Echinops_telfairi Locus BIN1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi BIN1
Echinops_telfairi
BIN1
GeneScaffold_3939
SNORA33
45200..45333
76327
GAGCAGCCAGAAGGACAGGACCTGGGGCGGGGTGCCGCTTACTCAGCCTGACCATGTCC
TCCTCCTTCCTGCTGTAGATTTTGGGTACCCGGCTGCAGAAGGACCTCCGTACTTACCTG
GCCTCGGTCAAAGGTAAGGGTCAGACAGGGTTCTGGAACAGAGCTGATGGGCCCTGCCCA
ACTCAGAGCTGGAGGGCACAGGGCTGGAAGGAGGCATCAGGGCCAGGTCTGTGCAAGGTA
GACAAGGGGGTGCACTGCATCCCCCCTCCCCGAGCCTCCTGGTGTGGGGTGATGGAGGAA
GGGCGGCTCCCTGCGTTAGCACCCCCAGCCCTGGCTGCAGCCATCTCTCTCTGCTCCCAG
CCATGCACGAGGCTTCCAAGAAGCTGAACGAGTGTCTGCAGGAGGTGTACGAGCCTGAGT
GGCCTGGCAGGGACGAGGCGAGCAAGATCGCGGAGGTGCGTGGACAGCGGCGCAGAGCCT
CCTCACAGAGCTCTCTCTAGGCCCTGCTCTCCCTCCCCCGCCCATGGCATTCGACTTGGC
TGTTGTGAGCATTAATCCAAGGGCTGGGATGTCTCTCATTCTATGTGTTGGGGCTCATGA
CGTGCAAAATCCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GACATTGGGCCTCCACTCAAGTACTCCCTCAACACAAGAATACTTTCTTCTAGTAAATTG
GCATTCTATGATGTTCACCTTCCCAACACAACTGCTGAAGACAAAGCGGGTGAATAAGCA
AATGTGGTGAAGAAAGCTGATGGTGCCCGGCTATCAAAAGAGATAGCGTCTGTGGTCTTA
AAAGCTTGAAGGTAAACAAGCGGCCATCTAGCTCAGAAGCAACAAAGCCCACATGGAACA
ACATATCAACCTGTGTGATCACGGGGTGTCGAACGGATCACTGAAGACAAATGGGTGCAT
AAGCAAATGTGGCGAAGAAATCTGATGGTGCCCGGCTATCAAAAAGTATAGCGTCTGGGG
TCTTAAAGGCTTGAAGGTAATCAAGCGGCCATCAAGCTCAGAAGCAACAAAGCTCACATG
GAAGAAGCACACCAGCCTATGCAACCACGTGGTGTCGAAGGGATCAGGTGTAAGGCATCA
TCAGAACAAAAAAATCTTACCATAGTGAATGATGGAGGGAGTGTGGAGTGGAGATCCAAA
GCCCATTAGTAGGCCACTGGAGATCCCCTTGCAGAGGGGTCTCGGGGAGGAGATGAGCCA
GTCAGGGTGCGATGTAACAATGATGAGAAATACAATCTTCCTCTAGTTCATAAAGGTTTC
CTCCCCGCTCCCACTACCATGACTCGAATTCTATCTTGCAAGACTGGCTAGACCAGAGGA
GGTACACTGGTACAGATAGGAACTGAAAATACAGGGAATCCAGGACGGATGAGCCCTATA
GGACCAGTGGTGTGAGTGGCAAAACAGGGAGGGTAAAGGGAGAATGGGTAGGAAAGAGGG
AACCGATTACATGGAACTGTGTGTGACCTCCTCCCTGGGGGACAGACAACCGAAAAGTGG
GTAAAGGGAGATGTCGGACAGGGCAAGATATGACAAAATACCCATTTATAAACTATCAAG
GGCTCATGCAGGAGGGGGGAGCGGGGAGGGAGAGGAAAAATGAGGACCTAATGTCGGGGG
TTTAAATGGAGAGAAAATGTTTTGAGAAACGATGTACAAATGCGCTTTACACAATTGATG
TGTGTGTGGATTGGGATAACAGTTGTATGAGCCCCTAATAAAATGTTAAAAAAGAAAAAA
AAATAATGTAAACTGTGCTGAATGAACATGGGAGTGAATATGCCTGTTCGTGTTCTGCCA
CTTAATTCATTGGGATGTACAAACGGGTAGCCCCCCACCCCCACCCCCAACAACAACAAA
ACCAGAATTTTTTTCAAAGCTGTGTGTTTAAATTTATTTATAAAACATCCTTATCACCTT
CAAAGTTGTCTGCATTACACTTAATACATGTGTAATCCCATTCTTGGAAACATTTTTCAA
ACTCATTTGTTTGGATGGCTGACAGCACCTCCCTCGATTTTTTCCTTCACCTCTTCTACG
TAGTCAAATCACAGTCCTTTCATGTCCCTCTTCATTCATGGAAATGAAAAGAAGTCACAC
AGAGCGAGGTCAGGTGAGTAAGGTGCATGTGGCAAGAGAGGCATGCTGTTTTTTGCCCCA
AACGGGTTCCTGAGATAGCTGCTTGAGCAGATACATCATCGTGGTGGCAAAACCAGTCCC
CTGTCTGCCAAAATCAGGAGTTTTTGGTCTCACACCGGTACACACTCTTTTCAGAACCTC
TAAATAGAAAGCTTGATTAAGAGTCTGACCAGGTGGAATGAACTCCAAATGCACTATTCC
CCTCACATCAAAAGAACAAATGAGCATTATCTTGATCTTTGATTTCACTTGACGAGCTTT
TGGGGGGCAAGGTGACAATGGCATCTTCCTCTGGCTTGATTGATGTTTGCTTTCGGAGTC
ATAAGAATAGCATCATGTCTCCTCACTAGTAATGATCTTGGGGGGAAAAGTCTGGGTCGC
TTCTGAGCTGTCCTTTCAGAGCACGGCATGTTCCCAGCTGATGATCTTTTTCCTGGTCGC
CAGAACCTGAGGCACAAAGGTCACAGCAACCCTTCTCATTCCCAAATCTTCTGTTAAAAC
TCACTGAGCCAAGCTCCAAGATAGTCCAGATAAGTTCCCCATCTCTTAAATGGTTCGTCA
TCAATCTTCGAGGACAAACGCACAAATTTTGTTGACATTTTCATCTGTTTAGAAACTTGA
TGGACATCTAGAATGAAGTTTGCTATCAATCAACATTTCACCTTTTCTGAAACAAGAAAA
CCACTTGTACACTTGAGTTTTTCCCATAAGCTGTCCTTATAAGTTGTGTTCAACATCACA
ACAGTTTCTGCGGCATTTTTCCCAAGCAAGAAACAAAATTTCACAGCTACACACAGTTCT
CTTAAATTGGCCATCACAAAAAACGAGGTTCAAGTGAAACTGCTTTTAAGAAAAAATTCA
CTGTGAGCAGAGAGAACTTTTCCAGGTGATGCCACTGGGAGCACTAACTCAGAGCTTGTT
GCTTGATGGTGCGCTCCTTGCAGGAAAGATGCGTTCAATGAAAGCTCTGCCCAGTGGGGT
TTTTTTTTTTCCATTTTGGGGGGAGGTAGCCCTAGTAATCCCATAATTTTCAAAGAATTT
TCTTTAAAAGGGACCATACATTTAAAATTAATCAACTTCAGCATTTGTGATTATATATTC
AACATGTAAGAGCTTTAAAATATATACTGTATATACTCGAGTATAAACCCAACCAAATAG
CAGCCAAGGCACTTAATTTTATGACAAAAACTGCATTTAAAATGTTCTGAAAAACTTGGC
TTATATACACGAGTATATACGGTAAACATGACTTGTCTGTCAATTTGTCATACTCTGATG
GGTTCCATGCTGCTGTGATTGTGAAAGCTATACATTTATATATTTTCAATTCCTGAGGAA
TTACCCATGTGGACAGGAGAACCCAGTGATTTACTTCTAAAAAACTGGCCATGGAGTAGC
AGTGGAACTTAGATATTGAATGGTGCAGGAAGCATCAGAAGAAGGTGGAAGGAATATTGA
GCTAAAAAGAACGTGGTCAATATGCAATTATATCAGAAGGTAGCACATGATCAANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGATCAACAATCAACAATATGAA
AGGAAAAGTCCCAACCAAAGGAAATTCAGACTCATATTATACAATGGAGGTAAAGAAGCA
TATGTCTGGCGTCTAGAAGAGTCCTTAGGATGTCTATAAGTACTACTCCAGCCCTATAAC
TAAAGTCAATGGTAAACTACAGCAACTCGATTGTGACATGACTAGTACCCACCAGAAGAA
GCAGCACAACTGACTGGGATGTTTCCTGAAGGCAAAGGGGATGAGTGGTGAAAGAAGGTG
TTCCAAATACCAGCTACAGCCATGTGATCAGTAGTAGAAACTGTTACCTACAAATTTCAG
GTTTGTACCCTGGATCAATTGAGTCAGGTCAACAACCACTCCAAGTAGAACACAGAGAGA
GTAAAACTGGATTTTGTTAGAAGCTAGCTAGGCAAGCATCCTTCCAGTAACATAGTGGTT
TGGAGTCAACACCATCCCAATTTCTCATATATTTATACTGATTTATTCTTCCAATAAAAA
AGCCATAAATCAGACTGGATATGTGAAAAATGATCTATTGCCTTGATATTTAATTTCCAA
CTAATCCTTTAGCCTTGTAATAATGACCAAGATAGCTAGAGGTGTAAATTTGACCAGCAG
CAAGGTATAGCTAGCAATTAGCATTCCAAACTCTTGTTGGACCCTTGGAGAAAGGCAAAA
CCCACAATAACAAATAAGAAGATTGATTATACTTAAACAGGATTGACTCAAATCAAAATA
GCTATAATTTGCTTATAACTCACAAACTCTCCCCATTCCAGACTTAGACTTGTAATACTG
AACCATGAGACTTGGAACTCACAATTTATTCCTGATTGTTATGCATAACTCAGAGAGTAT
CAGCAGTATTATCACCACCTGGCAAGAGAAAGCTTCTGTTAAGCTACAGTTATTTTACAT
ATCTCATTGTCTCACTGGGAGGGACTTTGAGAAATTCTTCTGAAGAATGTTATACATTTT
CTTCTATAGAACACTGGCCATCATTCTCTCCCCCTTTAAATATACAAATTAAATTATTGA
TTTGAATGCCATCAGTTGCTTCACCAATTTCTTTTTAATAACAAACATTTTCTAGCCATA
TATTTGGTGGAAGACAAGGGGCAGGTCAATCTGGAGAATTGCTATTAGAAAAAGTAATCT
TTAAAATTTGACATGAATTCATATCAGAAACTTAAAATGAAGTGAGGCCTCCATTTTCAG
ACTTTTCCATTCACACAAATCTACTTCTGAAGTTTGACTCCTATACATTCTCCTCTTGAT
AATGGATTTTATTTAAAACCCTTTTGATCACTCATAAGTTGATGTGCTTCTACTGCCTAA
ACAGCTATACAATTCCTTTTTTCCCCATTTATTAATAAATCATTTTATTGGGGGCATTTA
AAGCTCTTATAACAATGCATACATCCATTGTATCAAACTCTCTTGTACATATGTTGTCAT
CATTTTCAAAGTATTTTCTTTCTGCTTGAGCCCTTGGTATTAGCTCCTCTTCTTTCCATC
CTTCCCCCACCCTCCCACCCTCATGGGCCCCTGATAAATAATATATTATTATTATTTTCA
TATACACTGTTCACTGTCTCCCTTCGCCCACATTTCTATTATTCACCCCCCTTGGGGGTA
GGTTATACGTTGATCATTGTAGATCATTGTAGACGACATTCCCCATTTCTCCTCCATCTC
CACCTCCTTTGCCCCCTTCCTCATGGTATTGCCATTCCCATTACTGTTCCTGAGGGGTTT
ATTTGTCCTGAATTCTGTGTGTCGAGAGCTCTAATCTGTACTATTGTACATGTTCCGGTC
TAGCCAGATTTGTAAGACAGAGCTGTGGTCATGATAGTGGGGGGTGGGGAGGAAGCATTA
AAGAACTAGAGAGGAATGTTGTGTGTTCCGTCGGTGCTTTGCTGCACCTTGGCTGACTGG
TTTCTTCTTTGTAATCCTTCTGTGAGGGAGTGTCCCATCACCTACAGATGGGCTTTGGGT
CTCCTCTCTGACCCCCATCATTTGCATCAATATATTTGTTTGTTTTGGGACCTCTGATGT
CTGTTACAAAGTAAAAGGAAATAGAGGAAAGAACTAGGAGGCAAAAGAGGTACAAATACA
GCCACGCACTTACGTAAATATATAAATATATTAATAGGGATGCGTTTGTCCAGATTGACT
AGAGAAACAAATGCATAGACACTCATACGTGTGTAACAGATGATTTTACATCAAAGAGTA
ATTGTATATTAAGAAAACAACTCAGCCCAGTCCAGATGAAGTCCATAAATCCGATAGTAC
ATCAAATGACCAAAATCAGTCCCTAACTCTCTTTTCAGACGTATGCACACATGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTAATAGTTTATTAGGGTTATGGCAGGGAAGATTGGGAGCAAATGGGGAGCTG
ATATGAGTACAAGAAAGGAAAATGTTCTAAAATGAATTTTGGAGATGATTGCACAATTCT
TTTCAGTATATTTGAACCATTGAATATACTGTATGATATGTGAATTATATGTTAAAGTAT
TAAAATTAAATATAAGTACTTGGATAATTTCTAAAATATTTTAAAAATAAAGCAGAGGCT
TGTCCATTGACAATAACTGTAAGTATTAGCAATGCCACCAGTTATTTCTTCTAACGTGGC
AAATATACTCTGAATGGCATGTACAGGAAAGAAGGGCTCTTAAAAAGAAGTACTCTAAAG
CCAGCCATTGATTCTGCTTACTTGATTGTGTTTCTGCAGAAATTTAGAAAAAGCTGGCAA
TAACAGTAAAGCCATGTAACGAGCCTTAAGGATAATTGAGATCATTAAGGTCCCTGAAAA
TGGCTACATTAATAAAAAAAAAAAAAAGTACTGTAAGTTAGGTGAATGACTTAGAGAACA
TTAGCCTATCATTTTAAAACTAGCCAAACACAGAAATACCCAATCATGCATTGCAAAACA
CATATAATTCTTACTTATCCAGGATCAGTTATAGCTTTACAAAATTTAAAGGCATGCAAT
AATAACATGATAGCAAATATAATAAAAAGCAATATGCAAAATATAATGATTTGATGCCTA
TTTATGTGATCTTGTTCTGTAATCTTGGGGTAAGTTGTCTGCCTCTTATGCAGTCGTCTA
CTTCTGGCCATCAGTTGGGTGAAATTACGTGTAATGTCCACTGCTGTCCTACTCACATGA
AGACAAACTGATCCTTATCAGACAGAGATAGAAGAATGCTTCAGTTGAAATTATTATACA
GAGGAGGCACCTTTGGAAGGTATTCTGCCTTAAACTGTTCGATGCTTGCACTGATCTGCT
GTATTGTGCTGCTTGTTCCTAGAGGTGGTTATTCAGAACATTGGTCAGCATCCGCACACA
ACTGTCACTCTTCTTTTTCACTGTAGATGAAAACACTTAATAGGACCATAATAATACCTT
TTTAAAATACAAAACTTAATAGAAATTACTTATAAAAGTAATATAAAGTTAGTTAAGACA
TGGAAATATCTCAAGTATAAATGATTAACTTGATTTGAACATAATAATCTTGAAACAGTA
TATATCAAATTATCAAATTTTTAATCAACTGAATTTAACTTTATGAGGAGGTAAAATCAC
TTTCCAGGTTAAATTCACTGGCTTTTTTGTTGTCAGATTGAAAATTTTAAAAGAGCAAGA
GTTGTGTTTCTGTTTAACAAATAAAAAATAAAGTCAATAAAATTATAACATAATTCTATG
TGTTTACTGTCTAATATCAGACAAAAACATAAGGGAAAACACTAATGTGATAGGTAGGTT
TATTGTGCCACCCTGGCCAATAAGAACATGTGGGATTAATGAGGTCACAGTTTGATTGGA
GGACAAAGAGATAAATGACTCTGCAAACCCCACTGATCTTCTCTTTTGTTCTCTGGTGAT
CAAACCATCGTGTGGCTACCTTGGCTGGTTCTCTGCCTCAACTTGTGAGCTACACTATCT
GTGGGACACCCAACCTGTGGACTGTGTCACTAGAGCTTGAGGTTCTGTGTTAGACAGGGT
TCTCTAGAGAGACAAAACCTGATTCCTAATAATTATATATATATATATATATATATTTAT
AAAGGATAGATAGATATATAACACAAGAAATGATCAGTTAAATTATATACAGATCGATAG
ATATATAATACAAGAATGAACAGTTAAATTATAAAGCAGTACAAATGGCTCAGTGCAACT
CACTTCCGTGAAACACTGGCAGTCCTTCAAGTCTTTAGGGCCGCCAGGTAGTCCTCTGTA
GAGAGAATCAGGCTATCCCGGCACAGGCAGCAAACAGCAAGGCAGGTCACCAACAGTCAG
TGCCCAACTCAAGAGATGTAAGTTCCAATTGTGTGGCGAAGCAAGTCTTAAAGGGACCTC
AAATTACAGCGACACAGTCCACAAGTTAGGTGTCCCACAGGTAGTGTAGCTTGCAAATTG
AGGCACAGAACAAGCAAGGCAGCCACTCACTGGTCCGATGATCAAAGAGTGAGAGACAAG
AAAGGCGAGGCTCGCCGAGCCACTCATCTCACCGCCCTTCAATTAATCCCACATGTGTCT
ATCGGCCTGGCTGGCACAATAAACTAACTATCTCAGGTTCCTTTGAGATCTGCTTCACCA
CACTCCTGGTGTATACATCTCTTGAGCCGGGGACAGTCAGATCCTGTCATCTGGCTGACT
GTTGGTGACCTGCCCGGCTGTTTGCTGCCTGTGGCCAGACTGCCTGCATTGCTTTACAGA
AGACTCAGCTGTCTGCTTCCTTGACCTTGGACCCAACAGCCCTCCTGAGTTGAAGGATTG
CCAGTATATTAACGATTTCATGGAATTGAGTTGAACTAAGCCCTCTGTATTGCTGTGTGG
ACTAATTAGCTGCTATATTCCTTTGTGCTATATATATATATATACACACACGTGTGTATG
TGTGTGTGTGTGTGTGTGTATTCATAAGTGTCCTGGTTTTGTTTCTCTAGAAAACCCTTT
CTAACACAACTAACATAATTTTTCAACCTAAAAGAAAATCAAACACCTCTTTCATTAAAT
AAAAACTTTTAAGCACTAAAAAAAAACCAAACAAACAAACAAAAAAACCCCTTATTGTGA
ATTGTGTGCAGGTTTACATATTAGTCATCATTTCGACAATTTAAACAACTTATCAAATCT
CCCAGTAGCTTGCCCTGCCCACCTCCACTGTTCTCCTCTTCTCCGTTTTGTTGGTTATTA
TCTTCTCCTTCATCCAAGTCTATCCTCCAGCCTGTTGCTCTCTCTCCCTTTCCTTCTCTT
ACCTGGTAACCACCAAGTACGTTTCCTTCAGTATGGAGATCTTTAGCTTGACTTTTTATT
TATAACTGTGATCTCATACAATAGTTTTCCTTTTGTTATTGACTAGCTTCACTCACCATA
ATGTCCTCTAAATCCATCCAAGCCATGAGGTGTTTGTTTTATCACTATTCTTTAACAATA
GGTAGCATTCTATTGTGTGTATGTATCAGTTTATTGATCCATTCTTCCACTGATGGGCAT
TGTTTCCATCTACTTGCTATTGTAAATAGTGCTGTGATGAACACAGGTACACATCTAGCT
GATTGTACTGTACTCTCTATTTCTTTAATATATATACTAAGTCAAACTATTGCTGGGCCA
TATGGTATGTCTATTCCTAGCTGTATGAGGAAGCCTCATACTACTTTTCCACAGTAGCTG
TACAGTTTTACAGCCTCACCAGCAATATAAGGGTTCCAATTTCTCTGAACCCTCTCTAGC
ATTTGTTATTTTCTGTTTGTTTGTTTTTTATGAACTTGACCATCAATACTGGTTTGAGGT
GGTATCTCATCATTATTTTGATTTGCATCTCTTGAATGGCTAATGATTCTGAATATGTTG
TTGGCTATATGAATATCTTCTTTGATGCAATGTCTGTTCATGTTCTCTGTCCATTTTAAA
ATTAGGTTATTCATCTTTTTCTTGTTGAGATATTGCTGTTTATTAATCATTTATTGCCCA
GTATATTGCTTCAAAAATTTCCCAGGCTATGGGTTTTCTTTTTAAATCTTTTGATAAAAT
TTTAAAAATAGTTTTATTGGCATATACTTCCCTATCATACAATTTAATCATTCATTCATA
TTAAGAAGATTTGTGCAATCATCATCACAATCAATTTCTGAACATGTTTTTCTGATATTG
ATTATTGTCTCTCCATTTCCCCCTCATCCTCATCTGCCATTCCCTACCGAGTTACTGTTT
CTATAGATCTACCTATCTGTAGTTTCATATAAAGAAAATCATACAAAACACAATCATATA
AAATGATACAAAGCAAATAAACAACCCCTCCCTCCAAAAAAATAATGACAAGAGAAAACC
TCAAAGAGAAAGGAGAAAATATTAAAGCTGGAGACAACTTTAAAATGGGTCAAAGGAGAG
ATCAAATGATGATATTACATTTTAACCTAAGTATATCTGCCATAATCTCCTTTTGCAGTG
CCTTCTGTATGATAGCAAGGCTATTCACACCCTTCAACTATGGTCACGGGAGATTCACCA
GGCAGTTAATCCCTGTGGAGAATCTGCAAATGCATTTGGGGCTTCCACTGTCATCCATAC
CAAACCCAAACTCGCTGCTACCTTTCAGATGACAGCCCAACACATAACCACTACTCCATC
AGCGCTCCTTGTTTGTCATCTGTAGCCTTCTGCAAATCAGGTGCTCACAATTTAAGCTAT
AATACCATTTCCTCCTTTGAATTTAGATTTTATTGTTTACAGTCCTTGGATCACAAAGGC
TGATGTGCTTCCTCTATGTATACTTAGTTGATTCCTCACCTAGAAGGCTGTTGTGTGAAG
ACAATCCTTTAAGTCCACAGACACTATTATTTCTGATACCCAGGTACCATCTGCTTTCTT
CATCACATTTGATATAGCATCTATAACTTCAGTTAGCCTTTTGTGAGGACAAGTATCAAG
CAGGGCCATGTCATGAAAACTAATTGATCTTAGATTGGGGCTACAATGAAGTGTAAGCCC
AAAATTCATTTATATATCTATAGTTTATATATGTTTCTGATTCACTTTAGAGACATCATT
ACCCTTTTTATGATAGAAAGCATTATAAATAATCCGCCTGGGGCATAAGGTAATTCTATT
GATAGTATCATTAACCTAGCCAATGGTACAGAATTTGAAAAACAGTCGAGAAAGGAAATT
ATTTACATATAGACTGACTTTAGGCTGCAATACATGAATTGTTTATTATACAAATTAAGT
TATACAAATTAAACTCTTAAGTGATTGGACACTATTCACACAAGCAACGAGGGTTGGTGA
TGAAGTCTTTTGATAGACCTACTTATTTTATTTTTAATAAGTCATATATTTTGTCTTCTA
CTGATTGTCTCCTTTATTATATTTGATAGTCCATGTATGCCCTGCAATATGGCCCTAAAT
TTTGTCCCAATTTTCTCTGGGATATACATTTAGGCCTCTAATCTATCTTGAGTTCATTTT
TGTGTGTGGGGTGAGGTATGGGTCTTGTTTCATTCTTCTGCTGCTGGAGACCCAGTTTTT
ACAGTGCCATTTATTGAAGATGGCGGTCCTTTCCCGTGTAATGTTTTTTGGGTCCTTTGT
TGAAATTCAGTTGCCTATAGGTGGATACTTCTATTTCTAGGTTTTCTATCTTGTTCCTTT
GATCTGTGTATTTATCATTGTACCAATACCAGGCTGTTTTAACTATTGTGGCTGTATAGT
AGCCTTTGAGGTTGGGTTGTGAAAAATCTTTTATTTTGTTCTTTTTTTTTTTTTTTTACT
TTGTTCTTCTTTTTGAATTCCTTTGTTATCCTGGTCCTCTTCCTTTTCCATATGAAGTGG
CTCAATTCCTCTTCCATTTCTTTATAGAATAATGTTAGGATCTGGATTGGAATTGCATTG
CATTTGTAGAATGCTTTAGGCAGTATTGATATATTCACTGTATGAAGTCTTCCCATCCAC
AAACATGGGACATTCTTCCATTTGTATGGGCCTCTTTTGGTTTCTTATAGCAATGTTTTC
TTTGCAAAGGTCTTTTGTTTCTTTGGGTAAGTTTTTTCCTTGGGTATTCCATCTTTTGCG
TGGCTACTATAAATGGTACTGTGTTCTTGGTGTTTGATTGATTTCTACTTGTTAATCTTG
TATCCTGCTACTTTACCAAATCCCTCAATTGTTTCCATCAGTCTTTTTGTGGACTCCTTG
GGGATCTCGATATAAAAATAATATCCTCTGAAAGTAGCAAGAGCCTCACTTCTTCCTTGC
CCAATTGCAGTCCCTTGGTTTCTTTTTGTTATCTAGTGGTTCTGGCTAAGACCTCTGGTA
TGGGACTGAAAAATAATGATAATAAGGAGCAACTTCTCTAGTTAAAGTTTTCAGGGCTGT
ATGGATTGCGATAACAGTTGTATAAGCCCCTAATAAAATGTTTAAAAAAAAAAAGTTTCC
AGGGAAATGTTTTCCGTTTTTCCCCTTGAGTGTGATATTGGCTATTGGATTTGCGTATAT
TGCCCTTATCAGCTTGAGAAATATCCCGTCTATTCCTATTTTAGTGAGTGTTTTTATTAG
AAATAAAATGGATATTGTTAAAATGCCTTTTCTGCATCTATTGATATAATCATGTGGTTC
TTACTCTTTGTTTTATTTATGTGGTGGATGACATAGATTGTTTGGGGGATGTTGCTCCCT
GGTCTGAACCCCACTTGATCATGTTGATTTTTTTTAATATGTTGTTGGAGTCTATTGGCC
AGAAATTTGTTAAGAAATTTTTGCATCTATATTTTTATGAGGGGATGGCCTATAAGTTTC
TGTCTTTCTGGGATCTTTGCCTGGTTTGGGAACCAAGGTTATGCTTACTTCATAGAATGA
GTTTGAGAATTTGTTTTTCCTTTCTATACTCTGGAACAGTTTGTGTAGAATTGGTGACAG
CGGTTCCCTGAATATTTGGTAGAGTTCCCATATGAAGCCATTTGATGCTTGGCCATTCTT
GGTTGGAAGTTTCTTGATGATCTCCTCTATTCCTTCTCTTGTTACGGATCTGTTCACGTG
TTCTACATCTGTTGGCTTTAATTTGGGTAGACGGTCTATTTTTACATATGTGTCTATATC
TTCTAGATTATCAAAGTTGTTGTCGGACTTTTGTAGTACTGTGTTATTTGGTTTATTTCA
TTTGGATCTTTTGTAATGTCACACTTTTCATCTCTAATCTAGATATTTGCCTGTTCTCTT
TCTTTTCCTTTAAGTTTGCCAGCATTTTAATTTTCGATTTTGTTAATCCTTTTTTTAAAA
AACTTTGTATTTTATTGATTGTTTCCCTTCCTTTTCCTATTTTCAAATTTATTTATTTGT
GCCCTAATCTTTACTATTGATTTTCTGCTGTTCTTGGAGGGTTTATGTTGTTGCCCTTAT
TCTAATTGTTGTGCTAAAATGTTGATTTTGGATCTTTCTTATTTCTTCATGTGTATGCCC
TGTGATAACTACTTTTTCTGTATGTCAAAGGTTTTAGTAGGATATGTTATCATTCTAGGT
TTTTTTTTCAAAGAATATTATAATTTATCTCCTATTTGATCTATTATCCAGGCATTTTTC
AGTAGTACATTGTTCAGTCTGCATGTATTTGTGTTTCTGTTTTGTTCTTTTAGTTGATGA
TTTCCAGGTTCATAGCATTGTGATATGAAAAACTGGGCTACAGGATCTCAATATTTTTTA
ATTTGTTGCCTAACATGTGATCTATTCTAGATTATATACTCTGTTTTGGAGAAGAATGTA
TACTGTGTTTTTGTTGGGTGGAATGTCCTGCATATGTATAGGAAATTGAACTTGCTGATT
ATGGTGTTTAGCTCTTCTATTTCTTTATTATATTTCTTTCCTGATGATATGTCTCTCTTT
GAAAGTGATGCGTGGTAGTCTCCTACTATTATTGCAGTGCTGTTTATTTCTATTTTTAAT
TCTGTGAGAATTTGATTGATGGATTTCAAGGGTCTTTCATTGGGTGCATATATGTTTATT
AAGGCTATATTTTCCAGATGCATTATTCTTTTAATCATTATGTATTACTCATTCTGTCTC
ATTAAGTTTTTTGCCTTAAATTCTGTTCTATCAGAGATTAACATTGCCACTCCTCCTTTT
TAAAAAAAGAAATCATTTTATTGGGGGCTCATACAACTCTTATCGCAATCCATACATACA
TCCATTGTATGTCAAGCATATTTGTACATTTGTTTCCGTCATCATTCTCAAAACATCTGC
TTTCTACTTGAGCCATTGGTATCAGTTCCTCATTTTCCCTGTTCCCTCCCCTCTCTCAGC
TTCCTCATGAACCCTTGATAATTTATAAATTATTATTGTTTTTCATATCTGACACTGTCA
GATGTATCCCTTCACCCCACTTCCTGTTGTCCGTCCCCAGGGAGGAAGGTTGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAACGTCCACATTTCAATCCACCTGCCTTGACCCCTCCATAAATC
GCCCAAAAGTTCGCCTAGCACATAGTAAGATGACTATGAAATATAGTTACATTCCCTTCT
TTCCTAAAACACCAAAGGAAGATGTATAAATCCTTTCTTCTACGTTAGTCGCCTCCCCCT
CCCTCCGACTGGGGGCATTTGAGCGCATAGACACTCAGTGTCCTTATTGATATGTGTAGA
TTTGTTGTTGTTATTTTACTGTGCTTGTGTTTGATTTCTCCCCCCACCACCTTTTTTGGG
CGTGTGATTTTGTTGTGTCTCCGTTCCTCCTCTAGTTGTGTGTTGTTTTGATTGCTGCTA
TCACTGTGTTAGTTTCTCAGTGGTGTACTGTCTCTTGCTCTTGGTTTGTCGCTGGTGCTG
TTGATTCTCTATCCGTAGTGAACTAGTTAATATTTTCTGTGATGCTGGTCTTGTTTTTAT
GGATTCCTTTAGGTTTTCATTCCCTGGAAATAGCTTTATGTCACCTTCATATTTAAGGAA
TAATTTTGTTAGCTATAGGACTCTTGGTTGGTAGTTTTTCCTTCAGAATTTTATATATGT
CCCTCCACTGTTTTTTTGCTTGCATATTTTCTGCTGAGAAATCCAAACTTATCCTTATCC
TCATTGGTTTTCCTTTATACGTCGCTGTTTTCTTTTGTTGTTGTTTGTTATCTAACTGCC
TTCAGGATTCTTTCTTTTTTCTCAAAATTGGATAGTTTAACCACCAATGTTGTGATGTTT
CTCTTTGGGGATCTATCCTGTTTGGTTTTGTCTCAGGTTCTTACACAGTATTTTCCCCTC
CTTTATGATGTTCAGAAATTTTCTTTCATGACTTCTGATGCTATTTTCTGTAGATTTTGT
TTCTTCTTGTTCTGGGATCCTGATGAGACGTAGATTATCTCTCTGGATACTGTTCCATAT
CATCCTCAGTCTTTCTTCTGATTCTTTCATTGTCGTTGTTTTGTTGTTGATTAATTTACT
TGTTGATTGTAGTCACAATGATTGTCTTTCAGTTCACTGATTCTAGTTCCCTTTTCCTCT
ATTCTATTCCTTGGGTCTTTTATTATGTTGTCTAATTCTGTCAACTCATTGTTTGTCTCC
TGGAATTCCTTTGGGCTTAAGGATTTTAGCTTTCAATTTCTTCTGTTGTTCTCTAGAGTG
TTCCCCACATCTCTTGAAGTGACCTAAACATCTTTCTTCAGAATGTTTCTGGTAGTTCTA
GGGCTTCTTGTTTAGATGCTTGATTGGGTTTGGGTGATTTTTGTGTGTTTGTTGGTTTTT
CTTTATGATATTATTATTATTAATTTGCTGTGGTTGACTGCGGTTTCCTCAGCATCATGG
TACTATGGCACACGTAGAGGTGTGTGCGCTGCTGGGTCATGGAGAGGTATTTGGCTCTGT
CTAGTGGCATGGGAGAGGTCTAAGAGGAGCTTGAAAGCCTACAGTGGTGATATGTAGAAA
AGGGGATAGAGAGGGATAAGTGGAGAAAGTGGGAAGGAAGAAGAGAGAGAATAAAATAAA
AGCACTGAGAGTATTAATAAGAGGCTGTCTGGAAAGACCAGCATTTTTGTAAAAATGATT
TATTTTAAATGTATTTTAAAAGGGGTAATCTCATGAATAAGTTTCACGGAAATATATTTC
ATGAGGAAAAAGAGAGAGAGAAGAAAGAGATAATGGGATTATGTAAGGGAAAAGGGGGGA
TAAAAGAGACAAAGAGTAGGAAGAGATGAGTCAGTCAGGGAGCAGTATAGCACCGATGAA
ACATACAACTTCCCTCTAGTTCTTTAATGCTTCCTCTTCCACCCACCACCCACCCCCACT
GTCATGATTCCAATTCTACCTTACAAATCCGGCTAGACCAGAGCATGCACATGGGTACAG
ATAGGAACTGGAAACACAGGGAATCCAGAACAGTTGAATCCCTCAAGAACAATAATGAGA
GTAGCGATGCCAGGAGGGTAAGGGGAAGGTTGGGGGATAAAGGGAGAACCAATCACAATG
ATCTACATATAACCTCTCTCCTAGGGGGATGGACAACAGAAAAGTGGGTGAAGAGAGATA
TTGGTCAGTGTAAGACATGAAAAAATAACACTTTACAAATTATCAAGGGTACTTGAGAGA
GGGAGGGGGGAGGAAAAAAATGAGGGAGCTGATACCAAGGGCTCAAGTAGAAAAAAAATG
TTTTGAAAATGATGATGTCAACAAATGTACAAATGTGCTGGTCATATGGATGGATGGATG
GATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGGCTGGGATGTCT
CTCATCTATGTGTTGGGGCTCATGACGTGCAAAATCCCCCCCACTCCCACCCCAGATCAT
AGCTACCCATGGGAGTTGCTATACCACTTTACGGGAATGGTGAGGAATCAGTGGCTCTGG
GAAGCCACCCTGTTGCAAACTAAGGGGCAGGGGCTGACGATGCCCAAGTCTCCACTCTTG
GTTCCCAGCCCCTGGGGGTGACGGTACTCCAGGGGCCACACTCACTGCTCCTGGCTCTTT
CAGAACAATGACCTCCTCTGGTTGGATTACCACCAGAAGCTGGTGGACCAGGCGCTCCTG
ACCATGGACACTTACCTGGGCCAGTTCCCTGACATCAAGGTGAGAGAGGCCTTTCTTGGT
GGCCGTTCGGCTTCCGCCTTACAGCTGGTATGAAGAAAGGTGGAGAGGGAGAGAAAGACT
GAGGGACGCCGTCGGCCCAAGGGTGGCCCAGGGACTAAGGTACCCCGAAGGCAGGTTCCT
CTGCTTGACTGGCATTTCATTCTTCCTAGAGGGCATTCCTTAGGAGGCCAGCCCTGCTGG
CGATCCCAGCCTTCCTGCACTGGGAGCTTCGGGTCCTTTCTCCTTGGGTATCAGGCCTGT
GGGAGGAGACTCTACGGTGTGTGTGTTTGGTGTGCACACATGGTGTGTGTGGGAGGTTGG
GTTTATAATGTGTGTGGTGTGTATTATGTATGTTTATGGTGTGGGTATGTGTCTGTGTGT
TGTGGGATGGCTGTAACCAGATGTGTCAGGTCTGAGGACTTGCTGTGCTGCGTGTGCTAA
AGGAGTACCCGAGGATGGCACATGTCACTTCTTACCTGCTGACGCCTCTCTGTGGTGTAC
TTGTGTGGGTTGTGTGTTCAGAGAGCCAGCTGGTTGACCTTACTCAGCTGGAGGCCCAGA
TACTTATAGAAGTTGTCAATGTACCAGGCCGCCGGCTGGTGAGTAGGATCACAGAGGCTA
CATCCCAGGGCAGAGAGGTCTGAGCTTGGCCTGTGGACGGGTCATCTCAACAAAGCCTCA
TATCCTAACCATGAAGATGCCCAGTAGAGATACTGAGATGCCCGAGGGGACAGGGAAGAG
AGTGTGGGTGCAACGGGGTCTTTGAGGCCCTGAGGGCAGGTGGGAAGAGCCTCGTTTCAC
TCACTGACAAATGGGTTGGTGTCCCATGGAAACAGTTTGCCTTCTTGGAGTGAGATCCTA
AACACTCCAAGAGTTCAGGCAACAGGGTCACGTGCATGCTCAGACTAACCGATAGCGCCC
TCAGCATGACTCAGTTGCTCTGGGTCCAGCCTGGGGGCAGGATGTGTTCAGCCTCCTACC
CTGTGTGTACCCTCAGTCACGCATTGCTAAGCGAGGGCGGAAGCTGGTGGACTATGACAG
CGCCCGGCACCACTATGAGTCCCTTCAGACCGCCAAAAAGAAGGATGAAGCCAAAATTGC
CAAGGTAAGCTGGGGAGTTGGACTGCCTGGGTACAGCAGAGTTCGGGGAGCCAGGGCTGA
GGGCGGATGGTCCAACTTACCTCTCTGGCCCGCTGAGCATTTGCACATTAGATCTCCTGG
TTCCTGGACCATGGGCCTGTGGGAATGATCAGCCCCGTTGACAGAGATGGGGCTACTGGC
CCAAGGCCCGTAGCCTGGGAGGGGAAGTGCCCATGTGAATACGGGTGCTGGATGGTGCTG
GGACCCAGGGTGGGGGAGCAAGAGGGCCCACCCGTGGCATTGCTCTGTCCTTTGGCCTTC
CTGTTCCTCTGCCCACTCCCGGCCACTTTCCAGAATGAGCTCAGGCCTGGCTTGGGTTTG
GATAGAATGGTACCCATTCCACCGGTGCAATCTTGTCATGGGTCTCTGATGTGACTCCAC
CCCACATGGCTCTGGGGCAGAACCAGCCTTGATGAGCCCTGTGGCCCTGCTAATGATTCT
CACAGTTTGCCTTTGTAGGTTGGAGTTTACCATGGCCCCTCCAGCCCCCCACTCCCACCC
CCAGTAGTTTCCCTGTTAATTCTCTGAGCCTCCTGGGCCACCTTACAGGAGGTGTTTTGC
TTATCTATCACTGCATTGGGATATTTGGATTTCATGTTTAATATCAATGTCTCTGTTTCT
TTCTCCCCATCTCCCTCCTGTCTCTCTACCCTCCTTTGCCTTGATCTCCCCACCACCTGC
TCTCAGCCTGTCTCGCTGCTTGAGAAAGCTGCCCCCCAGTGGTGCCAAGGCAAACTACAG
GCTCATCTCGTAGCTCAAACTAACCTGCTCCGAAATCAGGTGACGCTGGCTTCTAATCTT
GCATGTGCTGACACCGTTTGGTCTGTGCCCTGCCCTCTGTGTGTCCAAATACTTGTGTTT
CCTTTCTTGACCTAGAGATAGATTCGGCCCCTTCCTTTGTATGGGTGGTTGGGCTAGATC
TGAACCTGTGTCCGAGCAGTTACAGCAGCCTCCTTCCTGAAGGCAAAGGTGTAAAAGAGA
TAGACGCTGAGGGGCTCTGGCTGACTTGGGCATGGGCCCGGGGTCTGTCTGCTCGGCACT
GTGTTGGTGGAAGTTCTGAGATTCCTCTATGAGATACCAGTCTCCCCAGAAACACAGAGA
TAGCTTTGAGTCATCTCTCCCCCCATCTCAGGAGGGCCTCTGAGGGCCGAGGTGGGATAG
TATAAGTCTCTTGCCCTGATAAGTATTGTCCTTTAGCCGCGTAAGAACTCCTGAATTCCC
ACACGAGGAGACACACGGCCGGGGTGGGCCAAGTCTCTTGCCCAGTTTCACAGAGCTGGT
TAGTAGCAGGGCTTGGGGTCATGTTAGATGAGCGCCACCCCCCCGCCCCATTACTATCCT
AGCCCCTGGCCCCTGCCACAGTCAGCCAGACTCTCAATGACCCTGGAATCTACTGGCAGT
GGTGGTGGAGAAGGAGGAATTGTCAGAATGACCTTCAGTCTGCTGGGAGGATGAGCCACG
GGGAGAACTATTTGGGGCTTCTTAGAAGGCAAGGGCTCTGTGCTGCAGTAGTCGGGGCTG
CTTTCTGGAGACGTTTCTTTGTCAATAACTCCAGGTGGTCCTACCTCCCTGGCTGCCATT
CCGAACGCTTCTGAGGCTCTGCCCTTGAAACAAGCCAGGTTCTGGATATGCATGTTGTGG
AATATGCTTTCCTCCCCCCGGAGGTCCTAACTCAGGTTTCAGAGGAGCAGAGACACAGTG
GACTGACTTCCTATTCTACGTGGGAGTTGAGGGGCGGTGGTGGTGTCCAGAGTCGGCAGG
TTGGCTTTTTCTGAGCAGCGGCCCCTCTTTAATGGGCTGCCTCTCAGTGGCATCGTCTAC
CCTGCACAGACTGAGTAGCGCGAGCTCTGGGCTGGGTACGGACTTGAAGCTCAACCTCTT
CCCTCGCTTGCCGCTGATTTCTTCTAGGCCACCGCTCCGAGCTGCCCTGGGAGGCACTGA
GCTGTTGACAGCTTCACCCTGACCGCAGGGGGGCTCGGGGGCTCGGGCTCTTGGGAGTTG
GTTTGGGGTCGAGGGGGGCGGTGAGCTTTGATAGGCCTCATTCCTCCTCTGTCCGAAGGT
GTAGGAAGAATGAGGGGCTGGAGACTGGAATGGGTGTTGCCTGGCTCCAGAGACTAGACT
GTTCTCTGGAGAAGGGGGAGAGCTCCCAAACCAAATGAGAGGTTTAGCATCATTTTGCCG
TAAAGGGTTGAACAAGGCGCCAGAAGGCATTGTCGCGCGGGTAGAGGGTCGATCTGCTGT
GGTAGGCTCCCTGGGCTGAGGGTGGTTGGGTACCGTGAAGGAGAGGGCTTGGAGCGGCGG
CAGCAGCTCACATGGGCAGTGCCACCATGGATGCTGGGTTGCAGATGGTGTGCTAACTTG
GTTTTCTCAACGGGATCCACTTTCTCTTTGAGCAGCTCCTCCATAGGCCTCTGCCTCTTC
CACACACCCGTCTGGAAGCTAGAAGGCCGCGGGGCTAACCCCGGACTGCATCCACCCGGA
AACTGGGTCTGCCCGAGCTTGGGGTGACCGAGAGGTGTGATTGGGCTTTCGGGAGACAGT
GCGTCTTCTTGAGGGGATGCTCCCATCTCCGGGGGTCTGCTTGCTCAGCTCCTGTGGCCT
TTCTGGTAGGAGGAACAAGCTGGTTTCGGGTTTGCTTACCCTGCCCCTCCAAGTGCAGCA
CAGCCACTGTTTTGCCAAGGCCTCCCAGGCGGCAGACAGCTCTCCCCTCACTCTGTCCAC
CCCCTTGCCACGCGCCCAAGTGCTTCTGGAAAGAGCTGCGCTGTGAGGAACCAGAGACGT
GGGCCCTGGCTTCCGGCAGCTCTGAAGTGGAGCTGGAGCTCACGCCCGACCTTGGGGCCT
GCCGAGCTGCTTGCCCCTGGAGCTACAATGGCCCATTTTGCTCGCCATTCTCAGGCTCAT
TGGTTCAAGGAATTAGGACAGTGTTTGTGAGAAAGATGGAGGCCCCACGCTGGGCGGTCT
CAGCTCTTCCAGGGGCTGGTGGGGCAGGCAGGTCCCTGAAAGAGGTGGCGTTTCCCCGAG
GCTGAGCAATCAAGGCAAGGTGGCCTGCAGGGCAGGGAGACAGTCCAGTGCAGCCCGTGA
GGGCCATGTGTTGTGTCCATCCCACCAAGCCCCATTAGCAGCCAGCCCTCTTTGTCAGGC
CCTGGGGTCCCCAGAGAGCTAGGGAATGGGTGGTCTGGTCTGGTCAGGTGAGGCCACGGG
GACAGGCTGAGGAGTCAATATTCCCAGCACAGGGTAAGGTTCCTCCAGGGCCCTCAGCTC
TTACCCTTCCCAAGAGGTCAAGGCACGCATGTTCAGACAGATCTCTTTGTCCTTGAGAAA
AATGTAACACCAAGGGGTCCCTGCTCTTTCCAGCAAGTTTGCCCCACTGGTTACTCTAGC
TGAGCAATGCATCCTTTCCTCCTGCCTCGGCCCAGGCTTGGGGCGCTGGTGCCGGAAGGA
GCATGGGGTGGGTAGGCTGGAGGAATCAAGTGCTGATGGCAAATAGGCTTTGGGGCCAGC
TGGCTGCCGTTGTCCAAAGGCAGGCCTGTCCTGGCCTGATAAGATGAAGCTGAGGCTGCT
GGCAGGAAGCTTGCTTCCTACGGGGCAGGCACAGCACGTTCATGGGCTGTAACTCAACCC
CCAGGGCCAGGTCACCTCCCTGAGTCACCGTTTCTCCTTCTGCAAGGGTGAGCACACAGC
GCCCCTTCCCTGGCCCCGGTCTGTGCTCAGTCCCGAGTGGGGCACCTGCTGCCCACATGC
TCCTGCTTACTGGCTCTGGGAGGATGGTTTGGGCCCGGGGCCTGGCTGGATGAGCGTAAG
AGGGGAGGACGTAGGCTGGAACCTGCGGAGGGCTTGTCTCACGCCAGCAGAGGCATTGCG
AGTGGTCCTAGCAGCCTCCCCAGCAGCCCAGGCCCCAAGCCCAGCCCTGTGCCCCCACCT
CTCGGCTGCCTTTCGAGATGGACCCAAGTCGCTGCCTCTGACGCCAGTCTAGAAGCTAAC
AGGGTCCCAGAGAGAGGGGCCCTGTGTCGGGTAGAGTCTGGGAAGAGCTGTGTGGCTCCT
ATTGAAAGAGATGTTGGATAAGAAACGGGGAGGAAATCTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTGCTTGGCCTGGGGTATCCTCCGTGACGCC
TCGCCCATTCTCTACCTTCTGCAGCCGCGTGGGTTTTCTACGTCAACACGTTTCCAGAGC
ATTGCGGGCCTGGAATAGAACTTCCACAAGGAGATGACTAAGGTAGGCCCTTGGCAGTGG
CCCCCCGTGGGCCTCTGGGCCTCCAACTCCTGTCCACTCTGACCCAGGGTCTAAGGTCAG
AAGCATGGGTGGGCAGGCCGTGTCCAACTCGGCCCTCTGCCCCTTCCTAGTCATCTCTGC
AGGCGGATTGTGTTCTCAGGGACCTTGAGCCAAGGAGCGCAGAGCCAGAAAGCCGTGACA
GCTTCCCAGCTTCTTCTAAGCAAACTCGTAGGGTTTTCTCCATTTTCACTTGTCCTCCCA
AGTTCCCTGGGAGTTTGGCCCAGGCCTGTTCCATCTGCCCTGGAACCTGCTGTATGAAGG
GTTCTGACTAGCTGAAATTCCTACGCTGCTCAATTTTCACAGTCACTTGCCCGTCAGTTA
AATGAGGAAGTCCTCTCGGACTGCTGGCAGTTCCCTCTTGTCTGCAGAAGCAGGGTCTGA
AGCCAGAAGAACGGAGTGGGTGGTGATGTTTGGGCAAGGGTGGGAGGGGGCAAAGCCGAT
CCGAGGGCTCTCCGGTCTTGCCACCCTGAGCGCAGTTCCCCGCCTCGTAAGCCTTCCCTT
GCTCCCCTCCTTCTTCCCTTCCAAGATTCCAGACAACTAATGACAGGTTGAGGAAAGAAA
CAGAAAGGTATTATTAGAAGGAAGTATTTATGCAAAAGTTGTTCATGTCACAAGGCCCAG
TGCTTATAAATAGGAATATTCGGAGCGGAGCTGCTTGTTGGCCAAGGCAAAAAGGGAACT
ATCTCCATAGTGAGTGTCAATACGCACTCGGCATAACCCTTCCTGGTTCACTGTGCTTCG
GCTACAATTGCTAGCGTTGTGGGGTGGTCTGAAAACATTGCTGCGAAACAGCCAACCAAC
TAACCAACCAACTCACTGCCCTGGAGCTGATGCCGACTCAGAGCGACCCTCTAGCCCAGG
TAGACCTGCCCCTGGGAGGTTCCCAGACTGCAACTCTTTATGGGGGCAGAACGCCCCTTC
TTTCTCTGGAGGAGCGGCTGCCAAACAGCAGTTAGGGTTAACAATGAGTCTTTGAAAACA
TGCCACCACCACCCCTTGTAATTTGCAAACAGTACAAGCTCAAGGTGGCATTTTAGGAAC
TGCCAAGTAGAAAAAAAGGAGGAATGGTGGTCTCTAGAGACAATAGCTGTTAGTAATAGC
CTATTTTACTGGTTGTTCTTTATTTTCCCCCTCTGAGGCTTGTGGGTTTGGGGTACTGTG
TCCAGCTTGTTCCTGGCAGGGATAGGAGTTCAGGGAGGACGGATGGGGTGGGAAAGAAAC
AGGGGTGTTATTGGGGATGTGAGGCAGTCTATGGCCCCGCAAGCCCCCCACCTTCTACTG
TCGCCCCCTGCAGCTCAACCAGAACCTCAACGACGTGCTGGTCAGCCTGGAGAAGCAGCA
TGGGAGCAGCACCTTCACCGTGAAGCCCCAGCCCAGGTGGGTGGGCAAGGGGACTCGCAG
CCACTGGGGGTGAGGCTGGGCATGCCTTATCCCGCAATCGGCCAGCCTCTGGGGGTCTGG
GGACCTTTCTGTCTGGCACTCTATGCTCCGGGGTCGCCGTCCTTCCACGTCCCTGGCTCT
TGGCTGTGCTCTGTCCTGGGAGGATCCTTCCATGCCTTGGCTCTGCAGGCTACCCGGGCC
TGTGGGCCTCGTGCTCTCATTGGTGCAGCAGGAGCAGCAAAGGTGGGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCGGCTGCAACCTATAGGTACTGTTCCTCAT
TGAGCCACTTTTCTGACTTGGGATGTGCCCTCTCCTCCCTGTCCCAGGCAGCCCAGGGCA
GCTGTGGCTGGACTGCGCCCACTGGCTTCCTCGCAGGTGGAGGGCAGGGGCAGGCTCCAT
CAGGAGGGAGGCCGTGGCTCCCTCGCCTTACTCTGCACAGAAGGGTGGCTGGTGGGGGAA
AGGGACACCCAGCTGTCACCCGAAGTTTCCCTACAATGAAGGCCTCCACACCCCATCCCT
CCCACAGAAAGAAAACTAAACTCTTCTCCAGGCTCCGCAGGAAGAAGAACAGGTACCGGC
GGCAAGCTCTGCCTTGCGTGGCTCAGCATCACTGTGCATGTGCCTGACGCCCTGCCCTGA
GGGCACCACTAACTGCAACCCCCTGTGTGTGCAGCCGTGTGGGGCAGGGCCGTGCCGGAG
GGCGGCCCACGGGGCTGCTGTGCCCGCTGTGTCTGGTGTGTGGTGTGTGCTGCGGGGATA
GGCCTGGGTAGGTATTGCTGGGTGGGAGTGAGGCAGCGTAGGACAAAGTCTGAGAAAACG
GAGCAGATACCTTATGTGTGGCCGGCGTGTCCCCGAGGAAGGAAGCCTGACAAGGGCTGG
AGCAGAGAGACGTGATGTTAGTGTGCCTGTAAGATGATGTCTGTGTTCCTGTGTATTACA
CATATATATCATGAACACATCCGTAAGAGATCAAAAGAGACGCCATGATGTTCCTTACAT
GTCTGCTCTCGTCTGTTCTTCTCCCATCCCAGCGGGTAACCTGATTACTGACTTCTTTCC
TATTGCTTGTCTACTGAACGTCCCCCCGACCACGGTAGCTTGTAGCTGCATGTGGCTGGG
GTGCGGCTGAAATGCAGTTAGTGTACCGGGCGAGTTTGATTTCGAGAGTGATTTCTGTGC
AGACAGCTAGCTCACAGTCACCTGTGGTGAGCGGCTCCTGTGATGGGCACTGCCGTTCTA
GAACTTCTTTGCACAAGTGAGCAGAGCCTGTCCTACTTGCTTTTGACACAAATGTCCCCG
CCAGGCACGCATCTGGCCCTTGTTCTGGACACTCTGGGGCCGTTGGGGGACTTTTCCACT
TGAGCCCTTCCATGGGCCACACCAGGTGCTGCTGGCTTTGTGGAGGTCCCACCTTTTCAG
GAAGGCATGGGAGTGGGGAGGTGCAGGGAAGTGGAGAAACTGTGGGTGCTGTGGGCGGAC
AGGTTGGGGAGCAGTCACAGTGTGAGCACAGGAGGGGGTTGATGCTGACCCTGCATTGGG
TTGTGCCGGGACATGGGCAGGGTACCCTGTGGGAGGTGTCTGTCTATCTGAGCTCATTGC
TCTCTGGGATAGCTGGCTTCTGGCGCATTTTCAGCGGGGTGCTGTGGGGCCCTGTGTGGA
GGTGGGCCTTGGGTCATACTTCCCCTGGGGGTGGGGATCCTCCGGCCTCTAGCTCTGTGT
TTTGTCATGTCCTGTCACTGTGTGCAAGGCAGGACCTTGCTGAGGACTTGTGGAGTCTCA
CACCATGCCTCTTCATTTCCCTTTACTTGTGCACACAGCACACACACACAACTTCATGTG
TGGCTACATAGGTATGCTGTCAACACACATGTGTATTTACAACTCCATGGACACACGAAG
TGCACGGCTTACATACATGTGCACTCACCTTCACACGTAGACACATGGGGCAATGCCCAG
GCACACGGGACACACACTCAACACATGACTATACAGCTTTACACATGGATACACAATCAC
CTGTACATGCATCTTCATACCTAGGCACATGAAGTACACACTTATGCACATGTGTATACA
ATTTAAAATGTGGACACCGATTCAGTGCATGTACACACACACACAATTTCATACATGCAC
ACATTGACATGTTTACACACACAGCTGATGTGCATCCGTAGGTGTATATACACGTGATGT
ACCTGTGCACACACATTTTACACACAACACCCATTACATGTGTATATAACCGAACTGCTG
TGGAGTCGGTTCCAACGCATAGTTACCCTGTACGACAGGGTAGGTTTGCCTTTGAGGATA
ATCTTGAAGGAGCAGCTACCTCATCCCGGGGTGTGGCTGGTGGATTCTGACTGTTGAACT
TCCAGTTAGCAACCCAATGTTCAACCCACTTAACCCCTATATGATCCCACCCGACCCCCC
AAAACAAAACTAGGTGTATCAAGTTTCCAATGCTATACATCCATCTGTATACACATGGCT
ATTGTCTCCCTGTGCATACGTGTCCATGCGCACACACCTTCATGTGCATACCTACATATT
TGCAGCTCCCCTCTGGGGCAGCCTCTCAGCATCACGCCACTCTGTTCTTGCCTTCATAGT
GATAACGCCCCTGCCAAAGGGAATAAGAGCCCTTCACCTCCACCGGATGGCTCCCCTGCC
GCCACCCCGGAGATCAGAGTCAACCACGAGCCAGAGCAGGCTGGTGTGGCTGCGCCTGGG
GCCACCCTCTCCAAGTCCCCATCTCAGGTAGGTATGGGGTCTCAGCAGCCTGTCTGCGCC
TCTTCCTTGTCCCCCCGCCTTGCTGTCACTCTCCCTGCCTCTCTGTCCTGGCCTGCGTCT
AAGCAATTTGGAACCAGAGGTTGTACATAGCAGGGGCTAGAGCCAGGGCTGGGCTGAACC
TTTGTCTCCCACTCCACCTCAGTGGCTCTAGTCCCCTCTAAGGGGCATCTGTGACTGTCT
CCTCTCCCCTCCCCTCATACATACATCCCCCCACTGCCCCACCATGACACCCTGCCCTCC
CCTCTCTCCCTGGTCGCTAGCCACTTAATTCTGTCTTCCTCTTCCTCTTCTTCCTAACAG
AGAGAGAGGCGCTGGACCCTTAGTCCCCAGAGCACCCAGACTCTAGAGGCGGCTGCCTCT
TCTGTTTCCTCATCTCTTTCTTTCAGTAGCTGAGGAAGACCCCAGCCTGATGGCCATGCA
GGGCTTCCTTTAAAGGAGGGCAGGAAGGACTCAGGCAGGGAGTGCGAGGTGGCTGGGCCA
TGGGCAGGTGCCCTGAGACTCTCGGCCAACCTCTCTAGAGAAGCCCTCCCGTATCAGTCC
CTCCCCAAACGAGACTTACCCGAGGGTCTGCCGAGCTCTGGGAAGGCCCTGGGCATCTGC
CACTCTCCCTGCTTGGAGCCCGGGTATGGGCTTTCAGAGCTGCTGTCTTGCTGCTCTGCT
TGGTGGCTGGCTGTGGCCCAGAGCTGCCCCACGTACAACCCTTCTTCTGTGGACACTGGG
TGAGCAGCCTGAGCGTTTTCACCCCTCGATTAGTCACAGCCACCCACCTAGCAGAGCTGA
CGCTATTGTCACCGGTGTTCTTGAGTGTGGCAACTCACACCTGCTGGGTGGTATGCGTTC
TCCCTGCCCTGCTGCCCCAGATAACTGAGCCTAGGTTCCTCTAGGGGGGTGGGGGGACAC
AAGAACCCACTGGTGCTGAGCTGGCCGCAGAAGAGCAGGCAGGCTCTCTAAGAAAAGGGG
AGAAGGTGCAGGGAGAGGCCTGGGCCTGGGCTATGCCTCCAGCTCAGGATTTCTGTCCCA
GCTTCTCGCTCTGGGATTGGGCACCAAGACACTGTGTGCCCTGTAGACTGGGCCAGCTCC
TGCCCCCACCTCACCCCTCACCCTTCCTTTCCCTGCCTTCTCTTCTCTTTCCCCCGCTTT
TCCACCTCTTTCCCCCACCTCCCTGCTCTTCTCTGCAGGGTTTCCCGGTCCCCTGCCGCG
CGTCGCCTTCTTGGTGGCATCGTGGTCCTGGCGTCTGTGACTCCTCGGCCGCCTGGGTGG
GGCCGAGGCCCAGTTGTGACTAATCGTGACTTTGTCTCTGTGTGCCCCTCACCTGCTGCC
AACCCCAGCTCCGGAGAGGCCCGCCAGTCCCTCCTCCTCCCAAACACACCCCGTGCAAGG
AGATGAAGCAGGAGCAGATCCTCAGTCTGTTTGACGACACGTTTGTCCCCGAGATCAGCG
TGACCACCCCCTCCCAGGTCAGCCGCAGCCACTGCGGCGCAGCCCCTCCTCTTGCTTGCT
CAGAATGCGCACGGCCTCGCCCCCCACCCCATTCTCTGCCTGTCTCAAGGGCCCGGATAT
GGTCGAGACGGGTCCGGACCCTGCCTTGCTCTCATCCATCCTTCCAGCCATCCATCTATT
TCTGAGCATGTCCTGCGGTAGACACAGCGGGCCAAAGTGCCCATCCGACCCTCTCAGGAG
CCGGGCAGGCTAAGGATGGCTCCACAGTGTGGCGGAGGGGATTGTGGTGGAGGATTGTGC
GAACACAGGAACTGGGGTCAGCGAGGGAAGGCTCGCAGAAGTGGTAGAAAAAGCAGCAAG
AGCGTGCTGTGGACAGCGAGCAGAGCCTGTGTGTAGGCCTGCAGGGGCGAGAGGCGGGAA
TGTGGGGTGTTGTCGTGGTGGGGGATGTGGCTGATTCGTGAGAGGCGGCAGCAGGACTCC
AGGTGGGGGGACCTCTGTCGGACCAAGGGCCCTGGGCCGCAGCTCCAGAGCTCTGACAAC
AGCTTCAGTGGTGGCAGTCACAAAGTTGCCAATTGTGAATGCCCTTGGAAGGCATCTAAT
GCCTATTCCACAGAGAGACAAGCAGAGGGCCTATGAAGGGGGTCCTAACATTGGGAGGTG
AAGTCTCGCGGGCCAGCACTGAATGGCTGAAAAACTCTCGTTGCTGGAGAGAAGATGCAG
CTTGGCCAGCCGACCACAGCGAGGTGACCTCGAGACTGGACCCTGCAGCCCTCACTGCTC
TTTTGGCGGGCAGACCAAGGGCCCTGTGCAAGCCTCTCCTGTCTGGAAGTTTGGAACAGA
GGGCCTGAAGTGTCAGGGACGCTAAGAGCCCATGAGAATCTGGGCCCTCAGCCCCCCCAC
AGGCTGCTCTGCATGAGCCAGGAGGCCTGTGGGGAGGGCCAGGCTCGGGCTGTCCGTGTG
GAGGGAAGAGGCACTGGGGACCCAGCACAGTGGGCTCCACTCAGAGAGACCCTTTAAAGA
CAGGACCACGAGGAGTGGGTGGGCGGGCAGGGTTTAGGAGGTCTAGGAGGCGCCTCTCGA
CGGTGGCAGAGGAAGAGTGGGAATGGGGTGGGGTCACCGCCGAGGCCACTTGCTGCTGCC
TTCCCCCCTCAGCCAGCAGCCTCTGCCGATGTGAGTTGCTCGCAAACTCTTAACCTAGCT
GGCTGAGTGTCCATTTAAACTGCCCTCTGGGAGGGGATCTTTTTCCCCATTAATGGGGAG
CAACCTGGAACTACAGGTGCACCTCCCCATGTGGCAGCCCAAGTGTGCCGCAGAGATGGA
CAGGGCCATGCGAATGGACACACCACCCCTGTCCCCCGCATGGTCACAAGTCCCCCTTGC
TGCCCCCTGTCATCTCAGGGCCCTGGGTTTCTGCCTTGTCATGAGGTGCAATGCATGGGG
TGGGCTCATCCTCATGGCAGTGCTGCTGGACCGGTGGGTCGCCCTGAGTTGCTTTCTGGT
GGGCAGTCCTCTTCCGTTGACCGACGCCATGCCCCGTCACAGCCTGACTGGGAATGGCCG
TCTAGGCTTGGGCACTTCTCCTGGAAAGCACAGTCAGAGACAGGCAGGATCATGGGTAGC
CTAGCAAGAGAATCTGGCTGCCCCTGAAGCATGGTGCCCTGTGTGTTCATGCCCCCAGAG
GTGGCTGGCCACGGGGGCAGAGCAGCGACCTGCTCAGACTCACTGGACAGGGACCGTAGG
AAAAGCTAGTTCTAGGGGGCCAGGCTGGGCCAGGGGCTTGAGGACTGCACTCTCTTGGCT
CAGGGAAATGTATCCCCTCCACTTGGGCTCCTGGACCTCTGTGTCTCAGCCCAGCATAGG
ACCTTTATGTCTTACCTCCTGGAGCACAGCCCTTGGGGAACCTGCTCAGCCACCGCCCCT
TCAGTGGGATGCCTTGGGTGGCAGGGGTCAATGCTGGGTGCCTGAAAAAGTCTGTCACTA
CAGAGGGTGAGGGGCAGGGCCTGAGGACAAGCCCGGCCTCTCCCCTGTTGGACCCGGCCA
AGCTTCCTTCTGGAAGGCTAAGGTTAAGCAGCCCCCCTCCTTGGAAGGCCTTCTGGGCTG
CTACCATCCTTCTGCCGGTCCCCAGTCCTGGACAGAGCCTGCCACCAGGGGTGTCTGGGA
AAAACCCTTTCTCTGAGGAATGTTTGGGGTCTTCCCACAGTGAGTGTCTCCAGCATGGCT
AGGGCTACCGCGGTACAACCTCCTGACCGTGGAATGGGAATATTGGAGAGGAGAGTGGGT
GTGGGTAGCGCTCTCTTGTGCTTTGGGGACAGGTGCCAGGTCGTTTGGAAGCTCCTGGTA
TTTGGGATCAGTGGTCTGAAGACAAGCCCTTGGGCAACGTGGGCTGGCTCAGCACTTGCT
TCTGAAGCTGGCTGGGAGTGTGCCTCGCCTGAGGGCGCCCTGTGTCCCCGAGAACCCCTA
TCCCAGGGTCCTTCCTGACCAGCCTGCTGCTCTGGGACTGCTTCCTGGAGGTGGGGGCCG
GGAAGTATATTCAAGGCTGGTGTGGGGGCACCACCTTACATGGGGAGGGGGAATGGCATT
GGATCCAGAGGGGTGACCCCCCCACCAGGAGCATGCTAGAGGGGGTGTCTAGAGTGCTCC
AGGAGGCATCACGAGGAGGCTGGGAGCCTGTGCAAGCTGTGTGGCCATCTGCAATGCTGC
GCGCGTGCGTGCGTGCGTGCGTGCGTGCGTGTGTGTGTGTGTGTTGTTCTTGTGTCTGCA
CACTCCGGGGCTGGGATCGGTGTCTGTGTGCTTGTCCCCTAGTGTGCCCAGCTTCTGTCA
CTAACTGCCTTCCTCCTCTGCCAATTGCTGCCAAGTTTGAGGCCCTGGGGCCCTTCTCGG
AGCAGGCCAGCCTGCTGGACCTGGACTTTGACTCCCACCCGCCTGTGGCAAGCCCTGGGA
GAGCACCCACACCCTCTAGTCAGGTTGGTCTGGGCCCTGTGCCCTCAGGCCCTCCTGGCC
ATCTGGGGCTTGAGTCTGCCTATCAGCCACGCAGGCCCGGCCGGCCGGGGCTTTCTAGTG
GCACTCTGGGAACCAGAGTGAACACCTCCTCCTATTTGTGGCCACAGAGCGGGAAAGAAG
TGGGGAACTAAAGCTCCTGGGGGGCGTGGGGCAGGGGGCGTGCAGGACTCAGGAGGAGGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNCTTGACTGGAGGCTGCAGTGCAGCTTGCTTCTAAAGCCGTGTGACCTT
GAGTTCTGCATAAGCTGCCTGGCACTTCTCCAGGGGCTGGGCCCAAATCAGCCCTCCCTA
CCCTCATTCACCCTGAGGAGCATTGAGAGTGAGCACCTCCTGGGTGCTGTTGGCACCTTC
CAGAATGTCCTCATTTCTGTTGTTCCCTGGCTTTATGAGCTGGACATAGCCCTCTTTGAC
AGACAAAGGCTCGGAAAGTTGATCGAGTAACTTGGCCTGAGGGTCCATACCTTATAAGCA
TGTGGATGTTGTCCCAGACCAGCCTGACACTTGGGCCTGACAGTGTCCAAGGTGGTCCAT
CCTTTACCACACCCTCCCTGGGCCTGGACTTATGGGCAGCGCTGTATTAGGGCTCTTGTG
GGGCACATGCTGCCATTCTGGAGTGTGGCCCAGGGGTGGGCAGGGTGGAGTGAATGGGAG
GAGGCTGGGCCTTGCAAAGTCTTGAGCTTCCAGGCCAGAGCCTGCTGAGAGGGGCATCTT
GAGCCCTGCAGCGGTCCCTCCGGGGCTGCCAGCACCTTCACTCCAGCTGCTTACTGTCTG
TGCCTGGGACCGATTTTCTGGATGAGGCATACCGCCACTGGCAACTAGGGCACTCAGAGC
TGCCCTCTTGTGGCCTGACTTTGTGTCCTGGTAGCAGTGTCTGGGCAGGGTCTGACCTGC
GTGGCCTTTATGTTGTAGCCAGGAGAGGCCGTGGAGGGGACTGGTGGGACGGAACCTGCG
TCGTCGGAAGCCCAGGAGTCCAAGGAGACAGCGACAAGTGAAGCCGCCTCCGTAAGCCCC
CAGGACTCGTCCTGTGTTGCCCCCGCCCGCCCGCCTGTCTGCTTGGGGTGCCCAGTTGGT
GCCTGTGCTGCTCTGTCCCAGCCCTGCTCTGGCACCTGGAGGCAGGCTGCTCTGCCATTA
GGCACAGTCCTCTGACCAACCCTCACCCCCTGTCCCCGGCATTGTCCTCCTGTCCCCAGA
GCTCCCTGCCGGCTGTGGTGGTGGAGACCTTCTCAGCCACTGTGAATGGCGCCGTGGAGG
GCAGCAGTGGGGTTGGGCGCTTGGACCTGCCTCCTGGATTCATGTTCAAGGCAAGTGGGC
CCTGGGAAACGGGTGGCCCTGGGGGAGGTGGTGTGGCGGCTCTGGTACACCGCTCCTCAC
AACCCACGTGGCACAGGAGCCCTGGGCCTGTGGCCTCGGGGCCCCTCCTCACCACCCCTC
TCCACTCCACACCCAACTCCACCCCAGCTCTGGGGCATCGTGCAGGGCCAGGAATCGGGT
TGGGGGGTGGGACCCAGGAACAGAACTTTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTGCAGAAACATCCAATTAGTGGGTGG
GATTTCAAGAAGAGAGACTCCTGGACCCAGATCACAGGAGGTCACTCAGAGCGGGGCAGG
GAAGGGCTCAGAACCGAACTAGTGGCTGTGACAAGGCAGAGAAGGATGGCGAGGTGAATG
CCTAGGACACAGATAGGTCCCAGGCCCAGCTGGTCCAGCTCCTCTGAGGCCCAGCCTGAG
CTAGCCCAGTCCCGATGGGGCAGAGTGAGGAACATACCCACCCTAGGGCCGTAGAAGGTC
TATGAAATCATCAGTAGCAGCCCACATCACACGTCTCACCAAAGAGAAGCCGTTTCAGCC
ATCACTAGGGGTGATTTCATGAAAGGTTTGACCAAATGTAGCCAGCGGATGTTTAAGTGG
ATATTTTTGAATGGCACACCAACGATGCTATAAATACCCAAATGGCCCTTGGCAGAAAGA
AGAAACGTCCCTGCCCCGGTACAGGGCAAGGGTTTATGACTCCTGCAGACTCCTGTGGGA
GTAAGGGGTTGGGCACCAGACACCCCTTAAAAATGAGTTTTGAAGCCAAGACCAAGTTCA
CTCTGTTGGAAGACTTGCTGTGGTAGCCTTGGGCCACTCTAGACACTTTAAACTCGTCAA
ATCTCACCAGAACTTTCTGCTGTGGTTGATAGGAAGCTTGGGAGGACAGCTGCTTAGTCT
TCAGGGGCTTGTCCTCCGTGGCACTAAGCTCCTTGCTGTGTGGCAAAGGGATGGTTGAAG
CAAAATCAGGCCCACGTGGCCCTTGGGCTACAAGGGCCCAATCAGCCAGCCACAAAGTAA
GCTCGACCTGCCCCAGGCAGAGTGGCTTGGGCCAGGTGGGTCTGGGTCTGGGCTTGTCCT
TCAGGCAGGTGTGGTGGGCTTGGAGGCGATAAGCAGGTGGGTAGGAGGGAGCTGTCTTCC
TAGCAGATCCCCAGGAAAGTGCATGTCCAGTGGGGCTGAAAGGCCCTTGTGTCCCCGTCC
TCCACGACCTTGAGGTGACCCCAGTGCTTGTCTCCCTCAGGATGAAGGCTGGCTGATGGG
CATCAAGGAGAGCGATTGGAACCAGCACAAAGAGTTGGAGAAATGCCAGGGCGTCTTCCC
TGAGAACTTTACCGAGCGGGTCCAGTGATCCAGCCCATGTACTCTGGCCAGCGAAGATCC
ACCTTTTCCCAAACAAAACAATGTGTGTTTCTTGTTTTGTTTTTTTTCCCTTTGTTTTTG
TTTTTAAACTTTGAAAAGCAGAGAGGGACTTGCGCGGAGAGTACAAAACTGAAGAGTGCT
CACTCAAAGGTTAGGCTGCTTCCTGAGACTGATGCAGCCATCCCGTCCCGTGGAGCTCAC
CGGCGTCCCTGAAGCTGCTGTGCTGTGTAACTGAGCTCCCCGTGCTGCAGCCAGGACATG
GCCTGCATGTGTGCCCAGCTGGCTGCTCGGCACGCAGGGCCAGGTTTGGGCATCACGCTG
GGCTGACCTGTGGGCTGTCCTGCTTGCCTGAAGCTTTGGCCGCACCCCTGGGCGCAGGCC
CTCCTGTCCTGGCAGCTGGTGTGCAGAGGCCCAGTCTGCCCCAGGGGCCGTTGGGGCCTG
ATACCAGCCCACCTGGCCTCGCCCTGCAAATGTCTGTGTGCTGTTTTAAATAAATCTTAG
TGTTCAAAAGAAAATGAAGCAAACAGAAACAAACAACAACAACAAAGTGACAAAAACCAT
TCAGACAGTGCCTGCTTATCTTTATTCTCCCTCCTCTTTGGTCAGCTGTTGTACTGGGAC
ATGTGGGGGTGGGGTGGGGGTGACACAGGCTGGGGGTGAGAACTTGTAGGGGTGACGGGT
TGCCAGTGATAGTACCTTTTCTTACAAGCAATCGCAGAGCTCAGCGTTGACTGCAGATCA
AAGGGGCATGGTTTCCAGAAAGAGAAGGAAGTGGAGCTGGTTGGGAAGAGCCTCCTTTGG
CAGTAGGCCAGCTGCTTTGGAGAGCTGTCTTGGTCCAGACCTGACCTCAAACGTTACTGC
CCTGGCTTCTTGCCGATGGCTGGATAGAATGCTGTGAGTTGGGAAATGTCGGGATGGGGA
ACGCTGGGGCGGAGATGAGAAACTGAAGAGCCAATTGTGCCTAGAATGCACTGGGAGATG
CCCAAGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1283..1377, 55706..55801, 56799..56906, 57629..57721, 61452..61537, 62027..62038, 62040..62054, 62056..62077, 62081..62104, 63456..63538, 67162..67309, 68671..68799, 71638..71745, 72063..72086, 72187..72294, 73121..73213, 73402..73512, 74373..74474, 76143..76250
1001..1055, 1283..1377, 55706..55801, 56799..56906, 57629..57721, 61452..61537, 62027..62038, 62040..62054, 62056..62077, 62081..62104, 63456..63538, 67162..67309, 68671..68799, 71638..71745, 72063..72086, 72187..72294, 73121..73213, 73402..73512, 74373..74474, 76143..76247
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved