Echinops_telfairi Locus SP3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SP3
Echinops_telfairi
SP3
GeneScaffold_6959
SNORA9
8827..8961
20344
GCTTTCTGCTTTCATTGGTATTTTCCCAACTGATTTAAACTATAAAATAACGAATGATA
CCTAAGATTCTAGCAGGCTATGCCTATGCTTGGCATTCAGCGGCAGTTGTAGGTAAAGCT
ACCATCTGTAGTCCCCAGCTGTCAATTTCTAGAAACATTTCAGATGGGGCTACTTAGTCC
TATGGTCACAGAGCAAAAAACTTCATTAAATTGGCGTCTTTTTTTTTTCCCCTAGTAGTT
CATGGCAAAAGTGAAGAACAATGATTCTTTCTAGAATAACCCTAGCCATGGGTTTACCCT
ATATATAGTATCTTAACATAGCCATAGAAGGGTAACTTTAACAATTTGTATTGTATAACA
ATAATATATTATTTTTCTAACGTGGAGGATCTATATACAAGTAATGTTCCTTTTCATAAC
TGTAAAGTACCTGATGAAGTGATACATTTTTAGGGGACTGGGTTGGGTGGACTCCTGGAG
GGTTTAATTGGTGAATTGAACTATTGAATGAAAAGTTGATGATCTGAAATACAAACTCCC
ACCTAAGTTACAATAAAAATTGATTGAATTTTTTTTCAATTAAAAAGTGAGATATTTTTA
GAGGTTTGTATGCTTATTGAGCTCTCCAGTAGTTGGAGTTTGTTGGTTTGAATTGTCCGT
ACTCTTCTCTAGTCATCTTCTCCGTTTTTTCTTTTAACTTTGTACCGTTAGTGATCACAA
ATCAAGAATTAGAAGATCAGTTTGTGGTTATAGAACAAAGAATGTTCTCAATCCAAATAG
GATTTTGATAGATTATCTTTTGTAGTGACTAACAAAATTGGAGGTGATAATTTTTGTCAC
TTTGAGCTCTACTTTATTCATTTATTTGTTAAACACTACTACTTTATTTGAGCTCTATTA
TGTTGTTAAGATAATTTGTATTTTCAGGTATAGCCGGGTTTTAGAAGCCTTTTAAGGATT
GATTTAAATATACCACATAATGTTATTTTTTGTTTCTTCAGACAGGTGATTTGACTTCTA
CACCATTAGGAGGAACACCAAACCGATGGGAGGTTTTGTCAGCCACACCTACAACTATAA
AAGATGAAGCTGGTAATCTAGTACAGATTCCAAATGCTACTACTTCGAGTGGGCAGTATG
TCCTCCCCCTTCAGAATTTGCAGAATCAACAAATATTTTCAGTTGCACCTGGATCAGAGT
CATCAAATGGTACAGTGCCCAGTGTCCAGTATCAAGTAATACCGCAGATTCAGTCCACAG
ATGGTCAGCAAGTTCAGATCGGCTTCACAGGCTCTTCAGATAATGGGGGTATAAATCAAG
AAAGCGGTCAAATCCAGATCATTCCTGGCTCTAATCAAACTTTACTTGCCTCTGGAACAC
CTCCTGGTAATATCCAGGATCTCATACCACAGACTGGTCAGGTCCAGGTTCAGGGAGTTG
CAATTGGTGGTTCATCGTTTCCTGGCCAAACCCAAGTAGTTGCTAATGTGCCTCTTGGTC
TGCCAGGAAATATTACCTTTGTACCAATCAATAGTGTCGATCTAGATTCTTTGGGACTCT
CTGGCAGTTCTCAGACAATGACTGCAGGCATTAATGCCGATGGACATTTGATAAACACAG
GACAAGCTATGGATAGTTCAGACAATTCAGAAAGGACTGGTGAGCGGGTTTCTCCTGATA
TTAATGAGACAAATACTGATACAGATTTATTTGTGCCAACCTCCTCTTCATCACAGTTGC
CTGTTACTATAGACAGTACAGGTATATTACAACAAAACGCAAACAGCTTGACCACTTCTA
GTGGGCAAGTGCATTCTTCAGATCTTCAGGGAAATTATATCCAGTCGCCTGTTTCTGAAG
AGACACAGGCCCAGAATATTCAGGTTTCTACAGCACAGCCTATTGTACAACATCTACAAC
TTCAAGAGTCTCAGCAGCCAACCAGTCAAGCCCAAATTGTGCAAGGTATTACACCACAGA
CAATCCATGGTGTGCAAGCCAGTGGTCAAAATATATCACAACAAGCTTTGCAAAATCTTC
AATTGCAGCTGAATCCAGGAACCTTTTTAATTCAGGCACAGACAGTGACCCCTTCTGGAC
AGATAACCTGGCAAACATTTCAAGTACAGGGGGTGCAGAATTTACAGAATCTGCAAATAC
AGAACACCGCTGCCCAACAAATAACTTTGACACCTGTTCAGACGCTTACACTTGGTCAAG
TTGCAGCAGGTGGAGCCTTGACTTCAACTCCAGTTAGTCTAAGCACTGGTCAGTTGCCAA
ATCTACAGACAGTTACAGTAAACTCTCTAGATTCTACTGGTATACAGCTCCATCCAGGAG
AGAATGCCGACAGTCCTGCAGGTATGTATTTTGACACATTTGTTGAAAATTATCTTTGTG
TGGGTCTTAAGTCGTGTTATGCTATATAGTAAAGCTTTTGCTTTAGGAGCTTATTGGCCC
CTGGCTTCCTTAAAAATTGATGATACATTGTTCAGTGTTTGTATGAAAGTTGCTTCATTG
AAAGTATGTAATTTCTGGAGTTGAGGACTAATTTATTATACCATTTAAACATTTGTAACT
TTCTGATTAATTTTGTTGTTTTCATATCTAATTAAGCATTCGTCAAGCATTATTCAAGTT
GTAATTGGCGATTAGGTTGCCTTGGTTAGCCTTGGTGTGATGTGGGTTAAATGTATTGTG
CATTATTTTTGTTTGGAGAATTATTGAAAACACTGGGAGTAAAGATTATTTATACTATCT
CAGTCACTAGCTAGCTATGTGATTTGGGGCTGAACGCCATTTTTTCCTTTTGTGACCTCA
GTTTCCCATCATGCAAAATGGTAACTATACCTAGGGTCTCTCCCAAACCTAAAATTCCTT
TGGATTCTTGCATAGTTTTTTTTCTTTCTTATTGGTGTGAAATGGGCATCGGCTTGGAAG
TGCTAGCAGTATTCCTATTGACAGAGTGGGTAGACATTTCAGAAGTCTAGTCTCTGAGCG
GTTTTTGCAAGCATTAATGTATGTACTTGTGTATAAGGCGAATTTTTCAGCAAATTTTTA
ATGCAGTTTTTGTGGTAAAATTAGGTGCCTCAGTTGATATTTGGGTTGGCTTATACTCGA
GTACATACGGTAAGTAATAAAGTTTGAATTGATAATGTCATTGTTACTCTGTAAGTATTG
TCTAGAGAACATTAAAAAAAAATTGGGGACTCTTACAGCTCTTACCACGATCCATACATC
CATCCATTGTGGCATGTACATTTGTACATATGTTGCCATCTTCATTTTCACATTTTCTTT
CTACTTGAGCCCGTGGCATCAGTTCATTCCCCCCACCTTCCCTTCCCTATGAGCCTTGAT
AATTTATAATTTTTTTTTCATGTCTTTACACTGACCGCTGTTTCCCTTCACCCACTTTTC
TGTTTTCCATCCCCCTGGGGGAGGGGGTTCTATGTAGATCATTGTGATTGGTCCACTCCT
TTCTCCCGAACCTTCCCCTTCCCCTCCTGGTATCGCTAGTCTCATTTTTGTTTCTGAGGG
GTTTGTCTGTCCTGGATTCCCTGTGTTTTGAGTCTCTTATCTGTATAGATAACATTTTTG
TGATTGTATTATTATATACTACAACCTGAACTTTTATTCTCATTTATATTTGGGTTTTTA
TGGAGTGTTTGCTACCTCAGCCTTTCACAGGATTAGTCAACTCTTAAGTGGGAACATTTG
AGTTTTAATTTACTAAAATAACCCCCATGATCTTTTTAAAAATTTTCCTTTTTTTGAGGA
GGAAATTTGTAAAATATGTATATCATTGGAATTAATCTGGAGTCTCAGGTCAGAAATTGC
ATGTGAGTCTTCTGAAGTTCTCATGTTGAGTAGCAGGTCTCCAAGTGTAGTTGTTGGGTC
CCTGATAATGATATTTCTGAGAAATTATTTTATCTTTTCCAGTGTGTTGACATTTGCAAT
GATGGATAAAACTATTGATGTCTTAGCATGAATCAAGGCAGTTGCACCACACTGTACCTA
GTAGTCTTGGTATTCATTATGACCATGTGTTTAATTTTAAAAATGACAATTTCACTGGAG
TGTCCTTGATATAGCAGTAAACATTAGTGATTATTTAAAAGCTTAGAGTCTGTTGTGCTA
TTGCTAGATTACTTTTGAAACAGATTTATTGGTATGTGCTTCACATGTCATACAATTGTT
CAGTCATATTAAGAATTGTGCAATGATTCATTAGTAATTCTTGACTCTTGAATACAGAAT
GTTTTTTTATTGAGATATTAGTCACATATTATAAAACTCACCCTTTAAAAATATACTGGA
ATCGAGTAATTTTTAGTACATTCTTAGAATTGTATAACCAACACATCCTATTTTGGAGCA
TTTTCATCATCCCCAAAAGCAGCTTTGTACTCAATATTAGAAAACTCTTGTCGTTTTTTT
TCTTTCAGTATTAAGAAACTAAAGAAAATATCTGTTATTTGAATGTATGAGTCTGTGTAA
CACTTAGTTTATTAGTTATTTTTCCAAATAAAGTGTTCTGTGAAAATAGCATCTAGTTGT
TCTTACAACTCACATAATTCACATACGTACACAATTGAAGGAAAGTTTTGTTTCAAAGAT
AATTTATCTTATTTCGATATGTAAAAGCACTTTATTAAGCATACTTTCACTGGCTTTTAA
ACTCTGGAATTTATAAAATGTGGCTCTAAACCATAAGCCTAACAGCGTCACAGTGCATAT
ACTTTTGATGAGATGAGTGGTGATATATTTTTGATACTGTATTCTGAAATGTTTGAAAGA
TTTGTATAACTCAGTGAACAAGGATTTTCAAATGAAACTCATTTATGTTATAAAGTTACA
CTATTTATTTTATTCAAAGTCCAATATGGACAATAACAAGAGTACGGAAAGTTTACTGGT
AGGCTTTTTAAATTCCCCATTGCAACTGACTATAAAGGAATTGTTACTTGTCAAACTTGA
TGTCATATCAAAGAAGAATATTCACAATTGATTGAAAAGGCTGTTGAGTTACTTGTCCCC
CTTTGTACTGTCAGGCTAGTTGTTAATACACTGCAACTTAAACCATGTATTTTAACAATT
TAGCTGCAGAAGCAGATGTGAGACTCCAATACTCTTTTGAGACTTGCAAAAAGTGTAAAC
CATGGTTTCACAGGTTTTTTTAAATAACTTCATAAAATGCGATGTTTACATGTAATGGAT
TTATCTTAATAAAAATTAAAATACATTTCTATCATAAATATTGGCAGTAAAGAGCCCTGT
TGATTACAAATTTTGGTACTCAAACTTTGTTAACTCCACAATCAATACTTTCATGGTCAT
CTACAGACGGGAAGAGTGACCAGAAATGTGAATCACTTGAAATGTACCTCTTGGCTCATG
GGGTGATTTTTGCTTCTTTGTTGCAGTTCGCATTCTGTAAACAAACATCCTGTTTACAGA
GTATTTAGTGCTATGCGATTTCATTTTGGGTTTTTTGTGGTTGTTTTCTTTTTAAAATGC
CCCCCACATCTACTAGTACTCTTCGTCTATTGGTTGTTCCAAGCTTACTTTAATATGCCT
TGTGGTGTAAATAACATGTATCAAATAAGCTTTGTTCAGGCACAAGTTAAAGTGTTGCTG
ACTAAAAGTTAAATGTTAATGAATCAGCATTATATATTAAGTAAGAAACATATATAAAAG
GAGTTGTATATTGGCTAAATAGCAAAAATATGGTGACTAGAGCCTACCAATATTTTGTGT
TTCAGTCTTCCTAACAGTATTGTAGAACATATTCCAGCGAAAAACAAGAATTAGCTGCTT
AACTTACGTAAACAAAGGCTTACTGAAAACATCAGTAGTACTTAAAAGTTTAAAGGAGTT
CTCTGATCAAAAATCTTGAGAACCGCTGGTAGGAATAATAGGTTTTAGCAAACCATTTTT
AGAAACCAGTTTCTTAAAGTTTGTATAAAGTTAATCGGTTATGATAGTCCATCTATGTTT
TTGAAAAAGCATTTCTCCGGAATTTATGATTTTGTGGAGACCTACAGGAAATAAGTCTTG
AAAATAAGTTGTTTTGTACTGATGGCTCCAGTAAAGTCATATACTTAAAACAACAGTATC
AAAATAGAAACACCGTGAATCAAATGCAGGGAGGAATTTTAAGTGGCGATTCAGTTACTG
AATGGTGGCCAAGAAGCATGAAAAAGTACAGGCATGCCTCAGAGATGCTGAGCGTTAACA
TGCTATGGAAACAAGTGAGCGTGTGCTGTTGGGAAGGGATGCTGGTAGACTTGCCACAGC
CTTTACTTTGCTTAAAAACCAAAAAACCAAACAGGATCGACAAAGCGCAACGAAAACAAG
GTCTGCCGACATAGGCACTCTGTGGGGTATGGATGTCCAACTCAGGGACAACCTCCTTTA
ATGCATGACTTCGAATCAGTTCTGTCAGGGCTGACAAAGCGAAACAGATTGGGGTTTTTA
CAATTTGGGTCATTTGTCCTGGTAACTGCAATGTGAAAACTTGTAATCCAAGCCCTGGGA
TGGAGACCTCAGAAGAAGCATGGTGAACTCTTTCTTCCTGGAACCGGATGCATAAGATTG
GATTATTAGCAGGACTTTGGAGAGCCACATGCATTCAAAGTGTTGTGGTCAGCTGCTCAA
GTTGCCATCTTTGAAGCCCAGAGGTAACGTGAATTTGCCTTCACTTTGAAATGATTGAAC
TGGAAGTAAAGTCTTTGTCCTAATCACTTTCATTTTGCTGCACATGCAACTTTTAAATGA
TTGAAAAGGCCTTTTCTTAAACGAAGGCTCAATAGGAACCATTTGCATTGTTCTAACAGA
CCTACAGGTCGTAAAGACACAGGAATGGAGCTTGTTTGGAACTCGGGGACTGCCTGTATT
CCAGAACCATTAAAATGTTATTTTAGCCCACTTTTAAAGACATACAGAAAGAATTTAAGA
AAGTAAAAGTTAAAGTGAGTGATAATAAAAACAGTATTGTTGATGATTTTTTTGTAATAA
AATCCAGATAATTTTCATTTGGGGCATATTTGGTACCAGGAAAAGCAACCCTTGAGGTGT
GCTGTCTTTTTAATAGGGAAGTTATTTTAGAGTATGTTTTCTGAACGTGAACATCAGTAA
ACATTTCTTTATCTGTGTTAGCCCCTAATATGCCCAGATTACAATGATTAAATGAAAGTT
TAATAGTGGCTTGCAATTTTTCTTTAGGTCAGGATGGAATTAGCATAATAATTTTCCAAA
AGTACATGAGAAAGAGGACGTTTTTTAGCAGGGTTTTGGAATTTATTTTTACCTTTATTC
TTACATTTCTTTTAACAGCATAAAGGACTCCTACTCCAACCCCTCTTTCAAGCAGTGAGT
TTAACTCTGGTGTACTTCGGAGTGCCGTTAGCCCTTAAGAGCCAAATCTCTGTCCTCCTT
GGGACAGAGCACCCACCAGGCCACACAGCTTGTATTTCTGTCCATTACCCACCAACCAGG
AAATAAATGCATGTTGCTTTAGAGAACTTTTTGTAATGTTATATTTACTTTGTCTCTTAT
TGCTATATATTTGAAGCTGGGCGGATGACACAAATGAATTTATAGTATATTTACAATGTC
TTTTACTTCTGAATCAGATCATTTCCTACTTCTTGTTCTTCATCAAAGTAAGTTTTGCCT
GCTTCAAGAAAAGCATAGGGCTATGTCTGGCCTCCCCTGGCTACACAAGGGAGAAGGAGA
ATCCACGTCCTCACCAGCTCAAGCCTGTTGACCACAAAGCAGAAGTCAGACTTGTACGTA
TATGCTCGAGTATGAGCCGAGCTGAGTATCAGCCGAGGCACTTAATTTTACCACAAAAAC
TCCATAAAAAAATGTGCTGAAAAACTCCGCTTATACACGAGTATATATGGTATTTCTACC
GTCCATCCTTTTAACCTCTTCTGACACCAACCAATCCTCCCACAACACTATTTTTCTGTT
GGGTTCAATAAGTGATTGCAGTGACCACTCAGAACTCACAGACAATACTCACAGATTGGG
GTGGGGGTGGGGGTGGATTATTAGGGAAGTTAACAGGATCAGAAGATATTAAGGGTATGT
TTTGTTCATTGGTTCACGTCAACACCTCACCTTTAGCAGCCAAGCCTTGCCTTGGTCCTC
AGCTTCCCAGCCACATGGAACCTTGACGTCTGCCTTTAGGCCAGGAAGCCAGTCTGCTCT
GCCTCACAGTCTCAGCACTGCTCCTCCTTTCAGTCCTCCTTACCTTGGCCTCTGGTCTCA
GCCTTTGCTACAGCAGACCAGAGGTCTTGAATGTGTTCCATTGGTAGCTGCTCTTCTTCC
TTGTTGGTCTTGGGATTTCTCTCTTTTCCCACTTCTGAGATGGTTCATCCTTCTAGCCAG
GGGAGTGGCAACTAAAATGGAACAGTCAAGTGCCCTCTATTAGTGTTACACGAGCCCTGG
TTGCATAATCCCACCCACTCATTTGGTGGCAGTTGTGGAGACATGGATCCCATACCAAAG
GCAATGCCATTGAGTTGATTCTGACTCATAGCAATCCTATAGGACAGGGGTAGAATTGCC
CCTGTGGGCTTCTGAGACTAACTCTTGATGAGAGTAGGCTTTGTCTTCTGTAGAGGGGCT
CGTGGTTTCCAACTGCTGACCTTTCAATTAGCAACCCAATGTATAACCACTATGCCACAG
GCTTCTTGAGACATGGATATTAAGAAATTTTACTCCACTATTCCTGCTTAAAAAGTATTA
AAAGACTTTGTGTCACTTTTTAAAAAATATACTGCACAAAGGAGGGGAATTAGGAAAATT
CATGGAATTGCAAGCCTCCAGCATGCCTGGGTTTGGAGTAACCCTGTGCATTCCTACAGT
GCTTGCAAGAGCAGCTCTGAAAGGGTTTGAGGCCTTGCTCTACAATGTCTGCAGAGCGAG
GTTATAGAAATTTCAGACATTCAGGAACAAAATTAAAAGTCAAGAAAAAATGCTATTACA
AAACACATTTTAAAAAGTTATGGGAAAATCTCATTTTCAGTTCCATTTTTCCAAGAACCG
TTTGAAGCCCTGTATATAGGGTAAAAAATGTTTTTATTTGCTGAATTAGGTTGAAAATAT
GGCATCTTATTATTTAGGTCTGGAGTTACATCCTATTTAACTATCTTAGTATCAGTAAAA
GTACCTACATGAGGAGAGACCCAGCACACCTACTGCTTAAGACCAGAGGATGGAGGAGAG
GTCCTTTTTAAGTTGTGTTGAAAGAAGAAAAGTTACTGTTGTCTGTTAGCCAAAGTATAT
CTTAAATGAAATTGTATATTGACACAGATGTGAAGTGGACACTGAGAAGTAGGGGCACAT
CAACATAGGCTAACACCACTCTACCACCTGGTTCTTTATTGAGTCCGGGAGGCTTGGTAG
AGGCATTTGAAAAACTTAGATATGGCGGTGTGACTAGAGAGAGAGAAATCGTATTCAAGA
TGAGCCTGTAAACAAAATTTCTAAAATATATGAAGAAAGCAAAATTTGTTCGAGATAGCC
AGTGAAACCACAATTAGAAAAATTCACATCATAATAAAGAAAAGTAATGGGAAAACTTGT
TAAAATTTAAAATCTACATATAATTGTCAGTGAGATAAAGGGAGTAGATGTTATAAAACA
AGAAAAGGAAGATAATGAAAATAGAATTTGCGATTGCTTCTAAGACATTGTGTAGCACTA
TATTTCTGAAATAGGTTTATTTACAGTGCATGCTCATGTTTAATTGGTGCAATGTCTGCT
TTTTGTTTTTATATATTTTGTTGAGAATGTACCCAGCAAAACATTCCAACAGTTTTTTTG
AATCGGCATTTTATATAAATTTGCTAACTATTTAAAGTGACAAAATGATAGTACAATATG
TACTATATTATGTGTACTTTCAATAGTACAAAGTGTGGACATACTAGTTTTTTCCCCTAA
GGGGTTATGCATTCTACAAAATGTAACACTTGATTCCAGTCCATGTATTGGACAAATAGG
GTCACTTAGCTCTCATTGTGTAAGGTGTCTTTTAAGAGTGGCTATACTTCCCTTTTTTGC
TCTTTAGTTTCTCAAATTACATGCTTTTAAAACAAAACCCCCAAACATTTTCTAACTTAA
CTGTTCCCTTGAGCAAAGCAAAGCACTTCAGAATGGACAGGTGTGTGGTCTCCTGAGTTG
GTGGCTTGTTTCGCACTTTCTTTTACAGGTACAGTTTACTGACACTGAATATATTCTTTG
AGTTGAGCAACCATTCTCACCCTCAGTTTGTAGTTCCTCCTTCATTGGCTCACTGCCCTT
AGGGTTCCTATCTAAACATCTTTAGTTTGTTGTCAGTTTGATCTCAGCTAGATGGTGTTT
TTTTTAAAACCATAATGATTAAGACAGATCTTTTTTGTTCTTAGTAAAATTATTGTTCAG
TTTTAAGACTTTAGGAGATATTTTTGGTTTAAGGTTTAATAATTATTCCAGAGGGTCATC
CAACCTCCGTAGCTCCAGAAAATCTGGAGAGTATGAAAATGTAGAATTTTGCTCTGCATT
TCCACCCTTTTGATCAGGATTCCTCTATAAGATTCTGTGATCAGAGTGTTTGTTAAAGGT
AGCTGGGTACGCCCCCCACCCCCTTCTTCTCATCTCATGGTAAAGGAGACATTTGGTCAT
AGGAATTCACCACACATTCAGTGTCATCCGCCTATTTGTGATTCAGCTTTCTTACTCTCT
TGCCTCCGGGAAAGAGAGGTCAATTTATTGTGCCCTGGATAACTACTTGCAAGCTTGTAA
GACCCCAGGCACTATGCAGTGAGATAGAGGTGGAAAGGAAGCATGAAACACGTGAGGCCA
ATTAAAGGATGCTCTGTAAAACCAAGGAGGTTTGCAGCCTCAGCAGCCACTTTTGGGTGG
GTCAGTTCAACTTTTCACAGGTATAGAACTTATTGATAGCTATATAATAATAGACTGTGC
AACTCAACCCGTTATGTTTGTGGTCTTTAAATTTTTTTTTTTTTTATCTTTTTCTTTGTG
ATTTTTTTTTAATTAAAAACTGATAGTGGTATATCGTTTCAGTATTCTGTTAGATTGAAT
AAAATTTAAAAAATTTAAGTGTTAGGAAAAAGTAAACTTTAGGCTGAACCATAGAAAAAG
AAGATTTGTGAATAATATAACAGAATAGAGCACAGTTAAAGACATGTGGAATATAGGTTG
AGAACCATCAACCATAGTGATTTTAGAAAAATAGAGTGATTGGCAGAGAAATGACATGTA
ATGAAATAATAGCCAAGAATTTTTTTTGTGGTGAAGAAATAGTACATAGACCAAAATTTT
ACTTCAAATATCAAACAAAATAAAATTGAAGTTCGTTCTGACTTAAAATGAAATTAAGAG
ATAATCTTAAATGTTCCCACTGAGAGAAGACAAATTAAGAAATAAAAGACCTGAAGTTCT
CAGTAGCCACATGACACCGAAAAATAGTAAGGGTGGTATCTTCAAAATGTTATGAGAAAA
AAAACAAAGCCCAGCAATGTAGAATCTTTTATCTTACCAAACTGCTATTAAAAAGTTAGG
GATCAATGATATTTAAAGTATATAAAGATTGGGAGTTTATTCAGGAACCTTTACTGAAAT
AGCTGGAGAATCGAGTAGATAAGTGCAAAAGTAGATTCAGAATAAATGAGTGGTGAGGTA
ATAGTGATCACGAAAATGGACAGAAAGTTGATATTTTAGTTGTAAATTTAGGTTAAAAAA
TTTGGATTTGGATTATAGAATTTGTTTGGATTATAGAATGATATGTATTAACTCCCAATA
AATAATGCATTTAAAAAAAACAATTTTAAAAATACATGAAAATGGTTCATGAAAAAGACA
TGGTGCCTTCATGTAGCCCATTCCTACCTTGAAGAGTTGATCATTTTTGCTTCCCTTATT
TTCATCACTTAGAAATGTATTTTTGTTTAGAGTAACTTAAAGTAAACTTTACATTACGTA
ACTTTAACCAGAAATACCAGTTGAGTGAGTCTTGAAGGTCTATAAGCTTGAAATTGTTTT
TATAACATTAAGAAGGAGGAATTTGCTTATTTCATTTTCATCTCACAGATAATATATAGT
GGTATTTTCTGGAGCCTATATGATTTTTAATAGTAAGTTGTAGAAACAGACGGAAAATCC
AGCTGTTTTTTAATACACCGGATATAGAGATTTGTAAAACTGTCATTTTCTCACTTATTT
GAAAATAATTGTTTTGCAAAGGGATGCTAATGTTCACATGTAAGTTTACTGTTATTTTCA
AATTTCCCAGTTTTTATTTCTAATGTGACATCAGTAGGTATACATACAGAAGCACAGAGT
CCTCAATTTTATTTTTAATGGATCTTAGAAGTTTTGTGGAAAGAGTCCATTTACAATGCT
GTTTTGCAGTCTATTCCAACTCATGGCACGGCAAGTGGATTTAGAGTTGTGTTCTTGGAG
TTATCAAGGCTGGTTACTCTGGGGCTCCAAGCTTTTCTTCATAGGTACCGCTAAGACTAA
TCGTCCCCATTTCTTATAATTTACATGGAAGTGAACAGTTGTGTACTTCTTTAATTAAAA
AATTATTGTGCATGTTTTGACAAATGCACTGATGTGTAGCTACCATACAGTCAACCTATG
ATTGTCATCATAAATACTCTAAATCCCTTCCATTATATATTCATTCATTATACATTCAGC
ACTTACTCTTTCCCCCCAAAAGGCCACTTTGTAGTCACCTTTTTTTCTCCTACCTCTCAA
GTCGACAGATGGGTATAACTCAATAAACAAAAACTCTAGTTCTTAGTAGCTGTTGAGAGT
TCAAGTGATCCTAAGGAGTCTGGTGATGCGGTCAAGGTGTGAACTGCCCTTGTTTCAGTA
GGTGAATGGGGAAACACGAGACCTGGTGGTTCCTTAAATATCTCAGCTTTGGGAACTATG
GGGTTGCTGTAAGTCTATTTGATAGGCACATGACAAAAAGTGATCATGAAATCAGAAAGT
TTGAGAACTGCTACTAAAATGAATTGATGTGTTTTATTGTTACCAAAATTTTCTGTATCA
GACTTCCTTTAATTTGCAGTCCGTTCATGCTGTTACTCTGGCAGGGCTCCGTTTCCCCTA
TTGACCAGGTGTGCTTTTGAGCCGGTTTGTTTGTTCACGGTAGGACCCAGTCTGCATTAG
GTTCGGTGGATGGTGCTCCTGAGTCTCAGCACGTTGGCTTGCCATCGGACTCAATCATTT
GTGAAAGGCTGCAAAATGGCCCTTTCCAATTCTCTTGTTCCTTTTGTGTTTGTTGCTATA
AGTTTTTCTTAAAATAACTTCCTCATGAGATACTTAGTTATCCAAAAATACAGTTTGTAC
AGGAAAGGCAAACTATTTTGTTCATTCCCTTTGTTTTTGGGGTGAGTTGGTGTTTTAGTA
GCTAACAAATAATTTTTGCTGAAGTTGTGTATTTGTATTTTCATCCATTGTAATAATTTC
TTGGTAGTTAATAGTTATGATGTTAAAATGAAATAGGATAAAAAGTGTGAGGAAGAAATA
AGGGTAGGGGGTTCATAAGAGAATGGTTTGTGGGTGAGTTTTTGTCACTTGGGATGATTT
TTATAGAGTAGTTTTAGCAGTCTTACAGAAATTCATTGTTTGTTTATAAGGAACGTGAAG
ATCAAGATTAGTTTTCAGCTTCTAAATTGGGACCAAGCCAAACTCATTGTATTCAAGTTA
AGTCTGACTCCTCACAACCTTGTAGGAGAGAGTAGAACTGCCCCTGCGGGTTTCTAAGGC
TCTCTGTCTTGGGAGCAGAGAACCTCATTTTTCTCCTGTGGAGTGGGTGTGGTGGGTTTG
AACTACTTAACCTAGCGCATGACCACCAATTCTCAGGACTGCTTTAAATTGCCACACTGG
TAGAAAATAGAAGAGAAGACATACAGCAAAGAAAAATAGTAACAGATACAGAAATTCAGG
AAAGCTTTGATTAGGAAACAGTAAACAAAAATTACTAATCCCACAGCCAGAACAACTGCT
AAATTATGTTTCCGCAATAAACTGTGTTTGGGGGTGGGGGGGTGGGCATAGTTCTGTATG
ACTTGGCTGATAAACAAAAGCTTAGAGCTTAGAGCTTTTGCTTTTGCTTTATGCTTATAA
AAGTCAACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAAATTT
TTATCCCGTGTAGGAACATTGATACTGCAGGCTAGCCATCAGACTGCTGACCGGAAGTTC
AAATCAACCAGTCGTTGCATGGGAGAAAGCTGAGGCTGTGTACACCCTTACAGATTTCGT
CTTGGAAATGCAATAAGGGTTGCTGTGAATCAACCAACTCAGTGACCGTGGGTTTGAGTT
TTATAGTTTGTTTCAAGTAGTCTTTATTGTTTTAATCTGAAGAAGAAAGGAAAACTAGCC
CCTAAACTTTATGGAAAGACGGCATCCTTAGAAAGGAATAACAGGTTTCTGTTAAACTCA
AGGCAGTCCTACGAGTGTCGCAGTCTAAATATTCCACAGAGTTTCAGTGGCTGGTTTTTA
TTTATCTATTTTTGGAGATGTATCACCAAGCCTTTCTTCCAAGGTACCTCTGTACCTCTG
GCTAGACTTAAGCTCATTAGCACCAAGCTCATTAGCTGTTTAAACAACTCAGGGATTGTC
AGCAGTAATACCTTACATTGATTGTGTATTCTTTCATAGTTATTCTGAACAACTTGTGAA
ATAGAGATTTTGTCTGTGACGTTCCTTAAAGTGGAGCCCTGGTGCTGCTGTGGTTAAGTT
CTTGGCTGCTTACTGAAAAGCCGGTGGTTCAAATCCACTAGTTGCTTCTTTGAAGAAAGA
TGTGGCAATTCTCTCATAAGATTTGCCTCCTGGGAATCCTGAAGGTTTTTATTTATTTTT
GCTGCTGCTAAGAATATACATCGCAAGACATGTTCCAAATCAACAGTTGATACATGTCCC
ATTCAGTGTCATTGACTTGCATTGCTGGAATTGTGTAACCATCCTTATGTTCTGTCTGAG
TTGCTCCTCCATTCATGTAAATGCAGTGCCTCTAAGTTGTCTGCCTGCTCTTCTGCGTTA
CTGCTTGTCAATTTGATCCCATAGAGGTATTTCTTAAAAGGAGCCTAATGCTAAAGGCAG
ACATTTTTTACTAGTTGTTTAGGTGGGGTTTTTTTTTTGTGGCAGGTGAAACTGATTAAA
GGGAAAATGTAAATAAAAGTTTTAGAATTAAATGAAGCAATTCCATCAGTACTTTAAAAG
AAAATGAAGGCAGAGAAAATGAAAGACTTTGATAAAAACAACAAAATCCTAATGATACAC
TATTGATAAATGAGAATGTCTCATTTTATCAACACTACTGTAATTCATATTTTATCTAGT
GTTATTTATTTAAATTAAGTATGCATGTTTCATTCTTGATAAACATGTTAAGAATTTAGC
TTAAATATTCTATTAGCTCCATTGATAATTAGCAATTAGTTTAAGAAAGAAGACATTTAG
CATTTTCTTCTGGTAATTTTTAAAATAGGAATCTAGGCATGCTTTGAGTTAGTAGCGCAT
AACTAATATTGATTATACAGATTGCCATTGTAGCGTCATATAATTTTGTGTCAGCTTTGT
TATAATATGCCTACTCACTTTTACTTGCTTTTACCAGATTGCTGTTTATATATGCTGAAT
AACAAACAATGTACTTGTTATTGAATAGGAAAAAATGATTTGCAAGAACCACAGAACAAT
AGGAAAATATCAGCGCAAACAGTTTACCATTTTGCATTGTTCATGTCTAGGAGCCCTCGA
GGTGTGTTGCGGAAGTGTTGGGCTGCTAACTGGAAAGTTGGTGGTTCAAACCCACCTGCT
GAGCTAAGGGCAGCTTCCATAAATCCTAGGGGCCAGTTTCTATTTTGCTCTATGGGATTG
CTATGAGTCAGGATCAACTGGATGACTGTGTATTGATAAGTATCTAGTCTCAACCTAAAT
ATTTTCTTTTGAAATATTACCTAATATTGAGCTATTATGATTAACATGACAATTAAATTG
TTGTTTATCTTATCCTTTTATTTCTAGTTGTGTTTTATAATTATTTCATAATAAATTACC
GTAGCATGACATGTCTATACTTAATAAATTATACAATTATAGGGTGCATGTTTGAGACTT
AGTTAGTAGTGTTGAGCTGTCAGGAAAGTTGGGAGATCACTGGCTTCATCATCTTTCTAG
TCTGCAGGAGTCACCAAACTCTGCAGACGAATAGCAAGCACTGTTTAGTGGTGGGATAAA
AGGTGCTTTCCACTAAATTCACAAGATAGTGCATCTCTAGCGGTCTCGTTATTTTACTGC
ATTTCCACTTAATGTGTAATGCTAATCTGTTAAACAGATTGGCAGCTTGGGCCTACCCGG
AAGTACGTCCTCAGAAGAAAGACCTGGTGAGCCACCTCTGAAAAAATAGCCAGTGAAAGT
CTTAAATCCTATGGAACACAGTTCCCCTCTGACACACATGACGTGTCCATGAGGAGTTGA
CTGATGGCAGCCGGTTTTAACATTTTTCTGTTATTTTGTTCTGTTAGCCATATAAGAAAA
TTAGTCTTTGTACCTTATAATGTATATAAATCTAGTTCATCATCTTAAAATTTCACGATT
GCTTGTCTTTTCCTCAACTCTCGCCCAAGTGTACAGTATTTGTTTTCTATGTGCCTTTCA
CATATTTTTAATTGGTAATTCTTGAAAACAGCTGTAAACCTGGCTGACAGATAGCTTTCA
GTGGTAAAGCAGTCCATGTGAAAAGGAGATTTGTACATTTTAAGGGAAATAGTGGACAAA
TAAAACCAGACTTGTTACTTTGTAAACTTCTTAAATATTTTACATTGAAACCGTTTTTTT
GCCTCTAGTACCAAAGTCGAACTTAAATTAGTATATTTATTGTTTTTACTTTCCTAAGGC
TGCCATAAATGCCACAGAGAGGAGAACTTAAAAGAATGGGGTTTTATTTTCTCCGATTTC
TGGAGACTCAAGAAGTTCACATTTGGTCCTTGGTCACATTGTTTACCTTCAGAGAGAAGT
GCTGCTGCTCCAGGTCCCCGTCACTGGTGTCCACGTGTCGCTCGCTCCGCATTTTCATGT
GTCTCTCCCTGTGCTGCTCATATAAGACCCCGTTCAGAAGGGTCTAGGGTTAGGACATAC
CCGGATCTTCAGGTTTACATACTGTTTCCAAGGAGGCAGGAGCCCTGGTGGTGTCGTGAT
TACAGGTTGGACTGCAGGCTTCCGACTCCCGTAAAGAGGATTGTTTGCGAAGCCCACAGG
GGCAGTTCTGCTCTGCCCTAGAGGGTCACTAGGAGTTGGAAATGACTCAGCGGCATGGGC
TTGAGTTTTCAAGGAAAGACCATTTTCCCACATGGAGACACAAGGGCCAGAAATCCAGTC
TGTCTTTTTTTCGGGAACACAATTCATTTCACGATACAGGTCATTAAGAGTTCCTGGGTT
ATGAGGGTGTACAACCTGTGGTTTTGAACCGACTCCTGTAAGACCAATCAGACTACAAAT
CGAGATGCACGTTAGTTTGTGTAACTAACAAACTGGTGCTTCCTTTGTGACACCACCACA
CATCATTACTGCTATGTTGTGTTGAAGATTATTTTGCATGTAGAAGCATTTGCTAATGTT
CCTATGCATACAAAGGTACACCATGTTACTGAGACAAACATTTGACGAGAGTTAGGGCTA
ACTTGTTCCTCCTCAGGACAGATTGCTTTAAAGACAGACGGAGGCCCAGAACTCCTTTAT
ATATGATACAAATATCGCTCCTGAGTATAATGGCTAGTTGGCACTATTTCAGTTACTCAT
GTGTTAAGTATCTTTATGGGCTGTCCTAGGACTTTTGATACCGTTTTGTAATTCTTGTTT
CTATAACAAAACTCTTAGAGCCATTTTATACTTCTTGTCTCTTAATCAGCCATTTGAAAC
TATTATAATTTTGGCTTCCTTTCTCTACTGAAACAGCTCCCATCAAGAACATCAGTGCTT
GTTATTAAAGGTTACTAGAGGTCACATCACAGGTCTCATCTTAAAGAGTCCTCGGGTGGT
GCAAATGGTTAAGTACCCCAAATGTAGACCTAAGTCAACCATCTGCTTCATTAGGATTTT
TAGTTTATGTAAGTTAAAATAGAATTTGTTTTATTGAAGGGGGGTGGTTATAATTCATTT
GTCTTAAATGACTTGTTTATTTTTAAATCAGTATTTTGAGGAGGAAATTTGCTTAGAAAA
TGTAGCTGTGCTGGTGGCGCAGTGGTTAAGCACTCAGATGCTAACTGAAAAGTCCGTCGT
TTAACCCTGCCCACTGCTCTTCCAGACAAAAGTGTGGCAGCCTGCTTCTGTAAAGATTTC
CAACCTGTGGAGATCCTCCTGAGGGGCAGTTCCTTTCTGTGAGTCGGAATGGAATTGCCA
GCAATGGGTTTGGGTTGCTTTTATCATCAATATAAAGATATTTTGTTTCTGCTGAGAAAA
TGACATAACTTCCTCCCATATCCATACTTTACCATTGCATGTCTGTTGTGGATTTTTAGT
CTGGTTAGTAATCAGCTTTCTTCTACAGTGGTGTTGCGTGGCATTATAGATATTCTGGTA
ATGGTTTACCTTTAAAGTCCAAGTTTTCTAGTAAGTTTTAAGTGAATGCCTGCCTTCTTG
TGCACTTGATAATATTACCTACAGATCAGTACAGTTGATGCAGGTTGTGGAAGAGAAACT
TAAGGCATTAGATTTTGTCCCACTCTGAATTGACCATTGGGCTTATCGATGAACAGCAGT
ATTCAAATTTTACACTGCTTTTGACTTATAGATTCGTTTTAAAATCTATTAAAAAGTAAG
TTGTGATGTTTTATTCTCTTTTTGACTTAAACCTTTAGAATAAACTTGTTTATGTGTATG
GAGCAGTGCCTCTGTGGTACATAAACAGATGATTTTGACTCTCACACATGATTCCCACTG
CGTTAGAGAGGGTCAGATTGCATGCTGTCCTTTTGAGCAGTGGGCTGCTTCTCACCTGTT
TGTGTTTTCTTTAGATATTAGGATCAAGGAAGAGGAGCCTGACCCTGAAGAGTGGCAGCT
CAGTGGTGACTCTACGTTGAATACCAATGATCTAACACACTTACGAGTACAGGTGGTAGA
TGAAGAAGGGGACCAACAGCATCAAGAAGGAAAACGACTTCGAAGGGTAGCTTGCACCTG
TCCCAACTGTAAAGAAGGTGGTGGGAGGTATGAACATAGGAAACATCCTTTTTGTTTTAA
AGAGTGCTAATGTCATCTTAAGTTTTGAAATTCTGCATGCCATGCTTAATACGGAAAACT
TCATTACATGATCATTTGGGATGTGTGTTTGTATGAGTGCGGCAAAGTTTAGCATAACAT
ATGAAATTGAGCTTAGTGGGTTAAATACCAGGCCACTAACCACTTCAAAGAACAGTGAAG
CTCTCTGCTCCTATAAAGATTTACAGCTTCAGATACCTAAAGTGCAATTCTACTCTGTCC
CACAGAGTCACTGTGAGTCAGAATTGGCTGAATAATACTAGGATTTAAGTGTCCTTTTAA
AAAAAATTGGAATTACTTAGTTTGCATTTAAAAAAACCATTTATTTAAAAAAAATTAATG
TATCATTTTAGCAGGTCTATCAGGATTTTGGAGGCGCCTTGGTGCTCTAGTGGTTACACG
TTGGGCTGTGATCCACACGGTTGGCAGTTGGAAACCACCAGCAGCACCAAGAGAGGAAGA
TGGCTGTCTGCTCCCATCAAGTTAGTTTCAGAAACCCACAGGGGTCGTTCCAAGATATAG
CAATGTCTCGATGTCAGTGAGTTTGGTTTAGTCTATTTGCAAAACAGCAATGGGATTTGC
TTAAACAGATAAAAAGATGTTTCTTGGTTTAAGAATGGTAGTAAAATTAAGTCTGGAAAT
AGTTGGGCAGAAGCACTTAGATTTATACAAAAATATTAAGTCTTGATGGTGAATTTAAAA
AAAAATGAGACTAGTATTTCAAGTCAGTGTTGTAAAAATAAGTGGTAGGTAGCATAACAT
GATAGGAAAACAGATTAGTAATTACGTGTGTGAATAGGTTAATTGTAATGGATCGAGACT
CAGATAATATTTGAAAGCAAATTCCAGACTTGATAATAAGAAACACCTCAAATAAATTGT
CACAGGAAAATGAAAGAAAGGGGAATAGAAAAATGATTTATTAGATAAATGTTAGCAAAA
TGTGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..2360, 19154..19344
1001..2360, 19154..19344
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved