Echinops_telfairi Locus ENSETEG00000002169
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000002169
Echinops_telfairi
ENSETEG00000002169
GeneScaffold_6325
SNORA63, SNORA3, SNORA3
1632..1764, 2218..2347, 3561..3690
4923
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTACAC
ACTTTGCAGAGACCACAGATAATTTACAAGGTGAAAAGGGGTCTAGACCGGATCCCACTC
TCGATGCGCTCAGCATGGCAGCGAGGAGGGCTGTGGAAAACTTCTCAGGGAGAAGACTTC
AAAAGCTGAAACCTGAACGAATCTGAATTCTGAACGACCAGGAGAGATGGGGAGTCCCTT
CCCTGATGTTCAACGAGGAAGGGTTTTCCTTTCCATTAAATTTCGGCAGCATAGGTCGTA
GTTCGAACTATGGAGACGCCTAGAACGACGGAGCAAGGAGCAAGGAAACCCGGCCGTGCT
CTCAGGAGAGCGGCGGGCGGGCAGGGCAGAGGGTGGGAGAGACAGTTTGGGAGGGCACAG
GCGAACGTGGGGCGGGCACCTCGCCGCGGCCGAGGGGCACACAAGCAAGGGCTACCGCCG
GGCCGTGGGGAGCCCCGGAAGCTGAGCGAGGCACGCGGGGCGACCAAGGCCTGGGCACTT
GGGAAAGAGCCTTCTGGGTGGGTCTAGGGGATTCCCGGGCCGCCTAGGCTGCGACAACAA
GCACCACGGAGCCTCCAACCCGATTCCTTGAGAGCTCAGTTCCCGGGAGGCCGCGCTCCA
AGCGGCCCGAGGAGCGCTTCGACCGCAAGGGCTGATGGGATTGCGTAATAAAGTCGACGG
CGACAAGGAAGAGGAGGAGCCGCCAGACGCAGCCGCGCGGCTGGGAGGAGGGCGCGCCCG
AGACCCCGCCTCTGGCCGGAAGTGGGCCTTTGGCCCGCCCCCGTGATCGGGTCCTCGCGA
GATTTCGCCGAGCTCCGTTCTCTTTCGTCTCGGCCGCCGACATGGTAGGTGGTTCTTGCG
TCCCGCTGCCGCCGTAGCAGACCTCTGCCCCCACCCTCCGATTCCCGCGTTGGCTCGGTC
TTCCAGCCCGTGCTAGGTGGGGGCCGGCGTGGGAGCGCGGTGGGGTTAGCCCGCGGCCGC
GTGTTCAGTCCGGGGTGCGGATCGCGGGCACGCGGGCAGGAGGGCCGGGGCGCAGCCCTG
ATGGAGACCCACGGCCATGGTTTTGCCGAACCTCGCAGCCTGGAAAGCTGCGCCCCTTCT
CCCTGAAGCCTAACAGACTGCTAAGCTTCCGTTTCCCCACAGCCCTCCAGACTGAGGAAG
ACCCGGAAACTTAGGGGCCACGTGAGCCACGGCCACGGCCGCATCGGTAAGTGCCGACAT
CTCCGGGCGGTCTTGGGCTCTTCGTGCCGGCGCCCTAGCTAGCCTAGAAGTAAGTAGGTA
AGTAGTTTAGGAGTGGTTTAGTAGAGCTTTGGGGGACATAACTCTTTAGTAGAGATTCTG
GGGTTCAGATGGGATCGAGCCGTCAGCTATTGATTCCCTTTGAGGGTCTGGTTAGTACTG
AGAGAGGATTGCCCCATCAGTGGTAGATACAAATCGAGTTAGGAGTGTTGAGTTGATTTA
AGAGTACTGCGACAGCAGGATTTAGACTACAATATAGCTGTTAAGTGCTATTTTGTCGTT
CCCCCTGCTCAAAGTAAAGTTGTTTCTTAACTATCCCTGTCTGCTAGTTTCTTGTAGCAG
CCCAGGGACGCTTGGTCTCATACATATTGGGGGCGGGGGAGTACTGTGAGCCCCGTGTTG
TGGACAAGTGTAACTACGGGAGTAGAAAGCCTTGTCTTTTTCCCGTGGGCAACTGCAGAC
ATGTTTGATCCAGCGTCTTGAAGGCATTGCTATGGGGAAAGGACTCATGATGATTGCACA
GGAGTGTGGGAAATAATGAGGGACCGTGTTGCTCTGTGTTCTGTCAGGGAAGCACCGGAA
GCACCCAGGGGGCCGGGGGAATGCTGGCGGCTTGCATCATCACAGGATCAACTTCGACAA
ATAGTGAGTGGCCTTTGGTCTGTTTCATTGATAATTGGTCCAGCTCCTCTGGGGAAAGGG
CAGAGTGGGCTGCCCTCATTCATTCAGCCCCTCCCCAGTTAGGGGCAAGCCTCTGGCAGC
ACACACAAGCTGTCCTTAACTGCTGGTTTTAAACACTTGTGAACCAAGAGAACTTGTGGT
CGAGGCTAGAGTCACGCTTGGGTACTGGTTATTGCCTTGGTGTGCTAGAGTCCTCGAAGA
GTAAGCGCTGACCTTATTCACTGGCTGTGCGTCTCGTGGCACAGTCAGTCACCAGGTTAG
CCACATGCCTCAGGTTGATACCTAGGCAAGCTTTGTTAACAGTGTGTGGAATTTCTATAA
ACAACGGGTTAACGTAGAGGTTCCTATTTTGGGGGAGTGTGAAATGGAGAACGGGGCCCT
GGCCTCCACCTTATTTATTAGCCTGCCTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTT
TTTCCCTGAGAGATGTTAACTAAATGCAAACAAAAGGACCCCGGCAACTCTTCATAAGTG
GGGCGACTTATTGGGGTGAAGTCGTAGAGCGATCAGAAAGGGCCAAGTTCTGGCTGATAA
ATGCAAGCCCACACCCCCCATTGCACAGCCTGGCGCAAGAACACCCTTGGGTGCTAGAGG
AGGAAGACAAGATGCAGAATTTGTCGGTGGTCAGCTGTGTGGGAACATTTTCCTAGAGCA
TTTCTGCTGTTGGGAGGTTCCATCGAGTCTGCTCCGACTCATAGTGCCCTACCTCCAGCA
CAATGACCTGCTGTCGGCGCTAGCACCCTCTCCCATGGTCGCAGTGCTCGAATGCTTGAT
TCCATTGTCATTGTCACTGGGTCCGTCCAGTTCCTTGGGGTCATCTGTTTTGCTGACCCT
CTCCTTTACCAGGCACGATGTCCTTTTCCATGGTCTGGTCTCTCCTAAAACCCTGTCCAA
AGTCTATAAAAAGAAATTACGTCTGAGACTGGAGTCACATCCTGACACAACTCTTGTCTT
GGTGTGCTAGAGTCCTCGGAGAGGGTCTGCTGGCCTTGATTCACTGGTGGGGCAATCAAT
GCCTCCACTAGTGCCCTGGTCAGAAACATGCTCTGCCAAGGCCAGGCTCCTGGGAGGTGG
GAATGGTGGGCATCTTTCTTTGTACCTATCAGCATTGGAACCTGGTGTGATAATAAGTCC
ATTTCTTTCTTCTAGGGCTAGCTTGAAACATCGGGGAAGGGTAAACTTCCAAAGCAACCT
GTCATCGTGAAGGCCAAATTCTTCAGCAGAAGAGCAGAGGAGAAGATTAAGGGTGTTGGG
GGTGCTTGTGTCCTGGTGGCTTGAAGCTACGTGGAGGTTTAATTAAAAGTTAAAAATGGC
TTTTCCCTTATAGTCTAACTGTAGGTTCTTTGACACCTCTGTGTCTTCCCATAAACAATT
ACAGCTCACTGCCATTTAGTCAGTGCTCCCTCATAGTGACCCTATAGGATAGGATAAAAC
TGCCCCTGTGGGTTTCAGAGACTATAACTTTTAGAAAGCCCCATCTTCGTCCGATGGGAG
CTGGCTGATTGGTTTTAAGCTGCTGATCTTGCAGATCACAACCCAGTTTGTAACCAGAGC
TCCTTCCTAAGAGTCAGCCTCTGAAACCCACAGGGCCAGTTCTACTCTGTTCCTGGCCGT
GAAATCTTTCCCATGCAGCTCATACTCAGATTTCTGGCATCAGGAGCAGTGGGAGGCAAC
CTATGTTTCCAGCAGAGTGCTCAAACTATGGTAGTGATAATCCAGTGCTGTGGAGGCTGG
GAGCATTTTCCAAATTCCCATCAAGTGGACATTATACCTATTGAAAACACAGTCTAGTTG
AAACACCTGCTCGGGTTTACAGTGGGTCGGAAAGCAGTGTACAAATGCACCCTGGGCTCC
GAAGGACTAGACAGCTTTTTGAACACATGGGGTCCACACATCAGTGAGATTGCCAAACAT
TCCAGGGATTCATGGGTCCCCTGCCATCAAGTTGGTTCCAACTCACCATGGACTTGCCTC
TGGGGTTTAGGAGGCGGTTCATCTTCAGAGGTTCATCTTCAGCAGCTGGTGGGTTATGAC
TGCTGAAGTTGAGGTAGCCTGTTAATGCCGCTAGAACAACTGAAAGTTAAAGTGCAGGCT
GAAGTTTTTCTGTAGCCTACACTAGAAAGTAAGATTCAAGAACCAAATGAATGGAGGAGT
CTTGGTGACTTTATGTATTTGACGGGTTTGGTTTTTATAGGGGGAAGATTAGATGCATGG
TGTAATGATATGAGGGTCTGGAACAGACACGTTTTAAACCCCAAGCCCACTAACATTTTG
ACAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1302..1365, 1967..2042, 2684..2858, 3795..3797, 3801..3923
1001..1003, 1302..1365, 1967..2042, 2684..2858, 3795..3797, 3801..3920
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved