Echinops_telfairi Locus ENSETEG00000003700
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000003700
Echinops_telfairi
ENSETEG00000003700
GeneScaffold_7687
SNORD50
43263..43335
52728
GAAATACTTTTTCCATTATAAAAGTAGATTTAAAAAAAAAATTTTAAGGTGACATATAC
AAATTTGCAATTAACTAGTTTTCCAAGTTTTATCCAAAATATTAACTAATGAAGGAACAA
GGGAACTGGCAGAGGTTGCTCAAAGAATATTTTGAGGATCTATATTTTTATTGGCAACTT
GAAATCAATGTTAGAAAAGGAATGCTAGGTTAATTGCAGGGGTTAAAAAGCCTGGCTAAT
GTTCTACAGGGAAATAAATGATTTCCTTTGGTGTTCATCATTTTTATCTATTTGTGGCTA
TACTGGATAAATATCTAAAAGTAATGTATAATTTAAGTGTTAGTCTGGAGCTTTTAATCA
GTGAGTTGGAAAAAACACAATTTCCTTGTGTAATTTAATCATCCTTGTTAAGACTATTAG
TTTATATTATAAGATATGTCAACTACTTATTTGCCTATTTACAATTTAAAACAATTTTCT
TAACATCTTATGCTTCAAAGGTATAAAACATCAGTATTAAAATATCAATGTCTTTTAAAT
TCTAATTATAGTAATCCCATTTCATTTGTAAATTGCTGTTACAAGTATCCAGACCAAAAA
GTACTCCAAGTTTTAACCAATGGAAGCTATGTAAATGACCTTACAGGCTAATTATGACAA
ATATCTGGGGGGGGGAGTTTATGTGAAGAATTTTTTGTAGGTTGAACAAATGGTGGAGTC
AATGAGGACAGGCTTGTAGTTAATTCTTTTTGTCACATTGAATCTCTTGCACCTAATTCA
GTATAGGTGCAAAAATTAAATGCCAGTGATTGAAGACATGACTTACAATCTGTCAAAGTT
TTGAAAATTCCAGTTATCTAATATGAACTATTTTGCTTTATATGCTTGACCAGGTTAACA
ACAATTATGTGCTAATTAAACCTACTTCTGCCGGCCTCTCAGGACACTAAGGCTCAGTAT
TTACCGAACCTTTTTCTGTATCTCATTCGGGCTATGGGGACATGTCTTCAGCAGAATCTG
GTAGGTTCTCATACTCTGTACTTTGGGGCTGGGATGTGGGGGAACAAGAGAGGTACTTCT
CAGACTGTGCATAGGAGTTATCTGTGCATTTGTGTTAACCTGCACATTCTGATTTACTGA
GTCTGTGGTGGGGCCCAAGGATCTATATTTCTAAAAAGCCATCAATTTTTAAAATAGCGT
GGATTGGCCTATTGTGTTTTATTTTATGCTCTTCAAATTACATTTTTCCTGATTATAAAA
ATAATATGCAAGTGGAAAAATTGAATTAAAATATACTGTAATTTTCCAACAAACTTTTTA
AAGTCCTTTGATATGGTCATTGTGAGAATTTGGAATGTACAAAATACAAAGCCTCCAAAG
TAATTAAAGATGCCTATAATCTTCAAAGCTCTGGTTATTTACACAGTTTTCTTAGATGTG
GACTTAGGACATATACATTACTGAGATTTTTGTATATGATCCTAGTGCAGCTTTAATTAT
ATGCCAAATCTCTCCCTATATGTCAGACCTCAAACATTAGTAGCTTGCCAACATTTTTAA
ATATTATTTTATATTTTCTCTTAATCCTTCCATACTCCACACAGTCTCCAGCTTTCACTG
TGCCCCACCTTCTTTGCCCTTAGGATTGCTCCTATCTTAGAAGTTTAGAGCCCAAACTGA
ATGGGACAACTATTGTCCATCTCTAGCCTTTCAGCTTCCACTTTAGAAGTCCTACTGGCC
ATGTTTATACTGAAAGATCAGGAAGTGATTTTTTTTTTATTGTAATCTTCCTTACTCCAT
TGTTTTCATATCAGGAGATTTAAAAACGTTTGTGGAATAAATCCATTATCCTTTAATTTT
ATTTCTTTTCTACAAACATTTTGAAATCCCATGTATTGTTTCTAGTCCTCCCCTCTTTAC
TACTATTGACAATCTGCTAGTATTTATAGCTTGTAATATTTGAAATATTTCTCTAAGGTA
TCATAAAAATAGTGACTGGTGACTTTAAAGCTTGGCTTAAAACAACACTTGCCTATCAGT
TTGTCATATTGTGGTGGCTCGTATGTTGCTATGATGTTGAAAACTATGTGAGTGGCACTT
TAAATACCATTAGGTGACCCGGTTTTAGCAGAGTTTCCAGACTAAGAACAGAATATGACA
ATGAAGTAGGCTGCTAACTTCAGAGGAACGAGCCACTGATAACCATAGAAAAGCATTGAA
ACATCGTCAGCTACTGAAACCTCGTCAACAGAACGGCGATAGAGAGAGTGCCAGAATACG
AGCTGCTCAGGTTGGAAGGCACGCAAGATATGACTGAGGAAGAGTGGTCTCCTCAAACTA
GAGCTGACCATAATGACATCGATGAAGTAAAGCCTATAAGAGTAAGGCATTTGAGACCTT
CATTTGCTAGTGGACATACTCAAAATGAGAAGAAACAGCTGCAAACATCAATTAATAATC
AAACTTGGAATATAAGAAGTATAAATGTAGGAAAATTGGAAGTTGTAAAAACTGAAATGG
GAAAAAAACAAACAAAACAAAACAAAAAACTGAAATGGAACATAGAAAGATCGACATTTT
AGTGAGCCGAAATGAATTGGTATTGGCCATTTTGAATCAGAAAATTATATGATTTGCTAC
GCTGGGAGTGACACAATCAAGAGGAATGACATTGCGTTCATCATCTAAAAGGACATTTCA
AGATCTGTCTTTAAGTACAATGTTGTCCGTGACAGGATAATTTCTATCCATATCTAAGAA
AGTCCAATCAATAGACTGTTGATGAGTTCAGCAAGTTCTCTTTGCTGTGCCACTGATGAC
ATCTATGTGAAGAATACCAGCATTTTCAGGCTTTTAACTTCTTGGATCTTAAATTTCTGG
TGATTTTACTGTTTTGGGTCCAATATTCTAAATTACAGAAGACCATTTAGGACCTGAGCC
AATTAGTCTATGATCTCTTGCAATTTTTGGAGTGTCCTAGAAAAGTTTCACTCTTCCAAA
GACCAGAATGAAATGTCCATTCTACTAAAGGCCCTTGCCAGAACAGATCACTTGCTTCTT
CATGCTTGTTCTTACTTCCCCCATGCTAACCCACTTTTTAAAAAGAAGTATTTATTTATG
ACTTTTGCATGTTACGTCCTTCTCAACATGGGAGGGCCACATTTGTGATTTGTACTTTTT
TAGGCATTCAAAGTTCATGTCTGGCTAGCAACAAGCTAGATGGCATAACTGGGAAGAGTC
ACTGGGAAGTACTTTCAGTACTAGGTCTTGTATAGGTAAAAGGTCAGGATATATAGCTCC
CAAAATCAGCATTAATTTTCAACAAGTACTTAAGTCAGTCAGCACATCTTTAATAGAAAT
GATGTCTTTCTTAAATTAGTGCCATCTTAACTGACAAGTAGTCAAGAAGTCTCAATCAAC
AAGAAGGATTTACATAATACCTCAACAAAGCCTGCTACTGGGCATCAACTGCACAGCACT
GAGTAGTTGTTTCACTAGTAGAAAGCATCCAATTACCTATATAAACGCACACACTTTCCA
TGAGTTTTTTGTCATGACTCCATGAAGAAGCTTGAGGACTATGTTATGGGTTCTTCTGTA
TCACCTATATTATAAAAGTGGTCACAGTTTTATGCCTACCATAATTTCATCTGCTTATGT
TCCTTCTTTTACTGTTCCTTACTAACCATTTACAACCATGCTCAAGTTCATTTGGGCACT
GCCATGTAGCTAGTACTTTCAAGACTACCTCCGCTCTAAAGACTACCTCCACTAAAGTTT
GCTCTCATGCCTGTGTTGCAGGTTCAAATACATAATTGCCACTGTAATGCCTTGATAACT
TATAAAAAGTCTTTATTTGGTTATAACTGGACTGCTAGAATCTAAAAGCGATTCTTTTGA
TTGCAATCCCAAGTGGACATTTCAGTGAGTTTATAAAGGCAAAAACTCATTTATCATTTA
TCAGGTTCTGAAAAGATTGTGCAATAGTGTGGGGGGGAAAAGGCCTGATATGTGGCAGAT
GGAGGACTAGTTTTGCCACCATGACAATGTACCTGCTCATGCAGCCATCTCAGTGCACTG
GTTTTTGGCAAAAAACAGCATGCCTCTCTTGCTCCATGCACCTTACTCACCTGACCTCCC
TCCTTGCAACTTATTTTTGTTTCTGTGAATGAAGAGGGACATGGAAGGACAGAGATTTGA
CCACCAGAAGAGGTGAAGAAATAAATGAGGGAGGTGCCATCCAAACAGATGAGTTTGAAA
AATATTTCCAAGAATAGAATGGCAGATTTGACAAATGTATTAAGTGTAATGGAGAGTATT
TTGAAGTAATAAGGTTTTTTGGTAAAAAAATATTAAATACATAGCTTTGAAAAAAATTCC
AGTTTTTGGAGGGTACCCCTTGTACACAACAAAACATTGTCCAATTCAACAAATTCTACA
TGTAGTATTCACTTGCCATTGATTATACTCTTTGTGTTGTAAACCATTATTGATATTATT
TTCCAAATGATTCATTCTACCACCTGTAACATAAACACAATTTAAGCTTTGATACTTTTC
CCTTTCTCATATTTGGATTTTGTTATTACCATCTTTGGATCACAAAGGCTAGTGTATTTC
TTCCATGTGGATTTAGTTGATGCTTCACTTAATTGCTGCTTGTTTGAAAACAAGCCTTTA
AGACCCCAAACACTATTCCAATTGGTAGCTGGGCAACTCTTCACTTTGCTCTAGCACCCT
TATCTTCAGTGATATCTTCAGGAAGGCAAGTACTGATTAGGGCCATGATACAAGAGCTAA
CAATCTTGGATTGAGGCTAGAATTAATTAGGAGACCAAAATCCATCTACTTGTCTACAGG
ATATGAACAATTCTGGTTTACTCTGGCAGTTAGATTAGGACAAAAACCAAATGAGAACAA
CAACAAAACAAAAAAGCAAAAAGCCCCCAAACAAAAGAAACTAAAACATTGTCAATAACC
CCCCAATTGTATAAGGCGATTGCATTGATAACTTCAATACTTTATCCAGTGCATACAATG
TAAGGTACTGTTAATGTGGAGAGTTTATTGGGGTATAGGTCAACTGGGAGCTGTAATCCA
TGAGTTAATACTTTGTACAGATTGATTTCTTAATTGATTGAGCTCTGTTTATATTGAGCA
TGGGGATTTGTGCTAGGGGAAAATTTGCTATACCATGTCTTACAAGGGTATACCCTTGCC
TATTAGCTTATTACCTACCTGTCATATTAATGCAAGTGGAACATTGAGGTACTAAATATA
TGGTGGTCCTGGGTAGCCTTCCATTGGACTCCCACTAAGCCTGGGCTCTTACCCAAAGTC
CAGTGATGGCCATCAACATAGCCTTGGGGTGGCCATCCCTTGCTTCCACTCTTATCAGAT
TATTTCAATCCTAAATCCAGGGGTACGGGTAGTTTGTCAGTAGGGCCCAGTTCCTTCAGC
CGGGCTTCCATGTTAAGTCCTTCTAGTGTGACCCTAGGGGGATGCCATGTTCCCTGTAAG
GCCAGCATCTAAAGTCACCATAGCGCTTAGTCCATGGCATGGTTCACTGAGGGTTGGGTA
GAAACATACTTGAATTATAGAGCTAGGAACATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCTGTGCTACTTATCTTTATAGTGGATCTGTGCTACTTATCTT
TATAGTGGATCTGTGCTATTTATCTTTATGGTGTTCCTCCTATCACCTGGCAATGTAGAA
TTTCCCTCTTAATTGGTCTCTTGCACTAATTTCTGTGGATTCCCTCTGGTATGCGTTACT
TGGTCGCCATCTTGCCAGAAGTCCCCAGTCCTTAAGTTTTAACTTTATTTGAGTAATTTA
TTAAGCTTGACTCCATATTGAATAGGTATTTCTTCCTCTTCATATTTTGAGTGCCTTCCA
ATATATATTATTTTCATTTTGGTTAGAGTCCATAAAATGTGATTGCTGAGTTCCTTTTAT
ATTTCAATATGTAATGCAATATTTAGTTCTAAAAGTTAGGGTAATTTTTTTCTTATTTTG
TAGACTGTTCCAATTTCCCCACATTCTTCTTATTGCTCCACTGTCATCCAGTTGATTCCA
ACTTAGGATCAAGACTGTAAATCTTTATGGGAGCAAATATTCTTATCTTTCTCCCTCAGG
GTAGCTGGTGGATTTGAACTACCCACTGTTATATTAGCTTCCTAACGTCTAACTCACAGC
ACCACAAGGGCTTTTCATCACTATTGGTATGTGGCTCCTAGCAGCCCTGATGTACAATAG
AATGAAATACTGTCTGATCTTACATCATTTTCACAATTGGAATGTTTGAGCCCATTTTTG
CCTCCACTATGTCAATCCATCTCATAGAGTATTTTCCTCTTTTTTGTTGACCATCTTCTT
TACCAAGCATGATGTCCTTCTCCAGGGACTGGTCTCCACTGGCAGCATTTCAAAAGTAGG
CGAGACAAAGTTAGACCCTTGTTTCTACGGAGTATTCTGGCTATACTTCCTTTGTGGTGG
ATTTGTTTGTTCTTTTGGCAGTCCCTAGTAATCTTTGCCAGCACCATATTCACAAATATC
AGTTCTTCTCTGATTGTCTTTATTCACTATCCAGCTTCAAGGGCTTATGCATTCATTAAT
TGAAAATATCATGGCTGGGGTCAGATGTACTTTAGCCCTCAAATTGATATCTTGCCTCTC
AGACAATATTCTATTGTTTATGTAAAGTTTTGATGGTGAATCTCCAAGAAGTAGACTTTT
TTTCTTCCTGGTCTGCTCTTAAAGAGCCCTGGTGGTGTAGTGGTCACATGTCAGATTCCT
ATCTACAAGGTCCACAGTGTGAAACCACCACCACCAGCCACTGCATTGGAGAAAGATGAG
GCTTTTTAATCCAGTAACTTGGAAACTCACATGGGCATTTCTACCTGTCCTATAGCATCA
CTATGAGTCAGAATCAACTCGATGGCAGTGAGAGAGTCTCTTCTTAGTCTAGAAGCTCCT
CAGAAACCTATTCATCAAGGTTGACCCTGCTGGTATTTGAAATAGCAGTATTATTGCTTC
ACAGTAACATTCAAGCCACCACAGTAGGACAAAATAATGGGCAAGTGGGGACTCAAAACT
AGGTAGCCATTCGTCTAATTTTTTTCAAAAATGTTTTTGAAAAATTGCACCTGATTATTA
TTCAAATTTGCATTATTTTAATTGATTGTGTGGTCAAGTATGTGATCTGTGTTCATTAGC
TATTTATATTCTCGCTTCTCTGATTTCTTATGCATATTTTNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTGAAGAAGTGTTCTAAAATTGATTGTACAACTCTTAAATATGT
TTAAACCAGTGAATTATATGTCAATAAAACTGTTAAAAAAATTTAAGTACTAGAAGGGTC
ATCATTGGGGGCTCATACAGCTCTTATCACAATCCAAACATACATCCATTATGTAAAACA
CATTTGTACATATGTTGCCAACATCATTTTCAAAACATTTTCTTTCTACTTGAGCCCTTG
GTATCAGCTCCTCATTTTTTCCTCTTCCTCTTCCACCCTCCCTCATAAACCCTTGATAAT
TTCTAAATTATTATTATTTTCTCATTTCTTATACTGACTGATGTCTTCCTTCACCCACTT
TTCTGTTGTCCATCCCCTGGGGAGGGGCTTATATTAGATCATTGTGATCAATTCCCCCAT
TCTCCCCTCAACTTCCTCTTACCACCCTTGTATCGCTACTCTCATTGGTCCTGAGGGGTT
TTCTCCTCTGGGTTTGTTTATCCTGCCTATCTTATCTAGATAGACATTCAGAGACAATAA
TAAGCACAGAAAACAAGCCTACTGGTCTTTTTGGCTTTCAGCAAGCATGGTTGTGTCATC
TACATGCCACAGGTTGTTAATGAATCTTTCTTCAATTCTGGTGCAGCGTTCTTCATATTG
TCTCCATATTGACTATTTGTTCAGCATACAGAATGAATAAGTTTGGTGAAAGGATATGGC
CTTTCCTGATTTTAAAACATGTAGTATTCCCTAGTCCTCTTCAAATGGCTACCTCTTTGA
TCTGTGCATAGGTTCCACATGGACACATTAAGTGGCCTAGAATTCCTATGCTTCTCAGTG
TTATCTACAATTTGTTATGGCCCACATAGTCAATAACAAGGAAACATCATTTTGGTATTC
TCCGATTTCAGCCAAGATACATCTGGTGTTAACAAAGATATTCCTTATCCCATGTCTTCT
TCCGAATACAACTTGAATTTCTGGCACCTCATTGTTATACTGCTGCAGGTATCTTTAAAT
GATCTCTTAGCAAAATTTTCATTTCATGTGATATTGCTTGATAATTTTCTCATTTTGTTG
TCTTACAGATCTTTGGAATGGGTACAAATAGGAATTTCTTCTAGACTTTTGGCCATGTTC
CTGTCAAATTTCTTGGCATCGACAAGTTAGAACTCCCACTCTACATCAGTTTGTTGAAAC
ATCTCAATTGATATTCTATTAATTCCCAGAGCCTTGTTTTTCACCAATACCTTCAGTGCA
TTTTGAACTTCTTCCTTTAGTATCACCTGCCCTTGATCATATGCTATCTGTTGAAATGGT
TGAATGTTAACCAATTATTTTGGGTACTGATTTTATATAGTCCTTCCTTGTATGCACACT
CATACACATATACTCATACACACGACGTGGCTTCAAAAATTTGTAGAAATGTCCATTTTA
TTTTAATTAAACTTTTCTAAAAACTTTTTCAAGCCCTTTCTAAGTGTGTGTGTTTGTGTG
TATTAATATTATTAATTACATAATTTAGATTTTTCTACCTTTGGTATTTGTGTGTGAATG
TATGTTTGTGAATGTCTGTTGATCTGCGCTAGAGTAAGATGTATATTAAACCATCTATAT
CCTCTCATCTCATAATCCAGGAGCTTCTAAACACTCAGTCCCAGGAATGGCATAAAAGTT
TCTCTTTTTTTCAGAGAAATAGTTTTGTTCATTCATGTCTTGTCAACATTGTCAACATTT
ATGCCTAAATCACATTATGAAGCTGAATACTTCTCTGTCTGATGCATCTTATGAGTTATA
GTACTCCACAGTTTTCTCCAAAAACTGTATACTTTATGTAGTTAAATGTAAATAATCACT
GCCATTGAGTTGATGCTGACTCATAGCAACCCTACAGGACAAGACTGTAACTCTTTATAG
GAGTAGAAAGCCTGTCATTCTCCTGTGGAGAGGCTTATGGTTTCAAACTGTGTACCTTGT
GGTTCCACAGCCTAACGCTTAACCACTATGCCACCAGAGGCAGTCATTTTTTAAGTAATC
GACTCCTCATCCCTGGAAAAACAAATTTCCATTCATCCTTGAATAGCTTTTCCTTTATTT
AAGAGAAAAAAAATAGCAACAATAAAATCCCTCCTCAACAATAAAAGAAACCTAGGAATT
TACCAATGTGAATCTTTTTCTCTTCTTAGGTATGCCAATTATCTCTGAAAGTGAGCTAGC
TCAGTTGGCACAGATTCGACCATCAATACTCAATGGCCATGAGCAATCAACCATCAAGGC
TTGCTTTGAAATGCTTCAGAAAAAAGTGTTAAATTATGAAATCTTCCAGGAGTTTATGGT
AAACATTTTGGTATTTACAAAAATTTATATTTATGTCTTTGCTCCCTATACTCACATCAC
TACCAATGGTTTTTTCTGTTATTTGTTTCTTTTTTTAATGGTACAATGTTGTTGTTTATC
AAAGTTGTAAATACTAAATTTATTTCTGGAGCCATAGTTCATAGTGGAGCCCTGATGTAT
AGTGGTTACACTTTGTGCTGTAATCCGCGTCAGCAGTCAAAGCCANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTATATAACTTTTGGGGGCAT
GCCAGCCCACTAATTACAGGTAGAGACATACATCACAGGGAGGGGTTACAGTATAGGGTA
CCCAGTAATGAGAGGGTGGTCTCTGGGTCTCCATAGAAACCATTATCAGTAGGGTGCAAA
CCCCTCCTATAGAAACCAAGCTAATGGCCTTAGGCTCCAGAGAGAGGTAACCCATTGTCT
CTAGCAGTAGAGAGTAGGGCTAGTGCAGCCTGGCAACTGATTGCCTTCAGGGGAGGGAAT
GCCTTCGCATCTGACCTCCCCCCACATACAAGAAAAAAGATGTGTTTTCAAATGGAATAT
GGTGATGATTGTACAACTCTTCTTGATATGATGGAATTATTGAAATCTATGATATGCGGA
TGACATGCTAATAAAGCTGTTTTTGTTTACAAAAAAAAGAATTGCAGCCTTCAGTATGGA
TTACAACTCAATATAAAGAAGACAAAAATCCTCACAATAGGAACAATAGGTATCATCATG
ATTAATGGAAAAAAGATTGAAGTTGTCAAGGTTTGCATCTTGCTTGGATCCACAATCAGT
GCTCATAGAAGCAACAGTTAAGAGATAAAACAATGCAGTGCATTTGGTAAATCTGCTGCA
CAAGGTCTCTTTAAAGTGTTGAAATGCACAGATGTTATTTTGAGGACTAAGGTGCACCTG
ACCCAACCCATGATATTTTCAGTATCCTCAGATGCATGTGAAATTTGAACATTGAATAAG
GAAAACAAAAGAAGAATCAATGTGTTTTAATTATTCACAAAGAATATTGAAAATACTATA
GACTTCGAAAAGAACAATCTGTATTGGAAGAAGTACAGTCCGAATGTCCCTCAGAGGCAA
GAATGGCAAGACTTCATCTCATATACTTTGTCCATCTAGTAAGAAGAGACCAGTACCAAG
AGAAGGACATCGTGCTTGGTGACATATTAGGAGAGTGAAAAAGTGGAAGGCCTTCAACAA
GATGGATTGACACAGTCGCTGCAAGAACAATTGTGAGGGTGGCGCAGAACTGGGCAGTGT
TTAGCTCTATTGGACGTAGGGTCACTGTAGGTCAGAACCAACTTGATAACAATCCCAAGG
AGTTAGAGATTAAAATATCCCAAATGTCCAACTTTTGCAAGATGTTATTCTGCTATATCT
CCCACTCCCCCCTCATCTATTGAGTCTATGCCCTCACATTCCTGGGTTCTGCAGGTCACT
GTAACATTGCACAGAAACTCACAAAGCTTGGAGGTAATATTTCACATGGTAATGAGTGCT
CTTCAGTCCCAGATTCAACAGTCAAACAGGTGAACCAAATGTTGGCTTCAGAGCCGGAAG
CAAACTCAGTCAAGGATAGGGGCGTCACATTCCAAGTGGGCTGATGTGTGTTAGAACCAG
TTTATATACTCCACAAAGGATGGTGTCTTAAGCCACACCTTCTACTAAGGTAAAATCAGA
GATGCTCACAAGAAAATAAGGGATTTGATTTGGCTCACCCTCTATAAAAAGGTGGTATCT
TTTTTTTTTCCCCAAAGGTGGTATCTTAAAGATATCCATAAAGAAACAAAATGTGTGGCT
TGATCCACACCCTATACTAAATTTAGGTCTGAATCCCACCCGATTTCTGTCCATTAGTGT
GGTAGATAATGCCCTCTAAAGTGGGACTATATCCACAGGTTTCTAAAGTCCTGATTTATA
TAAGGAATTATAGCTATAAGGTCCATATTAATTGACTATAAATTCATATTAATAATCCAT
ATAATTTATATTAATTGACTATAATTGAGATATTGTTATTTTGCTCTGAATCTCTAAAAG
AATAGACATATGTTAGATTTTTCCCTCTGCATAACCCTTTTATTCGTTCTTTTACTTTTA
GCTATCATTTCCCTCTCCTTCTTTTGTCATTTATTTGATGCAAATTTTTGTACCTTGGTT
CCAGTCCATATTGTTGGCAACAAGAACAGTCTAGCTAGTGCTTCTCTCTCAGTCCATTCT
GTTTTATGTTTGGTAGGTCGACATAGATACAGGACTAGTAGACTACCCGGACCACTGGGC
AATACAACACTGTTTACAACCAAGCTTACAATCAGCCCCACTTTTGCCAGATTAGGCTAG
GTACAATCCATCCCATCATTGCCTTGGGAATTCTCACATACAGGTTTAGAGGTATAGTTA
TATCTCTTGTAGAGGGATCACCCCTGCTTCTGGCACTCAAAGCTGCATCCCTGGGATTGC
AGCATCAGGCAGAAAAAAAGCAATTTATGATGGTGTAAGGAAGAATTGTACAGTGGATCA
GCATTACCCTCTCCCTCATCTTAGTCAGACCCTCCTGAAAATGTGGAAATATATCTTGTA
GCGATCTTTGTGTTGAGTTTGAGCACAAACTCGTGAAGGCATGAAAACCATCCCCTCACA
CCTTTATCTCCCCCTGTTTAGGATAATAAATATTTCAACTGCACATTCTAATTTTCTATC
AAACCATTACACTGAAGGTGGTATGCAACATTGTTATGTCTATCTAATATGTTTTTTGGG
TCTTTACTGCATCCTGTGGGATGTATAGTGTGTTCCCTGGTCTGAAGAGCTGTAACTTGG
TGGCTCAAACTGGTTCAGTGTCTTTTGTTCTCAATTCATAATGGTATTTTTAGTATCTGC
ATGTATTACTTGATATGGAAAGCCCAGTCCAGAATAATTGTATATTCCTATGATGATCCA
TTTGTAGCCACCTGGTCCACTGGTATAAATTTATTTGCCATCTATGTGCTGGGCCTTCTC
TCCAGGGAATCCGCCCCATAACGTCTTCAACTTCTGTCTTTTCTGCTGACAGCAGAACAG
TCATTATTGGCAATTTGTGCTTCAGAAGGTCTAAGAGGGATATGTCTATATTCAGCCCAT
CTCTTTATTGCTGCAGCATCCTCATGTCCACCCATCTTTTCAACCCAATTGACCATCTCA
AGGGAGCATACCAACACAGCCATTTGCTGATTCCAATCACTGTCTGATCCAGGAAAGGGG
TTCTTCTGATAGGCATCAACATGTCTGACACTGTTGCATTCTTTAAATTTCCGTGGTTAC
ATTGCCCTACACAAATGTTCCTTTACTACTCCAGTTTTCTATTAGCCATTTGCCTGGCCA
GCCAGGCATGCCATCGACCACACTCTGACTCAGTAAAGCTCCAAAAATACAGGTTCTTAC
CATTGACCACTTTGTCTATCACAGCTAGGAAAACAGCACACAGTTCAGCCCACTAAGTTG
ACCTGTTCTTACTTTCTTCAATTAAAGTCTTTCCACTTGCTCATCTTAATACAGGCGATT
TCAACATCAGATGTTGTCCTCATACCCTGGAACTGCCATCTGTGAACCAAGCAACCTTCT
GCTGGTCAGCAAAAGTTCTTCGTAGGACACGGTCCAAATGGCAATAGGGTCTAATAGCTT
CTCAGTGATTTCAGGGTAGGATCTATGGGAATGGCTACCTGTTCATGGATACTGTGGCAG
TTACATAATTTCATGTTAACTTGATAAAATTGTTTAGGGGTGGAGTATAGGTCACTGTCT
TACGATGCCTCCTTGTGGGTGTGACCCTCTCATGAAGATTATGGGAACTTCCTCTTTTTT
CCCTGAAGGTAGGCCACACACTCTCATACGTGGTTTTACCTTCCCGCTGGCAAGCCAAAT
GGCTGAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGGTCCTCCAC
CCTTGCAGCAAAGATGGTTGTGTCATCTGCATATCACAGGTTATTAATAAGCCTTCCTCC
AATCCTGATGCCACATTCTTCTTATATTGCAGCTACTCTGATGATTTGCTCAGCATACAG
ATTGAATAAGTATGGTGAGAGGATATAACCCTATAGCACACCTTTCCTGATTTAAAACCA
TGTAGCATTCCCTTGTTGGGTTCACACAGTTGCCTCTTGAGCCACGTGCAAATTCTGCAT
GAGCACAATGAAGTATTCTGGAATTCTCACTCCTCCCAAGGCTATCCACAGTTTGTTATC
CACACAGTTTAATGCCTTTGAATAGTCAATGAAACACAAACATTTTTCTAGTATTCTCTA
CTTTCAGCCAAGATTCACCTGACAGCAGCCATGATATCCCTTGTTATACATCTTCTTCTG
AATCCTGCTTGACCTCTGGCAGCTCGTTTGTCAATGTTTTACTGGCATGCAATATCAGTG
ATATTGTTCTATAATTTCAGCATTCTGTTGTGTCACTTTTTGAAGTGGATACAAATATGA
ATCTCTTGTAGGCAGTTGGCCAAAGCATTTTATAAATTTCCTGGCATAGACAAATGAGTG
ATTCTATGACTTCATGAGTTTGTTGAAACATCTCAGTTGGTAGTCCATCAGTTCCTGGAA
CTCTGTTTTGGCTAATGCTTTCAGTTCAGGTTGAGCTTCTGCCTTCAGCACTGTTGGTTC
TTGCTCATATGCTACCTCCTGAAATGCTGGAATGTCAGCTACTTCTTTTTGGTACAGTGA
CCCTTTGTTTCCTCTCCATCTTTTTTTTCTTTTCTATACTTCCTGCACCATTCAATATTT
TGCCTGTAGGATCATTGAATATTGTAATTTGAGTCTGGATATTTTTCGTGAATTATTTCC
ATTTAAGAAATACTGAATGTGTTCTTCCTTTTTGGGTTTCTAACTCTAGGTTTTAGCATA
TCTCGTAATTTCTGACTTTGACTTCTCTAGCTGCCCTTTGAAATGTTCTATTCTGATTTT
ACTTTACCCTTCTCCCCATTTGTTTTAGCTACTCTACAATTAAAAGCAAGTTTCAGAATC
TCTTCTTTTTTTAAAGTTTAAGTAGGATATTTCATCTTTCTGTATCCAGAGCTCAGAATG
ATATCTCACACCAAATTTTATTTTAGTAAATAAAAACAAAGGATATCGTCATTCAGATAT
TGTTCCTCTGTGCTAAGTACGCTTTTAGGACATGAGAAAAGTCACCAAAATACATGGTGC
TTTCTTTTCATGGGTTTACATTGTTAAAGAGATTGAAAAGAAAATGAAAATATCTGGAAA
GAATTAATGCATTTGAATTATGGTGATGGATAAAAACAATGAATATACTATGGGCTCCCA
GAAGAATGAATGAAGATTCTTACAATAAGTAAAGTAGGAATGTTCCTTAGAAATGAAGGT
AGTTATCTATGATGATCCTATCCCAAACCTGAACAAACTGTTGAAAAAAAGTTTATATGG
ATCTGGCTTCTGAGTTGGGGGGAAAAAGAAAAAGAAAGAAATGAAGACAGTGAGACTTCA
TCTCATGTGTTTTGTGCATGTTATCTGGAAAGTCTGAGCAACACTTTTCTGTTTTGTTAT
GCTCAGGATTCATATGAGTTGAAACTACCATTAAATTGATCTAACTCATTTCAATCACAT
GTGTTCAGAAAAGGAGTTTTCTCCACAGGGTTTTTAAGGCTGTTACTTCTAGGAAACTGA
TCACCAGACCTATCTCCTGAGGGCCCTCTGGGTAAGTTTGGCAAACCAAAAACCAAACTC
ACTGTCACTGAGTTGGTGCCGACTCACAGAGACCCCATATCGGGCAGGGTGGTAGTGCTC
CTGTAAGTTTATGAGAGGCAGGGTCTTTCTGGCATCCACTTCCTGTCTGTTTCATAACAT
TTAGCTTTCTTCATGAATGATGTTCTTGTTATCCTCCCACAGCCCATCAGGTCTTCTGTC
GTTAGTGTTCAATGCATCAGATCTTTCCATGAAATAGACTAAAAATTCAGATGGGATAGA
CTTACAGTCATATTTGGGTTCTCATGAATTTGTTTTAATTTTTTTCAGGTTAACCTGAAC
TCTTACATATGAGCAGTTGATGGCCTGTTCTGCAATCAGCCCCTGGCTTGTTTTAGCTAC
TGATAGTGAGCTTCTCTTACATCTCACCTCTAGCATCTCATCACAATATAGTCAATTCGA
TTTCTGTGTATTCCATCTGGAGAAGTCCTTTCTGTATATCCATTTTTTTTTGCATTGTTG
AAAAAAGGTATTTGCTATGAACAAGTAATTGGTCGTGCAAAATCCCATCATGCCATCTCC
AGCTTCATTTCTATCACCAAGCCAATGTTTTCAACTACTGTTCCTTCCTCTTTATTTCTA
ATTTTACATTCCAATCACCAATAATTATCAATGCATCTTCATTGCATGTTTTATCAATTT
CCAACTGAAGATATTGGTAGAATTCTTCAATATCTTCACCATTAGCTTTTGTGATTGGTG
CATAAATTTGAATAAAATTTGTTTTGATTAGATTTCCTTTAAGGCAGATAAATATGAGCT
CATCAGGGACAGCATTGTACTTCAAGATTTTGTGCTGTCGTTGACCATGAATGCAATGCC
ATTCCTCTTGACTGTTTTTTTTTCCTGGCATAAGTAAATCATATGATTTTCTGATTTAAA
TGACCAACACCAGTCCATTTAAGCTCACCAATGCCTAGATATTAATCTACATGCATCCTA
TTTTATTTCTGATGACTTCAAATTCTTTTAGATTCATACTTTCCATGTTCCAAGTTTCCA
TCATTTTCAGATTTTTGCAGCTATTCTTCTTACCTTGATTCATGTCCCATCAGCAAATGA
AGGCGCCATTCACACAGGCTTTATTCCTTTTCATGTCACCATGTTGGGCTCCACTCTGAG
AAACAGTTCCTCTTCAGCTACATTTCGAGTTCTCTCTGACTAGAAGGGCCCATCTTCTGG
CACTATGGCCAACAGTGATCTGCTTTCATTCATTAGGCCTTCAGTATATGACAACGTTTC
GAAGCTATGCATAAGGTTTTCAGTGGCTACTTGCTCCCAGGTGGGCAGCCAATTTCGTCT
TCATTGTGTGTTCTTAGTCTGGAAGCTCTGCTGAAACTTGTTCATTTTAGTAACCCTGTT
TAGCTTCCAGCATCACAGAAAAGCACAAGCTCTCACAGTGCAACAAACTGGTAGTCAAGC
GGTGGACCTATATATAAAGGACTTCAAAACTTCATGGAAAATGAAATTAGATGATTAAAT
GAATTAAATTAAAATTTAAAACTTTATTTTTCAATATAAATTCCATCACAGTCAAGATAC
CATGGTAAGTGATGATATCAGTCATTTAGTCTATCCCCCCACTCCCACCACCACCAAACT
GACTGAAAACCAAACTCACTGTCATCTCGCCATTGCCAGCTCATAGTACAGGACTGGGCC
GGATTTCCCCTGTGAGTTTCTGAGACTGTAACTCTTTACAGGAATAACAAACCACACCTT
TTTCCTGAGGAGCGGCTAGTGGTTTCAAACTGCTGATGCTATGGTTAGCAGCCCAACATG
TAACCACTATACCACCAGAGCTCCAAGACTGTTATCTTGGAGATTTTACCATTTATTTTT
TACACTATTAACTGAGGAGAAAAATGAGTGCCTTTTTTTTTTAATGTTTTTTTGAATTAG
GAAACAAGTCAGAGGGGGCCAAAAATGAAATCAGAAGGAGTCAAATCAGGCCTTGGCAGA
TGAATGCCTAATGCTCTCCTATCTACACTCACAGATTCTCCCATGTTTGGTGAGAAGAAT
GAGCAGGAACAGTATCTGTGGAGAAGGATTCTCTTGATATTTTTGTGCTAATGCTTTCAC
TAACTTTCTCAAACTACTCCTATAATAAAAAGATGTTATTGCTCGTTGGCTCTGTAGAAA
GTCAACAAACAAACGTTTTTAGATTTTACTTTTCATTGGTTCACTTTTGCTTTAACTGTA
TCATTCCTACCTCTTTGGTAGCCATTGCTTTGGTTGTACTTTTCCTTTGGTTCATACCAG
TAGGGCCATCATCTCCTGTGGCAATCCTTCAAAGAAATGCTTCAGAATCATGATTCCACT
TGTTTAAAATGTCCACTAAACGCTATGTTCTCATCTGCATCTCATCTGGGCTTAAATATT
TGGGCACGCATTGAGCAGAAAGATTCCTCAATTTTAATTTTTTAACCCAAGTTGTGTAAG
CTGAAGCAATTGAGATGTCTTTAGTATTTGGCACTTGTTTCTATTATTAATCACTGGAGT
TCTTCAATTAAAGAGTGCACAAATTGATGTGGATTCCCTGTTGCTGTAGGCTTCCTCTCC
AACATTATCTTCTGTCTTCTTAAAAAGAATTATCCACTTCTAAACTGCTGATTGCCGGAG
TCATTGTTCCTATAAAGATTTCATAAAGCATCAGTGTTTTCACTTTTCTTCCATTCAAGC
TTTGCCATAAATTTAATGTTTGCTCTTGCTTTAAATTTAGGATAATTCATGTTGCAGTGA
TAGCAGCTCTTTTCCAGCTGATGTCTTATCATTCTTTAGATATGTTATAACAAGTTAGTG
TGAAATAATTCTGTGCACAAAAATTATGAAACTCATGAACACTTTTTTCTTAATACCCAT
TTTATGTGGACTTTTTGAAGACGCCTTGTACCATTACGGGAGATTTCTAAGTGTTTATTA
AGCAAAAGAGTCACAGCCTTTTATTCATTTTGAGATATTTCTGTTAGATAATGGCACAGG
TAGAATTAGGCCAAGGGATGTACTTACTATTCTTCAGTTCAACCCAGCACAGGAATAGCA
TTCTGGAAAGTAAGTGAATATATTGCCTTTGCAGGAGACTGAAAAGTCTAGTGTATCAGA
AGCTAGGGGTCAATGATGGGGTGGTGGATGACTTGATGAGGAGTAAATCCTGGACTCTAA
GGAACTTGACTGGGTATCCTCATATAGGACAGCCAGCTTTTATTATCTATTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGGTATTTTCTCCAATTAACATAATATG
CGAGAAACAACATTTAGGAGAAGAAAAATATCTGCTTGACCTATCAGTAAATTTCCCTGC
CCATAGAGCTCCTTGGTCATTTCACAGACATTTGGAGCTCTGACTCCACTGCTGCTCCTC
ACAAAGAATAAATTTGCTTAGCAAATGAATAACCTTCTCTGTCATGTAACTGTCTTATCA
ATAACCCTTCCTTACTCTTCACAACCATTGAACCAGTTATCCAGAATATACAAGGGACTT
CCAAAAGTTTGTGGAAAAAATCCATGATCTTTCATTGAAATTTTCCACAGCCCCCTGTGT
ATCTCTGAAGTCATTTTAATAGGTTTGGGGGAATCAATTGTTTAAAATCACAGACACAAA
TAGCCACTTTGAAAAGAAATCCTTATATCAGGCTCTCCATTGGTCAAATAAATATATGAA
CTTTTATTTGTGAAATGCTTTCCTAAAGTATATCAAGTCATCTGCTTTTCCTTTATCTAT
CTGGTGTTTCTGTAATAGATGATTCAACACGTGTTCCTCTCGGAGAAAGTAATGACTACA
TCAATGCTAGTTATATTAGAATAGTAAATTCTGGAGAAGAATATTTTTACATTGCTACTC
AAGGACCACTACCAGACACCATAAGTGATTTTTGGCAAATGGTTTTAGAAAATCAAGCTA
ATGTTATTGCCATGATGACCAGAGAGATAGAAGATGGAACTGTCAAATGCCACCGCTACT
GGCCTATCTCTCTTAAAAAACCTTTGGAATTGAAATATTTCCGTATCTTCTTGGAGAACT
ACCAGATACTTCAATATTTCATCATTCGAATATTCAAAGTTGTGGAGAAGACTGTAAGTG
TTTAAAAATCAATACTATATATGTTCCCCTAACTAAGCAATAAGGACTATTATAAGGAAT
AGAATGCGAAATATGTATTAAGTCCTTAATATAGACTATATCTGTGCCCAGCACCACTGG
TGCTTACTGAGTAATAGGAAGATGGGTAGACTCCTGATGATTTCAATTACTGCGTTAAGT
TGAAATAACGGAGGCTTGGAAGGGAGGTACTTAAGTTTACTTGGGGCTTGGGGAAAGGTT
TAGTAGAGGTGATGCCTAGATTGAGAATTACTCATATAAAACCAATGGAAAGAAGAAACA
GATCATTTAAATGAAAATAGCATGAGATATCTATAGAGAAATGTAAGTAGGTAAGTATTG
CTGAATATGAATATTCAATGCAAGTAGTAATTAATGAGAAGTGAGATGAGACTGTAGGAG
AGAATAGCCAGAATGTGAAATGTTTTTAATTTCAGATAAGAACAACAGATTTTATTAAAA
GGATATTTGAGAGACATTGAAGAATTTTAGTAGGAGAGAGGTATGATCAACTTTTTAAGA
AAGTTGGCATTAGGTTGGAAAACAAAGGCATAGTCGTTTTGCAAGTAAAATTCATATATG
TATAACTTATGAGTGACAATAGGAAGCATCAAAAACTGCTCAAACCAATTCAGTAGCCAC
ATGTGGCTATTCTAAGTTTAAATATTTAAAGTTTTATTAAATAAAAAATGTATTTAACAA
ATTGCAATAGCCACATTTCTGGTGTTCATTAGTTACCTATGACTAGTGACTATCATCTTG
GACAGTATGAATATGAAACATTTTCATCAATTTAAGTTTTCATCAAAGTAAGTTTTATTG
AGTAGTTCTGGTTTACTGTAATTCATGTACTTCCAGCTCTAATAGATTCAGAAAATCAAA
AGGAATTATATGTAGGAGAAGATTATGTATTATGTTCCTCTAAGTAAATTTGTGAGGTAA
TACATGAGCTCAGCAAGAGTGAAGTGGGTAAAAGTTGAGCAAAAAAATTCATAGAAAATG
ATGAGGTTTGCAAAAACCGGTGAAGTTTGGAGCATAGGCAAAGGCAGGAAAGTGTAGTGC
TAAGGTTTTAGAACTCACAAATCTGTAATGGTAATGGAACATTTTATAGCTATGTGATTA
TTTCTAGCACTCTAGTTATGGACTTGCTGAAGACAGATTGTGTGTGGGACCGATATGGTT
GGGATGTTGTATGTAGCAAGAACTAAGAATAAAGGAGTTAGCAGTTCACTAAAAGAATAA
TGCAGAAGTCAAACATGAATCTCAACTGCTCAGAGAGGTGAATGGGATCAGAGAAGGAGG
GCAACGGGGAATTAGTGGAGGATTTAAAAAACTGGAGAGCATCATTTGTGATGTTGGATT
GAAGTGAAGCAGGGATGAGCTGTTTCTTGTCAGAAAGTGAGGCTGTGTGTAAAACTGAAG
ATTGCATGTGATGGTAAAGAGTGGTCAATATCACAAGAACTAAAAGAACAGTTGTTCTTT
TAACTCTAAGAGGGAACTAAACATACTGTGACCCTATGATCTGTTGAGATCTGAATTCAT
CTGCCATGATGTCAAAATATGTAGTAGGGAGATGATTATGTTCTTCACAGTATAGAAGAC
CTACCAGAAGAGCAATGAGAAAATAGAAGCTTGGAGCTATGTGCTTCAAAGGAAAAAAGT
AGATTTTATACAATGGTAAATTCATGGAAAATGGAATTAAAAGATAATGGACTCTTTCAA
ACTTTTTTTATACCTATATATTTTTTGGCTTGTTTTTGCTGTCTTAAACTTTTCTAAACC
ATAAACATCACCAATGGGCTCTTCTTCGTGTGTGTTTCATAGTGACATTCCTACCTTCAT
CAACTATGTACGCTTTCACATCGGCCACAAGTCACTTCTGAGTGGTGTGCAATGCATACT
GCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTTTACAAGTTATTGTTTTTCAATCATCTCACGTTTCATAGTGGCCAATGA
CTTGAGACATTTAGTTTTCTTTGTTTGGGTGTCAAAGTTATGAAAAGGTGTTGGATATCT
GTGACTCACCTCTTCCCAACTGTCATTTATAGACCAAAAAGATACTTCTATTTTTTTCAA
ATCATGTGTAATACTGAAAAACATCAATAACTAAAGGGATGTAGAGATTTCTTTAGATTT
ATAATTTCAGGGAGAAGTTTTTAAAAAAACATCCAAGGAGGATTTCAATAAACATGTGAA
ATTATCAGGGGGATCTCTAAGTACCAACATCTTTTATTAAAGATGTTATACAAAAGATGT
GTTAGGGAAAGGTTAGGAGGACAAAACTCGACTGTAAGTTGTTTACAAGGGTCCTACTTG
AAGACAATGAGGACCCCCCACTGAAGGAAGGATAATCCCTTTCTTGGGGATTATGGGCCA
ACTCAAAGTGTTTTTTTGGTTTGTTTGTTGTTTGTTTGCCAACCATTAAATCTTTGATGA
TTCTCCTTCAAAGGGTCAGTTCAGGAACAGGAGCCATAGTCTCCTCGCATGACCAGTTGA
TCGTTTTGTTCTCATTGCCAAAGAAATGCAGTGAACCCTCATTAGGCAACTTGACACTAT
CAAGTGGTTTAAATTAAATTTAGTATCACGATAGTTAAAGTTAATGCCTTTTTATCTTAT
TCCTAACATATCAACTCACTTTTTCTGTAAATATTTTATAATCTTTGTTTTTCTCTACCC
TTATGGTGCAGAAGAAAGATGATAGATTAGGTATCCAAGAGGCCTGATTTATAGTCCCAA
CGCTAAATATTATTATGCTTATGACCAAAGCATAAATCTCTTAATACCTCCAATATGTTG
TCTCTTTGCCTATAAAATAAAGACAAAATAATACCTGCCTCACAGAGTATATTTAAGGAT
GAAATGAAAGAGTGCAGGTGGAGTAACTAATGCAGGGCCTCGAATACAGTAAGTGCTGAG
TTTATGTTACCTGTTAGTGATGTTCTGATAGTTGTTGTTGTGTTTCTTGGAAAAGGAGCT
ACTAACAACTTATAGAATTCTTTAAAATATGAAAATGAGGTTTTAAATACTCATTTGAAA
TCTCTATATAATGCCATCTCAAAAAATCCAAACTTCCTACCACGGATACAATTCTGATCC
TGATTCACAGCAACCCATAGGACAGAACAGAACTTATCCTGTGGATTTTCCAAACTGTAG
ATCTTTACAGGAGCAGAGTACCCCATCTTTCCCCCAGAGAGCAAGCACTTGGTACTTTCG
AATTGCTGACCTTGGGGTTACCAGCCAAACTCAAAATCTAGTATTCCCCCAGGGCTCCTT
ATCATACCCTCTAGCCATGATTATTGCTACTGTTGTTAGAAATGAGGTCTGAATATAAGA
AATGGCTGACATTTCCTCGGACTTTTCCTCCTTCTCCTGTATTTTCTCTATTTCGTTGTC
AATCTCTTGATCTGTGTCAATCTCTCTCCACAGACTGGAACTGTTCACGTTGTAAAACAG
CTGCAGTTCACAAACTGGCCAGACCATGGCACTCCTGCCTCAGCAGATGATTTTATCAAG
TTTGTTCGTTTAGCAAGGAAGAGTCACCAGAGTGGGCCTGTCATTGTTCACTGCAGTGCT
GGCATAGGCCGAACTGGGGTTGTGCTGTGTGTGGATGTTGTGTTCTGTGCCATTGAAAAG
AACTTTCAGGTAAGTATGTCAAGTAGATAATGCAAAGTTGCTAGTAAATCATAATTTTAA
CAAACACCCAACATTGGAAAACTAACCTTAGGTCTTGAAATTGAAAGTTCATGTAGCCCA
ACTTGGTGCAAATTACTTAACCTCAATGAAATTTTGACTCCTGAGGCTGGTTGTGAGAAT
TAAATTATATAGAGCAAATAAGTAACTTAGGCAGTATCTGGTACGAATCAGGTACACCAT
AAGTATGAATTCATTTGCCTCTCCTGTCTTCCACTCTATACCTGTTATTTTATTTTATTT
TTTAGAACACTATTACCGATATATATTTGCTTTTGATGAACAAAAAATATATTCCCAAGG
ACACACTGGAAAAATCATAGCTTTTGGAGTTAATGAGAATAAATGGTAGAACTGCCCCTG
TGGGTTTCCAAGACTAAATCTTTACAGGAGTGAAAAACCTAATCTTTATCCTGCAAAGTC
GCTTAGGATTTTGAACTCTTGATATTGGGGTGTGCATTCTAATTCATAACCCACTCTGCC
ACCAGGACGTGATGGCAGTGAGTTTTAAATTGTTTGCTATTGTTGTTAGGTGCCATCAAA
TTGGTCCCCACCCATAGTGACTGAATACACAACAGGACAAAACAATATCCTATCCTGTAC
CATCCTTAAAATTGTTCCTATTCTCAAACTCATTGTTGCAGCCACAGTGACAGTCTATCT
CTTTTTCACTGCCCCTTCACTTTACTGAACATGATGTCTGTCTTCAGGGACTGATCTCTC
CTGACATTTTCAAATATGAATTCTCACCATCGTTAGCTCTAAGGAAGAACTCTGGCCATA
TTTCTTCCAAGACAGAATGATTTGTCCTTTTAGCAGTCCATGTAATTTTCAATATTCTTC
ACCAGCACCACAACTCAAATGTATCAATTCTTCTTTAGTCTTCTTTATTCAATATCTAAC
TTTCACATGCATATGAGGAAATTAAAAATGGGTGCATAAGCAAATGTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1019, 5712..5806, 5907..6004, 6105..6217, 10829..10977, 11305..11395, 47478..47812, 51513..51728
1001..1019, 5712..5806, 5907..6004, 6105..6217, 10829..10977, 11305..11395, 47478..47812, 51513..51728
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved