTGCTGCTGTTCT
GTGTGTGGAGCAGATGGACCAAGAGGGGGGGAAATAAAGCAAAGGAAAAGTACCGTATAC
AGTATACTCGAGTATTAGCAAACCCAAATATCAGCCAAGGCACCTAATTTTACCACAAAA
ACTGCATTAAAAATGTGCTGAAAACTCGGCTTATACTCGAGAATATACGATAGTTAAAAT
AATAGTGTCTCTGTAGGAAATTGAAAACAAATAGAAAATAAGTGAATCTGAAAGAAAGCA
GAAAATATTAAAAACTAAACAACTCTAAAATAGGTCAAAAGGGGAGATTAAATGATAAAG
TGTTAAATTGTAACTCCAGTGAACTACTTCTACCATAATCCACTTTCCAGTGAACTCTGC
GTGATAAAACAAGGCTATTCACATCCCTGGTCCATAAAAACCTGCTTTTTAACACCCCGC
CCCCACCACCGCCCCTCCCAAAACCCTCATAGGACAATAAGGGGAGACATTTTCCCCCCT
ATTTGATGCCTTCGTGAAGTCTGTTGCGTATATTTATATTTTATATGTTTAAGCATATTG
TAAACTTAATAGTGCTATCTTTAATTAATGCTCAGTTTCTTAAAACTAGGAGTCAAGTAT
TAAAAGATAATGTCTATTCTGCTCTGTACAGATAGGAATATTTTTATTTATCATAGGAAA
TCAGGATGTGCTTACCTCTCTATTGCTTGTAGACAGCCTAAAAGGACAATCATCTTGTTT
TGCTATTTAAAAAGCAGAGCATTGTGAGGTTATTAAAAGTTTGTCTTTCTTAGATGTCGG
ACTGAATATGAAGTTAAAGATCAAGCTGCAAAAGGGGATGAAGCAACTCGAAAACGATTT
CATGCATTTGTCCTCTTTCTGGGAGAACTGTATCTTAATTTGGAGGTGAGCAAAATGTTT
TCTGTTGTGAATTTCTGAACACAGCCTGAGGACATACTTAATATATGTTCGCTGTTTCCT
GTTGCCATCTTAAGAGGGGTAGTGGAGGAGAAAGAACTAACAGCCCAGTACCTGCTCAGG
GTCATGACTACTCTAAATGTGCATCATAAATTATTAGTGCGTTTAGCACTTTACATTGGT
GGCTCAAAGTAACTAACTCGACAGAATGAGAGAGACTGTCACTGTGATTCACAATTCTTT
GGTTTATGTATTCATCTTCCCACATAAAATCTGTTTTTATAAGGCTTACATCTAAACGCG
TATAAAATGGGTTGTTTTTTTTTTAAGGTTACATTGTCACTTTATCTGTATAAGCCAGTG
GTATCAATGGTGCTCACAGTATCTGTGACATATAGGCAGGTTATATACATAGTCTCTGGC
AAAGCCTTCTCTAGAACCATGGCACAGACCCCATAGACAGAGTCCCCTTTGTGAATAATT
ATGTCTTTTTTCAAGAAAGAGCCACTGGTGATGATTTGCAATGACAAGAATATTTTATGA
CCAAAACTCACTGCCATCAAGTGACTGTTAACTCATAGTGATTCTATAGACAGTAGAACT
GCCCCTGGGAGTTTCTAAGACTGTAACTCTTTTTTTTCCTCCAGTTTTTGTTGTTGTTGA
TCTGACTTACATTTTATTTTTTTAAATACTTTCACTGGGGTCTGTTACATCTCTTACCAC
AATCCATATATTCCTCCATTGTGTCAAGCACATTTGCACATATGCCGCCATCATCATTTT
CAAAGCAATTCTCTTCCCACTTGAGCCCCTGATATCAGCTCCCCATTTCTTCCTCCTGCC
TCCCCTGCCCACCCTCCCTCATGAGTCCTTGATAAGTTATAGATTATTTTTTCCGTATCT
TACATCGTCCTCCATTGCCCCTTACCCACTTTTCCGTTATTCTAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNGTAGCAGTGTGCATGCTCTGGTCTAATCCGATTTGTA
AGTTAGAATTGAGATCATGATATTGGGGCGAAGGAAGCACCAAAGTGCTAGAGGAAGTTG
TGTGTTTTATCGGTGCTATACTGCACCCTGACTGGCTAATCTCTTCCTTGTGACTCCTCT
GTAAGGGGATGTCCAGTTGTCTACAGATGGGCATTGGGTCTCCATTTCTTATCACACACA
CACCCCCAACCCCCATTCACCTTGAGAATGGTTTTATTCTGGGTCTTAGATGTCTGATAC
CTGATCAAAATGGGGGTATTCTTGAATATGACTTTGTTAGCAGGCAATGTAAGTCCTGAA
AGGATTTTTTTTTGAATAGTGAATCCCAGAGGTTTATACCTTCTTAAGGCCTGATTTGAT
GAAGTAATATAAACACCGTTGAAAAGACACATGAATCATCCATCAAATATGCATCTCAGT
GCATGTAAAAGATCTTTGTCCAATCCAGAGTATAATTTACTACCTACTCTGTTTTTTTTT
TAAACCACAGATGTACCTAATTAAAAAAAATATTCACGTCTTATTTTTTAGTCTTAAGTT
TTATATGAGCCAAAATAAGAGCACCAATCAAAAGTTATACATGCCTCAAACGAAGAGTAA
TTGTAATATGCTCTTGCATTTTCTATCTGGAAGTAACAATAATAGGTAGGTCTGTAGGAG
ATATAAAGATACCTGGCTTCTAGACATAAAATTCTTCTGGCAGGAAATGCAAAATGGAGT
GTTTTATATACTATTAAAAGTGAATAAAATGCTGTGAATTTAAAGAAGTTTATAATTAAT
TAAAGAATATTTATTAAGCAATAACTTTTAAATGGGCTTACATTATTCTCACCATGTTAT
ATATGATAAATGAACATTAAATTTTACCTCTGGTGTAATAATTGTTTTAGGAACCTGGCA
TATGAAGTAGTTCTAATAAAATAATTCTAAAAGTAAAACCTGTATTAACTTGCATATAAG
TAATTCTAAATCTGTCAAGATGACAGTATATTCCTATTATTTTTGTACTATATTTTGGCA
TGATTGATTTTAATTTTCTTCTGTCCCCAAAGATCAAAGGGACAAATGGACAGGTCACAA
GAGCAGATATTCTACAGATTGGTCTTCGGGAGTTACTGAATGCCCTCTTTTCCAAACCTG
TGGATGACAACTTAATTTGTGCAGTAAAATTACTCAAAGTAAGTTTCACATTTTTTTCCC
TCCAAATGTAGCTGTTTTACCCATTTACTAAGTAAGGTAGACAAAGAAGGGAAGGTGTGT
ATAAATACACAAATTCAAGATAAACTTCTTTAAATATTGACCTTTTCACTTTAACTGCCC
TTGAGCTTATGTACTGGGGAAAATACATGCTTGCTGTTTAAACGAAATTAGGAAGTAAGA
AATGGAAGTTCTTCACCCCCACCCCCATACGTTTCCCTGCCACCTCTGTCTGTGTGGGGC
TTAGAAATGCTGTCTTCCTCTGTTGCAGTTTGCTTTCTTTCCACTTAACCAAGGATGGAT
CTTTTCATGTCAACATGAACAGATCTGCCGGTTGATTTAGTAGATTCTCAGTATTGCTTT
GTACACATGTGTATTACTTAGCTACTCGGTTGATGAGCATCTGGATTATTTTCATTTTAG
CCTCTACAGCACTATTAATAATCTCTTGTCATCTTTTTATATATGTCTTTATGTTTAACC
TAGATCTTTTTGTAGGTTAAATCCCTGCACAGTGAGTCAACAAGCACGTGTCCTTTTAAA
TGGACAAGTGATGCTGAATTTCCCTCCCAGAGGCTGAGCTAGTCTCTTGTCAGTGACATC
ATGTTCATACCCTTAAATCCCCCTTCCCTCAGTTGTTGAAATCACAGTGTGCATTATTTA
TTGCCTGCTGTCTATTTCCACTTGTAGTTTGGTTTGTTTGGGGGTTTTTTGGAAGTCTGT
CTTTGACTCTTAATTTTAGCTCTGTGTCTTTTACCGTACAGCTCTTATATTGTACATATC
TACTTTAAAAAATGTTTAGGCCTTATGACTGTGATTTTGATAACGATAGAGGTTCTCAGA
AAGTTGTTGTCAGGACCTCTTCATTCTCTAAATCGAAGTAGTAGGGCTTTTGTTCATATA
GGCCTCAGCTAACAGTATTTTGCTGTTTGAAAAATAAAAATGAATAAAACCAAAATTTTA
ATTTATTAAGTTGCTAAAAAAACCTTCTAAACATATAAAAAGTAACTGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATACGTCATTTTAGTTGAATTACTTGGTG
AAGAAAATCTGGAATTCATACATATTTTTAGTTGGAAGAAAGAGTATTTTAATAACCTTT
TCACTTACTTATGGATGCTCTTTATTGATGTGACAACAAAACTGAAATTGCCGTTTCTTA
AAGGAAAGTTGCAGTGTAGAACCAGAAAGCATGTCAATGAACTTTTAATACTGTTATTTT
AAAACCCTTTGACTTATTTTGCTATTTAAATACATTTATTTCCTGTGTATCATTTTGTAA
CATCCTTCATTGACCATTTGGAAAATATTAATTCATTGAGTTTTATGGATCTTCTAAGTG
TTTGTATATTTCATTAGACAGTATTTCTAAAACACATCTTTGTTATCACCAGTCTCATAT
AAAAAGGCTTAGTTAAGTTTTGGAAAAACTGACAGGCTCACTATGTTTGATACAAATTTT
CCAAAACTAATTTTTTTGCTGAAGGCTTGGATTTTACAGTAGGTGGTTAATACTTTCAGA
AGGTTTTCTCCTGGTGACACAACTGTTCACAAGGGTTCTGATTGTGTCAAGGAGTTACTG
AGGGAAGAAAGGGATGCAAAAGCCATGATTAATATTTACAGCCTCTCGTCACCATGCAGG
GAGTACAAGTCATTGCCAAGGTAGCAAATCTGTTACTTAAATTTTGTTAGCAGTTAAGTT
TCTCTTGGTTAAGAAAAGCATGGAGGTGCCTACATATTAAATGGTAGACAGAAAATAATT
AGGAATATGAATTCATTTTGAACAAAGAATGCTTAAATTGCTACTAATATCTTTCTTCTT
GGAATTTCTGCCCTTTTGAGTTCCTCACTTTACTAACACCTGCCATTTTAGTTGACAGGG
TCAGTTTTGGAAGATGCCTGGAAGGAGAAAGGAAAAACTGATATGGAAGAAATTATTCAG
AGAATTGAAAATGTTGTCCTAGATGCAAATTGCAGCAGGTGGGAAAAGTAACAATGTAGA
CAGCCACTAAATCTCAATTTCTTGACTTTTCTTTGGGGTTGTTTTTTAATCTGCTGTGCT
TCACCAGAAAATTTGAAATCTTAAAGACCTATGAAATTCTTTTAACATACAGATTTTTAG
CTATGGCTTCTGCTCACTGGCCATTCTGTTCAGTTATGTTCATCAACTGAAATGGTTTAA
GGTTTTTGAATAGTAAGATTTAACATCAGTCCACTGCTTCAGACTTGTTCAATAGATAAG
TACAGTCAGATACAAAACATATGAAGGATAACCACTCTCAGTGTCATACATTCTACAGTT
ACATAGAACAAATTTAAGTCTGTTAAAGTAAATTTATGACATAGGAAATTTTGGGAAAAT
CATAGCATTGGTTATACATTTTAAATTGAAGAAGTACAGTCTTAAGGTCTTGGGGAGGTG
CTGGCACATTGTAACTCCCGTTCACCTTGTTTGCAGAGACGTCAAACAGATGCTCTTGAA
GCTTGTAGAACTCCGGTCCAGTAACTGGGGTAGAGTCCATGCAACTTCCACATATCGAGA
GGCAACACCTGAAAATGATCCTAACTATTTTATGGTAGGTATACGAGTGTTTACATTTAA
GTTTTTTTGCTTGAATTAAATTTTGAGAATTTCTACATGAAGTACATAAAACTATTTTTA
ATGTCTAAAAACTCTCTTCACTGGCTTTTGGTCAAATGGTGGCAGCCTGCAAACCAGGTA
ACTAATGAGATGACTTGGAAGCCTTCAGTGAGATCTGGTGAGCTAGAGAAAAGCTCATCT
AATGGTATGCGGGGGAGGGGGGACAGTAGTGGGGGGATGTGATAAAAAATTTTATTCCCA
CAGAATTCATAATTAGGGACCTGCACCTCAAAACTCAGTTTGCATGTTTTAATAAAATGA
TGACCAGGTTAATGATCCCCTGAAGCTCCTGACATGGCCAAACATAAAGCAACTACAGTT
CGATGGTACTGCAACTCCAGACCCAGTAATTCTTCTCTTCAAGAAAATACTGATAAAAAC
AAACTTAACACTAAACCACTGCATACAACAGATGGATCAATACATCACGGTGCTTCAGAT
AACAGCAGGGTGAGGAGCACAAGAACTGGAGAAACAATCTAAAAGCCATAGTTTTTCTTT
TGTTTTTTTCCCAGTGAAATGAATGTTCTTGAATTATCAGGTGCAGACAGTTCTCATTGT
GTGCTTGTAAAAAATCAATTCTGAAATGCATATTTTTTATCACTTTGATTCATCCCAGAA
TGAACCAACATTTTATACGTCTGATGGTGTTCCTTTCACTGCAGCTGATCCAGGTATGTT
CTCTCACAATTTTGCCCTTGTTGTAACAAATGACAAGTAAACTACACCCTCCCTAGCACA
GGCCAGAGTGTGGTTCTTTTTTTTAAGTATTCACATTCTGAAATGCTAGGATAAAGGGTT
ATCTCATATAAAATGCTCTTTATACCAAAAGTTGATTTTTGGAGGCAAGGGTTTTTTAAT
AACCTTTACCAGTTTGGGCTGTTTGGGAGAATAAAGAGAAGACCACACTCCACAGTGGGC
TATACCACTTAGTATAGTTCGCTACTATTTTGTGGCCTACAATTAAAAAAAAAAAGCTCT
TTATATTGACTCAAATGGAAAGTAAAGCTCTTATGTAGCCACTCCATCATAACAACGAAG
AATCCCTCTATTAAATGCACCCATTTTTATTTCCTTAATATTTTATCTGTTACTAACTTT
TGAGTGGTTAGACTAGAGGGGAAAGATGGTTTCAGATCCTTGTATTAGCAGCTTATAGAT
TAATACTTTTAGATACCAAGACTTCTAGTTAGTAGGCAAAAGATAAAAATTGTGGTAGAA
AGGACTGCAATGTGAGAGGGGGAGAAATTTCCCATTAGCAGTAAATGGTATATGAATTCT
TCATTTGGTTTTAAATACCCCTTGGTATAAATGACAGCCTATTTTTCCTCAAATTTTCAT
ATTCGTTTGCTCAGAATAGCAGGTACTGACTGTTCTATCCTGTAGCACTAAAGGTCTACG
GAACTTTATTTTAAATTATGAAACATTTTGTAAAATAAGTAAACAATTAATAGTGTACTT
TTTCACTATCAAGATTTAACCAGTGTCATTTCTCCATATAATATACTTCAGATCTTTTTG
AAAGAAAAAACCCTTATAGATTCTACTGAACCTTTCTGTTCCCTAGTTTTTCCCACACCC
CAGGTAATTGTAATTCTGAAGTTGTTTTTTGTCATTCCAATGTGCCTTTTTAAATTAATA
CATATGAACAATAGATATTACACAGTAGTATTAACCAAGTGATATCATACTTACATTCGT
TTGCCACTTAGATTCTTCAGTATTTATTTTTGGTATTATCCATGTTGATACATAAGAGTA
CTTAAAACGTTTGTGGAAAAATCGAATTGAAAGAAAGTTGAATTTTTGAATAAATTAAAA
AATTGGGGGGAGCCAACCTTTTTTTTTTTTTTGCCAGCACTTCTTATATAGCTTTATTTT
ATTCATTTTAAATGTCAGATGATCATTTACTCAGAGTACACCGTTTGTGCATCCTTGACT
TTCAGACAGATGGCTGGTTCCCATGTTTTTGTTATTACACCGCCCTTGTGTTCATGTAGG
ATTTCATTTGAGTGAGGAAGAGGAATTTAGTTTTAGATTCTTTGCATCCTCACTACCACC
AAATCTTTGTTGGTTGCTTTCCAGAGGAGTTTTACTACTGATTCAGCTGTGTGGGTTCCT
GTTCTTTCATGCTTGGTAACATTGTTGTCAGACTTATATTTCTTACTTTGATTATATGAA
ATTGTATCTTGCTGTTTTTCAGGTTTCCATAGTAATGCAGAATTTCTTTTCATGCTTCAT
CCATTCCCTATTCTCCTGCCCCACAATTAAAGAGTTTATTAGGGAAATAAAAGGTTATAT
AATTCAAGATTATGATCAACTTGGAAATACCAAGAACTCAAAATACTATTTATTTTCATT
GGGCTTTTGATTGCTTTTAGAATTTTCTTCCTGTACTCTTTGTCCATTTTTTAGTTGGGT
TATTTGATTTCTTATTGATTTGCGATTCTGTACATAAGAATATACTTCTGTATTCTGGAA
GTTGATCCTTAGTTTAGAACTGCAGTTAACTTCTGCTATGTGGCTATCTTTTCATTTTGT
TGATGGTGTCTTTATCATAAGGAAATGGAATTTGTTTTATTTCAATTTGAAGTTTTATAA
TTTTTGTTTTATTGTATTTTTGTTGAGTATACACAGCAGAACACACACCAATTCAATAGC
TTCTACATGTACAATTCATTGGTATTGCTTACTTTATAACCATGCCCACCTACCTTTTCT
TAGCTGTTCTTCCCCATTAACATAAATCTATTGCCCCTAAGCTTCCTATCCAATTCTTTG
AGTTAATTTGAAATCCTGTTCTGCATTTCCCTTCCATTGGTCATGACTTTTAGAATCTTT
GATCAGATGTTCTGTAATGGTAGCCAGGTACCATCTAGTTCTTTTAGTCATGGCAAAGGA
GACAGTTATGCTAGAGGCAACTAACAGTCTGCCTTTTCAAGTCTTTTAGAATTGCTGGTT
CACAGGGTGGTTCTGTTTTTAGTTTATTGAACTACCACACCAGTTCCCACTATAGCTGTA
CCATTTTGCATTTTCACCAATGATGATTAAGGGTTTCTCCCAGATCCACACCATTGTTTG
CATTTTTGCTTGTTTGGGGTTGTTTTATTTGTGTTTTTGCATTAGCCATCCTAGTGGGAT
TGAAATTGCTATCTTATTCTGTTTTTTTATTTTAATCCCTCTGATAGCTAATAACATTGT
ACATCTTGTTTCATGTGGTTAGTGACCATTTGAATGTTATCTGTGGTTAACTTTATCAGT
CTCATTTGTGATTTCTATGACTTATTGAAGAAATCTTTCATAACATTATTAAAATTCTGT
TTAATAAGTTTTTGTTGCATTTGTTAATGTATGTCTTTAATTTATCTCATTTATTTTTAT
GGGTGCAATATAGGAAGAATTGAATATTTTCCATAGCACTCCTGTCTCAGCAAGGAGCCT
GTGCATTAGTGGGTACCTGTTGGGCTGCCAACCACAAGGTCAGCAGTTCAAAGCAACCAG
CCACTCCAAGGGAGAAAGATAGGGCTTTCTGCTCCCATAAAGAGTTACAGTGTCCGACAG
GGACCAACCAGACCAACAGTTCCTGGGGGGCACGGGTGGTGGGGGGAGGTGAGTGGGGAA
CCAACAATGACCGGTACAGGAGAATAGTAAGAGTTCTAAAATGGATCACAATAAGGGTGT
AGCTTTTCTGGATGTGTTTGATCAATCGAATCGTATCTCAGAGGAATTACTGAGAGGTGA
ATGACAAGCAAGCATAATAGTGGGATAGGAGGAAAGTGTATGTGTGTGTAAATGAACGTG
TATATTTGTGTATATGTGTATATCTATATATATACATACAGATATATATATATCTATATA
TATAGATATAGATATATATATAAATGCAACAAGGAAGCAGATGGACTTCGGGCCTCTACT
TAAATCTACTCAGTACAAGAACGGTTTGTTCTAATAATGTGGCACTGTTTGATACCCACC
TTCTTAACATAATCACTGAATGATACCCACCTCCCTGACATGATCGCTGAAGACAAAATG
GGTGCATAAGAAAATGTGGTGAAGAAAACTGATGGTACTATCAAAAGCTGTAACAATCTG
GGTCCTTATAGGCTTGGAGTTAAACATGCAGCCATCTAGCAGGGAAGCAACAAAACCCAC
AAGGAAGAAGCACACCAGGCTGTGTGATCATGAAATGTTACTGGGAAGAGGTATCAGAAG
TTTGAAAACATGCATCCAAGTGATATGAAGGGGACTGGATGTAGTGGAGACCCGAAGCCC
ACCATCAAGACAATTGGACAGTCCCTATTAGAAGGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCACTGGGGGCGCTCTTTCTATCGTTGGTGCAGTCTGTGCTTTCTACCA
GAGCTTATAAAACAAGTCCCGCTTTCCCCTTTTCTTCACCTGGGTTCATTTTGGTGCTTT
GGTTTTAATCTGTGTTGAATCTTCTTGTTTATCTTATTTAATTATTTCTAGCATCTACTT
TGTATGTAGAAATGCAGTTTGTTATTCAAATCATTTTGTTCAATATAACGTCCTTAAAGT
TTCAAGTACTTTTTTCTCATCATCCTAAACATGCTTATTTTTATCACACATGGGAAATTG
TTTCTTGCTTGAGTTTTGGGGGTTCCACCCTACTGGGAAATAATCTTTAAGTGTCTTGAA
AACTTAGTTGGAAATTATTTCAAATTTACAGAAAAGATACAGAAATAAAAGAACATACAT
CTAGTTTTCCCCCAGATGTACTTTTTATCAACAATTTACTTCGTTTGCTGTATGATTTTT
GCTCTCTTGACACACACATGTACACACCCACACACACGAGTAAATTTATATTTATGAGGG
GATTTCAAAAGTGGAATTAAAAGAATGAAAATAGTCCATGAAATTTTTGAAGCCCTCGTA
TATTATGGCCTTTTAATAAATGTGTTACTTTTTCAACTTAATTTGTTCTTCATGCATAAA
GCAGCCTTGTGTTTGGATCATGGAAACATCTGTCAAAGTGAATTTTATATTTGCTTCTAC
CAGGAGTCACAGGATTATCACTAGTTTGGGACAACTTTTTATTTTTTGTCAAAGAGGTCT
TTGATGTAGGTAGTAAAGCTTTGAGGTGCAGGCCCAGCAATACACATTTTCAGGAATGCC
ACTTTCTATAGAGTACATCTGTCTCAGTTCGAAACAAGCAAGATTTATTTCTGCCATCTC
CCTTTACTGCTGCTTGTTTTTAACTCCTGTTCTTCCTGATCCACCCTTTTTGTCAGATAG
TAACTCTTTCAGTATCCTAGGTTTGTGCTGGTTGAAATAGGATTAGGATCTGAATTCCAG
ACTCCTATCTCACTTGGGGCCCAAGGTTCAGTTTTCTGACCAAGGTGTTTACGCCCTTTG
GTTTCAGAGCCCAACACCAGTCTTTCAAGTCTCCTAGCTCTACAGCACTTTTGGTAGTTA
TATACGAAAGTGTGTTAAAACTTATTGCTAAAAAAATCACAGAAACCTTTTTACTAGACA
AAAATATCAAAATGTGACGTGATTGTTTCCCAGCACATTCTCCTTCTTAACACTTCTGAA
TTCTGCATTTCCATCTCTCTAATGCTTCTCCAAAGATCTTTGCACTCTGCAGTTTACACC
ACATCGAAATGGCCATTTGGGCATCCTTGTGGGGGGACTCAAATCATGTGTTCCTTGTAA
TTGCTAAATTATAGGAACAAAAAAAATCCTGAGGGGGCAAAATCAAGACTAAGGTAGATG
GGCTGAGGTTACCGATGAAGTTTTCATGGGACAGCCCTTGCTACCCTTGAAGAATGAGCG
GGTGTGTTGTCGTGATGGAAATTAGTTCCTTGGTGCCACTTCTGTAGCCATTTTCTCACC
AATACAGTTTTCAGTGTTCTCAAAATTTCTTCGTAATAAGCTGCTGTGATCATTCTGTGT
CCCGGGTGGGGTGGGGGAATCTATCAATTACTCTTTTGGAATTCCAACAGTCACCATAAC
CTTTGGAGCTGACCTCCCGGACTTGAATTTAACTGGCCCAGCAGATCCCCTAGGAAACCA
CTATTTGGATTTGGCCTTTTTTTTTTAAGGCCGCTTAAGAAGTCTAAGAGAAAATATATT
ACCAAGAGGACTTATCGACAGCTGTCCACTAGTTGCAGAGTCAGGTTTCAGCATCTTTGT
TAGGAGGAAACCTGTGCGTGCGTGTGTGCACAGGGACCTGAGTCCTAGTCGCACTGCCCT
TTGACTTACCCTTGTACACCTGCTCCCGGCTGATCATCTGTTTCTGATCTCACCTTATGA
ATTTACAATAGTAAAGAAAATTCTGTCGTCCAGCTCTTGTGCTAAGGTGCTCAGCAAGAG
TAATGTTGACTGTGATATTTAAAATTAGGCATCAGCATGCCCAGGTCATGATTTTATGTG
GTTTGGCATTTAGTTATAAGGTGGCGTAATTTGAGTTAGTGCAATGATGTATAGTCATCT
TCCATTTTGTGATCTAATGTGGTCATCCTCCATTTTCACAAAATCACAACTGTGATATAA
TGAATGACCTGATCTTTCCGAATGAACAATAACAGTGAGGAGTGAGTGGGTATAGATCAC
TCTGTTTTACTTTCTCTTTCTACCCTCAACTCACTTGGCTTTATTTTCAGTGAATCCAAC
AGTTTAAAAGAAGGCTTTATGTAGTATCCTTAAATGTTGATGATAACAATTTAACTGGTA
GTCCACGTAGTCACAACCAGAGGTCAAAATGTCACCAGCCCTTTAAGTTGCAACAGCATA
GTTTTAGAGAGATTGAGAAGCTTGGATAAACAAGATTTTTACCTAGTGTAAAATATTTTT
AGTTTCAAAACTTGAGGTGGCTGATGGTCATAAGAAAATATTTTTAAGTTAACTAATTTT
AATAAAAATTATTCAGAGCTAAGAACTTCCTAACCTGTACTACCAACCCATTGCCCTCCA
GTTGGACATGGCTTACCACAGATCCTGTATAGCCACAGGGCCACCAGGCTTCCTTCCTAA
GACATGCTAATCTTACAGGGTCCCAGTAAAGAGAACGCTTCTCTGCTAAGACACTTGGTC
CCTGGAGATCTAGATCATCACCTCTTTTCCCTTGGAAGAGGTTGGGGTCTGGCAAGGCTG
AGACATCTGTGAGCCTTTAAACTGTCTTTCAGAGCAGGAAAGAAAAAGAAAGCTCCTGTG
CAGAGAACCTTTGGTAGGCTAGCCCTTTCTGACAGAAACATGGCCTACTAGTTGCCAGCT
TGCTAACCAGATAGCTCCCACTTTAACTCCTTAGGGAGGAGTAATAGGGGATCTGTTAGC
CAGGAGTGTTTGCTTAAAATCCTTCCGTGTGGAAGAAAAAAAGCAGGAGTGTATTCTGGA
GAAGAATATCCAAAGGACCAAAAAAAAAAAAAAATCATGGAATTTCTCACAAGGGTTTTT
TTTACTCATGTACATAATTGAAGATTCATAAGCGTGCCCTGGACCACAATAGCATGCCAA
TTAAAATTAAAATTTTATAAAAGCTATATCTGAGACACATAATTGAGAGTTTAATGAGAA
TGAGAATTTGGAGTAGGACATATGTGATTCTCTGTTATATTTTTTTCTCAGTATTAATTT
ATTTTATTTATTATCTTATAGATTACCAAGAGAAATATCAAGAACTACTTGAAAGAGAAG
ACTTTTTTCCAGATTATGAAGAAAATGGAACAGATTTATCGGGGGCTGGTGATCCGTAAG
TTATCTTTAGTTAGTAATTTTACTTGTGATATTTCTCTGGCTCATTTCCACAGGAGTTTA
GATTAGAAAATAGTGGCGATAAGGGAACATGTATATTGATTTCTGTGGTGGCATACATGG
TAGTACTTAACAACAGTTTTCAGAGAAATCATACTAGAAAACTCAAGTCAGATTTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGGCT
CATCTCCTCCCTGAGACCCTTTTGTAAGGGGATGTCGAATTGCCTGCAGATGGGTTTTGG
GTCTCCTCTACTAGTTTTTAACTATGTAATAATTGAAGGGGAAAAAAAACTAGATGATCT
CAAAGGTAACTTCCTGTTAGGAAAATCTAATTACAATTAAATAGGGATGTGAATAAATTT
TCATTGAAGGAATCAAAGCTAGTTGAGTTCTGATTGTATGGAAGTACGTGGCACACTGAG
ATGAAGATGTAAAGTATTACAGACTCTCCAAATTCAGAATACACTTGTGAAACAACTTGT
TAAATGAAGCATGCTGTTGTCTAAGGAATGACACGTAGGTAATCTTCAAACAGTTATTCC
CTGGTGTCCTGGTAGAGACCATCCTATCTCTATGTTATTTGTTCATGGCTTAGCATAGAC
ATTTTCTGAATGGAACACTATTAAACCTGTAATTTATTTTTGCATCTTTTACAGATACTT
GGATGATATTGATGATGAGATGGACCCAGAAATAGAAGAAGCTTATGAAAAGTTTTGTTT
AGAATCAGAGCGTAAGCGAAAGCAGTAAAGATAAGTTTCAGCATATCAGATTTATACAGC
AGTTTAGATATGGTGATTTAGCAGAACACAGGAAAGCAAGAAAACGCATCACACGTATAC
CAAATTAAGGATATTGAGTTATGTTACTAATGTATGCAACTTTTAATTTTCTTTAACACT
ATCTGCCAAAATAAACTATTCCCTATAACTTAAAATGTGTATATATATATAATAGTTTAT
TATGTACAGTTAATTCCACTGTTTTGGCTGCAATAAAATCGATTTTGAAATAAATGAAAT
GTTGAAAGTAAATTTTGCTAGATGGTTAGAAGCAACATATCGTTTAAATTCTACTTTTCT
TTAGGAGTCTTAGCCTGAAAATAGAATGACTACAGAAATGTAGCATTCATTATGAATATT
ACAGCTTTCATTTCAGTCTGAACTTAAGTGTCTCATTGAGATTCCACATATGAATCACAG
TCATGAAAATCTTGGGCACTAAAATCTTGGATTATGATATTAACAACTGATGTTACATAT
GCAGGTTCCTGTTTGAAACCAAGGGCTTTTATAATGTTACTAAAAAATGACTTGGAGAAC
TCCAACAAAATAACCAAGACTCTTCACTGAGGGTTTATTCCAATTCTATAATTGTTCTTC
CAGTTACTTTTATGCTTAAAAAAATTTTTTTTCACCTGACTAACTTCATTTCCCTAAGGC
CTAAAACAGTCCTGCTATATTTACAAGGCTTTTTCTTTTTATTTTGTAGTATGAGTTATG
TTGACTTTTTTACTAGACAATTTTACTGGATCTTTGTCCCTTGAGTTTTCATCTGCTTTA
TAATTGATACACCCAGAGGATCACTTTTCTAATACTTTACTATATAATATGGCACCACCC
TGCCCTATTTAAGTAATATTTTTATCTAATGTCAAAATTCTTTTTCCAACTAACTAAAAA
ATAAAACTTATATTAAAAAGAACTGCTTGTAAATATGCATGTAAATAGTTCTGCTAATAA
TCCGCTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1186, 1190..1271, 11120..11289, 11390..11575, 25043..25155, 29693..29804, 32012..32137, 34131..34237, 34716..34832, 34837..34837, 35518..35572, 43041..43134, 57774..57867
1001..1186, 1190..1271, 11120..11289, 11390..11575, 25043..25155, 29693..29804, 32012..32137, 34131..34237, 34716..34832, 34837..34837, 35518..35572, 43041..43134, 57774..57864
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved