Echinops_telfairi Locus C12orf41
snOPY snoRNA Orthological Gene Database
Echinops_telfairi C12orf41
Echinops_telfairi
C12orf41
GeneScaffold_4233
SNORA2
4183..4318
7447
GTCTCAGGAGCCCCTGCCGTGTGCTTTCACTCATCGCCCATGCTCGCAACCTCGCCTGG
AGGGACAGGAGTTTTGCATTAAGCATATTCTCGAAGACAAGAATGCACCCTTCAAGCAGT
GTAGCTACATATCGACGAAGAATGGAAAAAGATGTCCCAGTGCTGCCCCCAAGCCTGAGA
AGAAAGATGGGTACATATCTTTAGATCTGTCTTCAGTTTTCAAATAGGAGGGAGGTATAG
TGGGCTGTGAACGCGAGGTTGTGAATCTATTGGAAAATTCCAAGGGAAAAACAAAGCAAT
CCCCCCCCCCCCCCCCCCAACAAAACCAAACAAAAAACTGCTGAGAGGAGACCTGGGTGC
TATTCCTGTCACCTTGGATGAGTTAGGCTCATTTGTTTTGGGTCTTTGGTTTGTGAAAGA
AGGGATTTTATTCTGAACCCTGGGGTCCCTCCCTGATTCTGAGCTTTGCTACACACTCAA
AATTGTGTAAATGTGCCTTTTTATATGGGAGAGGCATTGTCGGCCCTAAGAGTAAAGGTA
TCCAATGATGCCAAGCCTCCTCCCACCCCCAATTTTCAGTAAATGATTTTTGTATGTAAC
TCCCAGTTATAAAATTGACCCAGATTCTATTGGCAATGGGTCGCTTTTAAATGGGTTGGC
TTCCAGAACCAATTTTGAAAGATGAGAATGGATCCCAGATTTGCTCTCCCAAGATGCCAG
CATTTTTATGATTGGGATGGTTAGGGTAGATTACGCTACCTACTTTTTAATAACATAGGA
CGAGTGTACCTTAGGGCAAGTTTTTTTGATACATTGACCTATTTAGGAGTAAGTAAAAAT
GATTTTAATTTCCTAAAAACTTGAAAATCATTGAATTGATGATGAAAATCATTGAATCTT
TTCAAGCAGGTGCCTGAGTGTACAGTGTTAATATTTGTCTCTTTAGGGTATCCTTCTGTG
CTGAACATGCCCGTAGGAATGCCATGGCACTTCAGGCCCAAATGAAAAAGTCGAACCCAG
GGCCTATAGGTGAAACCCTCTTGTGCCAGCTCAGCTCATATGCTAAGACAGAGCTGGGTT
CTCAGACTCCTGAAAGTAGCCGCAGTGAAGCCAGCCGCATTCTGGGTAAGAGTCTTCTCT
CCCCAAATGAAAAGGGAATATTGCTTTTGCTTTAATATGGTGCATGAAATATGATACTTG
ATAATACAATTTCAAGGTTGCTATGTCCTTTGCTAATTCTTTTGGATTTGACGTAATGTG
TGCTTAAAATTAGTTTATGACATTTCCCTCTCTTGCATTGCTATCTTTATGTTTAACAAC
TTGGCAATTTTAGGAAACGGGGATATTTTGGATTTGGGATTTCTAGCTTTTGGAGAGGGC
ATGGTTAATTCAATTAGATTACCTAACTGGGGTAGATATATGTATGTATGTGTATGTATA
TCTGAATCATAGTGACCATATGAACAACAGAATGAACAAACAGCCCTGGGCCATCCTCAC
AATTGTTTTTATGTTTGAGCCCATTGCCATGTGCACACATGTAAAGTTACATTGTAAACT
AAATATTAATATTTATGTATGGCATTATATACATGTATATGTTAAATGTATATGTTTTTT
ATTTGCCAGTACCTCTGTACTAAATTGTGTTTTTTTTTTAATTTGAAATTTTAGGTTGAT
GTATTAAATAATCTGGTCTTGTGTGGTAGAGTTAGAGAAGGGGGGGTTGTCTTAATTGCC
CCTCTTCCTTCCTCAACTCAGATGAAGACAGTTGGAGTGAGGGGGAGCAGGAACCCCTAA
CTGTGGATCAGACATGGAGGGGGGACCCTGACAGTGAAGCGGATAGCATAGACAGTGATC
AAGAAGATCCTCTCAAGTAAGTTGCAACTTCACATATGGCTCTTGAATGCTTCATGTAAT
TCAAATGTGCAATATTGTACTGCATGTGGTCTTAATGGAGGAGTAACCTAGAATGGTTAG
AATAATGGTTGGTCTTTAAAAAAAAAAAATGACGGTTGGTCTTAATGGATGAATACTCAG
AATGGTGGCCTAGTTTGTTGTTAGCAGTATTAGCTTCTCTGCATTATGATTTGTCACCAT
CTTGCTTCAAGACAGATTTTGATTGTTTTTAAAGTCTTAAAATTTGGAAAATTCCTTGAA
GGGAGAAAAAGGAAATTTCTTGGAGTTGGAAGTACGGTGTGGGTTCAAAAATGCTTCCAA
CCAGTTTGGAAAGAGAAAACAAGGGAGGGACTAGGTATTTGGCCTAAACCTTAGGCATCA
TGAAGTTACTCTTTCTGCTCCTCCTTTCTTAACCCTCTGAACATGGTCTTTGGGTGAAAA
TCATCTTTCGATCTTCGGTGGTTGATTCTTTTCATGAGGGAATGAGGTTAGTCCCTAGAC
TGAAGGGTGGGTGATGAAACGCCAGTCTTGGTGGCTCCACCAGTTTCTCTCTAAATAATA
AGCTTGGTCTTTTCTATGATTTTAGGTTTGCTCCATATTTTCTTCCATTCAACCCAGCAT
CTTCTAATGTGATACTTCCAGAGCAATTGGTAGTGGTAGCCAGACATCTAGTTCATATAG
TCTGAGGGTTTGTTCTTCTTTTCATAGCAACTTGAATTATAAGATGTTCTGTGAAAGCAT
TCCTGCTAAATAACATCTCAGTATTGAGTAAGACAGTACATAACAGACCAAATCTGACCC
CTCTATTTTAAGTTTGGGCTTTATTAAATTTTTTTTTAATGCTTTGCTGAATTCTCATTT
CAGACATGCTGGTGTCTACACAGCAGAAGAAGTGGCCCTAATTATGCGTGAGAAACTAAT
TCGTTTGCAGTCTCTGTACATCGATCAGTTTAAAAGACTTCAGCATCTGCTCAAAGAGAA
GAAACGCCGTTATTTACACAATCGCAAGATGGAACATGAAGCTCTAGGTAAAATTTGTGG
CAGTTGAAGCAAAGCTTATCCTGGGCCCAAACTGTGAATTTGGTAGTTAACAAATTTCTC
CTTTTGTAAGGAGTTGTACTGGAGGGTCAAGTGTACTTTTAAACCGCCCCACAGGGAGTA
AATGGATTTCCCTGCTATTCCTTGATCGTTTAGAGCAGCATTTTTTTGGGTGCATAGCAC
ATAACATCTGGACTGCTGTGACCCTCTAGGTAGTAGCCTCCTGACTGGTCCAGAGGGACT
TTTGGCTAAAGAACGGGAGAACTTAAAGCGCCTTAAATGCCTTCGGCGATATCGCCAACG
CTACGGAGTCGAAGCCTTACTACACAGGCAGCTGAGGGAGCGAAGGATGCTGGCCACAGA
AGGTGCCTCTCAACAGGTAATTTGTGTCGGTTCTAATAAGGTTAAGCTACTTGTCCAAGT
ACTTTAGTGTGTTTTGGCTCTCAAATCTGACTTGTGGGACTTGGAATATATTGGAAACAG
CACTTAAGAGCCATGTAGCTGCCGTGTAGCTCACTGTTGACGTCAGTTCACTGGGCCTCA
GGGTTCTCATCTGTAAATTGGGTGTTTGGAATTGGGTTCTCTCTTGGTTTAGAAATTCCT
TACTTTAGGAACAGGTGTGGATTAAACCTAAGTTGTTTTAAGAATCTCATTTTAGAAAAG
CAAGAATATAGATAGAAGAATAGGGGCAATTGAATGTTAGAAAGTAAGGTTGATAGCAAA
CAGCCAAGTGGCTTTTCTTTTTAAAAGTTATTTGTTTATTTATTTGGTTTTTTAAAATAT
GTTTAAGTCATGGTCCCTCCTTCAGGGAACATAGTTATATCCATTTTGGTTCATTATGTT
TGTCAAGGTTATATTAAAAAGGGTTCTACTAAAAGACAAATTTGTTTGGAAAATATTAGG
CTATAATATGAGTTTTTGGAACATGGAAGGTATTTTAAGTATTATCATAGATAACAGGGT
TATGTATACATACATACACACACACACCGGTATATATAATTATTTTTTTCCTGATGTATC
TGTTTTTTTCCCTTTTAGGCCCACACTACTCGTTCCAGTCAGAGATGCTTGGCATTTGTG
GATGATGTTCGTTGTTCCAATCAGTCTCTTCCAATGACCAGACATTGTCTTACCCGTATC
TTTTTGCTTTGCTTGCTTAAACTCTGATTTGCTTGTGAGAGTCAGGGCTGGTGGGAGTTT
AAACTCGGGGCTTATATGCTTAATCGAAAGCCTTTAGTTTCCTTTGGCCCTGAATCAAGG
CTAACAATTTGATGGAGCTGTTAGCTTCAAGCAGGAGCCTAAAGAAATGTCTTCCTATGG
TCTGTTGGCCATTTCAGAACTTGGAAATGTAATGGTCAATTCATTAGAAAGAAACATCTG
AGTCAGTTACAGATGTGGATTGTTAATTGTGGTCTTAACCAGGATCCCTGAGTTTGAATG
GGTCTTTAGAATGATAATGCTTTTTGAATTTAACTACCAAGAAAATCACTGTGGAAGGGC
TTTTTTTTTAGCCTAAAGCTGACAGGTGGGAATTGTGGCCCTGCTTTGAGTATTGTCCCT
TTGTATGGCCAGGGCCCTAGCTTCAATTTGTAAACTTCATTCAAATTAGAAATGGCCTAT
TTTAAAAAATGAAATATTTTTCTCCTTTTCATTTGATTTGTCTTTGAATAGTTATAGTAT
CTCTTGATTCTGCTGAGAACTACATTTACCTTTGGGTTATATAACGTTTTGAGTTTTCCA
TTGGATTGTAAAAGTAAAAAGATTATAAAATCTTTATTAGGGACAATGATTGGGAAAGTT
ACTTTGATAGAAAAGATCCTTCCTTAGTAAATATGATCTCCATTCTCCAAATGTTTGGAA
AATATTAAATGTATTTTCTTTAAACTATTTTATTAAATATTGTGTTAGCCTATTCATTAC
AACAAATGTCTGAAAGGATTGTTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACCCTTGAAGA
TCATTCAATTAAAGAAATTGCTGAAGTGCACAGTGGATATATTGGCAAGTGAAGAACATA
CCCTAGCCAGACTTCCCTCATGTAGTGACCCAACCAGGCAGAGGTTGGCTGCTGGTTACA
GTGAACTTCAGGGAGTGAGGGGTCATCACAAGTAGAGTGTAAAGATGCCCAGATGACTTT
TGCTCAGTGATACCATGTATGGACGGTACATAAAAAAATGCATTTCCCACTCCTTGAGTT
CTTGGTTCTACAGGTCTCCAGATGGCCAGCAGGGAACACCTTACGACTTCTCATGTCCCA
GAGTACATGTTTACGTAGAAAAAATCGAGGCAAGGAATTTAGTTAAATTGTTTCTTTCAG
TGGGGAGCTCAGCACTGGGATGTATCTTGTAGAGTAGGGCAAGTGGTGTGATTTGGGTTC
CTTCTCTGAACTTTGGGTCAGATAGCTGTGGCAGGCCCTGACTGAAGACTAGCAGTTACA
CACAGCTGTTGGTTTCAAGCAGAGGCCCAGAGGATTATCTTCCGGTGGTCTTTTGGCAAT
TCTGGAACTTCAGCTGAGAATGGCCATTTCCTTTGGAAGAAACATCCCCCAGTCCTCCCT
CCAGGTGGGAGAGTCTCAGGAATGATCCAAGTACTGGGTTCTAATACAGGTTGAGGGACA
AAGATGGCTAAATGCGAGGCAACTGCCCAGAGTCATTTTCTTTCTTCTGTCTTGTTGCCT
TCATAAGTGAGTATTAGGAGTTAATTCCGTGCTTTCAGCTACAGTGAATGAATTTATAAA
GAAATATTTGTATTTCTTTTACTAGGGCCAGATGCAGATGGATGTAGATGGATGCAGAGC
CCAGGGATCCCGACATTTTGAGCGAACCCTTGCGCGGTTGCCTCACACTGGAACGACTAC
TGCAAATGGGAAAGCAGAACCCAGCTGATAGTTTGTTTTGGGAACTGCTTGACTTGCAGA
ATTTAAAGTTCCCATTTTCAAACAAATATTTCTTTCACTAAACAAGGGTAATTTTCTTTT
GCTTCTGGATTATTGCATACTATTGTTATGCCTGGTTTGGGGGGAATGGACCAATACTGA
CTGAAAGTTATGGGATTAATAAATACTGGGTTGGGCCTAAGGGGAAAAGGACTTCTTTGT
AAAGGGATGTTCGCCTCATGGACATGGAAATCTATACAGGTGATTTAGGTGGACACTGTC
CAAGTGGTGGCCCAGGATGTTGGTGTACTCAGTGTCTGGTTGTCTATCCCATAGCTGGTG
TTTAAGCTTTTCTTTACTTGTCACCTAATTGGCCATTGTGAACCCCCTTCGACCTGTGTA
CGTCACCTGTGTCCTTTGAGAAAATTGCTCATAGAACCGGATCCACATAGTTTTTGCTTC
TAATCTATGTAAATTTTCTGTAGTGGTTATGTTACATAATATACAATAAAATGTGTTTGT
ATATAGCTTATATTAAATGTTTAAAATATTATTAAAATTTTAAAAATAATCACCTGAATG
GAATGCATATTTTTGTATTTGTGTCTTTTTTTGGGTTAGAAGTAAGATGTCTTAGGGGAA
TAATTTTCTAATGGGAAAGAGATAACTATCCCATGAAAATTAAATTTGGTGGTAAATTTT
TCTTTTGGTTTTGGGGGTACAGATACAAATTACATATTACCATTTTCCAAATAGCTTTCC
CTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1124, 1761..1875, 2763..2930, 3153..3315, 3978..4074, 4986..5239, 5340..5405, 5509..5545, 5547..5567, 5995..5996, 6331..6447
1001..1124, 1761..1875, 2763..2930, 3153..3315, 3978..4074, 4986..5239, 5340..5405, 5509..5545, 5547..5567, 5995..5996, 6331..6444
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved