Echinops_telfairi Locus CCDC68
snOPY snoRNA Orthological Gene Database
Echinops_telfairi CCDC68
Echinops_telfairi
CCDC68
GeneScaffold_312
SNORD81
33982..34055
36093
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGTTCCCAAATTGACACCAGATTTACG
TAATTACCACAGCCGGGGTACCATCTGCTTTCTTCACTACATTTGGGTTGTGCACCATTT
TGTCTCCAGTGATCATGCCAGGAGGGTGAACATCACAGAATGACAGGTTGTTAGAACAAA
ATGTTCTTGCATTGAGGAAAGGCTTGAGCAGAGGCCCAAACTCCATCCCCTACCTCAGTG
TATTGCCATATAGATATAAGTACATAGGGCAATACCTCTATTTTTGTGATTTACTTTACT
TACAAATATACACACCTATGTTTATACCTCTGTCTGTAGCTTTGCTTCCTAGGTCTTTCC
TGTTTCCTTTTACCTTCCTCCTACCCCGCCATCACACTCAGCCTTCTTCTGCCTCTTAGT
ACTTCCTCTCCGCTAGATTGCTGTTGCTTTAACTCTTTATGGAAGTAGAAAGCCTCATTT
ACTCCAGCAGAGTGATTGTTGGTCTCTGGGACTGCAGACCTTGTCCATGGCAGCCCAGCA
CTTACCGGCCAGGTTACATCACATAAAAACTCATGGCCAAAGAAACCAGTGCTCCCTAAC
TGATTTATGTTTTCCTGAAGCCAGGATTTGACCTCTCCACAATGGCAACAGTCACAGTGA
CCACAGAAGTTGCCCCAAGGACCAGGACCAAAGAGAACTCTGCCTTGTATGAGTCCACAT
CGGCTCGCATCATTGAAGAGACCGAGTATGTGAAAAAGGTACGTGGGTGATGGCGAGATC
ATGCAGTGTTGTTTGACTGGCAGAGGCGAGTTCCCCTGTGGATCGGTGTGCTCAGTTTCC
CTGTGACTCACACTTGAGAAAGGATGTTCTTTGTAGCTGAAGTTGGGGTGCCTGTTTATC
AGTTCTCTTGAGGTCATGAAACCCCACGCGCTTCATCTTACACATGGAGTAAGAGGATGT
TTTTCACTCAGTAAAATTGAAAACTCAGCCAGGAGGGTTGAGAACACCTATAAGCACTGA
ATTCACCCCGCTCTGTTCACCACCGGGTCGCCTGCTATTTTACAGCCTCTCCCAGTTGTC
TCGTGTGCTTGGTACTGTGTTCCTGAGTAGATGCTTGTGCTCCTGCTGCGTTTGTGTCTC
TTGTTACCATGTTCCTTTTCACAGTTCAGGGAAGGCCGTGCCATTGAGTAGATATGGGCA
GGCTACTTGATTTTAAAATGTGAAATCTTGTGAGAATCCAAGATGGTAATAGCTGACCAA
ATTCTATGTTCTCTTCATTGTTTTTTAAGACAGATGGAAAAATTCTGGCATGGCAATTGG
TAACTTGTCTAGATTAATCAATGAATTCATCTGCCAGTGTCTTGCATTTCTCTAGGTTAC
CAAGACATGGAACCAACCTTTTACACATACATTTGTATCATCCCCTCTTAGTAATTATTC
TGTTGCAATTACTAAATAGCAGTTCATTTTTACTAATTAGTTATAGTAGTTCTGCTGCAG
TCGTTAGTAGGTAGTAATTATTTTGAAGTAATTACTAGATAGCAATTGTTTTATATTAAT
TACTAAATAAGTGCTAAATTATTACATTGAAAAAGAATGAAATGCTATTATATATTAGTT
AATCAGGAATAATCATTTGTGGTTACATTTCAAAACTCACAATCTCAGACTCACTGCTAT
GAGTCAATCCCACCTCATAGCTGCCCTGTGGGACAAGGTGACACTGCCTTTGAGTGCCTG
AGACTGTGGCTGTTTACTGGAGAAGAAAGCCCCATCTTTCTCCCATGGAGCAGATGATGG
TTTCAAACTATGGACCTTGCAGATCATAGCCCAACCTGTAAGCCCTATGCCTCCAGGGCT
CCTTATGGCTATATTTTGTAGTATAATATTAATTTATCCTATTTTAGGTTTGACCAAGAA
AAGAATTGTAAAGACCAGATGCTTATTTTGTGTGTGTGATCTAAACAGTATTAGTCTAAA
TGGGAAATTAGCTTGGAGGTTACTGAAACTTGAAGGTTAGTATAAAGTGATTACTTTCCA
GATAGATCAAACAATAGTTAGTAGAAGGAAAAAACATTTTGCTTATTACACGTCTTTGAA
AAATTTCCCCCCCCTCTAGATTCGAACTACTCCTGAAAAGGTCCGAAATCAAATGTTAAN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATCAGTCTACAGCAGCGTTCTCAACTGTGGTCATGACC
CTGTGGGGTTGAACGAGCGTTCACAGGGGTCTTCGATCACAGCAGTAGCAAAATTACAGT
ACCAAGTAGTAATGAAAATAATGTTATGGTTGGAGTCACCCCCAACATGAGGAGCTGTAT
TAAAGGGGTGTGGCATTAGGAAGGTTGAGAACTATCATCTACAATGTAAGTACTTCCTTA
CTGTTATTATTCCCCCATTGACCCTGCTAACTCTTTGGGATGAAAATTGGAGCTACAGAG
GAGAGTTCAGTTGTAGACCCTGAAAAGGTGTTTAAAGGGGAAACAGTCTTAGAGGTTCCA
CCAGCCGTTATCTGACCAGTAAGTAAGCTTGATCTCTTTCATTATTATGAGCTTTGTTCC
ATCTTTTCCTCACATTCTTTCTAGGATCTTCTAATGTAATCCTTTTCAGAGCCGTCAGTG
CTGGTAGCTAGACACCATCTAGCTCTTCTGGTCTCAGGCCATGGGGACTGATGTTGACAT
GGCCCACTGAGCTCAGTGCTCTCATGTGCTTTGGATTTTTATTCCTCTTCTTTCCGCCAC
GCAGTGAAAGGCCAATAGTTAAACCTATAAACCTTTAGGGAACCAGACACATCTTTCTTC
CTTGTATTGACTGGTGGGTTCAAGCCATAAATCTTTTTTTTTTGGTTAGCTGTGGTGCCA
CTAAAACTTCTTTGTGTAAGACAGGGCAACCATTATTGTTGTCAAGGTTTGTAGAGGAAA
GGTCTATTATTTTCATGTTTGTTCATTTCAGCGCTGTCAAAATGGCTCTGGCTCTGAAGT
GGGCCCCTCTGGTGTGAACACGTTGGATCGACTCATGGAAAGGATGAGAGGAAAAGAGCT
ACAGCTCCTAGAAATGAACAGAGAGAATGAAGTATTGAAAATCAAGGTAGGCACATAAGA
GACATTTTCAATCTTGCACGTTGGGCTTTTGAGTCAATAGGATCAATTGTTAGCGCTCAC
TTAATCGTAAAAGTAGAGGGCGTCTACACCCACNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTCAACTCCTGGTCCATCTTGCCCAGCCCGGTTAGAGTTTC
TGTCGCTAGATTGTCTTATGACTCTTACTTGGTTAATGCTACTGAGAAATGCCAAGTTAA
AAATAGATTTTGAGGCACATTCACTCAACTGCTTATGCAATCAATAAATAATCTGAGTAC
CAACCTTCTAAGAGTCAGGCAGAGCTGGGGGGTGGCACACACTGTTCATGGACCAGACAT
AGTCTCTCTTTTTGCGGAGAGTTCAATGTAGTGTTTGTGAATAATGTGGGACTCAAGGAA
TGTTTCATCCTTCCCTTCTTTCGTTTTCCTCAAGGTCCTACGAACGAAGCCAAACTCACT
GCCTTCGCGTCAATGCTGACTCATAGTGACACCCCCACCCCCACCCTGTGGGTTTCTGAG
ACTGCCACTGTTTATAGGAGTAGAAAGCCCATTCTTTGTCCCACAGGGCTGCTGGTGGTT
TCGAACTGCTGGCCATATGGATAGCGGCTCAATACATAAACAATCCACCTCCAGGGCTGA
AAATCCTGTTGGAGGGAGGGGTGTCGACTTCAAAATGAGGTAGAATGAGTAGCTGAGACC
TTGGAAGTACGTTTTTAGAGAATCCAGCCTTGATCCATATTGACCCATATGTGTGGTCTG
CCTGTTGGAACTCTGCATTTAGAGCAGTGGTTCTCCACCTTCCTCATGCCGCACGACCCT
TTCATACAGTTCCTCATGTTGTGGTGACCCCCCAACCATAAAATTATTTTCCTTGCTACT
TCATCACTGTCATTTTGCTACTGTTATGAATCGGGTGACCCCTGTGAAAAGGGTCATTAG
ACTCTCCCAAGGGGTCTCGACCCACAGGTTGAGCACTGCTAGCTTAGAGAGTAAGAGGGA
AGGGTGCTGACCATTTGAGCTCAGCAAGAACTCTGCAGCAGTCTTCTGTGCATCCTCTAG
TTCAGGGACTTTCTGGTGGGGGAGGGGCCTGTGGGTATCTCCTGGGAGGTAGAGTTGGTG
GGGAATGGGTTGTTGGCACAATGTTCTGAAGTTAGAAAATATTTGGTATAAATAGAATTA
AATCTATTTGCAAAACAAACAAGCAGATCAACAAACTATCCTGAAAGAAGCCTTGGCAAC
CTTTTCTTGCTTTACGAGAGACACCCAGAACCCAGCTCTGAGGAAGAGTCTCTCCGGTGG
GGAAGGAGCCATGTGCACAGGGTGAGGGATTACTGAGAATTTCCCACTCATCAGCAGAAG
ACATGAGGTCAAAACGGAAACGAAAATTAAAAATGAACATCCTCAGCCGAAGCTGATAAA
TACTGCCCTGGTCGTCGGTTCCCCCTGGAGAAGGATTCATTTTCTACTCGTTTGAACAAG
TTGCTGCTCCAACGAATAGCCAGTAGTGGTATAGGTCCAGTAATGAAGACATTACTTAAA
CCCTGCGCCATCTGTCCCACTTTAATCAGTAATGCGGTGAGAATGAATTCCATAAACACA
GTGACAAGCCAGCAGAAATACCCGACCGGGGCTTTTGAGTTTGGCATATGTTCCTTTTGC
TAGCAGGAAAAGGAACTTGGTTGCTTCATATGATTTGGCTTGGTGGTGTTGATTTGTAGC
GCTCAAAGGGGCTTTCAAGAGCCCTCAGTGCCTCATCATCGTCGTGTAGATGAGGAGAGG
GTGAGTGAGGAATGATTTCACAGCCTTACCACTACGCCCAGATAGTCTCAGGATAAAAAA
ATGATAGACTTGGTTCCTAAATCATTTCGAAGCTACTAGTGGGTAATGGTCTAAATGGGA
TGTACTCTGATCGGTACTCCTACTACCTGCTGCGTTTGAGACTCAAGGCAAGTCCATAGA
GCAGATAGGAGCAGATTGCTGCTTCTTTCTCTGCAAGAGGGCCTGATGGGTGCAAACCAT
GGACTTTTGGGTTAATGGTAGAATGCTCTTAGCCACTGAGCCACCAGGGATCTTTAAGAT
GACCAGCAGAGCAAAGGGATCTTCAGTGGGAACAGTGACCTGGCCACTGGGTGGTGCCCT
GAAGTCCTTTATCCTTTCCAGTAGATGCTGTCTCTGGGAAGTGTCCACTGGTACAGCCGT
AATTTTCTGTTTTGTCAAAGAGGAAGGGTTAAGAACAAGGTTTTTAAAAAGTCCCGACTT
TTGGAAAGAATGTTCAATGAGCTAGGGAATGGTGGGAGAATGGGAAGACCAAAATTTTAA
TTAAGACGCTGCCCCCCCCACCCCCCCACACACCACCCCCCTACCCCACCCCCCGTCAAT
GGTGTCCCGCTTTACCAATGTTAAAATCTGGTCACCTTAGTTAAGAACCCAGACTGCATG
CTTGAGACCTGACCAAGGTAGAAGATTTGTTTGTCCAGATGTCTGGTTTTCTTGAACCGT
GAAGATTCATGAATCCAAGTTGGGTTGCTATGAGTTGTAATTTACTCTGCCATACAGGGT
TGTGATGAATTGTAACTGACTCATCAGTACAACCCGAAGACCCTATTTTAACGATTCCAA
AGAAGATATGTACACTTGTATCCTTGATGTGACGTATACTAAGAGTGAGTGCACACATAG
GTCAGGACTTTATTCAATCCCATCAATCAATATAGGACAGAATAAGATGGTGCAATGAAC
TTAAACAGAACAATTTAGCCACAGGACAATTTTTAAACAAAAGGGCTATAGAATAGATTG
CTAGGTTAGATAAAAAACCTGCTTAGTGCCACTTAGAGTTATTAAACTATAACTTTTGGG
GTTATCTAGTGATTTCACATAGTCAGAATCTAATCAAATTAAAAAAATAAATAAAGTTAA
ACATAAAGAAGTCATCTGAGAAAAAGAAATAACTTTGACTCTGATTGTAAAACAGTGGTC
CCAATAGGACATTCAAACCACACACCGTGTAATTTTCCGATTTTTAAGTTTGAGTAACTT
AAAAACAAACAAACAAACAAAAACACGATAGGCCCAGAAAATTAAAATCATGGCCCAAAT
CACACAACTATGAAGTTGTAAAATGAGGACAGTCTGTATCCAAAACTCTTTCTGATTTTT
CTGGGACCCAGCACTGCCTTTTGTGATAGCATGTAAACACTGCAGCAGGAAATAGTTTGA
AGCAGCATTGTCAATCCGGTTGACCCCAGCCATGTTGCCCATGCCAATTCCTGCCTTTTC
CCAATCTCCTGTGCTGACATCAAAAGTAGACCAAAGCCTTTATCAGCAGCAACCATCAAA
ATAAATAAATAAGAATATAATTGTCCAGCCTGCTTTTTCCAAGGCTTGGCTCTTTTCTCT
TTAGTTAGAAAGAGTCAGGCTTTTCAGTAAATGACGGAATTCTTCAGAGCTTATTTTTCA
ATGTCTTCATCTCTGCTGCATCTTAATTAGGAGCCTACTTCATCATGTGTGCTCTTAATC
CTTCATGAAAAATACATTGACAATTGATACCCCTAGCTGCTCTCAGAGCATCCGTTGGGA
AATGGCAACTGGTCTTGACCTATTGTTGAGTAGCTGCCAACCGCACCAGAACCTGTCCTG
TTCAGGTTTCACTGGGGTCAGGGGTGTAACTGCTCCTTTGAAATTAGCTCTTCAGCTCAA
ACCATGCTTGTGGTATTGCACAAACGCATCTTCTGTGAACACTTTACAGGCATGCCTTCC
TGAATGCACGTGCACACGCGCACAGCACCCAAGCAAACGAAAACAACTTTATTTTCTCCT
AGGAAAAGAGAATGCTGTTGGAAAGGAAAACATCTTTGGAAAACAAGCTGCTACAACTCA
AACCCAGCGCTGCATATACGAAAAGGTTTGTCCCTGCCTCTCCGCAGTCCTTGATAGCTT
TGTTCTCGGCCGTGGAACATTGACCGTGGAGACACAGTGCAACCCTGGAAGGAACTGCAC
AACTATCAGTGCAGGCAGAAGGGAAAGTTCCCAGAATTCATAAATGTGTCCCTTCTCCGT
TCCCACTCCTCGGAGAATCAGAGGACAAAGTTGGGGGACGGGGGTGTTCCTGGGAACTTG
TGGGAGGGGTCGTTCTCCTCAAGAGTGAAGAACCTTCTCGGCTTTCAATGTGGTGCTCAA
GAAGTTGCTGTATGGGCCTCCATTTCCTGTGATGCTTTTGTTTTGATTTTATGTTGTTTG
GTAATTGATCTCTGCTAACGTTGGCAGTGGACAGGGTGGCTCACTAGTGGAAACCTAGTC
ATTTTGGGATGCTCCCCAGTGACTCTGCAGATAATGAAAGGCAACCTTGGTTCATTCCAA
GCAGCTACAGAATCTACAGGAGTAAGCCGGGGGTGGAGATGGATTTGTGGGCATCACCAC
AAATGGCTTTCTACCCACGGACGATCAGAACAAGTCTGTGGAGTATCATATCACCCTTCA
ATTGATGTTAGCTGAGGTTTTACCTTTTTTTTTTTTTTTTTGTCTTTTTAAGTCCAAGGT
CATCATGGTCATTGCATGTCCCGCTGTAAAGGTGAGGTGGTCACAGTCTGCCCTATTTCA
AGATCTGTCCATCAAGAGCTAGCGGTCACTAAGATCTTAGGGACTGTTAGGATGCTCAGG
ATGCACAAATGGCTCTTCTCCTTCATTTAGTCACATACGCCCCACCATGCATCTCTCAGT
GTCTTGTCTCTCCCCATTTCCTGTCCTTTCCTATTGAGTTTCTTTTTCCACCGTTCCTGG
TATGTTATGCCTTCTGTCATATTCCTGCATTTGTGTCCAATTCTGCCAAGGCCACAGAAA
TGGGTTGGCCCAGGCAAGAGTGCACACCTATGTATGGTTACACATGGGGCTGCTGACTGC
AAGGTCAACACTTGGAAACCACCTGCTGCTCCTCGGGAAAAAGACAAGGCGTTTGACTCC
TGTAAGGAATTCTAGTTTCCAAAACTCACAGGGGCAGCTCTCGCCGGGCCTATATGCTGG
CTAGTTGGCATCGACTTGGTGGCAGTGAGTTTTTGGGTTGAGAGACCCTCATAATAAGTT
ATTCCTTTCCTATCTTTCTTCCAGTAAACATGCATGTAGCCACTGAAGGTAGATTTCTAA
AACAGGTTTGTAGCACTGCATATCATTCCATAGAGAATAGAGAAAATACCATGAAAAACA
CAAGTCTTTGACATTATTTTCAAATACTCACTACTTCATTTTTTTTAAATTTTTAATTAT
TTTATTGGGGGCTCGTACAACTCTTATCACAATCCATACATCCATCCATTGTGTCAAGTA
CATATGCACATTTGTTGCCCTCATCATTCTCAAGACATTTGCCTTCTACTTTAGCCCTTA
ATATCAGTAGCTCATTTTCCCCCTCCCTCCCCATTCCCCCCTCCATCATAAACCCTTCAT
AATTCATAAATTATTATTGTTTTGTCATAAGTTACACTGTCCAACATCTCCCCTCGCCCT
CTTTCTTCTCTGCCTTGTGTCTTTTCATTTCTTAAGTGAGAGAGCCCGTCCATGCAGCAC
TACTGGCTTTCCATTGAGCAGCCATGAAGCCTCAGTTTGACTTTATCCCCACCCCCCCAC
CCCCCACCCCCACCCCGCCTTTTTTAAGGATAATGAGGGTTTTCATCCATCTCGGTGTCA
ATGGCATAAGTGTTTTAAATGCTAAATTGTTCTTTATTTTCAATTCCAGGATATATGAGC
TGCTGTTAAAAGGAATTCGCAGGAAGCTCTTAAGGGGGTTTTAGACACGGCCGAGGGAAG
TGGGTGTTTTGGCTTTTGAGAGCGGTGTCAGAGCAGCCAGGATCAAAAGGCCTTGAAGTC
AGTTTCGCTTCCCCTTTCCTCCTCCTATAACCGCTCAGTGCAGTGCTGAGGTCTGACGGG
AATTTAAGGCCATGGCTCTCTCTCTTCTTTATCCGTCTCTCTTTATTTCCCATCTTGTTT
GTGGAATATAAAAAACACAAAGAAAAACAAAGATGGAGTTGCCCAACCCTCCTCATCCAT
GCAGTGACTGTAGCCCATGAAACCGGTCCTCTGTGTGAGCTGTTTTTGTTCTTCCTCTGT
CTCCGGATTCTTTCTGTAAGCATCTCCCTCCCTCTGTACACGCCTGTCTCTGCCCCTTTC
CTTCCTCGCCAGCCCTGGTCTCCTCCGAGTCTATAAAATTTTGTGCTTTGGTGTGAAAAC
CATTTTTATTTTTATTTTTTCCCCTTTATAGTAACACTGTCATAAATGATTTCTCTTCAT
GAGCCTGACTGCCTCTGCTGAGTGCAATGTCCTTCACTGTTCTCCACTTCATGAGGCGTT
TGAGGGACTTGGAATTGTTTTGTAAGGATGTGTAATATTCTATTGTGTGTATGCAGCGGA
GTTTGCTTACCCATTCCTCTAGAGATGGGGTGTTGGGTGGTTTCCATCCTTTTGCTCTTA
TAGAAATTGCTGCAGTGAACATGGGTGTGCATGTGTCTCTCCACGTTGTGTACTTGATTT
CTTTAGGGTAAATACCAAGTAGAGAGATTGCTTTTACATTTGTTTAAGGAAACACTATAC
TGTTTGGGTTTTGCATGTGTTTAAGAAAGCACCATACTGTTTTCCATAGTGATTGTACAA
TTCTGCAATCTTACCAGCAATGTATGAATGTTCAAGTCGCTCCCCATCCTCTCTAGCATT
TATTGTGCTGTTTTTGTTTTTCACTGTGCTAAGAGTGTCAGTTTGAGGTGGTATTTCATT
GTTTTCATTTGTAGTTTTCTTATGACTAATGAATATGACTATTTCTTCAAATGATTGTTA
GCTGTCTGGATGTCATCTTTAGTAAATGGTTTATTCATATCTTGCACCCATTTTTGACTG
GGTATTTGTATTTTTCATATGAAGTAGTTGTAGAGTTCTGTGGATTTTTAAAATTAGCCC
TTTATCTAATATATCATTGTCAAATACCTTCCCCCAATCTGTAGGCCTTCCTAGTACTCT
TTTGATGAAGTCTTTCGATGTACATAAATATATTTCTGAAAGATTCCAGTCTTCTATTTT
GTCTTCTAGCACGGGTATTTTTCATTATGCTTGGTTGTATGTTTATGCCTTGTGTGAGGG
TCCTTAAGTTTGTGCCTGTATTTCATTGATAGTCTTTATGGCTGTGTTAGTCTGGGTTGA
CTAGAGAAACAAATTCTTAGACATTCATATGTGTATAAGAAAGAGCTTTATATAAAAAGA
GCAATTGTAAATTGAGAAAACATCCCAGCCCCATCCAAATCAAGTCCATACGTCCGATAT
TAGCCCATATGTCTGATACCAGTCTATAAATTCCTCTTCAGACCCAGAAACACATGCAAT
GATGCCAAATGCAGGAAGGTCATGGGCCAGTGGGTGGAAAATTCTTGTGGATCCAGTGGC
AGTGGAAGCTTCTCAGCACTGGCACAGGTCTCCATGTGGGTCCTCCTGCTCCAGGGCTCT
AGTACCATCAGGATAGCTCTATGTGGCTTGTCAGCAGGAAGATGAAGCCGAGAGAGTATG
TGTCCCACCTCTGGGAAGGAAGACAGGAGTTCCCAGAATCCTAAAGAGAAGACCATACCC
ATACAGAGGCATTATTGGCTATGAGCTAATTGACAGGCTAGACTCTACCCCTTTGCAAAT
TGACAGAAGATTATGTAACTTCCACAGTGGCTCTAGTGTTTATATTTAGTTTGTGTTTGT
ACATGGTATGAGGTATAGGCCTGTTTCCTTCTTTTGCAGGTGGAGGGCCGATTCTGCCAG
CACCAGGAAATGACTGTCTCTCCCCAATTCAACCTGTTGTTTTCATCCTTTATCGGGCTA
TGCAGTCTTCATAGATTTGAGGTCCCACATATATCTATATTACTTATTAACTTTTTCTAA
GAGATATGTGGAGATATTCTCTTTTCTAAGTGGCAAGACAATAAAATTACTTATGTGAGA
CTTTTGGTTAAAGCAATGGAGTTTTGACCAAGTGACTCTAAGTAAAGGGGTTTTGGGTAG
CTTAAGATTGGAGAGATGGGCCATCAAGAAGATGACAATAATAGGGATACAGAAAAGTCA
TCTCTTACCAACTACATTTTGATACCAAGCTACTTTGTCCTCTCCTTTGCTTGCACATAT
TTGTGCAGTGTAACTCTTCTCTTGGCCTTTTATCTGCATGGATTATTCTTTAAAAATTTT
TCTTATTCTTATGTCACCAATCAGCTTATAGTCTGTATTTTCCTTTCAAATTCCAGAGGA
ATAACCCTGATTAGCTTAGTACCATTTCGTGTATTGAGGATGCTGATGATATTGGCCAAA
CCCTACATTTTCAGTCAACCAATGGCCTTTGGCAGGTACCCTTCCCATTCCCATGTAGGC
CTCCCATTATTCAAAGAATAGCCTACAGCAGGCTCCTTGAACGGGTCTATGGATGATGTC
GTTTCATTTAGGCTTAGAAAGTGATTATGACATATATCCTTCCATCTTCTTTTTCTAATT
TTCCTGGGTTTCATTCTTCTATTTTGATAAAAAGGCTCACTATATTGTAATAAGGCATTG
CTATGATTAAAAATAATCTCAGAGAATAATCAGTATACATCTTTATGACTCAGAAGAACA
ATGCAGTCTTTCTTTGCATGTTGAAATGCACTCCTTAAATATATTATGCTAAACCTCTTA
ATTATTTTCAATAATAATTAAAAGATTCTCCTGAAGACCCTTTTTTCTCTTTCTTTTCTT
AAAGAAAGGTTGACTCCATACTTTGTTATCATGACTTCTCTTGTGATTCACAATGTCTGT
GTGACAAAAACCAACACGCTCTTTGGGAGTTCCATTTTCCCCAATATACTGCTGAGGTTT
GAAAAAAGGTTTCCAAGGTGAACTCATAATGGGAACTTTGTTAGGCAGCATTCTCTAGAG
AGATAAAACCAAACTTCTGATAATTTAATATATTTATAAGAATAATTAGATATATAATAA
GAAATAAACAGTTAAATTATAAAGCACTACAAATGGCTCAGGGCAACTCACGTCCGTGAG
AAAGAGTTGTGAGAGACTAGCAGTCCCTTCAAGTCTAGTCTGCTGCCCAGATCTTCCTCT
ATTTGTAGAGAGAGCTAGGATATGTCAGCACAGCAGCCAATCACAAGCCAGGTCACCAAC
TGCCAGTCCCCAGCTCCAGAGATGTCTTAAAGGGACCTCAACTTACAGCGACACAGTCCA
CAGGCTAGGCATCCCACAGGTAGTGTAGCCTTTAAATTGAGGCACAGAACAAGCAAGGCA
GCCACACACTGGTCCGATGATCACAGAGTGAGAGACAAGAAAGGCGAGGCTCACCAAGCC
ATTTATCTCTCTGCCCTTCAGTTCATCCCACTTGTATTTATCAGCCAGGCTGGCACAATA
AACTATCTCAGGAACGCTGACTAATTTTTTAGCTGCAGCCTTGTAGTAAACACAGGGACT
ATACCACAGCCCCCTTTGTAAAAAGATAGCATGATAGCAAAGAACAATTCAATTAACAGC
GAGGAGCAGAGGGAAGTATTGTAAGATTCAACTATTTTGATTGTGTCAATGATTCCGAAG
ATAGATCGAAGAGCCTCTTGAAGCTGGATACAGAGACAGTTCTCCATGAACTCAGTCTCT
TTTGATCACACTGGCCATAGACATTGGGCAGCAGAGAGAGATTGAGGGTGTGCTTCTTGC
GCAGAGGCTAGTCTACCATCGTCCTATATTGCTAAGGCAAAGCCAGTGGTTTTCTCAGTT
TTGAAAGTTAAGGGTAGAATTAAATATCCTTTCTTGAATGCTAAGAATTCTAGCACAAGT
ATTAAGGGAGTTGAAGATTTTTTCACTCTTTTTTTCAGTTGTGAATTGAGTGAGGATCTA
TGGGGCGGTCTCAAAATTCTCTCCTTTTTGTTAGAGGCATGTGTGTCTGTGTGTGTGTGT
GTGTGTGTGTGCACGCACTAACATTGACATTTCCTGGCTGCCAGCTCCTTCCTCTCTCAG
TCTAGGGCATATGAGCCAAAAATAAACCTAGGAACACATCATTGACTTGCTTATTCCTGC
CATTCTAGGATCTGAGCCTGTCTGCCTTTTTTCTCTATCAATGAGTGTCTTGTTCTGTTT
GCTTCTATGAAATGCTTATACTTTGCTGAAAGAATTGGGAAAAGTACATCAATCCCATCT
TCCTGCAAGCAGAATTCCTTCAATTATCTTTCAATGTCACCATTTACGTTATTGTGCCAG
CAGAGAAAATACTGTTCCCAAAGTAGATTGGGGTGTTGCGAGGCAGAACAGGAATCCTAG
AGGATACCGCATGTTTCTTCAAAGGGCGGTGAGCTCTTTTTCTGTACTTGCCTCTTTGGG
TTATGTTTGCGTCCTTTCCGCATGCTTTATGCTCCTGTTCTCTTTTGTTTCCTCTTAGTC
AGACGGACTGCTTTCACTAAATTGTAAGAACTAAAACTTCAAGGATGCTCAAGAAGCCGG
GCATCTGGATAGAGCCTCACATTTTAAAGTCTTGACAGATGACTAGATTTCATATTTTGT
AAGAACCATCCCAATACTCAGCCTGCACAGTGTGCATTCTTTATGTATTTTTTGGCTAGT
CAGTGGTACGTCTGCCTCTGCCAAGTATCCTGAATGCCATTCATTATGTTCCAGAGAAGT
CCTGGGCTGAATCCCTGAGCAGGTCACCACTGCCCTTTCCACCTTTCCTTCCTCCCGGGA
GCAGTTTTGACTTTTAGAACCAGTGGTTGGGCAGACTGTTGCTTGGCCGCTGTGATGTTA
TGATCCTTCCTGTCCTCAACGTATCTGTTCGGAGGCTCCCCACCTTCTCCATCCTTTCTC
TGTGTCTCAGCTCTCCTGTCCTCTGAGGCAGGAGCCCTGGTGAGGCTGTGGGGATTAAGG
GTGAGACTCTTAATCACTAGGTAAGAGATTCAAACCCACTAGCCCCTCACGTGGGAGAAT
GGTGAGGCTTTCCACTCCTGTGCACATTTACAGTGTTGGAAACTCAGTGGAGTTCCACTC
TGCCTTCTAGAGTGGCTATGAAGTTGATGGCAGTGGGTGGTTTGGAATCCTTAGAGGAGA
ACTCTTCCTCTTCTAAGAGTTCCAAGCCCCGCCCCTTGATTCTCAGCACCCACCCCCTCC
GAGGGGGCTGAAGCAGGGCCCTAAGTTGGGAAGGGTCTGGCTGCACACAGTCAGAAGGTA
CTGGGTAACTCGCTAGTAATTTTTTTTTTTTTACCCCCTCTGTACTCCTAGTTGCCAGGA
TCTTCAAATGGAGATTGCCACTCTGCAGGAGCAGATCTCCCATCTGCAGTCTGTGATTCA
CTCCCAACATCAGACCCTGCGCGGTGTCATCCAGGAGGTCAGACTAATCAAGTCTCTTTC
TCTAGTAGATGGGATGTTTACACTGTGAAGACCAAGTACAAGTGGCTTGTCTGGACTTCA
GAAGTAATGAGATTGTCCTCCCCCCTGCTGACATAACCTTTTTGTTCCACCTGCAACATG
GCTGTTTTCAATGCCCTCTCTTATCGAAATGCCAGCACCTGGAAGGTTCTCAATGAAGCT
AGTTTATGAAATTGGGTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
CTTATTTTTAAGTGTTGTGAACTAGAGATTGCATGCTATTCTTTAGCAGATCTTGTAGAG
CAGGGACTTGGCTCTTTCAGAAGGGAAAGAAGGTTTCCATAACTTCATAAACAGTAAATT
TATTTAGAAGATGGTTTGGGCCACGCAGCGAAGCCTGGCTTTACTCAGGGGGACATATTG
GCAGGTGATAAAGAAGAGGAAACTGTGGTAGCAGCCAGCCAGATGATAGACCATATGAAT
ATTTAAGATCTACTTTATGCTATATATTGATCTGGCTTTGAAGATCTGATTTAGATTTAA
AATAAAATCTCCATTCTATTTTTTTTTTTTTGCAACCTAAAGTTTGTTTCCAAGTGGAAG
CTTCAGACATAATTCTAATCCATTCTGGATGTGAATGCAGTTTCAGAACTCCTTGGCTAT
GTTCTCATCAAAGGGCCAAAGAACTGAGCCACAGGATTTGAGAGCCAGAAGGGACCTTGG
TGCCATCTCACACTCACATTTTACACATGAGAAAGCTAAGACCCAGAGTGTTTCAACGAT
AGAGCTGGATGGTGGCCGACCTGGCCTCGGAATACATGGATCGCCACTTTACCTGGCCCA
CTCTGGTCATCATCCCTCTACCTCCCGACTTGACTTTCTCTTGGCAGATGTGTTGCTTCC
AAAGAAAGCAGGCTTTCATTGCTGTGCCTCTGGTGGGCCAATGGCTCCAGGAAGCCTCCC
TAGGCCAGGCCCTGGCTTTCCAGCACATCCACTAGCAGTTTCAGCGGCAAGATGAAAATG
TGATGTGACTGAGAAACAGAAGGATTAAAGTGCTGCTCTCCACAGGGTACCCTCCTCCTG
AATTTGGTTTCAGTAGACTCTCCCAAGAGCCAAATAGATAACAGAGTTGTCTGCATGCTC
CTGTCCCCAGGTGTCAATCTGGGCTTGCTATTTTCTGGAGCCTCCTGAGTGTGCTAAAGC
ATTGGGCTTTCCACTCTCTCCTTTAACGTATTGTTTTTCCTCAGATGCAGGCACACCTGT
TGCCTGACGTGATTTCTTCAATTGTGTCTCCTAATTCGTAGATGGAAGGGTTGAAAAAAA
GTGTAAAAGAACAAGATAAAAGAATTGAAAATCTGAAGGAAAAAATTAAAATTCTTGAAG
CTCAGGTGAGGAAAATACTGGCTGTACATATCACCGTGAGTGTATATGCATGAGCGCATG
TGTGAATGTGCCCTCTGCGTGTTTGCAAATGTGTATGAGTGTGTATACGAATGCCTTTGT
GTGTGTGAATGTGTTAAGGTGTTTGCAAAAGTATGTGGAAACGTGTTTGTATGAGTGTAT
GTTTTTACAAACGTGTGAATGTTTCACAGTGTCTTTTTGAGGGTGTGTGTGGGAATGTGT
CCGTGGGATACTATTCCCATCCTATCAGTTTTTCACCTCACCCTGTGTGGGGCCAACTTG
GACCACTTTAACTCCATCCTTCTTTTTTAACTTTTTAACTTTTATGATGTTCAGATATCT
TTTGGCTATCATCAGGAAATGTCTGCCTAACAAATTGCAAAATAATTTGTTTCTTTCTAC
TTCTGCTTATCTTTCAGCTTCTTTTTAAAAATCACTTTATTGGAGGCTCATACTGCTTTT
CTCACAATCCATGCATCCATCCACTGTGTCAAACACATTTGTACAAATGTTGCCATCATC
GTTTTCCAAACATTTTCTTTCTACTTTCTTTCCCCATCTTCATTTATGATTTCTGCTGTG
TATCTCTTATCTCGTGCATTTCTGTCCTCTGCCCACATGGGAGTACATCTTTAGAAATCA
CCCCATTTTATAGACTTAGAAAACTATTCTACTTTCTATAATCACCATCCTCCTTAACAA
TTTATGCTACTCTCAAGAGTGTGTTGAGAGAAGAGGGAGTGTGCATGAATTAGATACTTT
TCCAAAACCCTGTCGATAAATTATCCTCAGAGAAAGCTGTCATCATGGCAGATATATTCT
GGCCAGTGATTTGTACTATTGTAGACTAACACTTAAATCGACTTCTTGCGTTAAGTTATT
AAAATAACACTAATACCTTCCTGACATAATGAAGCTTTTGTGTTCGCTTGAACTAGCTGT
TCTAGTTGTAGGAAAATTTAAATCAGTCCTGAAGCAAGGATGCTATGGTGTGTTGTTGAG
CCTTAATGGTGCCAGGTGACAGAGTAGAATGGTCTCACTGGCTTTTCTAGGCATTTCTCT
GTCAGGAGGACAATCGCCAGGGCTTTTCTCCCTGGAGCAGTTGGTGAGCTTGAACTACCT
ACCTGTGAGCTCCTAGGGACCCTATAGGATGGACTAGAATGACTCCTGTGGGTTTCTGAG
ATTATAACTCTTCAGGGAAGCAGAAAGCCTCATCTTTCTCAACGGGTAGCAATGAGTCCG
CCTCGATTGATGGCAGTTAGAGTGAACCTTTGGTCAGCTATTGAGTGCCTATCCATCGTA
AATCAGGGCTCCTTAAATCAAGAATAAAGACCCAGATTTGATCAAGGAACTACAGTGATC
ATCCAAGTCCAAATAAGTGAAATAGTCTGACGTGATAACACTTAAATGCTTTTGGATCAT
TTGGTACTTGACAACTCAATGAGCTAAGGTTTGTTTTTTTGGGGGGAAATGTATACAGAT
ACTAGGTTATTATCCAACCAGAGAATATGTGTAGTTCAACATTAGCTGTCTCCTAACAGC
GTGTTGAAAATTAAAACCTAATCTTGAAAGTGGCATAGAGGGAATTTTCCGCAATTACAG
ACTTAGCCTATTTTATGTGACTGCCGATTGTTTGAGGGTCTACCACATTCATCTTTATTA
TCCCAAGGATGTATTTACTACCAATTTACCAATTTTGAGAAGCTCCTTTTGGTTGGATTT
AGCTGCCTCAAATGGCTCTTGAAATATCACAGTGAAATGATTAATGTGCCCTAAGATATT
GGCTTTGTTTTTAGTTATTACTCGATATGAATGTGTTCAAAGACATCAAGGGCTAAGACG
AGACACAACCCCCTTCGTGGCTCTGCTCGCCTTCCCCTAGAGGTTCTGCTTCACAGGCAC
CCTCACAATCATCTGGGGGTACGGTCTTGGTTTTGTTCGTGAAAGAGTTTTATTGGCGCA
CATTTCAACTATACAATTCAATTGTTCTATTGTATTAAAGAGAGTCGCGCAATCATCTCC
ACAATCGATTTAGAATATTTGCTTCTTTCTTGTACTCAGTATCATCAGATCTCCACCTCC
CCGCAACCTCTCCCACTATCACCCCCAAGAGTGGGTTTTGAAAGCTCTGGTGCCCAAACT
ACAACCGACTGACGCAGAATCTCTGGGGATGAGACTTGGCATCAGGAGACTCTAAAGCAA
TAGAGGCAATTGGAAGGCACCCAAAGACTGAAAGCCACTGCCTTGGTTCTCCAATTTGAG
TAGGCATCGGAGTGATCTGGTGAACTTGTTAAAACAGCATCCACTGGACCTTTTGCGTTT
CTGACTCAGTAGGTCTGCATTTGGGACTAAACCTTTGCATGTGTTCAAGTCTCAGCTGAT
GCTTATGCTGCTGGTTCCAAATGATGCTGATGTCGAGGCAGCTGGCCCTGGAATCACACT
TCAAGGACCCTCAGTGCAGGTCTGCTTTTCCCCTTCTTTCCCAGCCAGTCCATTTCACCT
TCTCGTCAAGGTCCCCTGTAAATGTGTATCTCCATGAAACGGCCCAAATTATGCCAGCCA
CACAGATTTCTGTGTGTACCTGTTATCTGGTTATTCATTACTCACTGCCTTAAGCATGAT
TGCGTGAGATAAACCTGCGCCACAAGACTTCCTTAGAGGGCTGAGGAACAAGGAGGTCAC
AGAGGATGAAAGTGCACCTGACCAAAGTCAGGGTCTTTCCAAAGGCCTCACATGCACCTG
AGAGTTAGACAATGAATAAAAAAGACAGCAGAAGAACCCATGCATTTGAATTACGGTGCT
GGCAATGAATATTGAAATTATTGTGGACTGCTGGAAGAAGAAACAAATCAATCCATCTTG
GAAGAAGTATGGCCAGAATGTGCATTAGCGGCCAGGGTGGTGAGATTTTGTCTCACGTAC
TTTGGACACATTATCAGTAGGGACCAGTCCCTGGAAAAGGACATCATGCTTGATATCATC
AAAAAAAAAAAAAAGGAAGGCTGTCAAGGAGATGGATTGACCCAGTATCTGCAACAATGA
ACTTCAACATAATGACAATTTTGGAGTCACCCCAGACCAGACAGTGTTTCCTGCTGTTAT
CCATTGGGTTGCTGTGACTTGTCACCGATTTGACAGTGCTTAACAACAACCTTATTTGCC
TCTTGAATTGCTTATACTTATTTTTAATGTTCATATTTTGTTTTAGCACCTTTACTCTAT
TGTGCAGCCTGTACTCTGAAAGAGAAGATGCATCTTGTTCAACTTCACCTCCCCTCTGCC
CGGCTCTGTGCTGGGGACAAACAGGAAGTCAATTCAAGTGGGGCTGGAGAGTTGTATAGA
CAGGTTAATGATTACAGTTTCCTGAATTTGCTTCCTTCTGTTCCTTATTTCATTCCTGGG
ATCCCTTCAAGATGCATTGGGCTTTGATCCACATGTGGGTTATGCATTGGGCTTCGATCC
GCATGATAAGCAGTTCGAAACCACCAGCAGCTCCCTGAGAGAAAGACTGGGCTTTCTACT
GCTGTCAAACGGTTCCAGTCTCAGAAGTCTACAAGAGTCGCTAGGAGTTAGCATTGACTC
GGTTGCAGTGAGATTTTGGTTTTGGATCCCTTCCTTCAGCTATCACCGAGTCTATCACCC
GGAGCCTCAAAGCTTTCTTATTTGTACAAGAGATGGTTATTGTTAAGTGCCACTGGTTCC
TTTAGACTCACAGCTATTTCTTGTAACAGTGGGTTTTAGATTGTCACTGTTACAGGAGCA
GAGAGCCAGATCTTTTCCCCCATGGAGCCACGAGAGGTATTCAAACTACCAACCTTTCTG
TTAGTAGCTGAGTGCTTGATCTCTGTGCCACCGGGGCTCCCTGGAACAAGAGCAGGCTGG
ACTGACATCGTACAGAGAAAATACATTGACCTTGGAATCAGGTTCATAAAAAACCCACAT
GTTGGCATCTGCATGTGCATTTATTACCTGGAGGTAATCAGAGGTTGGTCTATTAGAGTG
TCACCTGCCTTTTCTTCTTTGAAATGTGCATAGCAATAGAAGTTACATAAATTGCTTCTC
TATCAGAGGAGAGATTGCCCATAAAGAGCCTGTCAAAAGGCTGCACTCCAAAGTATTAAC
TTCCTCACCTTCCATCAGCATGTCACAACACCTCTTTCTGCACGCCATCCAGTGCAGTGT
TACTTTCTCCAAACCAGCAGGTAGAGTCATAGAAAATTAGATGGGTTTCTATGTCTGTAG
TTGCTAAAAAGAGAACAGAGATGGTGAATTGCTGCTCTCTGAGAGCCGGAGGCTCACCTG
TGGTCCTTGTTCTGCAGCTAGTTCTTCATAGGCGTACCCATTAAGGAGCTCTGGCAACTC
AACCTTGGGCTTAGTCCTTTCCAGATGTGGCAAATGAACATCTTTGTTGTATGAGACTCA
AAGTCTCTGCCATGAACAAGATGTTGAGTACTGAGCATCTCTGGGACTTCCTATGGCTTT
GAGTATACAAATAGTATGAGGTGGCTTCAGAAGGCTGATGGGAGGGAAATGGAATTGAGA
TATAATGGACTTTTTTCCATGAACGTTTTGAAGCACCATTGTATCTGCATCAGAAAAATC
ATTGAAAGCTGCCTTTAAGACTTAGAATTTGTCCCAGGTGTTAAACTGGATGCTTTATCT
CAAGACCTATGAAGTAGGCACTATTCTTATATCCATTACACAGCTGGCAAGATATAATCC
CAGCGATGTTAAGTTACCTAAATGGGGTCACACAGCTAGTAAATAGATAGGCCAGAATCC
ATGCTTAAGAACTCAGACAATAATGTTTCATAATTTCAGCCATTGTATTCTCATCATTTT
AAGATGGCTTCTAGATCTACACTATTTTGAGTTTATGATATTTTATTTGTTCCTTCCAGG
AACATATACAAGATTGGCAGGGTGGATTATTCACCTGAAAGATAGGGATGATCAGTCACT
CTGGGGGTGCAAACATTTAAGCGCTTGGCTGTTAACCGAAAAGTGAGTGGTTCTAGCTCA
TGTGGTAACGTCAAGGGAGACAGGATGGGTGCTCTGCCTATTTCATTAAATATTACAGGT
TGAGAATCCTATGGTGCCGTTCTACTCTGTCCCCTGGGGTGGCTGTGAGTTGGACTTGAC
CTGATAGCACCCAACAACAACATAGGGATGAAGACTTTAAGTCATCGAGGGGCATGTTCA
GGCTAAAGGTCCCATGAACAACGTAGTACAAGAGAGACGGTGCTGGTACTGACAGGCAAG
AAAGAGAAACAAGTAACCAATATCATGGGTGTTATGACTAAAGTGGTTGGCAACTGTCGA
TAGAAAAGAAACTGGAAAACCAAGCATAGTTCAGCTGTTGGATTTCAGTGGTTAAATTAG
AATGCTAAACTTGAGTGCCTTAATCTCTGAACTGTATGCCTTTTAGAGTATCTGGAAAGT
CATCCTGATCTACACGGGTTCTACTTCATGACTCTCAGTAGCTGGTTTTCTGGGGTCTGA
AAGCGTGCCTGTGACATGGACCTTATCCCCCACTGGTGGTGCTGGTGATGGGCTGCAGAG
AACAGTGGTGGGTGTGGCCAGCAGTTGTACTATCTCATCTCTGAAATGATCATTTTTTCA
ATTTTAGAATAAAGAACTAAAGACCAAGGTGGCATTCTGGTCTGAGACGCCTAGGCCAAC
AGTCTCTAAGGCAGTGTCTACAGGGTAAGGTCTTCCCACACCGCCCCCCACCCCTTCTCA
TATGCCTTTACCCCCTCCATTGTATTAGTATATTTGACACGCATTCCACTTAAAAGAATT
CAATCTGCATGAGTTTGTGATTAGCCTGAAATTATTTGTAAGGAGGTGGGGATAGGATAT
CTTTCTCTATTTCTTTTATTGGAAGGATCTCTTATTCTGTGGGCAGGGGATGGTAAGTAT
ATGATAATGGCAGGCTGAGTTGAATTAATTTTGTTCCCTTTCCTGGTTAATAGATATTTT
GGATGACAGATTAGTTTTAGCTCTTCTATTCTATATTCTGTGGCTTGCCTCGTACACATA
TTGCCACATACTGTGAATGAAATTGATTTTCCTGGTGGTCAGCAGGGTTCTTGACTTGAT
TTTGATAGAGAGAGGTTTCTCATTGTCTGTTACCAATCATCCTTAAGTTTGTCTAGATGT
ATGTCGTTGGCTACAAGTGAATGAACGGAACAGTATGCTGAACATTTCAAATTTTGAAAG
GACACTAAGTTTTACAGGAGGCATAGCTTCTCTCCCTTGAAATGTAATTTTTCATTTGTG
TTCTGAGTCTCATCAGCTCACAAGTCATGTATTCAGCAATTATTCAATGAGCACCCTCTA
GAGACTTATGCTGTAGTTGGTCAAAAGCAAAACAAAAACCAACTCACTACCATCGAATCC
ATTCCAACTCACAGCCACCCTCTAGGACAGAGCAGAGCTGCCCCTGTGGGTCTCCAAGAT
GATCACTTCTGATGAGAGTCTAAAGCCCCGTCTTCTCCCATGGAGTAGTGGGGGGTCTCT
TACACCCCCAGGTCTCCTGTAGTTGTACTGGGGGTGTCATGGTACATGAAACCCCTGGAG
TGCCAATGACAAAGGTCCTCAAACCTTAGTAATTATAAGAACCCTGTGCTTTTCTTACTC
TATGTCCACTTTTGTCCAGTGTCTCTTTGACAAACCTTCCTGGAGTTATCTGAATTAGAA
TGCCCCTCCCTTTCTTCCTGAGACCTCAGCTTTCTCTTGCTTCATGGGATTGAGCTTCCA
GGGCAGTACACCGGCCGTTATCTTCTTTGTTCTTTTATTCCCTAGTCAGCCTAGGCTGCT
AACCCTCATTCATGGTAGCCATTAGGTTTCAAGTCCTCAGAGCAGCCTTCCTTGCTCCTG
GGAGTATGTCCAAGTCCTTGGGTATACACTCTCATAGCTTCCACTTTTCCATAATTATGA
TTACATAATTGCCATGCAACTATTTGTTTACTGTCTCTCTCTGGAAAAAGGAAGAAGCTC
TTTGAAGATAAGAAATGTTTTCCATCAAATTCTCAAAGCCTGGCACGTCAATGCTTACTC
ATGCCACCAGGGAATACCCTTAGGACCTTATACCTTCTTCACGACCCTAGAACAGGTCCT
AGCTCACCTTTAACACTCTTGCAAACATGGCCAATCATCTTTCCATCGTCCCTGGCCTTC
TGTTGCTCAGATTATGTATTGCACTGACGGATAATTTACATCACGGATTCTTTGTAGTGA
CCTACATTTCTGTTTGTGCCTCTGAAGCCAAGGAGTCCTGGTGGCACAGCAGTTAAGCAC
ATGGCTGCCAACGCTAAGACTGCACGTTTGAGCCCACTGGTGGCTCTCGGGGAGAAAGAG
GCGGTGATCCGCCCCAACCAAGCGTCGAGCCTAGAAAATCTGATGGGGCAGCTCTGTTCT
CCCACAGGGGTCCCTTTGAGTCAGAATCGACTCAACAGCACCTAACAGCAGCCCCACATC
ATGAGGACATAAATCGCTCATTGGGTTTCTGATCATTTCCTGCACTGCTAAGGACAAACC
AAAACTAAATAATAATAAATAAAAGGTGAAGGGGGTGGTGGGGAGAACTCACTTCCATCA
ACTTGATTTCGACTCATCACAACCATATAAAACAGAGAGAACTACCCCTGTGGGTTTCCA
AGACTGTAAATCTTTACAGGAGCAGAACACCTGATAAGAACAGCATGTTTTCTTAAAACT
ACCTGATGGTGAATGCATTGAAGCAATGATAATGACCAACAAAATTGGGCGAAATGATGG
TTGAAACCATCTAAAGTCACTTAAAATCTTTTAACAAAATATGAAGTGGCAAAATGTGAA
AAAGGACCCTTGGGATCCAGTCTCATTTCCATAATACCCTATCAAATTATTGTTTAAACA
AACTTATAAATATGTGTATCATTTTTTAAATGATTTAAAACTTCCTGTTCTTAGCACATT
TGCATTCTTCCTGTCTGACCCTCCTGTGAAGCATCTCATTTTCTGCATCTCTCCAGTTTT
GAGCTACAATGGAGGATCCATCCCACCACGATCAGCAGCTCTCTAGGAATTCTGAGGGAT
TCACCACCTTCTTGAAGACTGCCTGCCTCAGTGCCTCACTTTGCTAATGATACATAGAGG
TTGACACTGGGGATGAAACCATTTGACTCGCCCAGATATTTGGGCTCCAGATACTAAGTT
GCCATCAGGCTGGCAACTAGCCTGGAAATGTCTAAAAGGAAAAAGAAACGAAACTTCAGA
AGTCTCCACGGAAGTGGTGAAGCACTTACATTTCTGAAGCAGGGAGAGAAATAGGGTCAC
TTCCAAATGAGGAGAAGTAAAGGGCCTGGGATTGACTTCCCGAGGAATTTGGGAGGCTCA
GTATTTGCTCCCTCCATCTCGATACAGCCCCCTCTGTGATGAGGGGGCCCCAGGGCCAGC
TTCTACTGCTTTGACTTTGGCCAGATGAGGTCAAAGTGAGGAAGATGAAGGGGCAACTGA
TTGTCTTGACATTGTCCCTCTTCCAGCATTGGATCCCCAGACTCTGGCTGCTAAGAGGGA
GTGTGCTAGAGAGAATGACTTTTAGGACTGGTTCTTTACATGCAACTTATTAAAAGTTAA
AAGTCTACTGGGTTTAGAGACTTTTCTTCTCCCTTTGAATCAAGAAAGCTCAAAGAGAGA
AATTTCTTCATTGGAAGTTACGAACTGAATGGACCAACCACCTGTCCTCCTTTGATTGAT
TTATTTTAGTAATATGCCAATGGTAATGATGCCAAGGTAGATCTCATTTGTAATATGAAG
TATGGCCAACGGAGTGCTTTGAGTGAATGATGGGTTGGAAACTTTGGAATCAGAGTTGCT
GGACTCTGAACAATGGAATCCTAATACTAGTGAAGAATTAAAGCAGCTGTTAAGGCAAAA
ATATATGTATATTTATGATGATAGCAAAATAGATCTATGTGCATATATTTATAGGTTTAG
GATTAAGGTAACAGATGGACATTGGGCCTCCACTCAAGTACTCCCTCAATGCAAGAACAC
TGTTCTATTAAACTGGCATTCCATGATGCTCACCTTCCCGACACGATCGCTAAAGACAAA
GTGGGTGCATAAACAAATATGGTGAAGAAAGCTGATGGTGCCCAGATATCAAAAGATGTA
GTATCTGGGTTCTTAAAGGCTTGAAGGTAAACAAGTGGCCATCTAGCTCAGAAGCAACAA
AGCCCACATGGAAGAAGCACGCCAGCCTGTGTGGTCACGAGGTGCCGAAGGGATCAGTTA
TCACGCATCAAAGAACAAAAAAATCATATCATTGAGAATAAGGGGTAGTGCGGAGTGGGG
ACCCAAAGCCCATCTGTAGGCAACTGGACAGCCCCTTACAGAAGGGTCACGGGGAGGAGA
CGACCCAGTCAAGGTGCAGTGTAGCAATGATGAAAATTACAACTTTCCACTAGTTCTTAA
ATGCTTCCTGCCCTACCCCCCCTACCCCCACTCTCATGATCCCTATTCTACCTTACAAAT
CCGGCTAGATGATAGGATGCACACTGGTACAGATAGGAACTTGAAACACAGGGAATCCAG
GACAGATGATCCCTTCAGGACCAGTGGTGAGAGTGGCGATACAGGGAGGGTGGAGGGAAG
ATGGGGTAGAAAGGGGGAACTGATCACAAGGATCTACATATAACCNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAACAGAGAGGGGTGTCTTGA
GATGAAAACTAGAACAAGTGGTTTGCTTGCCATTAGAGGTCTTGTTGTCAAGGTGTACCC
ATATATCCTCATGTAAGATATACACAATATATGACGGTCCATCCCAACTTGACCTCTCTC
ACCAGTTACTTGATGATAATCGGATCTGATATTCTGTGTACACCAGCCTGAAATCTGGGT
ATATAACTAAACCAGGATCTTTGTTTTGCAGACAGCTGGAAGGGTGATTATGGAATAAGA
TTAAACTGGAATAGTTTTTAAAAAATGCATATAAAACAAAAATGTATAACCCCACACTTA
TGTGTACAGCGCACATATATATCTCCAAACCAAACTCACTGCTACCAAGTCAATTCTGAC
TCTCAGTGGTCCTTTGAAACAAGGTAGAACTGCCATTGTGGGTTTCCAAGACTGTTTACA
GGAGTAGAAAGTCTACATTTCCTCCTAGGAACAGTTGGTGGTTTTGAACTGCTGACCTTG
AAGTTAACAGCCCAATGAGTAACCACTAGGCCACCAGAACTCCTCACACAAATATAATTG
TGTGCATCCTAATAGGCAGACCATGTGGATTGTTGGGTTCTGGCTCCGCTCCATTTCTGC
CTCAGATACTGTCTACATGGGGTGAACTGAAGCCCAGGCTCCCTTTCTTGGCTCTGTTCC
TCATCCTTGTCCTATCACAACTCACTCCCTCACTGTCATTGGGTCAATTCAAACTGCTTG
AGGGCAAAACTCACCAGAATGTGATGCAAAGGGCCCTGGTGGTGTCAAGGTAAGCACTTG
GCTAGTAACAGAAGAATCAGCAGTTCAAACTAACCCAACAGTTCTGCAAGAGAAAGCCCT
GGAGTCAGCTCCCCCAAAAGTTAGGAATCCAGAAAACTATATGGGGCAGCTCTACTCGGT
CCTACAGGGTTGCTATGAGTCGGAATCAACCTAATGACAAACAACAATAAAAACATCTCC
AACAGTGATGTGGTGCTATTTATCTCACACAGAATTGGTCAGAATGAATCAATTAGGTGC
CAACACTGAGACACAAACTACAGGTTGAGGTTGGGATGGATGATGGTAGTAGAAATGGCA
ATGGCAATAGAGCAGTCATTATATCACCCGAGCTTAATTGCTTGATTTTAATAACTGTGT
TATCTTTATTACAGAGAACTGAGGACTGAAGGCACCACCCCTTATTTGATGCTGANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1117, 2479..2516, 2519..2567, 4591..4725, 7829..7954, 8055..8183, 14882..14964, 22311..22416, 23801..23884, 29527..29603, 35054..35093
1001..1117, 2479..2516, 2519..2567, 4591..4725, 7829..7954, 8055..8183, 14882..14964, 22311..22416, 23801..23884, 29527..29603, 35054..35093
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved