Echinops_telfairi Locus KIAA0907
snOPY snoRNA Orthological Gene Database
Echinops_telfairi KIAA0907
Echinops_telfairi
KIAA0907
GeneScaffold_8929
SNORA42
30708..30836
35658
ATTATGTTTTATGTATTCAGTCTTGTATCTCTAAGATACCTCACGTGTTGGACATCTCT
GGCCTCCAAAATCAGCTCAAGCGCCTTAGCACGGGGCTCAAACCCTTTCAGGGTCCACCC
GGCCCCTCCTCCGCTAGCCCAAAGGTAAGCGCACAGATGTCGGAATCGGCGTTTCGCCAC
GTCGGATGGCTCTCTCCGGCCCTCCACGCGGTGTAACTTGGGTGTCCTTCAAGTCTCTGC
TTAGATACCGCATCGCGATGGCCTGTCTCCCGCTCTCTCTCAGGATTCCAAGCAAACCAT
TCAGAGCGGCACCCTAGGGGGCAGCCGAACGGCCCAGGACGGCATCCAAGGTAAATCCGT
CTCATCTCCCTCCTGCAGGGCGGCGGGCGGGGCCGAGCTCGCAGCCGCTGCCCCGCCGCC
TCTGGGACGCGGGCTGGCCTCGTGCCCACCCGCCGCGCGGTGCCAGACAGGCCGCCATCG
CGATCGTATCCCCTGCCCTGGGAGCAGTGCTGGACGCACAGACATCAAACAAAAACTAGA
GACATTCTTCAGGTGACTTGGCAAACGGATCATCTCCTTTTCCCTCGGGAAGTCACTAAA
GTGTCACGGGGGTACGAGTCGCGGGAAGTCTCTGCTCGGCAGAAAGTGAAAGGCCGCACA
CCTGAGCAGGCCGTCGGTTGGATGCCCTGACTCACGCGTCTGGTCTCCTTGTCTACCTCC
TTGCCCACGACAAAGATGGAGTCTTCGGGCCCCAGTTCCGCCTCTAAGCGCGAAGGAGCC
ACCGCCTTCCTCAAAGGGGAGGCGCCAGCGGGACGCCCGCAGCCTACCTGCCTCCGCTAC
CGCGAGACGGCGTGAAACCCCCGAGCGCCCAATCGGAACCCACAACGTCACCGGAACCTC
TCGGCCGCGGAACCGGAAGTGCCCGTGCGTGAGGGCGTGGGGCGGAAGTGACGGGCAGGG
GTAGTGGGTCGTTGGCGGGTGGTTAGGCAGAGCCGGTCGCCATGTCCGCGGGGAGCGCGA
CGCACCCTGGCGCTGGCGGGTGAGGCGAGGGGGCGAGGGCGGGCGTGGGCGTGGGGCCGC
GGGCAGTGCGGCGGGACTCTGGGCCGCTGCGTGGGTGTGGAGGGGCGCGGAAGCGGGGGG
GGTGTACGGATTGGAGGTCCGGCCTGTCGGGGGTCCCTGAAAAGGGTTGGCGGGCAGCAA
AGAGAGGAGGGGAGCAGGGGCTTTTGAAAGGCCGGCCCAGATGAAGGGGGAAACGCGAGC
GTGTGGTCCAGCGCCAAGTCTCTCCGCAGAGGTGACTGGACGAAGATGCCGGGGAAGGGT
TGAAAGAGGTGGGGGGCTAGGGAAGTTAACGCACCAACGGACGTACTTTAAGGAGAGAGG
GGATTTTAGAGTTGGGGGAAGGTCCGAAGCCGTAAAGGGAACGGGAGAGTGGGCAATTGA
GGGGCTAAAGGTGAAGGAGGAGCAGATGGCAATGGAAGCTCTGGCGCCTAATGTTTGCCT
TTCTCGTCCTGTACGCGTCGCAGTAAATGGGACAGCCAGCTCCAGGCCTCACTTCTCTTT
CTCCCACCTGCTGCTCTGGTGGAGAGGTCCTCTAGCAGTGGGGGCAGCCCTGGGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCATGCTCATGGCCAAAGGCAAACTGAAACCAACTCAGAATGCTGCTGAGAAG
GTACTGGAAGTTGACGGGGTCCTTTGCCCATTTCTTAGACGTTATTTGGAATCCTGCAGT
CGTTTGTGTTCATGTAAAGGGAAAACAATGGTATCCTACTTTAAAGAGCCTTTCCTTTTG
GGATTTACCCCATGGTGTTTTGTCAGTACTTGTTTTTCTGAGGCAGTTGTGAGTGGGCTT
GTGAAAGGACCAAGTGGCTTATTTTGTTCATGTTTGCATAGTTCAGTTTAAGTTGTATCT
ATATATTCATTTAAAGGATGGGCATGTTCTCTGAAGACAAAAGAAGTTCAGGTAAAATGA
GCTCTGAGTAACATCTCTTGTTCGAACGACAGATGTTTACTTAGTGACTACTTAACTGTT
GTGGTTAGATGCCATTGAATTTGTTCCGACCCACCTCCTGTTTAACAGAAGAAACCACTG
TTGGGTCCTCTGCCGTTTCAACCGTTCTTGCTGTGTTTGAGCCATTGTTGCAGTCACCAA
GTTAGTCTTACCTAGTTGAGGGTCTTCCTCTTTCTCACTGACCTACTGGACAATTAAGCG
TTAGCCCAAGAGATGGTTAATTTATGTATGGGTTGTTTGGTTCTTCGTTTACAAGTTGAG
GGATTTAGGCATAAAAAAATTCCTGGTTAAAAAAAAATCCTGGTATAGAAGCGTAGGGCT
TATCCTGCCGTAAGGGTAAAAGTACTCTTGTAGGGTAATAATTAGAAAGGCTAGTTGTTA
CTAGAATGCTTGTTTTGCACCCCCACACCACCACCACCCAAACCTTAAAAGAATTGTGTA
ATCGATTATTGTCAGCAGTGTACAGATGTGGAAAATTGGTCTCAAGAATTAAATAGAATA
ACTAGCCCAAGATCTGCAAGTGGTAGGTGTAAGCCTCTGACTGAGCTCCTTCTGATGGTT
GGGCATCTAGTTTGTTTGAAAACCTCTCAATTGAAACTCATTGCCATTGAGTAGGTTCAG
ATTCATAGCAACCCTGTAGGAGAGGGTCGAACTTGCCCCTGTGGGTTTCCAAGGCTGTGT
CACTTTACAGCATAAAAAGCACCTTTCTGTGGTGGAGCAACTGGTGGTTTCAAACTGCTG
ACCTTGCTGTTAGCAGCCTTGCGTGTAACCCACTCCACCACCAAGGCTGCTTTGAAAACC
TCTAGAGTAAAGAGAATTCCATGTTTCAAAGCTGCCCATTCACTTTGAGAAATGTTCATG
TAAGAAAATAGTTTTGCTTTAAATTAAAATTTTCCTTCCATGTTACATGTGAAGAGGTGA
GTTCTGTGTTTGAAAGTGTACTCTTTTGTTAAGCTTTCTAGTTCTATAGATTTAGTCAGT
TGGTTATAACCTGTCTGGAGGCTTAAATGTCATTATTAGTGACCTTGACATTAATCAGTA
GATTTTTATGGTTTATAAAGAATACTGAATTTAGAATCTGAAGGTCTGGCTTTGAAACCC
GGAACCCTCAGTTATGTCTTGTGTGTTTATCCCACTGAGTGTCAGTTTCTTGTAATCATG
CCTGTGCTGTCCAACATGTGGCTGTTTAAGTTAAGGAAAATTTAATAGTTCCTCAGTCAC
AGGTGCTTAGTAGCCATGTGACTAGTGACAGCCACACCAGACTGCACAGATCGAAAACAT
TTGCATCATCATAGGCAGCTCTGTTGGATATCACTGATATATACCTTTAAGATAGTGATC
ATAAGGGTTCAGTGAGATAAATGTAAAGTGCTAGAAGGTCAAGTGATGAGTCTGTATTTA
ATTTGCCTCCATATTTTAAAAATATCTGATGCACAAAAGGGCATTTGAAAATTCACGGGA
CCATTGTGTTTAAAACTTACTATAAGTTGGGTGAAGATTTTCAAAATAGATCAGTTTTCC
ACTCAGTAATTCATACACATTTTGTTTCTTGATTGCTCCATTATCGTTTTATTCCATTTT
TCCCTTGGGGTTTTGGGGTTTTTTTTGAAGTCTCCTTGTATTTTATCTTCTTGAGCAGAT
TGGTTAGCCATCCAAGTGGAGTAGTTTCATGTGCTGTTACTCTGTGTTTGTCATAAAGGA
AACAACTCTCCTAGGAGCAGGTCGCATGGGTTGTTAGGCTTGAACTCCACCTTTGTTTTA
CTACTCCGGCACCTAGCTGTAAGGCATCATCACTCCACTCTAGTATTCTTTAGAAGTTGC
AGCTCCTACTCCATAGCGCTCCTGTAATTACATACATGATCAGAGAAATCTGATGATGGC
CTTCAAGTAAATTGGCTACTTGCTGTAAATATTTATTTCATTTGTGGAGAATGACCAGAA
AGTATTTCCAAGTGTGTTTGCTGGCAGGTGAACGGAAAGATAGTGAGATGGTGGGACTTG
GGAATAAATGGTTGAAAAATGGGTCACTAGAAGATTAAATTCTATTGCATAAACATTTTA
ATCTGATCTCTCCCTTTTTGTAGCTTCAGGCACCTGGCAAAGGCCTGACTAGCAGTAAAA
GCAAGGACGACCTGGTGGTAGCTGAAGTAGAAATCAACGATGTGCCTCTCACCTGCAGGA
ACTTGCTGACTCGAGGACAGACTCAGGATGAGGTGTGGAGTAGTGGGGCCCCTTATTTGG
GGAAGATAGAGATGGGTGTCATTTAAAAAAAAAAAAAGGACCTCTAATCCAACCAACCGA
AAAACCCAGAACTCAACAAATGAACACCCACAACCATCAATTCTAACTGGCAGCCACCCT
GTAGGGCAGAGTAGAGCTGCCCCATAGGGTGCTGCTGTTTGTGGTTAAGTGCTGTTGCAT
TCGCTCCAACTCACAGAGACCCAACAACAAAAAGGAAGCACAGCCCAGTCTTGCCCCATC
CTCGAGCTCACTGCTGCAGCCGGTGTCAGTGCATCTCACGAAGGGGCTTCCTCTTCTCCA
CAGGCCCTCCTCTTTACCAAATACGATGTCCATTTCTAGGATTGCCAAGGCTGTACATCT
CTACGGAAGCAGACCGCCACCTCTTTGTCCCGCATGGTGGCTGGTGGGCACACACTGCCA
GCCTTTCAGTTGTGCCCTTTAAGCCCTGGGCCACCAGTGCTCAAGCACGAGTAGGAGTCA
GTGGTTTGTTAGTGGGATTGGGTCATAGCATCAAAATCACAGTTGGGTTTAGTTTAACTG
AAAAGGAGCAGCTTCTAAATCAGAAGTTCCCAAACTTACTTGGCCTACCACCCCCTTTGC
AAGAAGAAAAACGTGTTCCTGCACCCCCCTGGCAATTGAAAACTAAATACTGTAGCCCAC
AATCCAGGAGAGAAGTGTAGGTATGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCTTAGATTCAGCAGACTCAGTGGGGCTGCAGTGTCAAC
TCGAGGGAGATTCCTGACAGCTGAGGAGAAGGGCCAAAAGTGGGAACCCGGGTGTGTCTG
TGTGTCCTCTCCCTCGGAGAAGGGTTGGGTGGATGGCTCCTATTAGCTTCCTGTTGTCCG
TTCTTGAGGATATGCAGTGAAGCAGGCTTCTGAATGTCTCAAATAGGTGTAAGAAATGTT
GGCAACTGTTTTCCTCACAATGATTTTTATTGAAGGAGACTTAATTACAAGAAACTGTAA
AGGAAAATAATTGTTAATCTTTAATTTTCATGCTTCTAAACTATTTCCCTCCCCACGAAG
ACATTTCACCCCCAAAACCCCCTGCGGTTGAGCCAAATTGTATGCAGAGTAGAACTGCCC
TTGTGGGTTCTCAGAGCTCGCCTTTCTCCTGAAGAACGAGCGGTGGTTTGAAGTGGTGAC
CTTGCAGTTAACAGCCCGACTGGTAACCACTGCGCCACCAGGGCCCCTTCCCTTCGTAAA
AGCACATATTCTGTTGTCCTCCGTTAAAAATACGGCTTCCTTTCTCATGCCTATGACATG
GAATGTAGGTTGTCTGTGTAAATATGTAACAGCTTCGTTTCTCCCATTGTTTAGTGTTTG
AGCTTAGGGTGCAGTGTGTTAACATTGGCTTAAACTTAATTAGGAGGTAAAATGTGTTCT
CACCCAAAGCCAAGCGTGCATGTCAAAGGCAAATGTAAGAATTATCGTCTGGGTGCTAGT
TGCCATTTTGCATTTCCTCTTCGCTTCTGCCTTCTGCGAAGCATATGGGTGCTGATCACT
TTGTTCACGATCAGGATCTGAATCTTAGTGCCAGATCCTAGAGTTTCCGTAGTTGGTATG
GGTCTGCTTCATTTGCGTAGTTAAAGGCAGAAAGTATCTGCTGTAACTTATTGGTGTCCA
ACAAAAAAATTATTTTCTTCAACTTGGGGTTACCTCGATGGAATACTATTAAATGAGCCC
ATAGCATAGAATGAATCCTTACCTGGACCATTTAACTCTAAACAAGAAGAATTTGTTGTA
TAGCTGTAATAACCATGTTCTTAAGCACTGTAATTCAATACTCAATGTGTATACGCTCTT
TTTAAATTACAAATTAAAGTTGGGAACAGCTTTGCTTCCGTGGCTAAGCTAGGTAGCAAT
AATCATTTTATATCTCTTTATAGGGATCGTCCTTTATATCTTCATGTTCAGGGTCAGACC
CGGGAATTGGTGGATAGTAAGTAATATCTTTGACTCGTGACTTTCTTGTGAAGGGTGTAT
TTCAGAACTCTGTGTAACAACTTGGCAAACTCTGGTGACTTTTAACTCTTGGTTTATGGA
CTTTGTACAAATGTGTGCCTGGAGCTTGGGAAGCACCTATGAAACGGTACTGCTTGCACA
CTTGAACCAGGTGCCATCCTACGCATCGGGCTCGAGGCGTTTCATTCGGTTCTCTGGCAT
AGTGTTTTGCTATCTCTCTCTCTCTAGGAGCTGTAAACCGAATCAAAGAAATTATCACCA
ATGGGGTGGTGAAGGCTGCCACGGGCACAAGTCCAACTTTTAATGACGCAACAGTCACTG
TTTATCACCAGCCTGCACCCGTCGCTCAGCTGGCTCCAGCCGTGANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCACAGTGATAATGTGACATCAGGC
TGTCATGGCATCTGAACCCACCTCTCTCATACCGGTTCTCTGAGAAGAAGGTTGATCAAA
GAGTATAAACATGGTATGTTTTCAAGTTAGTGGCTGGTATTTGTGAGCTTGATAGCAACT
GGAGGACTAAGAAGGCTGAGTCTGATGAAGCAAGACTCTGCTGATACAATCCTCCTAGAC
GAAAGGGGTGGAGAGAGCAGCCCTCAGGGAGAGCGTCACAGGGCTGACTGTACTACCCAA
CATTCGCTTACTGAGACAGGAGCAAGTGTTGCTGGAATTCCTTTTTCGCTTAGTGGGTTC
CTGGCCGGCTCAGGCGGTGCAAGTGTCATAGCGGGGCTTTTCTCTTCTCCTCTCGCCGAG
CCGATGAGGGTGTGTGCTCACATGAGGACATTGAATAGTATTCTCATTTGAATTCAGACT
GCTTGGTTGAATGTTCATGGAAGAAATTACAGGGCTCTTTATTTCTGGATGTGATTAAAA
TTACTAGGGGGTCAAAATATTGTCTGCGAGATTAGTATGTATTTACCTTATATTCTCTGT
TTAATCTGAGTTCTGTTGTTTCACAGATGCATTATGTTCAAGATAAATTATTTGTGGGTC
TAGAACATGCTGTGCCCACTTTCAATGTCAAGGAGAAGGTGGAAGGGCCAGGTTGCTCCT
ATTTGCAGCACATTCAGATCGAAACAGGTGCCAAAGTCTTCCTCCGGGGCAAAGGTTCAG
GCTGCATAGAGCCAGCATCTGGCCGAGAAGCTTTTGAACCTATGTANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTCATCA
GTGGGATTCGTGGTTGGTATGCAAATTTGCATAATATTGTATTAACTGGGTTTATCACAG
ACAGCACTGTATTTTAAGATAGATCTTGAATTATTCTTTTTTTCGAACATCACAGAATTT
TAATCCTCCTTTTCCAGGTTGCCTAGACCACTTGTGAAGAAGAAACCTGTAGAAAGTTAG
TAACTTAAAAGAGGAGGAGGAGGAAAGTTAGTAACTGCCACAAGAGACGCCGGAGAGTGG
CACGTGCTCAGTTCTCCGAAAGCCCTGCTTTCTGGGGAAGGTAGGCAGGGTCTGCATGCA
CTGCTGGGGTCTCTGCTCATACTCGCTGGAATCAATCGTGGCTGACGGGAGGCCACGGGT
CGCTTCTCATCATCCTTCTTGCAAACTCTTCGGCATTCTTACAGAAGTTTTTGCGGCCCT
TCGAGTCTTCTTAAGCTAAGTCAGCCCCATAAGGGCCTGATGACTTGGGGGCTGGCTGGC
TTCAAGTTGTCAGTGCTAATTACAGGCAGGCCGACCTGTTCCTTCTCATAGATGTTTGAG
TGGTAGATCTTTGTTTTGAAGGTGATCTTTGGTGGTTTGAATGGATAAGCTGCTGGAAAG
TTGATTTTGATTCTGAAGGCCTCCTTATTATATGGAGGGTTGTCAGAAATAAGAAGCCCC
AGCCCAGTCAACAAAAAAGCTTCACCAACTTGAATGCTACAGACGTTTTCAGTGCACATC
TGGGATCCCTTCAAGCTCTCCGTCAGCTTCCCGCTGGCTGCGTCTGCATCGGGTGCTCTA
GGAACGCTCTTCATGACAAGGAATGCCATGCCATGGCTCTGGAATCCCTCATGCCTGGCA
TAATGAACCATATGAGTATCGGACTCAAAAGGCCCAACACCAGTTCATTTCAGCTCACAA
ATTCCTAGCCTATCAACCTTTATGTGTCCCATTTAATTTTTAACAACTTTCAATTGTCCT
GGATTCATACTTCATAAACCCCATGTTCCAGTTGTTCACCAATGTCTAAAGCTGCTCTGT
CTCATTTTGAGTCAAAGCTCGTGAGCAGAGCCGCTCTCTAGAAAGTTTTCAGTGCTTAGT
TCCTCCTAAGTGGACAGCCTATGCCTTCTCCCTATCTGACCTGAGTCTGTAAGTTCCACT
GAAACCTGTCCCCCAGGTGTGTTCCTGCTGATATTTGAAATACCAGTGGCATAGCTTCCA
CATATCACAACCAGTGTCAGGTGGGTAGTGGCATTATCATTGCAATATAAATGAATAAAA
ATATAATTACAATGAACAAAAGCCATGTATATTTGAGAATGATGAGGGCAACAAATATAC
ATATGTGCTTGACACAATGGATGTATGTATGGATTGTGATGAGAATTGCATGAGCCCCCA
ATAAAATAATTGAAAATAAATAAATAAAAGATATGGAGAAAAAATAAAGAGCAAAAAAGA
TAAAAAACAAAAAAAGAGTCTAGGAAATGAAAGTTAATTTCTAGTGATAGAAAGCAGATC
AGTAGCTACAGGGGAGGTGGTGGAGGGGAGTAGAATGAGGAGAGAGAGATTACAAAGTGG
CATGCAAAAAAGAAAAAAGTGGTATGAAGAAGCCTGGCTGGGGGGGTAATGGGTGTGTTT
ATCATCTAATTTGTGATGGTCTTTTCATGAGTGCTTAAATATGTCAGAGCTTATCGAATT
ATAAACTTCAAGTAGGTGGTTTATGGAATGTTAATTATACCTCAATAAAACTAGTTGTTG
TTGTTAAAAAAGAGCAGTTACTCCCCATAAGAGGAATGGGGCTGACGGGTGGTCCAAGCA
ATCTGGGGCTTAGACATTCCCGAATGGAGAATTACTCACCATCTCCTGCCAGGCCATGGT
TGCTGTCCCTTCCCACTTAGCTCGCTGACCCTCTGTTCCTCCTGCATCTGGGAGGACTGC
CGCCCCTTTACACAGCAGCTAGTCGTGGCAGTGTTCTTTGGTAGAAGCAGCAGGCCCTCG
CTGCCTCCATGTGCTCTGGGCCAGGGTCACTGAAGAAGCGCCTCACTCGGCTGCCCAGGC
TCTGGTTCTGAGCACTCAGCCTTTCTGGTCTCCAAGGCTCCCCAGCTGCACGCCATATAC
CTGAGCAGGTTTCCATTTCAGATGTCAGGTGTTCACCTTCCCAAGGAAGGGGAAGGAAGA
TGCATTCTCACACTTGCAGATGATCAGAGGCTTTCTCCAGTGCCACTCTTCTAAAGGAAA
CAGAAATGAAATCTTCAGTCATTGATCATGCTAGCTGCATCCTGGTTAGGACACCCTGCC
GCACGCCACCCTCTAACCAGAGGGCGCATCCATGCCTGGTATTCTCTAGTCTCAGCTAGG
GCTTCACCAATACCTGGAAATCTCTTTATGTATCCTTGGTCCTCAATCTTTTATATGTTC
ATCCAAAGAGAATACTCATTAAGCAACTTTTTCCTATTGAATCGGAACGTGGAAGGTTGC
ATGCTCATTGGTGCAGGCAGTCATTGTCAGCCTCAGAAGGGAGCCAGTCTATGGAAAAGT
CTCCCGATGGAAGCAGGCGGTGAGGAGAGACAGTAGAGAAACCCAGGCATGCGCAACCCC
TGTGCCTCGAGTTGTGGGAGTGACTTTTGATTATTGTTTAAACTGTTTCTTGAGTTGGGG
TTTCTGTTACTTATCATATCATCAGGAGCATTCTGGTTCAAAGCAAGGAGGGGACAAAGG
AGTGATAAATAGTATGTTTAAGGGATGAGGAAGCAGAATATGTTTACAGGCTGAGAAGAA
GTTGCCCTAGGAGGGAAGAAAAAAGTGAAAACTACAGGTGGTGGAGGTCAGAGGTCTTTG
CTTCCTGGGAAGGGCTTAAGTGGAAGCTACCTCTCCTCTCACCATGCTTAAGATTGCCCT
GGGGTCTATGCGCCTTGCACTGCACTCCCCAGCGAGCTGTCCACGGCCTGCTGAAAGCAC
GAGCGTTTCATTGTACATACAGCACTCACCACGGCATTGACTGAAAATAGAAAAACAGCA
CCACGGCTTCACGACTAACAGGGCTGACATACAATTGGCCCTACCCTCCTAAACAATTTA
AAACCTGGGCAAAATTCAGGAGACGGTCATTTTCAGATCTGTGACAATAGGCAGTTCAGA
ACTGCAGGGCCTGCGAGAAGGGAAACGCTGAGGTGAGTCTCACAATCACCTGGGGTTCCT
CCCTCAAGGCGGTTTCCAAGGACAGAAAACCTAAGCCGAGCTGAGATGAGATGGAGGTAA
GCGCTCAGGGCAGCAAAGCAGTTAGGATTTATGGGTAGAAGACCAGGAAAGTGGGCGTTA
CACCTGGAAGTCGCCCCAGAAAGCTCCCTAGCGGTCATTGGGAGCCTGAATATGCACATG
AGCACACACAGTGTGGAACTCTAAAAGGTCAGGCAAAGAGTACCCACTGGGGAACTGTAC
ATTCACCCTCAGAGCTCACCAAGGGTTGGGAGGCCTGCAAGTTTCTGCTGGCCTGATGGA
GGGGTGCTGGAAAGCCTGGTGTCAAAGAAGACCCCAGAAGAGCTCACCTTAGAGGAGGGC
TAAACTTGTGCAGGAGTACAGGCTACTGGAGGTGTGCCGTGGCCAAGCTTCAACATCAGG
CTTGAATAGAACAAGCTGCTCTGAAGCTATCTTCAATGCCTGTCAAAACAAACTTCAGCA
CTCTTTAAAATAAAGCAAGATTAAATTGTTAACTAAAATAACATTTAACATGTCTAACAT
CTAATCAAAATCACTAGACATGCAAAGAAGTATTAAAATGTGAGCTGTAATCTGGAGGTT
AAGTCAATCAACAGAAACAGGCACAAAAATGTCATGAATAATGGTATTTGCATACAAGAT
TTTTAAACAGATGTAAGAGAATGAACAGAAAACAAGCATCATAAGGAAAAAAAAGAAGAA
AAAAAAAAGAAATAGGATACCAAAAAAAAAAAAAAAAAGTCCAAGAGCTTGACAAATCCT
TACCCCTTAGAGGTATAAAGCTGAGGTTGACTTATCAAAAACAACCATGCTCTGAAAATT
GACCAAAGGCAAACATTTATGATCTAGAACTCCTGATACGACCGTGGAATTCTGCAGTCT
TTGCCCTGCCTCCCCTCCAGACCCGTAGGTGGGAAAGGAAGTTTGATTAGGGTGGGACTG
GCCATGAAACTTAATAACCTTGCTGCCATAAGAGACAGAACTTATTTGGGGCACAGGGCA
GAAGCCTATAACCTTGACTTTGGCATTGCCAGTATCAGTGACAACCTCAGTAGGAAATGG
ATGGAAAAACTCACAGCTCTGCAAATCTATAGAGTTGTGGTTCCAGTCAGACTGAGTAGT
ACAGCCTCAGTTAGTAATGAGATCTGGAGAAAAGTGAGCAATAGACACGCTTGCTGGGAA
GCAATAGACACGCTTGCTGGGAAGCAATGTATATAGACTGATGTGATCTGAAAAAGCAAG
AAAAAACAACAATAGAACTACAATAGTATATTAGAAAACANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTTACTGTCATTTGGGGGGATGTGTTTTAGCAGTTTTCCTCATCCTGTAGTAAGG
AGTTGTGGTTGTGGAGTGGTTCAGCCTGGGGTTGCTAACTGCAGGGTCAGCAGTTGGAAA
CTACCAGCTGCTTCTCAGGAGAAAGCTAAGGCTTTCTACTCCCATAAAGAATTACAGTCT
CAGAAACTTATGGGGACGGTGCCACCCTGCCCTATAAAGTGGCTGAGTCTGCATCAATTC
GATGGCAGTGAATTGGGTCATAGTGACTAGGAAGGTCCTCAGTTAGATGAGCTGACACAG
TGGCTGCCACAATGGGCTCAGGCGCAGGAGGGTGGCACAGGATTGGTCTTTGTTTCGTTC
TGTTGTGCATAGGCATGTTATGGGTTAGAACTGACGCAATAGGATTAACAAAAACATAGT
ACTAGCATTCTCTAGGAGGAAGTTAGGCTCCCAGAGCCAAGGTTACAACTGTGAGAATGT
CTTACTTGGGAAGTATTCCAGTGTGGAGTTCTAGCTTGGAATTTCCGTGTTACCAGTTGT
TTAAATCACTTTTTGATTGTGGTTAATTTGTTACTGATGGACAATACAAATTCCTTTGAA
GATTAACGTTAGCTGAAGGGTAAGCCCTGGTTTCCCTGAAGGCTAGCTGTTGAGGACAAG
GTCAGTCAGCAGTGAAAGGGTTAACTGCGCAAGAGAAAGATGAGGCTTTCTGCTCCCATA
AAGAGAGTGCCCATGCGTCGGAGTCAGTTCGGTAGCACTGAGGGGTTTGTCTTCGGTTTT
TTAGCTGACAAGTGGGGCTACAGTAGTTTCATTAGTAGTGTCTTTGGGATAAATGCTTAT
TTCATTATTCATCCATTTTATTCTAAGGAAGTGACAAAAAGTTAAACTGTGTGGCTACAT
TTATGGCATCTGTAGGAAGTCAGGCTTTTGGGTTTGAATGTGTTCAACCTTGTATTTGGT
GTGTAAGGGTATCCTTATGGGGGGCTGTTGTCCTTGCTTCCGAGCAATTAACTTGACTCG
CCAGCCCGTGTGGGTGCCAGATAACTTCCCAGCCGTTCCTCAGGTTTTTCTGGTATTGAG
AGTTAGAGGCTTAATAGGATTCTTCCAATGAACTGGAGGTGAAAAACTACAAAAATCATA
TCCTAATTCTATTTATATTTTTATCATTTAATCATGTTCACACCCATAAGTGTTGAATAA
GTAAATTAGTGGATTCTCAACGGTTATACAAATGACTTTAAAATTTCCTAATTCCTGAGT
GGCTTAAATTTTCCATGTGCCTGATTCCTAAAATCTGGCCTAATGAGCTTCTAGATGTAC
CTTATAAGTTCTATTAAAAGTTTATCAAAAGTTTAAATTTGACACCTTATATGTAAACAT
TTACATTCCAATCAGTTTAGGTAGTATTAACAGGCCCTTATAAATACAAAGTGAATTGAA
TCTGCCCTAGATGAATTTGTTTCCCCTTCTGTTTCAGGTTCATGCTGAATACTCTAGATT
TGTGAATCAGATTAATACTGCTGTACCTTTGCCAGGTGTGTATGTCTTCAAGTATTTATT
TTAATTTAAAAAAACAAAACCTAGCTAGTTATAGTTAGGTACAAACGATGATACCTGAAG
TTAGACTGCTGTGCCAGGGCACTAATGTTCCCTTCAATTTGGGGTGATTTGGAAGTTCAT
TCTTGCCTCAGTATTTTTCTTCCCCTAGATGTTAAGTTTAATATTCGGCTAAAATGTCTC
ATTCTGCTGCAGCTGATTAAACACTTTTTTTCTTCCCCCCTCAGGCTATACACAACCCTC
TGCTATAAGTAGTGTCCCTCCTCAACCACCATATTATCCATCCAATGGCTATCAGTCTGG
GTTACCCTGTTGTTCCCCCTCCTCAGCAGCCAGTTCAACCTCCCTATGGAGTACCAAGCA
TAGTGCCACCAGCTGTTTCATTGGCACCTGGAGTCTTGCCAGCATTACCTACTGGAGTTC
CACCTGTGCCAACACAATACCCGATAACTCAAGTGCAGCCTCCAGCTAGCACTGGACAGG
TAGGATGGCACCGTGTGCAACGTGATACCACTGAATTAGGAAAAAGCTAGGGTGGGGAAG
AGGGCAGAGGGGAAAGTGTGATATGTATTATTCAGAAGGAAATCATGTTACATGAGACTG
ATTTCTGTCTTCCTGTGGCCCTACCACCAAGTTACCTGAACACTTTGGAACGGCGTGTAC
ACGTGTGTCTCATTCTGAAGCTTGCTGTTGGTTTCACAAGTCTTGCTACCAGATTGTTTA
GCCCAAAAGTTGACACACTCAGTAAAGGGCCATCTAGTAAATGTTCTAGGCCTTGCAGGC
CATGTGGCCTCTGTTGTAGTTGCTCCACTCGGTCCCTATATTATGGAAGCGGCTGTATGC
AGTACTTACATGAGTGCATATGGCTGGGTCTAAGAAAACTTGAATGGTGGCCAGCCAGGA
TAGACCATGGGCCGCAGTGTGCCTACACCTGGCTTTGGAGCGTTAAGATGGAATGATTGG
AACTTACCGTAGCTATTCTAATTTTAGAAACGAAAAAAAAGAAACATACCACATATAGGT
TTCCCTGAGCTTCCAGACGTAAGGATTATGAATAATGGTGTCTGCTTCTCAAATTGTGGA
AGGCAGTAGAATTTCAGGAAGGAAGTCGATAGCTAGCTCCTCGTCTGGGTGAGGGAGACT
AGTGGCGCACCCTTCTCCTTGGGTCTCTCAGTGTACTCCTGCCAGAGGAAACTGCGGCCT
CGGACCATTGCCCAGCCTGATGACCAAGGGCTGTGCGCACTGACAGGCCGCACATGCGAC
ACCAGAAGAGGGTTTGTGAGCTAGGTTCTGCACGTGGCCTCTAGTCTTGCTGCTGTCCGT
TTTATATTTAAGCAGAGCTACAGTTCCCTAGCTTTGGGCTACATTCCTTTGTAGTTAGCA
ATTTAACAGTGGCTAAGAACTGCCTGTCAGGGCTTATCATCACACTTTCTTTATTTTTGA
GCTGTGTGATTTTGGACTATAACTTAAATCTACCCAGGCTTTACTTTTCCTCGGGTATGA
AACCACGCCATTCTATTATCTTAGAGGGTTGCAAAGATTACCTAAGATGAGCCAGGCTGT
CAGTAAATGTGAGCTGTTTTTCATGGCAATGATAGATTTTTTTTTTTTAATTGCTTTCTC
TCCTAATATATATTCTTTTGATAATCTTGTATATTCCGTTTTGGCATGCTCTCTTAAAAC
CTGAGACAGCCTTACTCTTGACAAAGCAACTTACTAATAACCGTGGGAACGACAGATGAA
GTTACCTTTGCCACATGTGTGTTAACAGTAACTATTATACAGAAAGAGCTAAGATATTGG
TAAAGGGACTAAGTAACTGATTATTGTTGCTATTGTCTGTCTCCTGCACAAAGTTCACAG
GTGGAGTTTTTACTACCTGTTAATGGGCATGTTTGCCTTTCATATCCCAAATGACATAGC
GGGTTTTTCTTGAGGGTTTAAAGAGGTACTATATAGAGGTCATTTTCCTTGGAATAAAGG
TTTGAAGGCAGCTGGTTAACCAAGGTTCCCACGAAGGAAACTAACAGAATGCTGCGTGTT
GATTCATAAGATGCACACTGTGACCTTGGTTTTCATCAGTTGGGTGTTCTCACATGATTG
CTTCCTTGCTTTGTTTTGGTCCCAGAGTCCCATGAGCGGACCTTTTATTCCTGCTGCTCC
TGTCAAAACTGCCCTGCCTGCTGGGCCCCAGCCCCAGCCCCAGCCCCCGCCCCCACTCTC
AGCTCAGCCTCAGGCACAGAAGAGACGATTCACCGAAGAGCTGCCAGACGAACGAGAGTC
GGGACTTCTTGGATACCAGGTTAAATACAACACCTTTCTTCACCTTAATCTCCCGACAGT
AGGCTCCTTCTAGAGAAAGAAACATACGTATCTCTGTCCACAATCCTTCCGATACAGGAT
TTTTGCTTTCTGGATTCCATCGAGCGAGATTTTTTATTAAACTTGTGGGACTAATCTACA
GCCTGGGTTTTTATGTGTGGGTGGGTTTTTCCCGTAGGTTTTACCAGGTCACTGTGGTAA
GGGAATAAACAGCTCCCCACCCAGAAAGATGTCTTCCTCTTCCTGGCATCTGTAGAAGGC
TGTATGTCCTCTTTCTGTGCAACCACTTTACTGTTTACCTCGAGTTGATGCTGGCTCATG
GCAGCCCCATACGTGTAAGAGCAGAATGGTGCTCCGTGGGGTTTTCATTGGCTGGTTGTA
CAGAAGTGGGCTGCCAGGCTTTTCTTCTGAGGTGCCCCTGCTGAGTGCCTTAACAGCCCC
CCTTAGGCACGTTCATAGCGCACTCTTGAAAGCCCATGATGGTTCATCTCTAAGATTCCA
CCTGGAGCTGTCGTTATATTTTAAACTATGGCTTTCAATGTAGCCACACACTCCACCCAC
CCCCAAAAGGATGATGTCCCCTCCATTCTTCTCTGCAAAAGGATGCCAGAAAAGGGGGGG
GGGGGGAGAACTGGACTAATCATGGGCACACAAATAATTGTGGGTATACATTGAAGAATT
TCCAAAGGCTATTAAAATATGCCACATATTTTGTTTTGAGGCAATGAAGACCCACCATTG
CTTTTTGCCAGAATCTGTAAGAGCATTCTTTGAGGCATTTTAATAGTTTATAGCTAATTT
GTAGACACCAGTTGAATTAGGGGTGATCGGTTGAAAACAGACAGACATACAACAAAATGA
ATCCCAGCATCCCTGCTCTGACCATAGTTATGCTCCAAATCCCTCAGCCATGTGATTCAA
TTGAACTTTACTGCCATTTATGAGAAAGATGAGGCGCTTGAGAGTTACATTAAGGAGCTA
AAGCCAATGCAGCAGTTGTAGATTTGCTAATGCCGCTGTATTTTTCTGCTCATAGCATGG
ACCCATTCATATGACTAATTTAGGTACAGGCTTCTCCAGTCAGAGTGACATGGAAGGTGC
AGGACCCAAGCCAGCAAGTTCCTCTGGCAAAGAGCGAGAGAGGGACAGGTGAGTTTGTTG
GAACGCGATTGAATGAATCCACTCAGGTGTTGCTTGTGCCATTCGTGATAGTAATGATCA
TTGCTGCACACTTGGATCGCGTTTGTGTAACTGATGCAATAGTGGAAAATGGTAATACCT
TTCCCGGGCTTAGAAGAAGTTGTGCTCTACTTTAAATGATCTTGTACCTGCTCATTCTTC
AGACGTCTTTCTTGGGCTTTCGTTGTCTGCATCTTGACCATTTTCTTACTACTTGGGATA
TTGTAGATGGAGGTACTTGAATGGGGAGCCCACCTCCTTGCCAATGTGATAGATTTGCCT
TCCTGACTGGGAACTGGCCGCTCGGTTCCATTTTGGCTGCTTTGGCAGGCCTTACAATCT
CACAAGTGTGATAATATCCTGAAGTATCAAGTGGAAAGAATTTTAATTAGCGATCAAAGC
TCTAATCTACTTGGTAAGTTAAAAGTGATTTGAATCTGAGAGAACATTTTTTCCGTTTTT
CAACAGGCAGTTGATGCCTCCACCAGCCTTCCCGGGGACTGGAATGAAAGCAGAGTCTGA
TGAGAGGGATGGGCCTGGGGTCTTCGCAGGGGGCCATGGTAAGTAAGGTGTAGCTGGGGA
GCGGGAGTCTTGGGCTGTTTGTTGTGTTTAATCCAACCTCTGACCTACTGGCTAATAAAG
AACACTTTTTCTTTAACACAGATGATACGGTTACGCAGCCTTGTGCAACCTGTGTCTAGA
AGAGAGCTAGACGACTTAAGTTGCACACACAGCATCAGTGACACTAACACCATAGGAAGT
AGTCCTAGTGATTGGAGGGTTGTTGCACAGTGTTAGTGAGTTACCAGCGGCACCCGATGT
GGTTCTACTACAGATTGTGGTCTCTTTGTATTGCAACTGAGCCGCATCTCCTGTCCATAG
CTCTAAGGGTTGATGCTGCTCAGCCTGTTAGGGAAATGTTGTCTTAGTATCCCAGAACTC
TGAACCCTTAGAGGTACACAATCATCCTTTTGTTTGTTGCTTGTAGTCATAATAAAAATG
AACAGAAGAAAGTACATTTTTCTTTTCTTAACTCCTTTTCTTTTAACTCTTTAAAAGGTG
AATTATCAACCCCCAGAGACTCACTTGCTAACTTTCCTTTTTTTTCTTTCCTTTTTTTTT
TTATTTTATTTTTTTGTGTTTCTTTTTTTCTTTCTCTGTTTTCTTACATGGTTCTGGTGG
ATTCACATTTGCTGATGCTGGTGCTGTTTTTCGTGTGATCATCAACGTTTTGGGGTGACC
ATTGACCCTGTGACTTCAAAATGGTGTCCAACTAACCACTTATAATTAACATCTTTTTTT
TTTTTTAATTAACGATTTTATGGTATTTTTTTTCTTTTTTTATGTGGGGTATGGGCGTGG
GGTATCTTCTCTCTCCTAGATTATCCAGCCAAGAAGATGAAAACTACAGAAAAGGGTTTT
GGCTTGGTAGCTTATGCTGCAGACTCATCTGATGAAGAGGAGGAACACGGAGGTCATAAA
AATGCAAGTAGCTTCCCACAGGGCTGGAGTTTGGGCTACCAGTTCCCATCCTCGCAGCCA
CGAGCTAAGCCACAGATGCCGTTCTGGATGGCCCCGTAGGAAACACTGAACCAGAACATT
GACTCTCAAGGACTCTTCTGTAGCAATAATGCATGTATTTGATTTAAACAAGACTTCGGG
GGCCTGTACGGAGAACCATCTTGGACTTTTGCTGAAGTTAGAGAAACACTGTCCCCTTCC
TAACGGGCTCCATTCCTCTTAACATCCTTATTTCTGCAGTGGCATAGCATCTGTTAAAAT
TTACTTAGAAACACACTTGTCTCTGAAGCTTTTTTTAAACAGTGGATGAAATGTGCTTGT
TGCACACAGCACCCAGACAAGGTTGGTTAATCCCATTTATATGTGACCGGGCCTAGCCTT
TTCCAGACACATAGCCCTTACTCTGTTGTGAAGAAAGTTTTGGTTGATTTTACTGCTGTT
TAGTAAAATAATAACTGGTTAGAAACAAATCGTGTTTATTGGGTGGAAAGGTAGTGATAA
TTAAGGCCATTCTATACTTTTCAGTACTTAATTGTAAGAGCCTCATTCATGTTTCATTTT
TGCATTCTTCAGAGAAAATGCTTTTGTACTAAATTCAAACTATTGGCTATAGCTGGATCC
TGGGTAGGAAAATGAAGTTATTTTTCCTTGTGTCTTACTTTTGGGATGATCCAAAGGCTG
GCCCCCTCAGGCACACTTATCTTGGCCATTGCTTTTTAAAAAATTGCCCTTCTCAGCTCC
TTGTCTTCAGCTGGGTCAGAGGAAACGACTTGACCAAAAGCTGGTCAGAATTCATCACAA
ATGAAACACAGTGGTCTGTCTCTCTCAGAAGTGGTTGCAGCTAAACTAGAGAGATTTGAC
TGCTCGCAATAGGATGGTGGACTTAGTGACTGAAGTTGCAACTTGTCCTTTTTTCTTGGC
AATTACAGTTTTGCCAAAAGAACTTTTTTGTATCAGACATTGATGTGTGAAAGTGAAGGA
GCTAGTCTGCTGAACCAGAAGTAGTTTGAAATACCGAACTGTCATTTTTGCACATTTGAA
CACTTGGCAGGCTGGCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 1514..1529, 1532..1543, 1545..1574, 1577..1589, 1591..1614, 1684..1799, 4223..4351, 5667..5668, 5670..5731, 5734..5743, 5745..5750, 6863..6915, 7167..7302, 7405..7432, 8126..8323, 8426..8439, 8540..8600, 29497..29554, 29804..29879, 29881..30058, 31705..31878, 32935..33047, 33546..33637, 34459..34658
1001..1038, 1514..1529, 1532..1543, 1545..1574, 1577..1589, 1591..1614, 1684..1799, 4223..4351, 5667..5668, 5670..5731, 5734..5743, 5745..5750, 6863..6915, 7167..7302, 7405..7432, 8126..8323, 8426..8439, 8540..8600, 29497..29554, 29804..29879, 29881..30058, 31705..31878, 32935..33047, 33546..33637, 34459..34655
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved