Echinops_telfairi Locus RPL37
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RPL37
Echinops_telfairi
RPL37
GeneScaffold_4685
SNORD72
3043..3122
4277
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTAGCTT
CCAGGCCAGGAATGAGGGAGAACTGGGGAAGCTGGATTTCTCCTGCTTTAGATTCCCCTT
CCCAACCAGGATCACTGTATACAAGATGGACGCAATGGGTCGGAGTGGGCCACCCCACAG
CCCAGGTTCGCCACGAGGACTCCAAGAAGTAACTGCGGATCGGACACCAAAAAATAAGAG
TATGTACACAGAAAGGGAGCCGAAAGTGATACACCCGCCTGAAGGCGGCTCTAGGCTAAG
GCGAGTCTGGTGGGACAAGCCATCCAATCAACAGCAAGCTCGTCGCCCCGCCCACCCAGC
GCGGAAACCCGATTGGGCTCTCCTGGCTCTGCATCCGCCTCTTCATCCACCTACGTTGCG
ACGACGGACTCTTTATAGCGGTGCACCGCGCCGCGCCGGAAGTAGTCCCTCGGCGGAAGT
TTCTTAGAGTAAAAGAGCGGAAGTGCCTTCTCTTCCGGCCTCTTTGGTCTCGGCCGCAGA
AGCGAGATGGTGAGTTGTTTGCCTGGGCCCGTGGAATCGTCTTGCATCCTCATTCCCTGT
GGCCCCTAGCTTACTATGTGTAAAGTTCTGGAAGGCTCCCGGATAAGAGAAATGGGTTGG
GAAAGAAGGAGGTATGCAGGGATCCCTAAGTCAATAGATTTACTCCCTAGCTGGAGCTTG
GGTTCCCGAGCCCGCCAACCTGGAGCCGGAGCTGCCCATCTCCCCGTTCGCCCACTGGGT
AATCCTCAGAAAAGAAGCGTGGCTTGAGTTGTTTTGGTTGTGCGAGTAAAGGACTTCGTT
GTCGGAGGTGCCTGACAGGAATCCGTGAGCTTCGGAATCAGTACTAAAGTAAATTTCACT
TCGCCTTATGAACCCACCCCTACTACCCCCTTTACTTTTAACCGTTTCAAAAGAGCTACT
CTCGCTTTGGATAGCCAGACAGTTAGGAAAACGATTCTTGTCCCTAACACTTAGCAGTTA
TTGCTTATTTTGAAGACGTCAGTTGGTGTGGAAAGCCTTGGCGCATTTTCATTTGCTTCC
TTAATTTGTAGACGAAGGGAACGTCATCCTTCGGAAAGCGTCGCAATAAGACGCACACCT
TGTGCCGCCGCTGTGGCTCCAAGGCCTACCACCTCCAGAAGTCGACCTGTGGCAAGTGTG
GCTACCCAGCCAAGCGCAAGAGAAAGTGTGAGTTGAATGCTCTGTGCGGTGTGCCTCAAT
GCAGCATGCCTTCCGACTTTATTTATCCAGCAAAACTTGTGCTTCACGTTATGTTGACCA
AGCAACTCCTGTTTGTGTTTCAGATAACTGGAGTGCCAAGGCTAAAAGACGAAATACCAC
CGGTACTGGTCGAATGAGACACCTAAAAATTGTATACCGCAGATTCAGGTACAGTTCTGT
TTTGCGTGTAATTTGTTCTGTGACATCAGTTTACTTGGATAGAAAGAAAGGAGGCCATGA
CACTGGTGGTTTCTTGAGGGTGGGATTTGGGAAGTAGTAATAATAGCTGCATCTCTTGGT
TCCTGCCAAATAAGTATCCTTATCCAGGTGAGATCGACAGTAAGGATTACTTGGTTAAAT
TTTGTTTTCCTGTGAAACAGGAATAAAACGGGTACAGTTGGAGGTTTACTTTTGTAAGTT
TGAGGCACATTGCTAACTAGTTAATGCATCTTTTCACGCTGAGAGTGAAGGTGATGCAGA
CAAATTCTATGGCTCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAATTAATG
CCTGCCATTGAATGTGTTCAACCTTAACTTGGATAATTTTGAAAGTAAGCATTTCTCCCT
CTTGGCTTAATAATAAAGCAGCACCAATGTTAGAGATTCAAAAAATTCTATAACTCAAAT
CAGGCTCTTCCATTACTATTTTGAAATCTCTTGACAAGCAGAGGAGAAATTCCCAGTGAT
CTGTGCAAGCACACATAAGTATTGGGCTTTTATTAGAATTGCTGTTGGCTATATTACTGA
AATATGGGTATGGTTGAACAGAGGAAAATAAAATTATACTTGAAGCTTATCGGTGATGTT
GTAAAAATAAATGTCTGAACATATGAGTACAATAATGATTTCAGCATCAAACTGAGATGA
GCTTATTGGATTCTATTTAACAGCAATCTTTTTAATAAGTATGTTAACTTTGCTGAGGTG
ATTTTTCTTTTTTTTTACCCTGGTGCAGGCATGGATTCCGTGAAGGAACAACTCCTAAAC
CGAAGAGGGCAGCTGTTGCAGCGTCAAGTTCATCTTGAGGATTTCAGCATTTAGTAGTGC
AATAAATGTTCTCGTATTAAAAATGTATCTGGTGTTTGCAATCAAGTAAGCTGTGATATG
CGTGGATTCGAATTGGTTTGGTAAATGAGACCACTTAAATGTGCTGGGTTGTAACCGTCC
TTAAGGGAAGACTTTCTAGAAGGCAGCACAGGAAGAGGGTAAAGGTAGAACTTGAACAAA
AATAATGTGTGTTAAATTACCCAAATAGCAAGCTAAACATGGTCTTGTTTACATTCTAAA
CCAAGAACTCTGATATTTTCTGTCCTGCTTTTCTCAGTTTTGGTGGTTTATTTTCCTCTG
TTTTTATTGAAACAAGACCAACTTAATTGGAGTGTTGTGTTGATGGGTCAAGAAGGAATA
AAGTGGTTTTTTATGGTTTAAACTCAACACATAGGGCCTCTGGAGCTATAGCAGCAGGCT
GCTTCATCTCTTGGGGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1028, 1571..1599, 1604..1706, 1823..1907, 3208..3277
1001..1028, 1571..1599, 1604..1706, 1823..1907, 3208..3274
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved