Echinops_telfairi Locus ENSETEG00000010398
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000010398
Echinops_telfairi
ENSETEG00000010398
GeneScaffold_4104
SNORA63
4110..4242
7627
TAAGGGAAATGTTTGAAATACCAGGTGAGTAGAATTCCTACTGCATAGTGAAATTTGTG
TGGCTGTGGTAAGTTTCTACAGCTGAAGGACTTCTAATTAGCCTCTTCCTTTCTGGAATT
TTAAAAGGAAAGATGGGTGCTTCTGAGAACTGGGTGGATGGGTTCATATTGGAGGAGGAG
GATGACATTTGTATCCTTTTACCTTTTGAATGTATATATATTCATGTGTGTGTATAAGCA
ATCTCTGTTCTTTGACTAAATAGTATAAAGCAGTGGTAATCTTGTTTCTGTATTACTAGC
TCCAGTGGCTGCAAAAACACTTGAAGGCAGGCACTTAAGAGGTTTTTTTAGCCTGAATTT
TCAGAACTCAACTTTAGTGTCTCAGTTATATTAAAATTTTCTTTTGGGAAATGTTTAAAC
TAGAATTGGTTGAAGTACGGATGGAGTTTTCCTTGCTTTCAAAAGCTGTTTAAATGTGTT
CAGATTTAAATCCAAGATTAATTTCAATCATGTAATGCTTCCCCACCTCCAAAGTAGCAC
ATAATCTGTTTTTAACCTACGTTCTCAATGTGAGTGACAACTGGTACTCCAACTTTTGAA
TGAATTAGAATTTGAAACAATTTGGGTGAATAGTTGGTAAACAATAAAATAGTGATTGAA
GTTTGGGGGGAAGAAAGGCTGGAGCTGACATTTAAGATGACATCTCAAATTATGGAAGAT
TTTTGGACGGATGGTGGAAATTTTATACATTTACTCGAAATTGGGCAATACTTAGAACTG
CCATGCTCTTTGGGGCAGTCAGGGAGGTTTCATTGCCTTTTCCAGTCTGTTGTCTACCTC
ACAGTATAAACTTACTCGGCATTGTATACAAGCCACTCACTCAGCCCTGTTAAGTTTCCT
GTTGTGATACCACTTCAGTGCCTCTGGCAAGAGTATATTTTGATTGACTACTTTATGTGC
TTGTTTATTTTTTTATAGCATTTAGATCAAACGGTATTGAGATGGATTGGGTTATGAAAC
ATAATGGTCCAAATGACGCTAGTGATGGGACAGTACGACTTCGTGGACTGCCATTTGGTT
GCAGCAAAGAGGAAATAGTTCAGTTCTTTCAAGGTACCTCTAGTATTAGTCAAAGTTTAG
TAGTAGTTTAATTATGTGTTTTGTTACTATTGTTACTCGGTTTTTTTGTAAGCTTGTTTA
TTTTTCGAAACTTTTAATTTTAATTATGATGTCTTGGTTAGTGTTCTAAACTATGAAATG
TGCTCCAGTTAATATTTTACTACAGAATTTAGAGAATGTGTAAGAACTGATGCCCAGTAA
ACTTAATTGAGAGTAAATATATGTGATGAGATAAACCATGAATTAGCATATGGAGTTTAG
TTATACTTTATTTGAAGCCTTTTTAAATATTTATTTATTTTACATAATATAGGTGGGCTT
TAGAGTTGTATGTAATTTTAAAAGACTGGGTGCAGAAAATTATTTAATCCAATAATGAAA
GAAAATTTCAGATTGTTTTATGGGGTGATGGGAAACTAAGCTTTTTTGTTTTGTTTTGTT
TAGACTTGTTATAAATATTTGATTCAGATGGGAATGTTTCAGCCCTTAACACTGTTCCCC
TTGATGGGGTTATTTGTCCTTGGGTTAAAGGGTTGGAAATCGTGCCAAATGGGATAACAT
TGACGATGGACTACCAGGGGAGAAGCACAGGGGAGGCCTTCGTGCAGTTTGCTTCAAAGG
AGATAGCAGAAAATGCTCTGGGGAAACACAAGGAAAGAATAGGGCACAGGTGGGGATGGA
GAGTTTGGGATGGTGTTAAATTTTTATTTTTGGGGGTTGTGGGGCACTTTATTAAATGGG
GGGGTAACCATAACATTTTTCTGGGGTAGCTTGATAATTGATAATTACCTAAATTTAACT
TGCAAACTACTACAGATTTGGGTGGGGAGTTAATGCTAAATAGTTTATGTAAATTAAAAT
TAGATTGTTTCCATTTGTAGGATGTTGATAAATGTTTTTGTATAATCGCCTATTTTCTTT
AAACACCTATCATGTACTAAAGGAAACAAACTAAAATTATATTTATATTTTATGGATTGT
TTGCAAATGACTAATTTGTCTATGTAAAACTTAAATATTTAAGTTTGTAGGTGTAAAATG
TTAACTTATAGTGTACTTAGGAAATTTAAATTGGGTTATGTAACTAGATGTAGACAAATT
TTACTGCATTTTGCCCAATATTATTTACTCTAATGCATTTATGCTGACACTTGTACCTTA
AACCATTTTTAAATAGGTATATTGAGATCTTCAGAAGTAGCAGGAGTGAAATCAAAGGAT
TTTACGACCCACCAAGAAGATTGCTGGGACAGCGACCGAGACCATACGATAGACCAATAG
GAGGAAGAGGGGGTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGATGCCAGTTCAGGTTTTCATGGTGGTCATTTTGTGCATATGAGAGGGTTGCCTTT
TCGTGCAACTGAAAATGACATTGCTAATGTAAGTATTCTCATAATTGCTGGTTTATTATG
CTGGTGTCTAAATTAACATTTTTTAAAATTAACATTTTTAATAGCTGAATATTCCTCTTC
CCCTTAATTTTGTTGAGAATATACACAGTGAAACACTAATTTGTTCAATATTTAGATAAA
TCTTAATTACCTGGGCTTTAAGATTATCCCATGGAAATTTCTGTTTAATGGTTTGATAGC
TCACGGGAATAAGTTCAGGAGTACATCCACCAAGAATAGATGAAAATTTGAAATTCTGTT
TTACATTTCCTTCCATTTGACCAGGATTCTTCTATGGGATCTTTAGCTCAAAATGTTCAA
TACTGGTAGCTGGGGACCATCTACTTCTGATCACAGGGCAAAGGAGGGATCAAAGGAGAC
AGTTCCTCATGGAGGCAATTAACTGCATACACCATGTCGTGTCAGACACTAGTTGACCTT
TTGTGATTGGCTTACTGTGCTCAGCTGAAGTCTTGAGACGTGCTAGAGTGTGGCTGAGGG
AACCCCCTCATGTCTCAAGACTTCAGCTTCCAGCAGGATTTAGACTACAATATAGCTGTT
AAGTGCTATTTTGTCGTTCCCCCTGCTCAAAGTAAAGTTGTTTCTTATCTATCCCTGTCT
GCTAGTTTCTTGTAGCAGCCCAGGGTCGCTTGGTCTCATACATATTGAAAAGAAAACAAA
AAACAAAAAAACGACTTCAGCTTCTTGCCAAGTGCGTATCACATGTAGGTGTATCACTGT
CATCCATTCATCTGTTGATGGGTGTTTAGGTGGTTTCCACCTTTTATTTGTTGTGAAGAG
TGCTTCAGTGAGCCTTGGTGTACACACCTGTTTTGAGTGTCTGCTTTCAAGACTTACAGG
GATATACTAGCTAACCAACCTTACCTCTAGTCACTTCCCACTCATACCGGCCATACAGGA
TAAGGTAGAACTGTCCCTGTGAGTTTGAGACTAACGCTTTACAAGAATAGAAAGCCTTGT
CTTTCTCCCCTGGAATGGCTGGTGATTTAGAACTGTGGACTTGTGGTTAGTAGCCCTATG
TGTAACTACTGTGCCAGCAGGGTTCCTTTTCAGTGTGAAATTGCCATGGTAGGGGAGAGG
GGTGTCTGTGTTTGCGTGCACACATGTGCACTTTAGCTCCATACTTTTCCACATCATCAT
TTCATTCCCATCAGTAGGGGATAAGGGTCACATAACTAACAAGCCCCATTAATCTGAATC
ATGATATAGCCGTGTCAGTGCACATATTTCTATATCTTCGTGACCTACATAATTCAGTTG
AGTACCTAGTTTATTTTGAAAGTTTAACTTAAGTGTAAGCTTATATTCGCAGAACCTTTA
TAATTCCTGTAGTTGGGCTTGCAGCATAGGAATGGGGAGGAGAGTATTAAAACCAAGGGA
TTGTGGTTATTTACTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCGGAGCTCTTTAGGCCATTAACAAACACTTAAAACCACATAGCCTGTGATAGGT
ATTGAATGCTTCCTAGAGTTATCATTGGATGAATCTGTTCGTAAAGAAGAGTTAACCAAT
AACGCTATGAAAGAAATTTTGAAGAGAAAGTATTCAGCCTAACATTTGAGATTATTGGAG
CTCACGTTAGGAAAGGGGGAGAAACAGGTTAATTTGTGTTTGACTAAATTTCCGTGCCCC
TAAGGACATTAATGGTATATAAGCTCCCGTTCCATGAAATTTGGAACTTGTTAAATAAAT
AAGTGTTCTAGTCTAGTTCAGTTCTATGATTGGGTCTGGGATATATTTCTAAGAATTAAC
TTTTATAGTGGAAACTGAGACCCAAACAATTTGTTGCTTGTTCAAGGGTATAACATTTCA
ATGACAATCATCAAATATACTTGCAGCTAAGTAGTAGTAAATATCCATCATTGCTTTCTC
CCATTTTTCTCTTTAAAAGAGCATCGATACATTGAACTCTTCTTGAATTCTACTCCTGGA
GGCAGCTCTGGAATGGGAGGTTCTGGAATGGGAGGCTATGGCAGAGATGGAATGGGTATG
TAATCAACTGTAACATTATTAAAGCAAGCAGCATTGTGCACGTAGCAGTTCCTCTCAAAC
TTACTTGTCCCTTCTCTCCTTTTAGATAATCAGGGTGGATATGGGTCTGTTGGAAGAATG
GGAATGGGGAACAATTACAGTGGAGGATACGGCACTCCTGATGGCTTGGGTGGTTATGGT
AAGTGTCTGGCTGGCTTTTGCTCTGGATGTTAAACTTGTAGTACCCATATGGAAGGAGGA
GGCATAGTTATTATTACATTGCTTGCATTATCTGACACCATACTAAATTATTTTTCATGG
CTTTATTTTTGAAGGCCGTGGTGGTGGCAGTGGAGGTTACTATGGGCAAGGCAGCATGAG
TGGAGGTGGATGGCGTGGAATGTACTGAGTCGTAACCCAACAACATAAGTCCTGGCAACA
GCATCTGGTCTACTAGACTTTCTTACAGATTTCATTTCTTTTGTATTTTAAGAACTTTAT
AATGACTGAAGGAATGTGTTTTCAAAGATATTATTTGGTAAAGCAAAAGATTGTGACAAG
AAAATGTTTTCTGTAGGTTTTATTTGTTGCATACTTTGACTTAAATAAATTTTTATATTC
AAACCACTGATGTTGATACTTTTTATATACTAGTTACTCCTAAGGATGTGCTGCCTTCCT
AAGATTTGGGTTAATGTGTTTTATTAGCTCTACAAGTAGTGGCATGGTGTAATTTTAGAG
GACTTGGTTCACCTCTGCATAAGCTGCAAATCTTAAGCAGACATCTGGACTACAGTGCTT
GAAGAGTAGCATATCTTTTTCCTTTAATTTCCACTGGATAATACTGTAAATATAAAGCCT
AAAGATAAATTTAGGTGGATTCAGGAGTATAAATCCAGTTAATTCTATTTTCTTTTTCAA
ATGTCATTTGTCAGCACTGAAATGATCTAAGAGGTATCTGAACTTACACATTCTGTGGAG
CATGAGATTGTTGAAATTTAAATCTTGTCCTTAGATTTTAGAATATATTCCCCCTCAGCA
CTTGACTGACGTAATCAAAAAAGGTTCCTAAAAAGTGATGAGCTGTCGCAAGATGTCTTA
GGTTAACATGAGAATTCAGCATATAAATATATAGTTACTGTGGGGTGTAATTCACAAATG
TATTTTTTGTTTCCTGCCCAATAGTTAAAACATGATTTTAGAATAATTGTATAAATGATT
TTTTTTTTTTAATGTAAGAGACAAGTCCATATCATAGTCTCAGAGTCAGTTCATGCAGTT
GGATTTTGCATCTAACTAACATCTGCTTGGAGTTTTTAGAGCCATTATGTTAATTAAATA
TGTAGCAAGGAAAAGGTGCTTTTTACTTTTGTCCCATTGATCAATATGGCTTTTTTGAAA
TTCGGCTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1650..1788, 2296..2480, 2923..3009, 3452..3567, 5256..5391, 6139..6234, 6325..6417, 6554..6627
1001..1112, 1650..1788, 2296..2480, 2923..3009, 3452..3567, 5256..5391, 6139..6234, 6325..6417, 6554..6624
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved