Echinops_telfairi Locus SPIRE1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SPIRE1
Echinops_telfairi
SPIRE1
GeneScaffold_3683
SNORA72
3641..3772
96171
TTTGTTTTATATTCTTATGACCTTGGTTTGTGTAGAAGACGCAGGAGAATATAGGTAGC
ACATTCTATTTAGTTTTGGAGAGATTATAAAAGGAGCACTCCAAATTAGTAGCTTCTAAT
AGCCACAGAAAAAAATATTGCAAAGAAGCAGCAGATGCTATTAAGTTTATTATACTTTTT
TTTTAAATCTTATTTTCTTTCTACCCCAAAATTGGAATGGTAGTGTTGCAGGTGAACTTA
TATATCTATCTTTTAAGTAAGGTTGTAAAAAATAGTATTTTGTAAAAAATTTTCAACTCA
TTTATTGAAAAAAACAGACAAGGGTTTTAAAGAATGATGTTTATTCAAGTCACTTAGCTA
TTACATTTATGGCATAACTTTTTTTCCCTAGTAGTTTCCAAAGACACTCAGAATAGAAAT
GCAACTCAATGAATAGGCAGTGTGCATATGAATAAGTCTATATACGTATTATTATTATTT
TTTTAGGTTTAAATTAATTGCTACCAATAGCTGAGTTTTCAGTCTCTTACCTTTGTGACC
TGTAGATAAGTATTGGCCTCAGAATTCTGGATAGAGATGTTATTATATAGCTATCATTTT
TGAAAAAGTTTTTTTTAGAAATGCCGAGAATCAGCCAGGTTAGAATGGAGAATGTAAGTT
TTAGCAAACAGTACAAATCTAAAAACCATGACAAAAGTGTAGGTATGTATTATATGTTGG
TTTGAAGAAGTCAAGGTGACTAGGTGATCCTTTTAAACATCTTCTTCAATGTAATTTACC
ACTTTTCTGAAATAGAATTAGGCTTAGCTAAAATATCATATCAAATATTTTATGTCTTAA
AGTTTTATGAAATTATTTAATCATCTTTATTAACTACCCTTCTCTAATGTTCCCAGGTTA
TTGAATCTTTGGGAATTGTTATTTATAAAGCACTGGATTATGGTTTGAAAGAGAATGAAG
AAAGAGAACTAAGCCCTCCCCTAGAGAAGCTCATTGATCTCATGGCCAATACCATGGAAG
CTGATAGTAGTAACGATGAGGGTTATGAGGCTGCAGATGAAGGGATAGAAGATGAAGACG
ATGAAAAGAGAAAAATCTCAGCAATTCGTTCTTATAGAGATGTCATGAAGGTAAGTAGCA
GTTTACATATTTGTTTCTTTCGAGAGATGATATTCCAGTTAAAAAAAAAAAGCAAAACAC
TGAATAAAAAATACAAAATAATAACACTGACTAGTGAATGAACATTTGATAATACACTTT
AAATTTCTCAAACTGACTGCTCAAAGTGAAATAAATTGGAAACTCTGATTTCTTCAGTCT
GATTTGTTGTTCACAGTGGTTTTTTGTTGTTGTCTTTTTAATGGAATCACTTAGTTCCTC
TCCTACACACAGATTCATGCACACTATCAAAATACTTTCAGGTTTTAGGACTACTTGTTA
TAAATTAAAGTTCCCCAGAAATGCGGTTTGTAAATCCCACTAAACCTGATGTTATAATCC
CAAATTAATCTTAATGGCAGTATTGGTGTAAGATGTGCGGCAAGTCAACTTCTTTTGAGG
TACTAAAGAGAAGATTCAACAAGCAGTAGAAGAGTAAAGTCGGGGAAGATAGTGCAATGT
TCCATGAGATCTCCAAGTAACCACGGAATGAGCTGGAAATAGACAATAACCTTTCCGCAG
AGCCAACAGAAAAGAAATCCTAACCAACACAGAAAGAAAGATTTACCTTAGAGGCAGAAC
CTAAATTTTGACTTCTATCCTCCAAAAAAATGAGAAAACCAATTTTTGTTTATTAGCTCC
TCTCACTTAGGTTGTTTCTGCTGTACCAACACAAGATAACTAAAAAATCCTTTCGTGTAT
ATGCCATGCCTTCCATTGTCTTGGCATTTTCCTTTTTGTCAGTAAATAGCTGTGTTTCAG
TTATTTAAATAATAAAGAATTGAGTAACGATTGTTTGACTTTATTTTCTTTCTTTTAAAA
AAAAATAGTTTTATTAGGGGCTCGTACAACTCTTAATCACAATCCATACATCCATCCATT
GTGTCAAGCACATTTGTACATTTGTTGCCATCATCATTTTCTTTTTTTATCCAGAACAGA
TATTTATTGAACTATTTGATGCAAGGCACTGCACTAGACCTGGAAAGGGAGTAGTGGGGC
TGCCCTGTAGTAAGAGCTCACAATCTAAGGGACGGGACCATCATCATTTTCAAAACATTT
TCTTTCTACTTTAGCCCTTGGTGTCAGCTTCTCATGTTTCCCCTCCCTTCCCTCCTTCAC
TAATGAACCCTTAATTTCTAAATTATTATTATTTTTTCTTATCTTACACTGACTGATGTT
TCACTTCACCCACTTTTTTATTGTTCGTCCCCCTGGGAGGAGGTTATATGTAGATCATTA
TGATCGGTTCCCCCTTTCTCCCCCTACCTTCCAGTGACCCTTCTGGTATTGCTACTCTCA
ATATGGGTCCTGAGGGGTTTATCTGTCCTGGATTCCCTGTGTTTCCAGCTCTTATCTGAA
CCCATGTACATGCTCTGGTCTAGCCGGATTTATAAGGTTAGAATTGGAGTCACAATAGTT
GGGCGGGGTGGGGGAAGCATTAGAGAACTAGAGGAAAGTTGTATGTTTCAACAGTGCTAT
ACTACACCCTGACTGCCTTGTCTCCTCCCCGTGACCCTTCTGTAAAGGGATGTCCACTTG
TCGACAAATGGGCTTTGGGTCTCCACTCTGCACAACCCTTCATTCACAATTATATGGTTT
TTTGTTCTGGGTCTTTGATGCTTGATACCTGATCCCATCAACACCTCATGATCACAGAGG
CTGCTGTGCTTCTTTCATGTGGGCTTTGTTGCTTCTCAGCTAGATGGCCGCTTGTTTATC
TTCTAGCCTTTAAGACCCAGATGCTATATCTTTTGATAGCCGGCCACTATCCGCTTTCTT
CACCACAGTTGCTTATGCACTTATTTTCCCTTCAGCAATTGTATCAGGAAGGTGAACATT
TTGGAATGCCAGGTTATTAGAACAAAGTGTTCTTGCGTTGAGGGAGTACTTGAGTAGAAT
CCCAGTGCCCCATCTGCTACCTTGATACTTAACCTATAAATATATGTACATAGTTCTAAT
TACCTATCATCATATAAAACTATATTTACATATGTACATGCCTGCATTTAGACCTCTACA
AATGCCCTTTGCCTCCTCGTCCTTTTCCTTTATTTCCTTTTACTTTCCTCTTGACCCACT
ATCATGTTCAGCCTTCATTTGGGTTTCAGTAATTCCTCTGTTATATTGTCCTTGATCAAG
CCCTACCAGGCGTCTAAACCCTCCTTGCCATCGATTTTTAGATCCCTTGTTGTTCCCTTG
TCCCTGGGTTTGTTAACACCCACTTCCTTCCCCTGCTTCCCCCTCTCCTATGTCCCCCTC
AGGACTGTTGGTCCCATTGTTTTCTCCTCTGGATTGTTTATCCTGCCTATCTCATCTAGG
TAGACATGCAGCTACAATAATAAGCACAAAAACAAGACAGAGCAAAACAAAGCAACAAAA
GAAAACAAAACTGCAACAACAACAGCAATAAAACCAACGACAAAAAAGAAAAGCCTATAA
GTAGTTTCAGGTTGGTGTTGACCTTTAGGAGTGTTTTCCATCTGCGAATATTCTCGCTGT
CCTGGTTTTGTGGTAGCCAGGGCAGGCTAACCATTCGCTGTATTAAGACCATGCATGTGT
CCCCAGGCTGAGTTCTCTCCCTGAGCCTGGTTTTATCAATGCTGGTGATAAGTCTGCATT
TCTGTATATGACTGGTACTCTAGGGATCTTTGTTCAAGTTCAAGATGACTGTCTAGTGAA
TAGGAAGTAACAAATGCGATTTGCAGAAGTATGTCTAAAGTAGGGTGATTCTGCAATAAT
TTGTTGCCCATTCATTAATGTCAAATTAAAAGAAAGAAAGAAAAAATAAAAAGGAAAAAA
GAAAAAAATTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGATTACTTTACACAGCGATGAGGCAACAGGCATGGTGGCAACTCGATATACAATAG
AACAAAACATGGCCTGTGCTGCTCCATCCTTACTATGCTTAATTAAGCCCATTGTTAACA
ATCACTGTGGTCATCTATTTAATTGAAGGTCTACCTCTTTTGCACTGACACGCTGCTTGC
CACCAAGCATGGCATCCTGGTGCAGTGACAGGTTCCTGATAACATATCCAAAATATATGA
GATGAAGTTTCATCATCTTCACTTCTAAGGATAATTTTGGCTGTACTTTCTTAGAGAGAG
ATTTGTTCATTCTTCTGACAGTCCATAGTATATTTAAAGTTCTTCACTAAAACCATAATT
CAAATGCATCAGTTATTCTCTATTCGTTGTCCAGCTTTTGCATGATTTATAAGGTAGTTG
AAAAATGTCATGAGAGACTTCTTTTTAACACAGTAAAGAGATCTTTTTCTTAGAGGTGAT
GCTGCCTCCATGAGCATTGATTATGGATTCATATAGAATGAAACCCTTGATAACTTCAAT
ATTGCCTCTGTTGTGATGATTTTTAAGATATATGTATGTGTGTGTACACACACACACACA
CACACACACACAAGTGTAATCCAGTAAGTACTTCAAGTCCTCAAGCAAGGTTCAGTCATC
TGTGCATTGCAGTTTTAAAATCGTCTTGTATTATTTTCTCAGCATGTAGATTGAATAAAT
ATCTGGAAAAGATACAACCTTGTTGTACACCTTTCCTGATTATAAACTGCTTCTTGGTCT
ATGTATAAATTCTCTACGAGTACAAATAAGTGTCTATAATTCACATTCTTCTCAGGGTTA
TGTAAGTATTATAACTTGTAATTATGATCCACACAATGTAATCTTTTGGTAATGAATAAA
ACAATGGTAAATATCTTTCTAGTATTCTCTGACAAGATTCATAACAGTGGTGATGATACT
CCTTATCCCACTTTCTCTTCTGAATATGGCTTTAATTTCTGACAGTTCCTTGGCAATAGA
CTGCTGCTACCATGTTTGAATTACCTTCATTCAAATATGAATGCTATTCCTTAATAATTT
ATTGAAATGGGCAAAAAGATGAATCTCTTAAACAAGTACTGTATATAATTGTGAGTAAGC
CGAGTTTTTCAACACATTTTTTATGCAGTTTTTGTAAAATTAGGTGCTTTGGCTAATATT
TGGTCGGCTTATACTTGAGTATATACGGTAGTTGTCTTCCAAATTTCATGGCATAGATGA
AAGTTCTGTCTGTTTTATAAAGCATCTCATTTAGCTTTTGTCAATTCCTATTGCCTTGTT
TTTTACCAATATCTTCAGGAAAGCTTGAACGTTCTTGATCATATGCAGCCTCTTAAAAGG
ATTGAATGTTGACCAATTCATTTCGGTATAATGATTGTGTATTATTATCTCCATCTGCAT
TTGATGCTTTTGCATCATTCAGTGTTTTGCTATTAGAATCCTTTGGTACTGCTAACTGAG
GCTTGAATTCTTTCTCAGGTTCTTCAACTTGAGAAATGCTGAGCACCTTCTTCCCTTTTA
TTTTTCCAGCTCCATTCTTTGCACCTGCCTTTATAATACTTTGTCAGTTGTATTCTACTC
TGTCAGTGTAACACTTCTCTAGTTGTCCTTTGAAAATTTCTGTTCAGCTCATTTGATTAT
TTATTCAATTCGCTTTAATTCCTCTATTCTGGAACAAGTTTCAGAAACTCTTCTCTGTTC
TTTTGGTCTTTCTCAGTTTTTTTTAACAACCTTTTGCATTCTTCATATACGATGTGCTTA
CATCATATCATCTGGCACCTTGTTTGGGCTTTGATAATTAGTATTCAAGGCATCAAATCT
GTTCTTGAGATGTAAGTGTGAATAGCTTATTTTGAGACTCTTATTAGATGCTTATATGGT
TCTATCTTCCTCTTCTGTCGTTCTTTCAATAATATTGTGCTCTTCTTTGTCTTTCATAAT
AGCTTTTGTTTGGTATCTGTTTTATCAGAGATTAATATTGCCATTCCTGCTGCTTTTGAT
TGTTGATGTATTTTTCCATCCATTGATTTTTAGTCTAATTTTGTATTAATGTCTAAGGCT
TTTTATAGGCAGCATGTTATTGAGTCTTACTTTCTTATCTGTTCTGCAACTTTTTGTCTC
TTAACTGCTGTATTACATTGGAAGCATTCATGTACAACTATTTTTAATAGGATTGGATTG
CTGAATTGTATGACATGAGAAGTATATACCAATAACACTGTTTCAGAAAGACAGAAGTGG
ATTACTACGATTGGCATCCCACCCAGCCTAGGGAGAGCCAGTCCTCTTTTAGGGCTTGCC
TTAGGTATGTCCGTGATGGAGATCACCTGACTGGGATGACGTCGTCATGAGTCATGCCCT
AGAAAACAATATACTGAGAGAAGTTAGTCAATAACTAAGGACAAAGACTTTATGAGATAA
CTACTATAAGGATACAATTCAAGATAAAGATGTGCAAAGCAAAGGAAACCAACTTTGGAG
AGGACTAGGATGAGAAAAAGAAGCAACTGTACTAGAAGGTCCGACAGATATTGACTTAAA
TGAAAGTAAGTATAGAGGCTTCCTCCCACCTGAGAACTGAAAAGGGGGAGCAGCGAGCCT
CACGGCCTCTCCAGGTGTTTAGAACGTTTACTACAAAAATGGGCCGAATTTTCCTTGACC
ACATCTGTAGGACCCGTCTGTTTTCCTGTGCAAACTGTGATACCATCTTCACCAACCGCT
CAGAACTCATCTCCACTCGGTTCACGGGCACGACTGGCCGCCCCTTTCTTTTTAACAAGG
TAGTTAACCTGCAGTACAGTGAAGTTCAAGACCGGGTCATGCTCACTGGCTGCCATATGG
TGGTGCGAGATGTGAGCTGCAAGAACAGCAATAGCAAACTGGCATGGATCTATGAGTTTG
CCACTGAAGACAGCCAGCGTTATAAGGAAGGCTGTGTGATCCTGGAACGGGCTCTTGTTC
AAGAGAGCGAGGACTTTGAGGAGCACGTACTGTCTGATAACTCTTGAAGGAAAAGAGATA
AATACCATCTTTTCCCAGGTTGCCTTCACTGAAAACAAAAATCTCCTTACATACACTGTC
ACCTTAGCATCAGCGTCAGAATCATGAACTGTAGAACAAGAGGTAGTGAGAGTCTAAGAG
GGAACCGACCTTTCTTTCTTTTTTTTTTTTTATTTCTATTCCAGCAGCAATGTGTAGAGA
GAATATGATGCAGATGCCGTTAACTTGTTTTTGTTTTTCCCCTTATGTTTGCATCTTGAG
GCAGAATAGTCTTATCTGCAGCTATGTAATGGGCTAAATGAAGAAAAAAAGCTGGGCGAT
TAGAGTGGAAAACAGCACATTTTATGTGAATCCTAAAAGGAAAACAATGTCAAGAGCATG
GTTTTAAAATTTTTATTTGGGCTTCATTTTCAATCCTTTTGGGTTAAACTCAGTTACGTC
ACCTGATTTGCCAGCTTCAGAATCCGTGACCAGCGCTGAAGGTCCAGTGTTAGTGCAGCT
TGTGCTGGGCGAGAAATTAAAACAAAAAAATGAAAGTAAGTATAGAAATCCATAAGAAAG
AAAAGAGAAATTGGAGTGATAGTGAGATAGGCTATAGGGGTGGCTGATGAGTGGCTTGAA
CTGTTGAATGTAGAGTGGTGTAATGTAAATGTCAAATATAACCCCATTACAAGCCCTCCC
ATATAAAACATGAAGCAAATTTTAATTCACAATAAAAAGTTAATTTAAAAACTTTTAAAG
AAGATAGTGAGTGGAGGATGTACTTTAAAGTGCCAATTTAGAAAGACTGTTTGAATGAAT
ACTTAATTTACCCTCTTTATCGAATCGGTCAAAATCATTAAAATTTTATTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATAGGATTTTCTTTGCTGTAATCTTTTCAGAAGATCACC
AAGGCTTTTGGTGATCTGCTAGTGGGTTCAAGTCACTGTTGTTTCAGTGTGCTGTTGAGT
TGATTCCAACTTAAAGCAACCTACTGTTTCCTAGGCTATGATCTTGTGACTTTCTCCCAC
CAGTGACTTTTTAGTTAGTAGATAATGGCTTCTTCAAAAAAAAAACCCCAAAAAACAAAT
TAACTGCCATTGAGTTGAGTCCAATTCATAGCTGCTCCTTAGCCTTTATTAACTGGGCAC
AAACTGTGCCATCCAGGGGTCTTAGTAAGTAATAGCTGTTAAAAAATGTTAGCTGTGATC
AGTATTCAATAAATATAGTTCTTTTGCTTCTCCCAATGAAAACCCCAATATATGCTCTAA
TTTTAAGATAAAAGTCAATTGATTTCATTAAGCTCATCTGTGTTTTGGACCACTTCCCCA
TATAATTGTATAGACCTTACTGATGGGCTTAATGTATGCTTCCCTGTGAGTCTGAATTGA
CGTGATGTGATTAAGTTTAGTTGTTTGTTTTGATGATAGGAATTGCCATGATCCCATCAT
ACCGTATCTCATGATACGAAGATACACATATAATGAGTATGTCAGTTTTTAAGGTACTAA
ACCCCCGAATAAATGTATTATTTCAATGTCCTATTTTGTAGTTATGTGCTGTTCATCTCC
CCACTGAGTCAGAGGCACCAAATCATTATCAGGCAGTATGCCGGGCACTATTTGCAGAAA
CCATGGAGCTGCATACCTTTCTGACGAAAATGAAGAGTGCAAAGGAGGTAAGTCTCACAG
ATAAATTTCTTGTAATTGTGGAAGATAAAACTGTCTTTTCAACATTGTGTATTCTTTCAT
TAGCATCCTTTTGATGAGTGTTTAAAAATAAGAATAAAAGCCCCTTCACAATTTAAAAAA
TATTCAAAATATTAATACTGTGAATCCATTTGGTAAAATATGTTCTTTCTTTTAAATCAT
TTTATTGGGGGCTCTTACAACTCTTATCACAATCCATAATTACATCCATTGTGTCAAACA
CATTTGTACATATGTTGCCATCATCATTTTCAAAACATTATCTTTCTACTTGAGCCTTTG
GTATCAGGGAAGAAGCATTAAAGAACTAGAAGAATGTTGTATGAAGATACTTTATTAGCT
AGAATCTATTAAGCTACCATATATATACTCGTGTATAAGCTGAGGTTTTCAGCACATTTT
TAAAAATCATTTTATTGGGGCTCATATAACTCATCACAATCTATACATACATCAACTATG
TAAAGCACACTTATACATTTGTTGCCCTCATCATTCTCAAAATTCGCTTTCCGCTTGGAT
TCCTGGAATCAGCTCATTTTCCTTTTCCCCCTCCCCCTCCCTCCCTGCTCCCCCCTCCCC
CCTCCTTCACGAACTCTTAATAATTTATAAATTATTATTATATCTTATCTTACACTGCCC
AGGTCTCCCTTCACCACCCCCTCTGTGCCATGCCTCAGGAGGAGGCTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCAGACTGCCATGATGGGACTCGGAGGCTAGAGAAGCAGGAGTTTTACTCTCAGGCTTCG
TACAAGTCGCCTGTGCTTTTGAAATTCATGGCCTTTTGAAGTCCTGCAGCTCCATATGCG
ATCCCCCTCTGGATTGAGCAATCTACAGTCATCTCGTGATATCCCTCTGGAGGTTTTTAA
TCTATTCTGTTATTGAATTCAATCTTTATAGAAAGTTAAACGGTGTGACATCTTCTTCAA
TAGCTTATGCATACATATTTTATCCAGAGATATGCTAGGAATTTTAATATGAGTGGCGTA
ATAAAATTTTCATACCTTTTTATTCTTTTTATTTTAATGGGTAGAATCTGAAGAAGATTC
AAGAAATGGAAAAGAGTGATAAATCTAGCACAGACCTTGATGAGCTGAAAAATGCTGACT
GGGTAAAATAATTTGATATGCTTTCGATTCTGTTGCTTTTAAGAATTTACATATATAAAT
AACATATAATAGCCAACGTAGCCTTTAAGAACTGTAGTATGAATTCAAATTACAAGTATC
CCTTAGGTTATGAATGAGTTCCATTTCTAAGTCTATCTTTACATCTAATTTTACATAAGT
TGGAAGTCTGGTATGGTTTATATCCAGTGTCAGTCAAATGTTAGTCTTAATATGTAGTAT
AGTTTACGTTCCTATGCATAAAAAACATATGCTTCCAGATACACTAATTATCTTTACATA
ATAATTGAGTAACAATAATAGCATTTTGTTATTCATTACAACACCCATTTGGTATTACAA
ACCATTGTATGTACCATGAAGTTTTAATGATATTAATAGGCTCCATAAGGTTGGATTCTA
AATTGAGCATTTGTAATCTGTGGCCTGCCTGCACATAAATTTGAATGTTTAGTCGTATAT
TTGGAGAAATACCTACTACTATTTTTTTGGGGGGGGGGCCTTTCCGATTTTATTAGAATC
AATCATTTCAGTGTGACATCAGGAAAATGACAAAAGAGATGGCTCCAACTTCCAGTTGCT
CCACAAAACCAGTAAAAAACAACAAGAAGAAACTAACAGAATCAACTTTGTCAGAAAACT
TTTTTTCTGGAAGACAGAGGTTTACAATAACCAAGCAAATGCTAAATGAGGAGGAGGCAA
CTTAACCAGGAGGAATCTTTATAATATTTTTACTTGTCTCTTGCTGTACCCTCTGCCCCA
CTAGCAAGTCTTGAAGATGGTAGCCTACATTCCCAGTGTGGGTCCCAGAGAGAGCAAAGC
ATACTACTTGTAAATACTATGCTTGCCTTTTCTGATCTGTTTGGGGATACTTGAAGGATC
AATTCAAGGCACTCATCTTTGTTTCACCTAATTTGAACCCAGTCAGGTGAAAAAAGGTAG
GTACTCAAAAACATTTTAAGATCCTTGAATAACCCACAGCCACATGGGGCAAAAGATTAT
GGCTATACCATACAATTGAGCAGTGAAAGCCAAAGATGAAAAGCAAGTAGTGTTTCTTTG
AGAATTTAGTTGATTCACAAGTGCTTGTGTATGCTGGGAAATTTAGGAAGCACACCCAGG
AAAGGACAAATGCTTAGTTAGCAAGGACCTCAGAAGAGCCTAAGCTTTTATCACAGACTG
ATTCATAGGTTTAGTGCAGTCAGGAAGTTAATACTGAGGCAGAGGTGTAAAGATTCTGGC
TAAGTATTGAAGGGAATCCCCAGCACAAAGCCAATACAAAGACTTAAAAAGGTTTTGTTT
TTGTTGTTTTCTGATTTTGCTTTCGGCTTTGTTAAAACTCTGGTATGCAAGGGAATATCT
GTAAAAACACAAGATAAGCCTTTAACACTTAATCACTTACAGTCTTGGGGAAATGAGAGA
TAATCTGATTTTGAGGGTTACCAATTTATTATACTATTTTGTCCATTTTTCAACAGCAAC
AAAATCACAATATATAAATAAATCCAAGTACACGCAAGAAGCTTAACAAACACTAAGCAG
AATAAACTCATAGAGGTCCAAACTGATCTCATTTCATTGTAGTCAATTTTTCAGAACACA
AAGAGGGAATCTTTAAAGCAATAGCAGATAATCAACTGTCATGTACTAGGATCTTCAATA
AGCTTGACAGTCAGTTTTTCATTTCAAACTATAGAGGCCAGAAGATAATGGGATNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATTTTTATTTGCGTTATTCATAGT
TTTCTAATCCAAGCTCTTTGCTTATTCTTTATAACTGTGTTATTTGATTTGCTTATGATA
TCTCTCCATGCTTGATTCTTTCAGGCTCGATTCTGGGTACAGGTGATGCGAGATTTAAGA
AATGGTGTAAAACTTAAGAAGGTCCAAGAGCGACAGTACAATCCTTTGCCTATTGAATAT
CAGCTCACTCCTTATGAAATGCTAATGGATGACATTCGCTCCAAAAGATACACTTTACGA
AAAGTGATGGTAAGTAACAAGGAAAGAATATATATGTTGCTAACAGTCTTACTAGCCTAT
AATTTTCATATCCCATAATTCAATAGTTCAGTTACATTAAGAAGAATTGTATGTTCACCA
CCACAATCAATTTCATGTTTTCTTTCTTGTATTGAATGTTGTTAGCTCCTCATTTCCTCC
CACACTCCCTGCCATACACACAATAAACCATCAATCCAGTTATTATCTCTGTAGATTTTC
CTATTTTGGATTTCATATACAGAAAAAGATACTTTTTTTTAACAGCAACAAAGTAAAACA
GAGAAAAACTTCAATGGAAAATAAATCATAAAGTACTAAAAACTACAGTGAATTTAAAAT
GGGTTAAAGAGTATCCAAGAGGAATTACTGAGAGCCTAGTGGACGGTGAGCAAGATAGTG
GGACAGGAGGAAGGTAAAAGGAAATATAGGAAAGAAATAGGAAGCAAAAGCTATTTATAG
AAGTATAGCTATAGGCATGTATATATGTACATATATTAATTTATAATGAAAGGGATAGAG
GCCAATGTACATATATTTGTATGTTAAGTATTAAGATAGCAGACGACTTTGGGCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCGATATAATCACAGAAGACAAAATGAGTGTATAAGAAGATGTGGTGTAAGAAAGT
GGATGGTGCCCGGCTATCAAAATATATAGCATCTGGGGTCTTACAGGCTTAACGTTAAAT
GAACAGTCATCTATTAGGGAAGGAAGAAGCCCACATGGAGGAAGCACACCATCCTGTATG
ATCATGAGGTGTCAACTGGATCAGGTATCAGGTAACAAAAGATCTAAAACAAACAATGTG
AATGAGGAGGGTTGGAGTGAAGACTCAAAGCCCATCCGTAGACAATTGGACATTCCCCCA
CAGAAGGGATACAATGAAGGGACAAGAGCAATTGAATATTGAGAAAACATCCCAGTCCAG
ATCAAATCCATGTCTAATATTCACCCATGTGTTCAATACCAATCTATAAATTCTTCTTCA
GACTTAAAAAACACATCAATGATGCCAAGTACAGGATGATCACAGGACAGTGGACCCAAA
GTCTTGTGGATCCAATGACAGTAGAAGCATCTCAGCGCTGGTGTGGGTCTCCATGTGGCT
CTGGCTGCATCAGCATATCTCCATCAGGCTCGGTGTCAGTAATGTCTTGCAGGGAGTGAG
CATGTGTTCCACCTCCATCGAGCTATTTATCTCCTTAGTGCCTCTAGATGAGGTCATCAA
GTTCTGATTTGATTGACAGACTAAACTCCACCCCTTCACTCTTCAGTCTCAAATTGACAA
CAGATTATGTGACTACCACACAATCATTTATCTCCTCAGCCAGGAGCCAAGTGTATCTCT
GGTTCTCATTCTCAGCTGTGTAGACCCTTCGCCTACACTTCCATGGGCCAGGAAGCTAGC
CCTCCTATCACTCCGCCCACAATTCCGTAGTCTTGAGTGAATTGAGAAAGTATCCCATGT
TTCAGTGCTGCCCCTCTGAGTCTCCATGCTACAGTGTGAGGTATCTGGTCCCAGCAGCCC
CCACCATTTCAGACGATGTTTGTGAACATGCCCTCCCAAGATCCTCAAGGTTTTCCTCTT
TCTGTTCTTCCAATATGGGCTCACTCTTCCTTATAGCCAGGGAAATGAACGCTAACCAAT
CCCCTTTTAGTATTAACAATCAGAACACAATGAGATGGCACCTTATTCCAGCATTAATAG
CAAAATTTAAAAACAGAAAACAGCAAATGAGGGTGNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGTATGGTACTTTGAGAATGATGATGGCAAAAAATGTGCAAATGT
GCTTGACACAGTGGATGTATATATGGATTGTGATAAGCGTTGTATGAGCCCCCAGTAAAA
TGATTTTTTTTTAAAGCAAAACAGTATGGTACTTATGTTAAAAGCTTGGAATAGAATGTG
ACCCAACAATCACTATTTGATGCATATTTAAGAGTAGTAACCACATTTGATTAAATATGT
ACACATCTGCGTTCATCAAAGTGCTACTCAAAATAGTAAGATGGATACAACCTAAACGTC
CATCACTGGAAAAATAAACAACCTACGGTACATTATATAATAACGATAAATAAGCTTGCT
TATTGGTTCATGTACATAAGGCATTGTGCCTCATTTATGTTCACCCAGGAGTCATTTATC
ATTGTTTTAAGATGTGTTCTGTATTTTGATTAACCTAATTCACCGTCCCAGGACAAAATG
GTATTTAGGCTGTTAATTTAGAATGGCGAGGACTTCCCGGTGTTGCATCCATATTGGCAT
GCTGTCACCCTGTGAGCTCTGACCCACATTTGCAGTTGGGACATAGGATCCGGTTTTCGA
CTAGTCAGGAAACTGAATGTGTGTTCTCTAGGAATGGAACCTACAATGTTGGCCTCAATT
AATCGATTTCTTAATCCTGCTATTGTAATGGAAACAAAGTTAAAGTAAAAGCATATGGGA
AACAGAAGATAGAGCCTATTTATTGGGAGAAAAAATAGGGGCATCGCATCTCTCATAAAG
GTTTAGCATCAAGAATATATAAAGAATGGTTATAATTCAAAAAACAAAGACAAACAGCCC
CATCAGAAAATAAGCAAAGTAATTGACTGGACATTTGAACAAATAAGGTATACATAATGA
TGGACAAGCACATGAAAAGATGTTGTTAGGTGTCTACTCTTGCACCATTCTTAACAATTC
TTGTTATGTTTATGCTGAATCATAGCAACCATGTAGGGCAGGGTAGAACTGCTCCTGTGA
ATTTTCAAGACTATAACTCTGTATGGGAAAAATGGGAAAGCCCCATCTTTCTATTGCACA
CTATACACAGCAGAACATAATTCAATAATTTCTACACATACAATGCAATGACATTGATTA
CATTTGAGTTGTGCAACTATTCTCACCCATCCTTGGTAACATAAACTCTGCCCCCGCCTA
AAGTATGAGCCCTTTCTAAAGTGTATTTCCTATCTCATCATTCACCTAATTGTTCTTCAT
CCGATCCCATATTGTTCTTAAAAGTTCACAGCGCTCAAGACAGACATTCTTTACTAGGAT
AGCTAAGCAATTGTTTGGTTTTAAGAAAACTTCTAGGGATAATTTTTGGTTTAAGATTTG
AAGATTCTCTCTCAGAGCAGCAGTTTCAAGGGTTCATCCAGCTTCTGTGATTCCAGAAAA
TCTAGACTCCACGAGAATCTGAATTCTGATCTACATGTAGGTGAGGTTTTTAAATTATAA
AATATTTAGTATTATAAATATTATTTATGCAGTTGGCATTCATAGTTTTAGAAACTTTAT
GGGAAAAATATTAATCGTATACAGCTTTCCACTTTAGTGAACTTGCACTTATTTCAATTT
TACATATTTTTCTTTTAATCATACAGCCATTTGTTCCCCCATTTTATTGATTTAGGATGT
GTCTTTAATAGAGTCAACTATAATATAGTAAATTTGCCACACATGCTGAGATAAAAGCTA
TACCCAGAAACCTAAAATAATAATCTTAAGATCATGTGAACCTACTTTTTGTCTCTTTTC
AGGTGAATGGTGATATTCCTCCTCGGTTAACAAAAAGTGCACATGAAATCATCCTGGACT
TTATCAGATCAAGGCCACCTCTAAATCCAGTATGTAATTTGCCACTCCTCTTGACTGGGG
ATTAAATTAGTCAGTTGCCTTTAGGGTTTCATCTCAGGAACTCAGTTCTACCTTATGGCC
AGTTCTCCCTTACGCTTTTCTATCAAAATCAAGCACAGGTGTGTAAATCACAATCTTGTG
TCACAAACAAATATATGAAAGTATTCACTGTAAGAAATGTCGTAGGATGTTTTTAACTTT
AAACAACTTGTTTATGGCACAAAATCAGCCAAATACTTTGTCATAAAGACTAAATTTAAT
AATGAATAGTTCTCAATTTCCTCAATAGTACTCCTATTTCCCTTGATTTAATTGTCATAT
TACTACTATTTCACAATAATTCAGCCCTAATGTACATCTACTTTAATAGTAATCGAGTCC
TCTGTTAACAGGATTCTTTCTAGTGACCATATGATAAAAATATCTAACCTGGCTTGATTG
TTGATTTATGTTTCCTCTGTTCTCTTCCTTCTGGCTTAGGTCAGTGCTCACCAAAGTATC
TTAAACCTATGCGTATTAAATGACCAGAAAGGAAGTAGTAGTATTATCTCAGTTTGTGCA
CATGTAAAGCATGATTAATAATGTCCCCCTTAAAAGGCATTTTATTGTGGTTTGTGTGTA
AGTCACGGGGCAAAATAGTTTCTCCTTCAAAATTTTTATCTATTTTGTTTTCTGATCGGA
GTTTCAGTCCCCAGCATAGCAGCCTTCTTCCCCTTCCTCTCTAGATTCCTCATTCCATGC
TCCCTCCTTCCAGCCCCATTCTGCCTTCGGAACTTTTGTTTTTAAGCAAATGCTACCTTT
TTGGTCTTGTATGGTTGATTGTTCTGAGATGCACATTTCTCCTCGGTGTCATTGTTCACT
TCATATGCCTGCCTGTTGTTTAGCTGAAGGTGAACTCCAGAAGCGCATTCAGTTTCAGGT
TTGAAGGATGTCTTAGGGCCACAGTCTTGAGAGTTCCCAGACCCATAAATCTAATCTTAA
TGATCCTTTTTAAAAATTCTTTATGGAAGGAGAGAGAAAGGCTACCAAGGAAATTACTTT
AAGAAGGCAGGTCATGTAGAGTAGATAAAACATGATGTCAAGTGAATTTAGATTAACACA
CAACCTTTCCAATTTAGCGGTCACGTCTCTGAGCATGGCCATCAGCCTCTCTGAGCCTTG
ATTTCCTATAGCGGAAACACCGTAACTTATTCAAAAGTCTGTTTCAAGTTATTCAGAAAT
TCAAAGACAGTGATTAGTTATCTTAAAACTGATTGCAGTAATAATTGTGTTGTGATTGAA
CTATGGAATGATTTGATATCTTGATTAGGTCCCAATAGAATGACTTTAGAGAAGAAAGGG
GGGGAAATGGTTAGTACCAAGTCAATTCTGACTCATTACAACCCATGTGTTCAAAGCAGT
AGTGCTATCTATATAAGGTTATCAGGGCTGTGATCTTTGTATCTTTGTTTATTTTTATTT
ATTTATTTTTTTAACATTTTATTAGGCGCTCATACAACTGTTATCTCAATCCATACACAC
ATCAATTGTGTAAAGCGCATTTGTACATCGTTTCTCAAAACATTTTCTCTCCATTGAAAC
CCCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCGATCCCCCCTCCCGCATGAGCCC
TTGATAGTTTATAAATGGGTATTTTGTCATGTCTTGCCCTGTCCGACGTCTCCCTTCATC
CACTTTTTGGTTGTCTGCCCCCCAGGGAGGAGGTCACACACAGTTCCATGTAATCGGTTC
CCTCTTTCCTACCCATTCTCCCTTTACCCTCCCTGTTTTGCCACTCACACCACTGGTCCT
ATAGGGCTCATCCATCCTGGATTCCCTGTATTTTCAGTTCCTATCTGTACCAGTGTACCT
CCTCTGGTCTAGCCAGTCTTGCAAGATAGAATTCGAGTCATGGTAGTGGGAGCGGGGAGG
AAACCTTTAGGAACTAGAGGAAGATTGTATTTCTCAAGGGCTGTGATCTTTCTGAAGGTC
ACCAGGCCTTTCTTCTGGCACATCCCTGGGTAGATTTAAGCCACCACTCTTTCAGCGATA
CCACAAGCTCTTAATTGTTTTTGTCAGCTAGGTGCCCCATAGACAATCATAGTAATATAT
AAAATATAGATTACATTTCAATTTATTCTTCTACTTTATAGTAAACATAATGATAACTTT
AGCAAAATTGCTTAAAATTAGTTGAACACTAATGTACATCTACTTTAATAGTAATCGAGT
CCTCTGTTAACAGGATTCTTTCTAGTGACCATATGATAAAAATATCTAATCTGGCTTGAT
TGTTGATTATGTTTCCCCTGTTCTCCTCCTGGCTTAGGTCAGTGCTCACCAAAGTATCTT
AAACCTATGCGTATTAAATGACCAGAAAGGAAGTAGTAGTATTATCTCAATGACTAAGTC
ATTGTGTTATCCAATAATCTCTTTATTGCTTTAGGGATCTTGAGAATTAATTACTTGACA
ATGAATCTAAGAACATTATCAAGTAACATTTTAATCAATGAAATATAATTTAATGTTATA
TTGTATGAGTGGAATTCAGTAAAAATCAATTTAAGGACAATAAATTAAGTCTTTAGCCAT
TACTTTTTATTTTCAAGGCTTCAGCTAGAAAACTAAAACCAACCCCACCACGCCCACGGA
GCCTCCATGAAAGAATATTAGAAGAAATCAAAGCAGAAAGAAAACTTCGACCTGTCTCAC
CAGAGGAGATTAGACGTATCCGATTTGGTGAGTCCACTGCTTACTGCATTCTAGTTTAAG
AGCCACCCACTTTTACAATTAACATTTATACTTGAAGTTAATAGGTTAGGCAATATTTTC
TCTAGTGGCACTAATCCACATGAGCACATGCCGACAGTGTTTGCAGAATCCTATACATTT
TTAGAATGTTGTCCTAGAATAATCTTTATATCTCTCTGAGTATTCGTTTCTTCTTCAACA
GAAAACCCCAAAACTCAAACTCACTACCGTCGAGTCAATTCTGACTCCGCGACCCTACAG
GATAGACTAGAACTGCCCCTGTGGGTTTCTGAGACTCTTAACTCTGTACAGAAATATCTT
TCTCCCACATCATCAGCAAAAGTTGGGAAGTAATTCTTATCTTACCCACTCACTCACTGC
CATCGAGTCAGTGCTGACTCTAGTGACCACCTGTGGGTTTCCAAGACTGTAACTGTTTAT
GGAAGTAGAAAACCCAGTCTTTTTCCCAAAGAACTGCTGGTGCTTTCGAACTGCTGACTA
TGTGGATTGCAGTCCAACGAGTAACCTCTACACCACCAAGGCTCTTACCTACAGTACAAC
TTTAATGTAAGAATTAAATAGAATCATGGTAAAGCCATTTTATAAATTGTGACATATACA
CAAAAGTAAGGTATTATGCTTTTAAGGTATAGATGATCAATATTATAGTTATCCTTCAGA
TTTCTTATCTTAACTATGGGCTTAAAGATAAGGTATTGTGAAGCGAACGTACTATTATCT
GATGTCACTTCACTTATTCCCAAACTCCCTCTATATTTGTTCATTTAAATGTTTTTAACA
TAGATTATAATGTGTGTTTCAAAACTATGCATAAGGTTTTAAAAAAAATAAAATAGTCCC
TGCCACCTTTTATTGGACATCCTCAAAGCAAGAGATCAGAACCAAAGTACAGTGACCTTC
AAGTCTATTACTTTGTGTTAGCAGTTATCTGCTTATTCTCGCAGTAGGGCTTTTCAACTT
TAAGTCCAAGGGAGTATGTCATTTCCTTCAATCTTCTACAGGTGAGTTTGAGGTAACAGC
CAGTTCAATTAGTGGGGGTTCCACATCAAATCCTTCTAAGGAGGCCTATGAAAGATGTTG
TAGACTTTGAAAGCATAGAGTCTAAAGTCCCAGTAGTTTATTGCATACAGCCTGGGTGAC
AAAGGGCTAGATAAAAATTAAGTCAAAAGTATCAGGTTAAGAATGGAAGCCGCCCCCCTC
AACCAAAAAAAAAAAAGTGTAAAATCCCTTGGGTTCTATATAAGTATTATCATTTTTTTC
CCTATGGGAGGTTGCTCTACCTGGTTTACCCATCAACAGAAGTGTAATCATCTCCAATAA
ATACCTCCTCCCTATCTTGACTTGAATAGCCAGTAGTGTTTGCTTATCTATGTATCCTAC
CAGAGTGTCTGTTGATGTGAAGTGGCCTCAGTACACTGTTTTATGGCAGCAGCTGAATGG
TCTTCATGCTTCCCTTCTGGATAAACTAACCCTACGTGATGAGAGGGTCTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTGTATGGCTTTTTCCATG
ATATGCCCAGGGATATTAACACCCCACCAGCAGGGGTAGAGGAATTCCCATTCTCTTTGA
AACCTCAATAACATTTAGTTATTCTCATGTTTTTTTTTTTAAAATTGGATAATCGTGTGG
TATGTATAAGGTGATTTTATTTAATATGCATGTTTTGATTTTTAGTTTTGCATTGTTTTG
ATTTGCATGTCCAGAAGGCTAGTGATCATGAGCATGTCCTCATGTGTTTGTTAACCATTT
GAGTATCATCCTATGTGAATGTTCTACTCATGACTTTTGCACACTTAGCAATTGAGTAGT
TTGTTTTTTTCTTATTGAAGTGCTACAGAATTCAAAAGATTTTAGTAACTAGTCCCTTAT
CCATTGTGCCATTGCTAAAGACTTTTCCCCAATAAAATTCATTCGTTGTTCATTCGTTTT
ACTCTTTTGATGAAATCTTTTGATATGTTCAAGTGTTTCTCCCAATTTTCTCATCAACGA
TCCTTAGAGTTCTGGCATTTACTTTAGGTCTCTGATCCATCATGAGATTGTTTTGATACA
TGGGGTGAGATGTGTGTTCTGCTTCACTGTCCTACACATAGAGATCCTATTTTTCTAGCA
GCATTTGTTGAAGAAGGTGTCGCTTTCCCATTTAATGTTTCTTGGTCCTTTGTTAAAAAT
CACTTGCCCATAGGTGGATAATTTTATTTCTGGGATTTCTATCCTGTTCCATTGGTCTAT
CTTTCATTGTACCAGTACCAGATTGTTTTGATTACTGTGGCTGTGTAGTAGATTTTGAGG
TCTGGTAGTGGGAGGCCTCCTACATTCTTTTTCTGTTTGAGAAATTCTTTACTTATTCTT
GGCCTCTTCTCGTTTCATATGAAGTTGGTAATTAGTTTTTGCATTTCTTTTAAGAATGAA
GTTGGGATTTGTATAGGAATTTTATTGTATTTGTAGATTGCTTTAGGTAATGACATTTTC
ATAATACTAAATATTCATATCCATGAACATGGAATATTCTTATTTTTGTGTAGGTCTCTC
TCAGTTTCTCATAATAATGTTCTCTAACTTTCTTTGTAAGGACTTTTGTTTCCTCAGATT
TATTCATAGATATTTCATCTTTTGTGTGGCTGTTAATAAATGGTATTGTTTTCTTTTTCA
GAGCCCCAGTTCTGCTTGTTAATCTTGTATCCTGTTACTTTACTAAATCCCTCAATTGTT
TCCAACAGTCTTTTTATGGAGTCCTTTGGGGTGTCTCTATATAAAAACCATACTGTCTGC
AAATAGCAATAGTTTCACTTTTTCTTTGTCCAGTTTTATTCCCTTGATTTCTTTCTGTCG
TGAAATGGTTCTGGTTGAGACTTCCAGCACTATGTTGAATAAGAGTGGTGATAGGGTACA
TCCTTGTCAACTTCCTGTTTCAGGATAAAGGTATTCTTTTTTTCTGCATTGAGCATGATA
TTGGCTATTATATTTTCATATTTGCCCTTTATTATGTTGGAGAGTTTCCCTTTTATTCCT
CTCTTATTGAGTGTTTTTTATTAGAAACAAGTGTTGGATATTGTCAACTGCTTTTTCTTC
ATTTATTGTTGATTATATGGTTCTTACTACATTGTTTACTTTTTGAATATTGAATCATTG
CATCCCAGGTATGAATCTTATTTGGTCATGATGATGACCATGGTTGGGTTCCATTGGTCA
GGATTTTGTTGAAAATGTTGCATCTGTTCATGAGGGATATTAGTAATTTTCTATTTTTGT
GTGGTTTGCTTGGTTTTGGAATCAGGGTTATGCTTGCTTCATTGAATGAGTTTGGAGTTT
GCTGTCTCTTTCTGTGTTCTGGAATAGTTTGTGTAGAATTGGTGACAGCTCTTCACTGAA
TACTTCCTAGAATTCCCCTATGACGTTATCTGGTCTTGAGCTTCTCTTGGTTGGAAGTTT
CTTGATGACTTTCTCTATTAGTTCTTTTGTTATGGGTCTGTTCAGATATTCTACATCCAT
CTCTGTTAAATTGGATACATAGCATACACAATTTGTCCATTTCTTTTAGATTATCACACT
TGATAGAGTATAGTCATTCATAATATTGTGCTGTTATTCTTTTTCCTTCATTTGGATCTG
TTGTGATATCACCCCTTTTCCCTCTAATTTTAGATCTACATCTACATCTCCTCTTTCTTT
TCCTTTGTTAAGTTTGCCAGCAGTTTTTCGATGTTTTTAATCCTTTCAAAAAACCAACTC
TATTTCTTCCAGAGTGGGTCGTGAGGCCTGAGGGTTGGCAGGTTTGGCATTGTCTGCATT
GGCTGCGAGGTGACATTTGTGAGGGGAATTAGGATGATGGACAGGGTCACCCTGCCTGCC
ACGGGGGTGGTCCACAGGGAGTGGCCAGTGGCGTCGTGCAGGGCTGGTTTTGAGCCCATG
TAGTGAAACCTCATCGCCTGGACTCCCATCAGAACTTCAGCCTTTAGAGTGACCTTGGGG
ACATTACATAAGCCACATGTACTCCACATTCTTATCCATAAAATGGTGATGTTAGCAGTA
ACTGCTCAGAGGGAGTTACTTGAAGCACTCAGTGATGAATGAAGATCAAATACCATTCCA
TTCCCTGTAGATTGCACCTCAACATCGAAGAAAATGAAACTTATAATTGGACCAATCAGC
AATGTCATGATAAATGGAGGCGAGATAGAAGGCTTCAAGGATTTTAAGTTACTTAGATCT
TCAAGCAACCATCAAGAGATCAAATGACCGATCCCACTGGGCAAATCTGTTGAAAACCCC
TTTAAAGTATTAAAAAGCAAGGCTATTTGAGCTGGCTGGAGATCCGGAGCAGAGTTCTTG
TCTTACCTTGGCTGTGGATACTGAGCCAAGTCAGTTTCCGAGGACCTCCTCAGCCAAGGA
CAGGAGAATGGACATACTGCATCCCCTTCCAACCTCAAACATCAGAAATGCAGCCAGTGT
GAACCCGAACAGCAACAACAAAAATAATTATGTACAAATTGTTTATAATTTCTCTGTACT
GAATCTCAAAATGACCAATGAAATGCCAGTAACCAAAGGTGGGGTGTGGGAATAATCTAG
CTATATCAATAATGGTTGCACAACAGAAAGGCAAAGCTGTCACTTGGAGGACTACGGTGT
GCCTAACCCAAGCCATGATATTTTTAGTTGTGAAAGCTTGGCACTAAGTAAGGAAAACAA
AGAATCGATGCCTTTTGAATTATGGTGTTGGTGAATAAGAGTGATTATGTAATATACTTC
CCCCAAAAACCAAAAAACTAACAAATCTGTCTCAGCAAATGTGCAGTCAGTACACTCCTT
AGAAGTGTAGTTGACGAAACTTGAACTCAAGTTAGGGTGGCTTGTAAGGAAAAAGAACAA
GATGGATTGACACAAAGGCTGCAACAATAGTCTGAAGAATACTGGCTCAGGACCAGGATG
TTGTGTGGGGTCAATGCGTCAGATCCTATTTGAATGTAACTATGTTGTCAAAAGAGTGAC
ACAGTGTCTTGAAGATTGAATGAGTTGGAGTTGATATTTGCAGTTGTTGAGTTGAGAAAT
AAGTCATATGCAGATTTCTTCAGAAATTATGATTCCGTGAAAGATTTTGAGTAGACAAGG
AAAGCTGGTATCTTTCAAAGTGTTTGTGGAATGGAAAGAATTTCTTCAGATTGATTTTAT
GAATGTCACTGGACAATGCCTTTGAACTATGAAATATGCATGTTGGACTAAGGAGTAGTT
TCTCTTGGTAAATAAAGAATTAACAAATAAATTAGAAAACCCAACTTCCTGTCTGCTGTT
TCCACTGTTTATCTTTTTTCCACTTCATTTATCTCTGCTCTAATCTTTATTATTTTTGTG
TTGTTGAACTGTTTGTTTTTCCCTTGTTCTAGTTGTTGGAGTTGTTGTGTCAAGATGTTA
ATTTTGGATTTTTCTTCCTTTTGCATGTGTGCATTGAGTGCTATAAGTTTCCCTCTATTA
AGTGCTTTTGCTGTGTCCCAAACGTTCTGGTATGATATGTTACTGTTCTCATTTGTTTCA
AATAATTTCTTCCTTTCATCCCTTATTTGATCTATTACACAGCCATTTTAAAATAGTATG
TTGTTCAGTCTTCATTTGTTTGTCTTTATGTTCCTGTTCTTTGCATTGTTGATTTCTAGT
TTTATAGTTTTTATAGTGTTATGCTCTGAGAAAATGGGTTGTAGGATGTCTTTGTTTCTG
AATTTGTTCATGCTTTCTTTGTGGCCTACCATTATGATCTATTCTAAAGTGTGTATCATG
TGCACTAGAGAATATATACTGTGTTGTTGGGTGAAGTGCTCTATATATGTCGGGGATATA
GTTGGCTAAACTATTGTTTAACTCTTACGATTCTATGTTGAGCTTCTTTTCTGATTGTCT
GTCTTTCCTTTAAATTCTCCTACTTTTATTGTCCAGCTATTTATTTCTGTCTTCAACTCT
AAAAATTTGATTTCTATATTTTGAGGGTCTTTCATTAGGTGGATATATGCTATTAAAGGT
TTTATGATCCTGGTGTATTGTTCCTATAGTCATTGGGCAATATCCATTATTGTCACTCAT
TATGTTATTCACCTTGAAGGCTATTTTAAGAGAGATTATTATTGCCACTCCTGTCTTTTT
ATGGTTGCCATTGACTTAGTAGATTTTCGCCATCTTCTGGTTGTTAGTTTATTATTGTCT
TCGAGTTTAAGGTGTATCTTTTGTAGGTGGGTTTTGTTTTCTAATCCAGTCTGTCACTCT
CTGTTTTTGATCAGTGCATTGAATCCACTGACATTCAGTGTCATTAGTGATATATTCCAG
TTGGTTGTTGTCATATTGCTGTCTTTGTGTTTGGTTTGCTTTTCTGGTTTTTTGTCCTTT
TACTAGTATCTTTGTTCCTTCTTTATTTCTGCAATATTCGGAATGCTGCTTTCATTCGAT
TAATTTCTGGGTAGTGGTGTGCTATGTGATGCTCTCAGGTTTACTTGTTGATTCTCTCCA
TCGTAATCTAGTTAATGTTTTTATAACGCTCATCTTGTTTTTATGAATTCCTTCACTTTT
CCCTTGTATGGAAATGCCTGGATTTTTCAATACCTTGTATTTGAGGGAATAATTTTGCTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGTTGCTTTATGTTTACA
TGGTTTCTGCTAGGAAGTTCTAGCTTAACCCTTACCAGTTTTCCTTTGGCTGTGACTCCT
TTTTTCTCTAGCTGCCTCAGAGTTCTCTCGGGTTCTTTTTAATGGGAGAGTTTGACAATG
ATAGTTCATGATGTTTTTCTGGGGGGGGGGGGGGGTCCTATCCTAATTGAGGGTCTCTGA
GCTTCTTGAATAATTCCTTTTCCTCCTCCTTTGTGAGATTTGAGAAAATGTCTTCCATGG
TTTCTCACCCCGTTTTCTCTGTAGAGTCCTTTGTTTCGGTGTGCTACAGGATCCCGGAAG
ACTTGGGTTGTTTCCCTTGATAGTGCCCTCCGTGATCTCTGGCTTCCTTTTCTTTCTGTT
TGTTGATTGTTTCTCTGTCAACGTGGTCACGGTGATTGTCTGCAAACTCACTGGTTGGGT
TTCCTTTTCTTTCTACTCCTCAGCTCTTTTTTACTACGTTCCCTAATTCCGTGATCTCAT
TTTTAATCTTCAGAGATTCCTTTTGCTTTAAGGATTTTAGGAATGTCTTCCATTATTCTC
ATGAGTGGTCCTTACGTCTTTTGTTAGGACCTAAGCATCATTTTTGGAGTTATGGTTCTG
TGGGTCTGGAACCTCTTCTTTAGGGTACCCATTGGGTTTGCTTGATTTTAAATAGTTTGT
GGATTTGTCTTGCGTTTTTGAGGGAGTTTACTGTGTTACAATGCTTTTTCTTCCGCCCTA
TGATACAACTACTAGTAGTGTGTAAGCTGCTGGGTCATGTAGCCATGAGTAGCCCTGTCT
AGTGATGTGTGGGCATGTCTAAGAGGAGCCAGAAAATATAAAAAATATACAATGGTGAAA
TGGAGCGGAAAGAGAGATCGTTAATGGGGGAAAGTGAGGAGGAAGAAGAGAGAGAATAAA
ATAAAAGTAATATGTCCAAAAATTTGTCAATATAATGGGAAACTATTTTTAGAGGGATAA
TCAGAATGAATAAGTTTCACAACAATATATTTCACAAGGAAAAAGATCCATAAAGAAAAT
GGATGGATGTGTGTGCAAAGAAAGAAGGACAAAAGATCAGGTGTGGCTTGAGTGTGAGTG
CTGAAGCTCTTTTGGTATTGCTGCATTAATGTAGGTAGATCTGTGTACTCAGAAGGGAAA
AAAACACTCATAGTTTCACGAGTGTGTTGGAATTGACAACCTCTTTGTTTTTGCTTGAGA
AAAATGCATACTCTTAGGAGCAGTGGTCCACTGGAAGTGGAAATGAGAGAAACTTGAAAA
ATGTAATAAAACATTATAATAGAAGAAAAGTACAAAAACTGAAGGAAATACAATTTAAAA
TAAAACTGTCTCGTTGTTAGGCGCCATTGAGTCAACTTTGACCCATAGCATCCTTATGCA
CAACAGAATGAAAAACTGCATTGTCCTGTGTAATCCTCACAATTGTTCCTGCATCTGAGG
CATTTGATGCAGCAATTGTGTCAATCCATCTCATCAAGGACCTTCCTCTTTTTTTTGACA
CTTCTTGATTTTATCTAATATGATATGTCTCCTAATAATATGTCCAAAGTATGTAAGACA
AGTCTTGCCACTCTGGGCTCTAAGGAGCACTTTGGCCTTACTACTCCCAATATAGATTAG
TTTGCTCTTTCAGCAGTCCATGCTACTTTCAATATTCTTCTCCAGCACCACACTTCAAAC
ACAACTAGTCCTCTTTGGTCTTTCTAATTCAATGGCTGACTTTCACATGTATGTGATTCA
CTAGGGAATGTCATGGCTTGGGTAAGGCTGATCTTAGACCTCAAAGTACATCCGTGTTCT
TCAGTACTATAATGAAATCTTATGCAGCAGATGTAACTAATGCAGTACATCTTTTGATCT
CTTGACTACTTCTTCCTTGAGCATTGATTGTGCATCCAAGACGAAATCTTTAACAACTTC
AACCTTTTCTACATTTATTAAGATGCTACCTATTGGTCCAGTTGGGAGGGTTTGGGTCTT
CCTTACATTGAGTTATAATCTATACTGAAGACAGTGATCAGTCCTTGATCCTGATCAGCA
AATGCTCCAACAAGCGAGATTGTGTATCTGCATATTGCGGACTGTTAAGTCTGCCTCCAG
TCGTGCTGCCACAGTCTTCAGAGAATCCAGCTTCGCTGATGATTTCTCAGCGTACAGATT
GAACAAGTATCATGAGAGCATAGAAGCCTGACTTGAAAACACAACTATCCCGGGGGTGAA
GTTTCCAGCCCTTTTTGTGGTGTTATTGTATGTTCATGTGTGCGGTGTGGGGCACATGGC
TGGGATGGATACCAGAGAACTGAGCAAGAAGGAAGTAGGAAGGGAGAAAAATGGCAATTG
GGTACTGAGCTTGGATACTGAGAAGTTCTCTACCAAACTGTCCATATGATCTGCTATCCT
AGTATGGCACCCAGAGGTAGCAGGTTTGGCTGGCCAGGTTGCCTCAGAGGTCAGGAAACA
TCAGCTCTGATGAGCTTTGGGACTCACAGAAGGCTTGTGCCACTGGTCAGTGTTAAAGGG
TAATTTGTCAGCAGGCATTGCTGCTTTGGTGTGCATCGTTTTACATTGATTTTCTCCCTG
TCAGAAAGTGCAGGCTATCCATCCTACTCCCTAGTAGTTGCTAAAGAGATCTTCCTGTGC
TTGTAATCTAGCATTCACATTACCCATCTCTGGATGTCATTTTTGGTGAACTGTCTTTGC
ATGTTGTTTGTCCACTTTGTCTTTTTAATCATTTTATTGGGGGCTCATACAACTCTTATC
ACAATCCATACATCCATCAGTTGCGTAAAAGCACATTTGTACATGCCCTCATCGTTCTCA
AAACATTTGCTTCTCCACTTAAGCCCCTAGCATCAGCTTCTCATTTTTCCCCTCCCTTGC
TGCTCCTCCCCTCATGAACCCTTGATAATTTATAAATTATTATTTTGGCATATCTTATGC
TGTCCGACACCTCTGGTATCACCACTCTCACTACTGGTCCTGAAGGGATCATCTGCCCTG
GATTCCCTGTGTTTCCAGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAAATT
TGTAAGGTAGAACTGGGATCATGATAATGGCGGGAGGGGGGGGGTGTGAGCATTTAGGAA
CTAGAGGAAAGTTGTATGTTTCATCGTTGCTACATTGCACCCTGACAGGCATGTCTCCTC
CCTACGACCCTTCCATAAGGGAATTTCCAATTCCCTACAGATGGGCTTTGGGTCTCCACT
CCACACTCCTCCTCATTCACAATGATATGATTTTTCCTTCTGATGCCTGATACCTGATCC
ATTCGACACCTCGTGATCACACAGGCTGGTGTGCTTCTTCCATGTAGGCTTTGCTGCTTC
TGAGCTAGATGGCCGCTTGTTTACCTTCAAGCCTTTAAGACCCCAGATGCTATATCTTTT
GATAGCCAGGCACCATCAGCTTTCTTCACCACATTTGTTTTATGCACCCATTTGTCTTTA
GCGATTGTATCAGGGAGATGAGCACACAATGATATGATTTTTTGTTCTTTGATGCCTGAT
AGCTGATCCCTCCATTTCTTTAAAGAATGGAGTTGGGGATCTGATCTAAATGGAATTGTA
GTTAAGGATTGTTTTGGGCTAATATTGACATTTTCACAACATTAAACTTTTCGATCAATG
AACATGTCATATTATTCCATTTATATAGTTCTCTTTTGTTTTCTTGTATAGTGCTGTATG
GTTTTCTTTGTATAAATCTTTTTATCCGACTAGGTTTATTCTCAATATTTAATCTTTTCT
GTGACTATTGTAAATTGTATTGTCTTTGTGTTCAAAGCTCTTTTCCTTAGTACAGAGGAA
TCCTTTGGAGTTTTGTGTGTTAATCTTGTATTCTGCCACATTGTTGTATCTTATGATTTT
GTTTCCAACATTTTTTGTTGTTGTTGGGTCTTCAGGGTTTTTTATGTATGAAATATATCA
TGTGGAAATAGTAACAATTTCACTTCATTTCTGCTTTGTCGATTTTTATTCCTTTAATCT
ATTTTGATTTTTTTTCCCTTTGATTTCTTTTTGTTGTCTAATGACTTCCAGTATAATATT
GGTTCCCATTCACAAGGGAAATGCTTTCAGTTTTTCATTGTTGATTGAGATATTGCCCAT
TGGTTTTTCAAATATAGCCTTTATTGTGATGAGAAATTTCCCCTCTATTTCTATTCTGTA
GATTGTTTTTATCTGGAAGGGGTTTTGGATATTGACAGTGCCTTGTTTACATAGATAGAT
ATAATCATGTGGTTCTTATTTTCTCTTTTGTTTATATTGTTTGTTTTTCAGATTTTGAAT
CATACTTGTGTAGTTACCATAAATCTCACTTGATTATGGTGTATATGTATATAGATATAA
AACAGAGTTGGAATTTTTTGGCCATAATTTTTATTTGAAAATTGTTGGGTATGTGTTCAT
AAAGAATATTGGTCTGTGTAGTCCTTGTCTGGTTTTAGTATCAGAGTTACGCTTACTTCA
TAAAATGAGTTTACTGTCATTTTTCTATATACTGACATAGTCTGTGTCATCTCTTCTCTG
AATATTCAGTAGAATTCCCTGGAACAGCTATATGACCCTGGACTTTTTTGAGTTGGAAGT
TTTTTAATGATCTGATACTTTTCTATGACAGTTTGCATTAGTTTAGGTAGATGATGGTAT
TTCTAGTAATTTGTCCATTTCATCTAGGTTTTCAAATTTGTTAGAATGCGATCTTTCATA
GTAATGTATTATTTTTATTTCGTTTGTTTCTGTTGTCACCCTTTTATTTCTAATTCTTGG
CATATGCAGCTTCTCTTTTACTTTGTTAAGTTTGCCAGTGACTTGTCAATTTTGTTAATT
AAAAGATCCATTTTTTTGTCTGACTGAATTTTTTTCTGTTTTCTTTCCTAATTCATTCTT
TCTGTTGTAATCCTTATGATTTCGCTTCCCTTAGCAGTAAGGTTTATTTTGTTGCTCTTG
TTCTAGTTGTTGAAGATTCCGATTTAAGGCATTGATTTTGGTTTTCTCCTTTTATACCTA
TAGACATATCTATATAAACATATGTATATGTTTATTTATAGCTAAATGTTTCCCTCTTGT
AATTGTTTTTGCTGTGTCCCAAAGGTTTGGACATACTGTGTTTTCATTCTTGTGTCAAGG
AATTTTAAATTTTCATCCTTTCATCTATTGCCTATTCACTTTTGCGTATTGTGTTATTCA
GTTTTCATACATTTGAGTTCTTGCCCTTGTTCTTTCTGTTGTTGATTTATAGTTCTATAG
CATCACGGTCTGAGGAAATGGAGTGTAGAATCTCAATGTTTTAAAACTTACTAAGGTTTG
CTTTGTGACCTAACATGATCTATACTAAAGAATTTTCCAGTTGTACTGGAAAATAATATA
TACTGTGCTCTGTATATATCTAGGACAGTGGTTCTCAACCTTCCTGATGCTGTGACCCAT
TTAATACAGTTCCTCATGTTGTGGTGACCCCCAACCATAAAATTATTTTTGTTGCTACTT
CATAACTGTAATTTTGCTACTGTTATGAATCATAATATAAATATCTGATATGCAGGATGT
ACTTTCCTTTTTTTTTAAATTTCTTCTTTTTTTTAAAAACAATTTATTAGGGACTCATAC
AACTGTTATCGCAATCAGGATGTACTTTCATTGTTACAAATTGAACATAAACATAATTAA
AGCATTGTGATCAATCACAAAACAAAATGTAATTATATATTGTGAAATATTTATGTGTTT
TCCGATGATCTTAGGCGACCCCTGTGAAAGGATCGTTTGACCCCCAAAGGGGTCACAACC
CACAGGTTGAGACCCACTGATATAGGAGGTCAAGTTGGTTAGTTGTGTTATTTAGTTCCT
GTGTCTTTATTGAGTTTCTTTCTTGATAATCTGTCATTCCTTGAGAGTGGTGTATGGAAG
TCTCCTATTATTGTTTTATTGTCTATTTCTTCAGCTTTGTAAGAGTTTGATTAATGCATT
TTTAGGATCTTTCATTGGATATGTATATGTTTATTATGGTCTGTCTTCTTAGTCTATTGT
TCTTTTAATCATAATTTATTGGCCTTTTGGGAGCCCTAGTTATGTATTGAAGAGCCTTGA
CTGTCACTTGGATGGTTGGCAGTTGAAACCACTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTTTCATTACTGTTGTGAGTACTGATTTCAGAGGGTTGTTTTTCTAGGTGGTGG
TGCCACTCAGCTGTCTGCTGTTAATTTTCTGTCCAAAGTGTTCCCATTAGTTTTTGTTTT
GTTTTTGTTTTTTGCAGTGCTAGACTTGTTTTTCCAAAGTCCTTTAATTTCTCCATGTCT
AGAAATGCCTGTATTTTTTCATATATGACAGATAAGATGATGTCTTCCTTTGGGGATTTA
TCTTGTTTGGGGTTCTTTAGCCTCTTGAATAGTTTTCTTTTTTGATGTTAGGCAAATTTT
ATTCCATGGTTTATTGTTCTAATATGTGGGGGGTACCCCCCCCCCCAAAAATAGAATTCT
CTCCCTACCCCCTCAAAGCTATGTATTTAATTTTTTAATAAAACAACCTTATCACCTTCA
AAGTACTCTCCATTACACTTAATACATTTGTGAAATCTGTAATTCCATTTTTTGGAAACA
TTTTTCAAACTCATCTCTTTAGATTGCTGACAGCACCTCCCTCTTTTGGGGTTTTTTTTT
CCCCCACCTCTTCTATGTCATCAAATCGCTGCCCTTTCATGTCCCTCTTCATTCACGGAA
ACAAAAATAAGTCATAGAATGAGGTCAGCTGAGTAAGGTGCATGGGGCAGGAGAAGCATG
CTGTTTTTTGCCAAAAACTGGCACACTGAAATGGCTGTGTGAGCAAGTGCATTGTCGTGG
TGGCAAAACCAGACCCTCATCTGCCATAAATCAGGCCATTTATGTTGCACACTGTTATGC
AATCTTTTCAGCACCTCTAAATAGAAAGCTTGATTAACAGTCTGACCTGGTAAAACAAAT
TCCAAATGCACTAGCCCCCTCACATCAAAAACAAATGAGCATCGGGTTTGGTTTTGTTTT
GTTTTTTTAGTAACCTCATATATTTATTGTGTTAGTCTGGGTAGACCAGAGAAACAAATC
CATGGACACACATGTGTATTAGAAAGAGATTTATATATAAGAGCAATTGAACATTGAGAA
AACATCCCAGCCCAGTCCAGACCAAGTCCATAAGTCCTATATTATTCCATATGTCCGATA
CCAATCTATAAAGTCCTCTTCAGACTCACAAAACACATGCAATGATGCCGAATGTAGAAG
ATCACAGGCCAGTGGTAGAAAGTCTTTGGTTCCAGTGTCATTGGAAATATCTCGGCGCTG
GCAGGGGTCTCTGCATCAGGGTGGGTCCACGTGTCTTGTCAGCTGCTATGTCTCCCAGGG
AGTGTCAGGGAGACAGAGGTGTCTTCTGCCTCCAAGGAGGAAGTACCAGATTTCCCAGAA
TTCTCAGGAGAAGGCCATGCCCACACAGAAGTCTCATTGGCTATCTCCAGATTGACAGCC
TAGACTCCACCCCTACACTCTTAATCCTTAAATTGATACCAGATTAGGCGACTGCCACAT
AGATATCTTCTGTTGCAGAATTTCAGTATTTGTACCTTTTACTAATGTTCCAATCCACAT
AACTTTCAGGCTTTCCTCGAATTCTTTTCTCTTTTTGTTGGTTGTTTCTCTTGTTGGTTG
TAGTTAAGAGTTTTCTTCTAGCTCATTGATTCTGTTTTCCATTTCTTTGATTTTAATACT
CTGCTCTTTTACTGTGCTGTCCAATTCTGTTTTCTTATTACTTACCTTCTGGAATTCTAT
TTGGCGCATTGTTTCTAGTTTTTCTGTTGTCTGTTGTACTTTTGAAAATTTCCTCCATCC
ATTAAAAGCACCTAAATATCACTCTTCCGAATTCTGTTTGTGATAGTTTCAATTTTCCGT
AGAATATTCCTTTGGATCTGTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCCCTTTATGAGCATTATTCCTATCTACTTT
ATTTACTACTTAGCCCAACCTTGACCTTCAACTATAATAGCTTTATAGACTATTCCCTGT
GCATGGATAAGTTCATTTTCATGGTTGTACATTAAATTACTCAGCCATTATCCATCTTCA
TTTTTGAATATGTTAATATAGTAGTTACTTATTAATTATGGTCCCTATTTAATTCTTTGA
AAATTTGAAGCTAATTAGTAATACTTCTGTTGGAGTTTTGTCATTCAGAAACAGACAAGC
TTGAGATTCCATAAGAAGCTTCACATTATCAGCTCTGCAATATACTAGCTATGTGACTTT
ATCTCTATTCTCCTATTTAGTATTTCGTTGCAAAGAGAGATAAAAATCAATGTTAGTAAT
TGCTATATCTACTCTGTACTGCCTCTACATGACACAATATTAAGTAAGCATTTCATATGT
AATTCTCAGAATAAGTCCATTTTACAGATAAGGAAACAAGAGGTTAAGTAACTTGCTTAA
GCATTGAATAACTAGCAGTAAAGCTAAATATTGTACCAAAACAATCTGCATGTTATAATA
CGTGGGAGTTACATAATCTGTTGTCAATTTGAGACTGAAGAGTGAAGGGGTAGAGTTTAT
CCTGTCAATCAGATCAGAGCTTGATGACCTCATTTGGAGGCACAACAAAGATAAATAGCT
CGCTGGAGGTGGGATGCAGCATCACTCCTTGCGAGATAGCCCTGTGGAGAAGGTACATGG
AGAGAGGCTGATGGAGCCACATCTCTGGAACCGGAGAAGATGTGTGGAGAATCCTGCCAG
CGCTATGATGCTTACTATGCCACTCGATCTACATGACTTCACACCCACTGGCCTGTGAAC
TTCCTGCATGGCATCATTGCATGTATTTCGTGAGTCTGGAAAGGACTTTCTAGAAGACTT
TATGAACTTGATCTGGGCAGGGCTGGGATATTTTTCTCAATATTTAATTGCTCTTGTCTA
TTATGCTCTTTTCTTGTACACATATGAGTGTCTGTGAATTTTGTTTTTTCAATTTACCCC
GGACTAACACACAATACTACACTGCTTTCAGTTTTCTTTTCATCTGTTATATTGCTTTCC
TGTCCAGTTATCTTCATAACTATGTCAGATTTATCCTTAGATTCTATATTCCTATTTTAA
AATTCGTATATAACTATTGGTTAACTATTAGCTACTTTCAATTTCTAAATCAAAACCTTT
TCAGAATTTGAAAGTGTCATTAAGGTTTTCTATTATGGTCCGTCCCCAATTTCCAAACAA
GGTTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGTTTAATTGAGGACAGGCACCTGGTGGGGGTCGGTTAA
CAAAGTCGGTTAACATAGGTTAAATATGGACTTCTGGGAACTTCCATGTTCCCTGTGGTC
GGCCAGGTGGCTGACCGCAGGCATCCTGTTATTGAGAAACAGGGTGGCAATCTTTAACGG
GAGCAGGGTGGTGCTGATGTCTTAACTGGCAGTTAATTTAAAATGGCGCATCTACACAAA
ATGGCGTTACTGTGGCTAAGCTCTAACATTAAAACTTTTTACTTTTACATATATACAAGT
GTGCTTGGCACAATGGATGGATGGATCCCCCAATAAATTTTCTTAAATAATTAAATCATT
TTATTGGGGGCTTGTACAGCTCTTACCTCAATCTACACATACATCCATTGTGTCAAGCCC
TTTTGTACATTAGTTTCCCTCATCATTCTCAAAACATTTGCTTTCTACTTGAGCCCTTGG
TATCAGATCCTCATTTTTCTCCTCCATCCCCACTCACCTTCCCCCAGGAACCCTTGATAA
TTTATAAATTATTATTTTGTCGTATCTTACGTCTGATGTCTCCCTTTGCCCACTTCTCTG
CTGTCTGTCCCCCAGGGAGGAAGTAATATGTAGATCCGTGTAATCTTTTCCCCCTTTCTC
CCTTACCTACCCTCCATCCTCCCTGTATCACCACTCTCACCACTGCTCCTGAGGGGTTCA
TGTGTCCTGGATTCCCTGTGTTTCCAGTTCTCACCTGCACCAGTGTACATCCTCTGGTCC
AGCCAGATTTGTAAGGTGGAATTGGGATCATGATAATGTGAGGGAGGAAGTATTCAAGAA
CTAGAGGAAAACTGTATGTTTCATCATTGCTACACTGTACCCTGACTGGCTCGTCTCCTC
CCCATTGGCCCTTCTGCAGGGGGATGTCCAATTGCCCACAGATGGGCCCTGGGTCCCTAC
TCCGTACTCCCTCATTCACAAGGCTATGATTTTTTTGGTCTTTGATGCCTGATACCTGAT
CCCTTCGACACCTCGTGATCTCACAAGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGTT
TCTCAGCTAAATGCCTGCTTGTTTATCTTCAGGCTTTAAGACCCCAAATGCTATATCTTT
TGGTAGCTGGGCATTATCAGCTTTCTTCACAACATATACTTGTGCACTCATTGTCTTCAG
CGATCATGTCAGGAAGGTGAGCATCTCAGACTGCCAAATTGTTAGAACAAAGTGTTCTTG
TGTTGAGGGAGTATTTGAGTAGGGGCCCACTGTCCATCTGTTTCCTTAATACTAAACCTA
TAAATATATGTACATAGATCTATTTCCCTCTTGTCATATATAAATATATTTACATCTGTA
TATGCCTGTATTTAGATCTCTATAACTGCCCTTTGCCTCCTAGTTCTTTCCTTTATTTCT
TGGTACTTTCCTCTTGTCCCACTATCATGTTCAGCCTTCATGTGAGTTTCAGGAATTCCG
CTCGGTTACATTGTCCTTGATCCAGCCCTGCCAGACCTCCTACACCCTCCTTGCCATTGA
TTTTGTATCACTTGTTTTTCCCTTGTCCCTGGGTTTGTTAACACCCACTTCCTTTCCCCT
GCCTCTCCCTCCCAATAAAATTATTTTTTTTTAATTATAGCCATAGTTTAGAGACTAAAT
ATAAGGATATTGTTCATGTGTTACTGTATAGTAGAATTAAAATAAGCAATCAATTTTCAT
TCTTTCATGATCTTAAATATCGTTCCCTTTGGGGAAATTATGAAACAAAGCATATTTCCA
TAGATTATTTTCCTTATAAAACACACATGATTAAGCTTGTTTTTCTGTAATGGTAAAACT
CTTTGAGAGCCTTTCCATTTAGCACTATTTATATCCTACCCTTTGGAAGAAGATAAGTGG
TTTTTTAGTCTTTTTATTGGGTTTCTTGCAGATATTATAACAATTCATAAATCATTGATA
TCAAGCAAACTTGTACATATGTTGCCGTCATTTTCAAAACATTATCTTTCTACTTGAGCC
ATTATTTTCGGCTCCTCCTTTTTCCCTCCCTCCCCCACCCGACCCGCTCTGGTGAACCCT
TGATAAATTAGATATTATTTCATATCTTTCACAGTCTGCTGTATCCCTTCACCCACGTTT
CGGTTATTCATCCCCCTGGGGGCGGGGTTATACATCAGTCATTGCCTTTGGTTCCTCCTT
TCTCCCCCCCTCCCCAATCATGGTATTGCTATTCCCATTACTGTTTCTGAGGGGTTTATC
TGTCCTGGCTTCCGTGTGTTAGCTCTTATCTGTACCAGTGTACATGGTTCAGTCTAGCAG
GATCTGTGAGGTAAAACTGGGGTCATGATAGTGGGGGAGAGAAGCATTAAAGAACCAGTG
GAACGCTGTCGTGTTTCATCAGTTCTATACTGCACCCTGGCTGAATTGTCCCTTCTTGTG
GGACCCTATTGTGAGGGGACGTCAGCTTGTCTACAGGTGGGCTTTGGGTCTCCACTCTGA
CCCTTCCTTGGAGGAAAATTTTAAATCCTTCCTGGTATCAGCACTCTCTGTGTACTGATA
CTTCCCAGAATCATTCTCAGCCTCTGTCTGCAGCTTCAGGGTTGATTGTGCTGGCTGCTT
GTTGGGTATCTCCACTGCTGTCTCCTCAGAACCCACTATCAAGTGAAAGTACCTCTTTCC
TCCCCTTCTTCCTCAAAGTCCTCGCACGCCCCAAGCCAAACACTCAACGAGCTTCTCATC
TTAGACATTATTTCTTTGTTCACCCTGTTCTCTCCACATTCGTGCAAGTTAAGTTTTAAC
CAATTACGCTTTAATTCTTCCATCAGTCTCCAACTCCAATGCAGTCAATAAAACGTGCAA
ACATTGCCCACCTAGTTCAACACAATCTAAACCATTATATCCAGCATTATTCTTGGCAAT
TTTACAATTATGCTTGATCTAATTGAATTATGTATTTTTATAATATCTGTAAGAGCTCCC
AATGAGGTAATTTTTAAAAAGAAAGAATATTAGGTGAAATATAAAGTGCTAGAAAAAATA
TATTACAGCTCTATTTCAGTTGATTGTAATCTTTGTCACTGACTACTGAATTAAGCCTAG
TAGTCAGTGGTAGTAGAAATATCAAAAATTTATGGAACAAAGTGGATTGTCTTACATGTA
GACTTGGTGTAAATATCATGTTTCCTTTCTCTTCAATGTAGAATTGATTTTTTCCCAAAT
ACTAAGGAAAACAGCTAAAAGATACTCCATATGAAAGTGCCGTACATTTTTAGTAGTTTA
TTAACATAAAATTCACATAGCGTACAATTCAGTGGTTTAAACATATTAAAAAGAGTTCTG
CAATCATCACCACAATCCATTTTATAACATTTTCTTCTCTTAGACTCATTTTTTGCTCCC
CATTTCTTATCATACCTCTCTTACCATATCCTGAAGAAATCATTAATCCAGTTACTGTCT
CGATAGATTTACCTACCCTGGACTTCATATAAAGAAACACATACACTCCCCCCAAAAAAT
TTAAAAAAGAAAAAGAAAGATCTCGATTGAAAAGAGCAGAAAATAGAAAATAGAAAAAAA
TTTCACATGGGTCTAAAGGAAGAAGAAATCATAAGGTGATAAATTTTAACTACATTGGCA
TTAGTCTACATTCCAAATCATTGTCTCGGATAACCGTTTTATTTATATCCCTGGTCAAAG
GTCAGCGGGGATTCTGTGGAAGTTAATCCACATGAGGACCTTAAAAATGAAGTTGGGGCT
TTCATAGTCATCCATGGCCTTCTGTGAACTGAGGACCCAGAATTTAAGTTCAAATACAGC
TATTACCTCCTCCAGACTTTGATTTTATTATTTACAATCATTGGATCACACTGACTGGTA
TGCCTCTTTGTGTGAACTTAGTTGACCCATCACTTCCATGGCTGCTTTGTTTCAAGGCAA
ACTTTTAAGACCTCAGATATTATTCTTTCAAAACATTCTAAGGAAATGTTTTGAAAATGA
TGATGCAACATGTGTACAAATGAGTTTGATAAAATTGATGTATGATTTGTTATAAGCGCT
GTAAGAACCCCCCCCCAATTTATTTATTAATGAAAATAAATAAAAATAAAATCTTAACAA
CCAGGGGGAATAAAGAACATAATAGTGCATATTCTCCCACAGGAGGTCTACACAAGTAAT
GTTAAATGGCTTTCCCAGTGGCAGCTTCCCCACCTGATTTTCTCACCAACAGAAGTGAAA
GCAACTTCCCTGAGGCAGACGTGCCCTGCCCCACCTCTGGACTTGAATATCCATTAAAGT
TCCCTGAGAATCCTTGTCGAACTATCTATTGATTTGGGGTGACTGTAGTGCAATGTTATA
TGGCAGGAGCTGATTGATCTTTCTTCCTATGGCCCCATGATAAACTGTCCCTAGCTGAAG
TGAGGCCTTCGCTATTAAAGTAACTTTCCAGATATACAAATAAGTGCAGATTATGAGCAT
TATGTAGGTACACTGCCTCATTGCTTGGGAGACCAGGTTAGATTAGATGACCTGAGAACT
GATGGCTGCCTTTGTCTTTGTGTTTACCCTGATAGTAGTGGTCTCAGCATTTGTCCTTTT
TTGAGTGACTTTGCTCGGCATAATGGTTTCTGTGTCCATCCATGTCATGTGTTTTGTGGG
TTTGTTACAATTTAAGGAATGTATAGTATTCCAGTATAGTATAGTACCAAAGTTTCTTTA
TCCATTCTTTTACTGATGGGCATTTGGACTGTTTCATACTTCTTGCTATTGTTAATAGTG
CTGTGATGATCATGAGACAGCATATATCTGTTCTCATTATCTTTCTTACTTCTTTGGGGT
CTATACTAAGGTGACCAGACATCCCGCTTTTGGCGGAACAGACCCGATTTTTGGCGTTTT
AAAAAAGTCCCGAGTTTTTGAAAGAATGCACGACAAGCTAGGGAATGGTCTATTTGGTCC
ATATAGACCAATTTTTTAATCAAGAACCCCCAGTCCCCACTCCGGTCAGTGGTGTCCTGC
TTTAAATCTGGTCACCTTAGTCTATACCCAGCAGAAATATTGCAGGATCACAGGATTACA
GTGCCCAGTTTTATTTATTTTAATTTTTTAATGATTTTGTTAAAATCCTTTTATTGGGAG
CTCTTACAGATATCATACCATTCCATAGTTCCATCACCTCAAGCAGTATTGTACAATTGC
TATCACAATCAGTTTCAAAACATTTTCTTTCTTCAACTTTAAAAAAAAATCAGTTTTATT
AGGGGCTCATACAACTCTATCACATCCATACTTACATCAATTGTGTAAAGCACATTTGTA
CATTCATGACCTCATATCTCAAACATTGCTCTCACTTAGGACCTGGCANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCACCCACTTTTCTGTTGTCCGTCCCCCAGG
GAGGAGGTTATATGTAGATCCTTGCAATCGGTTCCCCCTTTCCACCCCACCTTCCCTCCA
CCCTCCCGGTATCGCCTCTCTCATCACTGGTCCTGAAGGGATCATTTGTCCTGGATTCCC
TGTGTTTCCAGTTCCTATCTGTACCGGTGTACATCATCGTGTCTAGCCAGATTTGTAAGG
TAGATTTGGGATCATGATAGTGGGGTGGTGGGGAGGAGGAAGCATTTAGGAACTAGAGGA
AAGTTGTATGTTTCATCGTTGCTACATTGCACCCTGACTGGCTTATCTCCTCCCCGCAAC
CCTTCCGTAAGTGGGTGTTCAGTTGCCTACAAATGGGCTTTGGGTCCCCACTCTGCACTC
CCCCTCATTCATAATGATTTGATTTTTTTGTTCTTTGATGCCTGGTATCTGATCCCTTTG
GCACCTTGTCATCACACAGGCTGGTGGACTTTGTTGCTTCTGAGCTAGATGGCCGCTTGT
TTACCTTCAAGCCTTTAAGACCACAGACGCTATGTCTTTCGATAGCCGGGCACTATCAGC
TTTCTTCGCCACATTTGCTTATGCACCCATTTGCCTTCAGCGATTGTCAGGGAAGTAAGC
AAACAATGATATGATTTTTTGTTTTTTGATGCCTGATAACTGATCCCTTCGGCGCCTAGT
ATCATCACACAGGCTGATGTGCTTCTTCCATGTTGGTGTTGTTGCTACCCAGTTAGATGA
CCGCTTGTTTACCTTCACTTCTTGAACTTCTTGATATCAGCTCCCCTTTATCCCCTTTGG
CCCCTACCCTACCCCACAGAAACCCTTATTTATTTATCTACCGTATATACTCATGTATAA
GCCGAGTATTTCAGCACTTTTTTCTTTAGTCAAAGATGGCTTTTATTGATGCTCCGATTT
GGAAGGGATGGTAACGCTCATACAACAAACATCATCAGGGCAAGTTAGAAAAGCAAGGAA
GATCTCTGAAATGACTTTACACGACAAGGAGCCCGAATAAGTTAAGTAACCGGCGGCCTC
TGGCAGGTGTCTTACTTCATGTTCTTCACAAACTCCTCCCCCTTGTTGATGGAGACTTTC
AGCCCTGGGATGGCATCGGCGATCATCTTCTCCTTGAACTAGGACACCTTGCTGATGCCC
AGGTTCTTCTCCAGCCCGTTTCTCCCCAGCACCAATGGAGTGGAGAAGTAGGTGCAGTCC
GTCTCCTGGGACTTCACAAAGGAGCGTTCGATGACGCCCTCCTTGCCTTCCACGCGTCCA
CGATGGGCAAGACGAAGCGGGTGCCCGGCCTAGTCCATGGACAAGGTGGCAGAGCCTGCC
CCCACTTTTGCCTGGTCCTCCTCAGTGCCGGCCTCCTGGATGCGTCACGTGAGGGCCGTC
AGCTGGTCCAGGGGACGTCCACCTCGGCCGTACGCTGGGAGATCAGGGGGAGATGCTCTC
CCCTGCATGGCCACCACTCACAGGATGTTGACTCGAGCCAGGTCCAAACCCTTCAGCTCC
GCCACAAAGCCTTGGTCCTGACGACGTCCAGGGTGGTCACCCAGGTCTTCTTGGGGTTGT
CCACTCCGTGCTTCTGGAACACCTCCGTGGTGATGGCGGTGGTCGCGCTGACCGGATTGG
CCATGAGGCAGATCATGGCTTCCGGGCGATGCTGGACACAGGCGGCCGCCAGGGTGGCCA
CGATCGCGTGGCGTTGGTGTTGAACAGGTCGTTCCGTGCCCTGCCTGGCTTTCTTGGGAC
GGCCGCTGGGATGACCGCGACGTGGCAACCTTGGACTCTGCTCGGGTCCGATGCACCCTT
TCACATGGGCTCTGGTCCCGATGTGGCTCAGGTCGCCGTCTACTCCAGCGGTCCGCGCGA
TGTCGTGGAGGGTCAGACGGCTCACCCAGGGGCCGTTGTCCAGGAGAAGTGAGAGGGGCT
GCCCGCCTCCTGCGGAAGCGCCCGCATGGCGGCTGTAGCTTGGTTCTGGGCCGAGGCGCT
GAAGCTGCGGCTGGGAGCAGGGGCTGGCCGGGCAAGGACGAGAGCATGGCTGGGCAGGAG
GGGACAGGCCGGGGAGCAAAGGAGCTGCTTAGCACATTTTTAATGCAGTTTTTGTGTTAA
AAGTAGGTGCCTCGGCTGATATCCAGGTCGGCTTATACTCGAGTATATANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGGTCTCTGTGGATTTAAGATGATAATGTGTCCTTGTTTTGATTTGAATCTCTCAC
TTGCCTAGTGATCAGATGTTTGTTAGCCATTTGAGTGTCTTGTTTGTAAATGGTCTGGTC
ATGTCCTTTACCCATATATTAATTGTATTTTTCTTCTTATTGAAGTGTTGAAGATTTCTA
TAACAGTATTTGGTGCTGTCCTCATTGTGACATTGCTAAAGATTTCTTTCCAGTCCTTGG
GCTCGCTCTCTCTCTCTCTCTCTCTTCCTTAAAGAAACTTTTTTATGTGCCTAAGTATCT
TTTTTTCTGGTTCTTTAAGTAGGTCCCAGTCATCTATTTTGTTTGTTACTGTTTGTGACT
TCTTTATTATATTTGGTAATATATGTATGTTGTACAACAGGGCACTAACCTTTGTCCAGA
TGTTCTCATCAGTGATCCTTATAGCCTTTGTTGAAAATCAGTTGCCTTTGGGTGAATGCA
TTTATTTGGGGGTTTCTATTTTATTCCATTAGTGTATGTATGTGTCATTGTGTCAATACC
AGATTGTTTTAAATCCTCTAGATGTATAATAACTTTTGAAGTTGGCTAGTGAAAAGTCTC
CTTTTTTTTTTACTTATATTTTTTTGCGTATTCTATGCCCCTTTTTCCATATGAACTTGG
TAATTATTTTTTCCATGTCTTTAAAGAATAAAGTTGGGATTTGGATGAATTGCATTGTAT
TTTTAGTTTACTTGGATAGTAGTGACATTTCCACAATATTAAGTCTTCCTATCCATGAAC
ATGGGATAGTCTTCCATTTGTACAGGTCTCTTTTGGTTTCTTGTAATAGTGTTCTGTAGT
TTTCTTTGTACAGACCTTTTGTTTCTCTGGTTAGGTTTATGCCTGTGTATTTCATCTTTT
GTGTCGTTATTGTAAATGGTTTTTCCTTGATATCTTTTTCAGAGCTTTCTTCTGTGGTAT
AAAGGAATCCAATTGACTTTTTTATGTTAATCTTATATCCTGCTATTTGACCTATTCCCT
CAATTGTACCCAACAACCTCTTTTTGGCGTCTGGTGTTTTCTGGGTATAAAAATTGTTCT
CCTTTGATTTCTTTCTGTTGTCTATAGTCCTGGATAAGATTTCCAGCATGATATTGAATA
AGAATGGTGATAAGGGAGATCCTCATCTGCTTGCTGTTCTCCAGGGAAATGTTTTAAAAT
TTTGGGATTTCTTTTTAGTTTACTTTTGTTTTTTCAGTTGAGTGTGATGTTGACCATTGG
TTTTTGTATATGTTCTTTATTATGTTGTGGCATTACTCTTCTATTTTGTTGAGTGTTTTT
ACCAGAAATGGGTTTTAGGGTATTGTCAAATACCTTTTCTGCATCTATTGATATGATCGT
GGCATCTATTGATATGATCGTGTGGTTCTTGTTTATGTGGTGAATTACATTGCTTGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATTTCTAACATTGAACCATCCT
TGCATCACTGGTATGATTCCCTCTTGAACATGTTGAATTATGTTTGTGATATGTTGTTGG
ATTCTATTGGCCAGAATTTTCTTAGGAATTTTGCATGTATCTTCAGGAGGGACATACGAT
TCTTAGTTGGCAGGGTTTTTTGTTTTTCTTTCAGAATTCTTTCTGTCACTCTGTTGTGTT
CTCTTTTCCTTGGGTGCACTCAGTATTCTCTTTTTCCTTGCTGTTGGAAAGTTTAACTAT
AATATGTCACATAGTTTTGCTCTGAGGAAATCAGTGGCGAGTTCTCTCAGCTTTTGGGAT
TGTTATTTTCTCTCCTTTATGATGTTGGATAAATTGTTTCCCTGACTACTTGTACTATTT
TATCTGTAGATTTTTTTGGAGAGGGCAGGTCATGCTTTGTGTTCCCAATGAGACATAGAT
TGTTTCTTCTGATAGTGTTCCACCTCATTCTCAGGATTTATTCAGATTTCTTTGCTTTTT
CTTGATTATTTCTCTTGTCAGTGGTAGTCAGAGCTATTGTATTTCCTGTCACTGATTCGC
TTTTTTTCTTTTCTTCCATTCTATCACACAGTGCTTTTCCCATGTTGCCTAATTCTGTTA
CCTTATTGTTTATCTTCTGGGATTCCTGTTGGTGTAAGGTTTCTAGTATTGCAGTTCTCA
TGAATATTCCCTACATCTCTTGAAGATACCTTAACACTAGTCTTCTGAATTTTATTTCTG
GTAATTTCAAGGTCTCTCCCCTTCCCCCGAGTATTCCATTGGGTTTAGACAATTTTCAGG
TTTTGTGTTTTTGGTGTATTTAATTTGACTGCTATTTCCACAGCATTTTGGTGCTGTTAT
TAGTAGTGTGTGTGCTTCTGGTTCATGTAGGGATTGTTGTCTTTGTCTAATGGCACAAAG
GAAGGTTAATAGGAGCCAGAAAACCTACAATGAGGAAATGGAGAAAAAAGGAGAGAGGAA
TATGGGGAGTAAAAAAGAGAGAATATAATAAAAGCAATAATAAGGAGCCACTTGAATAGA
CTCAAGAGGTTTGTACAAATATTAGAAAAATGTATTATAGGAGGGTTCATAAGAATTACT
ACCTATGGTGGAAACATTTCACAAAGGAAAGGAGCACGCAGAAAGTGGTAGTGGATGTCA
CAGGAGAAGAGTGTAAGCATATAATCAGGAGATATATAGTAGGAGATATATATCTCCTCT
TCCTGTACTTCCTCTAAATATATACACACAAATGTGTATCTATGTGTATATGTACTTATT
TAGAAGAAGTAAAATTAAATGAAAGAGAAGGAAGAGAATACAAAAGAAGAAGAAAAAGAC
AGGAAGAATATGAAGAGGTAAAAAATGTAAATGTGCAGAGATGAGAAAGAAAAATATACC
TGGGCATGGCTTTAGTATGAATGCAAAGTTCAGTTTTTTATCAGTGAGCATGGGCAGTTC
TTTGCTCTCATGGGAAAAGAAAATAAATCTGGATTGTTTGTTTAAAAAAAACAAAAAACC
TGATTGGGTGAGTGTGCCTGGATCTGAAGGTGTGCCTCTGTCTACCTAGGATGCCCCACA
GGACCACGAGGCTGACAGAGGTACAGAGAGAGGAGAAAGAAAAAAGGTGCTGGGGGTTGG
GGCCAAGGTATTGCTTGGGTAGTGAGGGTGTTTACATCAAGGATACATGGTCTGCTATCC
ACACAGGACCCCCAGATTCCAGAGAGGCAAGAGGTTTGCCTGGGTCGGTTAGAGCAAGGG
CAGGGAAGGACCCTCTTGTACAAGGGATGGGGAGTACACAGAAATGGCCTACTCATTGAC
TGGGGTCTTGTTTGAAGTTAGTGATTTAAGCAGTAAGTTTTAGGTGAGACAGGTCATTAG
TGAACGGACAGTTCTTAAAGACACCTGAGCTCAATAGGTCAAAGAGAATTGTCACTATGT
ATCTCGTAGTCATGTATTAATATATTTACATAATTTTTGTTGCTTCTATACACAAAAATA
ATTAGCACCATCTGTACCAAATGGAGTACAATTTTCTTGCCGTCTAGTTTATTGTATTTC
CTGTCACTCAGGAAGTGACATTTCATGAATAAATATTCTACTTCATCTTGGTTTAGTCTT
AAAACAAATTAAGAAAGTTTCTTTTCATTGACAAAATGTGTTAAAATATCATTTGACTCA
GTGAACACATTTCTTATTTATATGGAATTTCATGAAATGTTTATTTTCATGACCTAAAAA
GCATTCACCCTAATGAGGCTGAATTTTTTTTATTTTTATAAATGTGCTAAATAGTCTTCT
AATAATATTATCTCTCATTTATTGAGTTCCAGATATTATATTTAGCATTTTGAACTGTTG
TTCCATTTAATCCTTCTAATGGTCATGTAGAAAAGTTGCCATTATTATGTACCCCCTTTT
ACAAATTAAGAAACGATGGTAAGAAACTCGCTTAATGTCACTGGCCTCATGAGAGGCGCC
AAACCATAACGCAATTCAAACTTGTCAATTATAGATTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNTAACTTAGTGCTTCATTTAAAAATAAGTATTTATTAATTTAAA
TATTCTTAATTAGCATGAGAGCACTGTGTAAGAAAACTCTACATCTCCTCTGCCCATCCT
GTTCCCAGGAAGAAGCTCTCCATAAGTCACCTAGCAGCAGCAGTGTTTCCCCCTCCTTCT
TCGAAGACCCCTTACTAGAGACGGTGTCCACAAAGAAGAGTAAGTATTTGTGGTACAAAT
AGCAGACTCACAACTGTTCCCACATACACTGGACCTAGCCAGAAATCCCAGAGTGCCCTA
TGGTAAATTTGGGATAGAAACAACTAACCCTGGAATTTCACTAGTCAGGTACTAAAAGAT
AGTTATTTTCTGGATGTTGCATGATACTGTATGGCTAAGCTGGTAACTGGGTCTGAAGTT
CTTCACTTGCAGCACATCTAATAACATTTGTGTTTACAGATAATATTTTTTAATTGTAGG
AAACAAATCAGTTGTTTTATTTATTTACCTGTACATTTAGATTATCATCTTATCTGAATT
TAAGCCAAAATCCCTAAATAATTCCATAAATCATTCCCTCCCCTACACACACTTTCACAA
ATAGATTATAGACATAGGTATCTAAGGTTAAGCAGTTTCCAAATGTTTTTAATAGTGTTT
TAATACTTGATTTCCCACAAACAGATGTTTTAAGGATTAAAACTATTTAAATAATGTGAT
TTACTTAAATAAATTCAATCATAAATAATAGAAGGTGCTTGATTTTCTGTAGTAGGTATA
TGGCCATGTCGATTAAATACTACAGGGTCCCAAATAAAAGCAAAAAGGCCACTTGTATGT
CTTTTCTTGCCTGGAATTATATTCATTGAGTTCTTTGAGTGATTCCTTTTGGTTGTACAG
TACAAATATATGAATCATATTTAACTTTCTGTTGAGTAGCACTTCTCTCTACCCACAACA
TCAAGCAGATCTCATAGGAAGGAAATATCAAATACAACCCTGATAGCATGATTTTATTTT
GCTTGTCCTAATATTTTCAAATTGTGAATTTAGAACCACTCAGACCCTAAAACATTCTCC
TGTTAAGCCTTATCCCAAAATAAGGCCAAACAAGAGAGAATAATGGTACAATATTAATAT
CATAGCTGATATTTTTATTATTTAAAATAAATTTAAATCTAAAGACAAATAAGCCTTGAT
AAATGTCTGGTAGATGTTTTTAAATTTTTTAAAAATTTAAAAAGAGGGTAAACTTAGGAA
TTTCAGAATGATTTGAGAGTGTTTTATTTAGTTTTGCTTTGCTTTCTTTTGTTTTGTGGC
CATGCAGAATACATATTTTTATATGTTGTTTTTTTTAAATGCCTTTCTACTCTTTCCTTG
TAAAATTCTATGGAGAGTAATAAGAGGACATTACCATGTAGAAATCTGAGCTAATATTAT
ACTTTGTTTTTTTGTGTGAATTTTCATGAGTATTAAACATTGAATATCTTATGTCACTCT
TCAAAGTCTCCCCAAGATCTACAGCTTAGTATGCCCCTCCAGTGAAATAAATACTTCATT
TTTAATGCCATGTTTGTCACAAATAATGAGTTAGTACATTCAACATTTAAGGTTTTGTAA
GAGTTCATTTGGTTAAATCTTTAGAGCCTCCAAAATTCTTGCCCATATCCTCAACACCCC
AGCCAGAGAGACGGCAGCCACCCCAGAGACGTCACTCCATTGAAAAGGAAACACCTACTA
ATGTTAGGCAGTTCCTGCCACCATCCAAGCAGAGTTCCAGATCTCTGGTAAGTAATCCAA
AGATTTAGTATCTTAAGGATCAGTAGGAAAGCCTAGAGTCATTAGCTTTCTTGAGAAAAT
AAGGGGAAAAAATGTATATTTTAAAAAAAAATACTTTTAAAGGTTCAAATGAATTTTAAA
TAACCCCATTTATTAATAACCAAAGAAAGCACACCTTAGTAGTAACTAAATGATGTTTGA
TTATCCTTTGTTCATTTTGAGTACTTTTTCTTCCTTCAGAAGACTTACCAGGTTGAAACC
ATGAATTATAATTATTTTTTAAAATGCTGCTTTCTTTGAAGGACCTATTTAAAAATATTA
AATCTTAATTTTTTCAAAGCAAACTCTTAGTATGGTTTAATTAAAGTAGACTCTTTTTTT
AAAACAAAATGAGGAGGGAGAGTTTTGATCCATCAATTGCCATTGTATATTGTTTTTACA
TATGCTTTGTGCTGTTGGGAACCAGAGCTGATATGTGGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTCCCTTCCCTTTATGCTGGGAGAAAGGAAGAGCA
ACTAGAGGGAAAATATTATAGTTTTTATAGAGATACTAAATCCACACAGAGCATACAATG
TAAAATTTCGTTGATCATCCCTGTCCCCAGAAAATACATTTAGGAATCCTCTACGCCTTA
AATAATCACCGAAAAATGCCCATTGGGTGAAATACTGGGGGGCATCAAACCGTGTGTGAA
AATTTATCTTTAATTTCTATTTCCCACAGACTTATTGAAACCTTCTCATATATCCTGGCT
CCAGATTTTAACAATAAGAAAGCATAACTCCATGGAATTCAGAACAGATAAACCCCCAGG
AACAGTAGTGGGAGTAGGGTTTTCATGGGGGACGGGGGGGGGGGGGGGGGTGCAGAAAGG
GGAACCCATCACAAGGTTGAATGTATAGCCCATTCCCCAGGGGGAAGAATAACAGAAATG
TGGGTGAAGGGAGACAACAAAGAGTGTAAGACGTGACAATAATAATATATAATTGTTCAA
AGATTCACAAGGGTGGGGAGGTGCGGGAGGGAGGGGGGAAAAAGAGGAACTGACACCAAG
AGCTTAAGTAGAGGGAAAATGTTTTGGAAATGCTGATGGCAACATATGTATAGTGTGCTT
AATACAGTTGAATGATGGATTGTTTTAAGATTTGTAAAAGCCCCCAATAAAATTATTAAT
AATATTTTTAAGTGCAGAAACTTCACCAGATTTAAACTAAAATCTAAAAGCATTAATATA
AATAAGTTGCTGCTTTAGTGAATTATATATTGTTGTCACAACTTAAAATAAGAATAGGGA
ATGCCTTTGTGATTTTTTCCCCCTAAGTCCAATAATGAGAATGTTTTTTTTGTCAAGCTC
TTCCTAAAAGTCATTCTGTCATTCAGTCGTCCACCTAGTGTTTGTGACTATATAATGTCA
CTATTAAGGTTAAAACTAACATAAGGTTAAAATACTAATGAAAATAATTACCATATAAAC
CATCAAGTAATTTCAGGTAACTGTTGTCAGAAGATTTGCCAAGAAAGGCCATCAGTTCAT
ATCTAGTGACCATAGTGAAGCTGAACTCTCACTTTGTGCTTGATTCAACTGGAAGCTGTT
TGCTGTGTAGAAGGGAAACAAAGATAACCCCACTGAGCAGCACCAGCAGAGGTCTAAGTG
AAAAGGATGAGTGAGTCCCCATCAGGTGACACTCTAAAATGTTTAGGTCACAGACTGGGA
GCATGGCATCCACACAAAATTAAGGCCTCTTCCAAGTGCCTCTGGGACCAGCTGAAGCAG
ATATCAGGTCAAAGGGAGAACTTTTCTTGTTAGTAACTTGTCTTGAGCAGTCTGTAAACT
CATACAATTCACTCTAACTTGGTAAGTATTATTTGTAAAATATAATAAATTTTAACATTT
AGCTTCATTTAAGAACATGCAATCCTTGTATTTAAGCCCTCGACGAAAATGGCAGAAATG
CTTTTATTAGTAATCCTTACTTTTGTTCTATCTCCCTCTCTTTCCTTAGCAGGTTTAAAA
TGTTTAAATGTTTACAATGTTGTTTTTCACCATTTTGGTAAATGACTAATGGTGGTTTCC
CATGCAAGTAAAAGGCAACATTTCCATAAGCAGGAGCAAGTGAGGGCCTAGCGTCCACTC
CTAAGTTTACATTTTCAGCATAAACTCCGGGCCTCTCCAGGAATGACTGTCTGGTTGGAA
TATTGACTTGATTCTCCTCTAGGCGTGGGCATGACCGCCCTCATGGGTCTCCATTGATGT
GTGCCGTAGTGCTTTTGCTCCATGATGGTTTTCTTTCATGATCAAGGACGATTTGTAGGT
CATTCATGTTCAGCTTCATTTTTGCCTTTGCTTTTCCCCCCCTGCCATTTCTTTTTTTCC
TTATCTATTGTTCAGGTTCCTAGGATAACCAGTATATGGCCAAGGACGCCTTTCCGACCA
CTTTTTTCTACCATACAAACAGCTTCGCTGCTCAGCTCTCATCCTTTTGAAGCAGCCATG
TTTGGGGTAGCAGGGGCTATGTATTATCTCTGTGAGAGAGCTTTTACAAGCAGGTGGAAA
TCCTCAAAGGTTGGCCTCTTTCTGCTGGTTCTGGGTATTATTTTACTCTTTCTTTTTGAC
AATGATACCTCAACTACAACACTCTAGGAGAATTAACAGCTTAGAAGGGTACTTTGCTTC
TGATTGTTGATTCCAATCTTTTGTAGCATGCTTACATCACACCACTGCCTTAGTTGAGAG
GAAATAACTTTGTAAGGACAACAAACTCAAAATGCAGCATTCAGATGAGAGGGACCTGTG
TTTGTTTCTTATAGAGGATGGATGTATTGTCCTGGCTTCGTGCCTCCCTCAGGGACTCCC
CAAATTTTTGTTACACATTTGCTTCCTCCCCAGATGCCGGAGCCAGCAGCTCCAGCCAAG
TGAAGTGAGCATGCTAGACTCCACCTGCCCATTATCCATTTCCTGTACCCCAGACCATGA
TGAGCCTGCCCTGGATTTGGGGAAATCTTCATTTCCCCATTGCCTTTCATAAAGCTGTAT
TTGGACTGTCAGGGGTTATATTTTATAGTTAATGTTTTTGAGATTTTACCCAGGATAATT
TTACTGTAATTAGAATCAGAATCAACAGATGTGTTTGGCTTGGGGCTTCACATTTTTAAA
GAAAGCAATAATTTCAAAACTCTAGTGAAATAAAAATCACACCCCTTTGGCCCCTCATTT
GTAAGCAACAAAGCTCACTATTCTGACTCCTTGTGACCCTATGGGACAGAGTGAACTGGC
AAAACCTGTTGGGTTTTGAGACTGTAGCTTTTGATGGGAGTAGGAAGCCTTAACTCTCTC
CTGCGGTTTGGAACTGCCGACCGTGTGGTTGGGGCCTTCTCTATTCAATGTGCCCCAGAC
AATGAGCCACCAACTAGAATCTTTTTTTTCTGTCTTGCTTTAAAGATGAGACTCTGAATG
TTAAAGAGATACAAAAGAATTCCTCCAATTCATTTTACTGTTTTGTTTTCTTTGGCCATA
AAATACAGGGTAAACATCTGTTCCTTATTACTATTAGATCTGGCCATTTGGCCACTTGAA
GGGATGGCTGTTTACCGTCTGTCACACTTTCCTGAACAGGGACATTATACACCGTCCACA
TGCTAGGCAAAGGGATGATTCACTGGAGTTTTAAGGTTGAACTAAAAAGAAGAGAAAAAG
TAATTAAACTTAATTGTTACTGTTCTTAATTTTTAAATATATGCTACTTATTTATGAAGT
TATTACTAATCATCAACAGTATATGAAACTTGACTATTCCCATTTATCTCTGGCTCAGTG
GCTGAACTTACTTGTAATGCTCGAGTTTATGTATGTTCCTTAACTGACCTGTTTTGAATG
GACATCTATAACCAGATTTCTGACCAAAAACTTAATATATTTTAATGCTGCGCATAAAAA
AACGGGGTACAGGCATATATCTTCCTGGGGGAACCTGTGATCTTTATTTTTTAGATTTTG
TTCCTCTCTCCTAAATTTGAAAGAAGCAAGGAGGAAAAAGGGTTTAGGCTAGCCACCAAA
CAAGCTTCAGGCTTCATGACTGGGGTGGATTTCCCATACCTGATTACAACCACAAGTGTT
CAGTACATTTTAGAGCATTAGCATTTCAGCAAGATAGAGAAAGGTTTTATTTAGTTTTGG
GAGGCTGAATTTGTATATCTTTGTCAATTGAATCTATTCTAGAAATTATTATTCTTTCAT
GTTGCATTAAAGTCTTGTTGTCCTTGGAAAAGCTCCAGAATTAAAACATTAGCATTTAAC
CCAATAAAAAATTTAGTAATAGGTAGTCTGTTTAAAAAAAACCATATACAATAAAGTAAA
AAAATAGCATATAATTTCTTAAATATTTCACAAAGTACTGAATTTAAACATGTTTTAAAA
CAGTAAATTGAACATGCTTGGCTAAGCATTTTTTACTTAAGAATGAAGCTGAGAAAAGTA
CAAGCTGTCAGGTTTATTAAGCATGCTAATATACCCTTGTAAATTAAAAAAAAATTATTA
CCAGTCCACTTGAAATGTTTACCACAGCGCCAAGTATCCCAATTTAAATATAAATTAAGT
TGGTGTTATTTGCTATCTTCTTAGCATGCATGATCAAGTAGTGATTACATGATCATTTGC
TGAATTAATGCATTATTTTGTTGGAACTCAACAATTTATCATATTGTCTACCCTTAGAAA
ATACACCAGAGTCATATTCAACACAGCTGACTAATATTAGTTCAGGAGGAAAATGCCTAA
TGAGGTATATTAAAAGATGAGAAATGCTTCCATTTGGCTATGTGTAGCCCACAACTCTTC
TTCAAGACACAGTTTTAATGACTTCAAAGGGCAATTTCTTTGTTCTCATTGAACAATTGC
CCTCTTTTCATAGGTTGAAGCAGAGTAGAGTAGATATTGAACACCAATTTAACCCGATTA
TCTTTGAAGATCATTTCCACTGGAAAAGGAAACAGTGTGATGCGTGGATTTTGTTTTGTT
TTGTTTTTTTAAGGGTTTGGGACACCTCAGAGCAAATAAGAAAGGAGTGGTCTTTTAAAT
AACCCACCCTCCCCACCCTCCAAATTAAAAATTCAAACATAGGATTTGTTCAAATCACTT
TAGGAAATTGAGTTAGCTTGAACAGAGATCATTTTGCATTGATTTTAGTAAGAAGCAGTT
CTTCAAACTATTATTTTAGTAAATGCTAATGTTTGTGCAATTTACAACATAGATCTGTTT
TTACTTTTCTCAGATTGAAAGACAGAACTGAATTCTAGAGCCACAAAATCTGGCTGCATT
GGGAAAGTCCTGTGCTTTCTCATCTGACCTATTCTAACTCTGGAAACCTTGAGCAGCGCT
GAGGAGTGGGCATAGATTACTGTGTGTTTGTGAAGAGAGCTGTGGGCTTCAGTCTCTGAC
ACCATAATAGCCCTTGTAAGGCAAGGCAGGGCATGTCCGGAATGCATGGGCTGGTTCTGT
CTTTCTCTGAGATCTGCTCAATCAGACACGTGCCAGGGAAGGCACAGATCGTGGAAGGCT
CTTTTTTCAGCGGGATCAGTTACATCAACATCTTAGCTTACTTCACTGTTTTTAAGGAGA
CTATTAGCATAAGACTTATAAACAGTGTTAAATTCCGTGCACACAGTGACATTTCTTTAA
TGCTGACTATGCAATGAGAAATTGTTTAAAAACAGTAGCAAAAATCTGGGTAAATGTACA
GGCCAACCTGTATAGTTTGCCTTTTGAATTTGAAATAGAATAAGTTAATGCTCAAATTCC
ATGTAGGCCGTTAGCATTTTTCTAGATGTGATGTAACTAACCACTAAAAAATGCTTCTCC
GTATCAAATACTAACCACCTTCTTTTGGCTATTCTGGGTACCACAAACTATCAGTCTTGT
AAATCTTCTATTTATCTAGTAGCATCTAGTGTGTAACACAACATCAAGTAATGTCTTTAC
ATAAATCATAGGATAAAACTAACATTAAATTGGTTTAAACCCTTCCCCCTCACAATTTCA
ATGTGAGAAAACAGTTCTAGCTAATGGAATAAGCTTACTGCAATGGAAGTATCTGAACAA
ATGCAGATCTTTCCTTAATGGAAAGTTCGAGAGGCTGCACTCGTTGCACAGAGTTGCCGA
AGTTCTGGGCTCTCTGCTGCCAGTAGTTCGAAAATCATGTGGTACTCCAGAGTGAGCCAG
CGTGGGTCCAGCTTTCACTGGGAAATCTGTATTCTTCTCTAAAGCTACTAACCAGGTGTC
TGATCGAAAAGGAGATGTTTGTTTTTAGTGCCAAAAGAGGGGTGAGGGTTTCTAGTCATG
TGGAAATCTTGATTTTCAGGAGGAATTTTGCTACCCAGTGGAGTGCCTTGCTCTGACCGT
TGAAGAAGTGATGCATATCCGCCAGGTCCTGGTGAAGGCTGAGCTAGAGAAGTACCAGCA
GTACAAGGATGTCTACACTGCCCTGAAAAAAGGGAAGGTAGAGCTGTTTAAAGTTGATTG
ATTAAAAGACTTAGAACAATGGTCCACTAACAGCATGACTCCTCAGAGCTAGCACAGAAT
TTTCTAGGAGTTGTGGGAGGCAAGATGTTTTAGCTAGAGTAGACAAAGTCTTGTATTTTT
GTTCCTCCCGTAGGAATTGAACTTGATGGAAAGCTTAAAAGCAATCATAATAAATAATGG
CATGCCTTCCTGAAGCCATGTTTGCACTTATTCCTTATTATTTTAAAAGATTTGTACTGG
TACCAAGGGCTCACTCAAGTAGAAAGCAAATGTTTTGAGAATGTTGATGGCAACAAATGT
ACAAATGTGCTTGATACAATGGATGTATGTATGGATTGTGATGAGTTGTACGAGCCCTTA
ATAAAATGCATGCATGCATGTACACACACTTTGAAAAACCAGAACCTATGTACGTGTATT
AAATCTTTCAGAGAAGGAAAACTCAAAATTATAAAGTGAGGTTGAGTTTCTTAACATGAG
AAACCACACAGTTGAATTTGTAAAATTTGCAGGACCCAGAAAAATAAAGTCATTTGGTTA
ATTTTCAGCTAAAAAAAATTTTTTTTGTAAAGAAAATATCTGAGAAACAGAAGCGGACTT
TAGATTGCTTCCACAATAGTGAGATACCTGATACCTGTGACCTTTTGCTACCTTTCTGAG
TAGATGGTAATGTTAGTCTCTACAGAAAGCTGGGTCCAGTGTTGCTGTTATTAGGTGCCA
TCAACTCATAGCAGCCTCCGGTGATATAGTACGGCTTCCTGATAGGGTTTTCTACGCTGT
CATCTTTATGGGAGCAGAGCACTAGACTGTTCTCCAGCAGAGCTGCTGGGTGGGCTTGAA
TTCCAGCCTCTCAGTTTTTAGCACCTAAGCTTCTACTACCTTTTAGAGCAGAATTATAAT
TACACACAGAACTAAAATATAATTATCACAGAGCCAAACACAAAAATAGTTTCTGGATTT
TATTCATTCTCCTTTTCTTCCCCTCTCCTTTTAAACTTGTATTTCTTAGCTCTGCTTTTG
TTGCCGAACCAGGAGATTTTCCTTCTTCACCTGGTCTTACACCTGCCAGTTCTGTAAGAG
GTAAAGCATTTTGTAATTGAGGAAAATAGAGATTTAGTAATTATGAAATAAATACCAGTT
GCTTTAATGTTTTCATCATGTTTCTACACAGGAGTAATATTGGAAATGTTATATATTGTG
CTAGCTTGGAGGGTACCACACAATTATTTGATAGTGAGCCTGTGAAATGTTTTCCTGTGA
GTCACTTTTTCACATAAGCAAGATTAATAATATGTTGTACTTGTACAGGAAAATGTAACC
CCTGTACAGACATAAGGAAATTCCAAACAAAGGTCATTCAAGCCTTCTATAGGACACAAT
GTGAGAGGGAAGTTTTGTAAATTGCTTGTTCTGTTGAACATCCACAGTCGCATCATCTGC
CACATTCTGTAGACGTTTCAGAGAGTTTACAGCTCTGTGAGGGATGGTGGTTTTAGCTCT
CCAGTCACATTCATAGCATCATGCCAAATAATACTTTTGATTTTGTGTGCAGGCCAGTGT
GCTCACAGTGCTGCAGAAAGGTAAGATATATCTGCCTCATTTACAATTGATATTAATTTT
AATGGTTCTGCATCTTTAACAGTATTGTTCATTCTCGGTTGTGTTTTTTCATAATAGATG
CGTCTGCCATCCAAGCCATACTCCACTCTTCCTATATTTTCTTTGGGACCTTCAGCCTTG
CGAAGAGGGGAAAGCTTTATGAGGCCAGAAAAACCCTCCACTAGCCACCATCGGCCACTT
CAGAGCCTTGCCAGGTGAGCAAGGGCCTGAGGATCAAAAGACCACCATTCTTTTTGACAA
CTGTAGTGTGAAGAGTTAGGTTTTGGATTTGTGTGAGAGTTTTGGTTGGCTGGTTAGTTG
GTTTTACACTTGACATTAGCCAAAAGGCCAAGAAGCGATTGGTTAGTTGGCTTTGACTTG
CAAAATAATCTCCACAACTTAACTGAGGCAGAATGGCTATTTGAAACATATTTCACGGTG
CTATCAGGTAAGCATGGGGCTGCTAACCCTAGGGTGGCAGTTCAAACCCACCAGTTGCTC
CATAGGCGAAAGATGTGGCAGTTTGTTCCCATAAAGATTTGCAAGATTGGAAACTGTATA
GGGTTGCTGTACACGTCCATCCTAAAAGTCTGGCAACTACTGCAGCCGTTTTGGATGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1129, 42521..42646, 44804..44881, 46824..46988, 50762..50848, 53477..53606, 71928..72100, 84548..84638, 86064..86206, 93199..93336, 94369..94439, 94912..94939, 95037..95171
1001..1129, 42521..42646, 44804..44881, 46824..46988, 50762..50848, 53477..53606, 71928..72100, 84548..84638, 86064..86206, 93199..93336, 94369..94439, 94912..94939, 95037..95171
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved