Echinops_telfairi Locus SPTBN2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SPTBN2
Echinops_telfairi
SPTBN2
GeneScaffold_7052
SNORA26
44338..44460
54428
CCCTGGGCCACTCTCGGTCTTTGCTCGACGTTCACTTGCTCAATCCCCAGGGAGCTGCT
TTGTGCCAGGCCATCAGTGGGATGTCCCTATCATGTTTCCCCCTCCCACCCCCCAAACTT
CATCACCTCACCTGGTCAGCACAGCAACTGGGTAAAGTGGAAAGCATTGTGTCCATTTTA
CAGATGAGGACATTGAGCCCTGGCCGGCCCCATTCCAGCCCCAGAGCCCTTTCTCCGCAA
CCCACTGCCCGCATCATCTCACCCCACATCCTCCGAGCTTGTCTCCCACATCCCTCTTCC
TTCTGATGTCCATTTCCCAGCATCCCTCGCCATCATCATCATCTTCTGACTTGGGGGCTG
TTCCACCGTGGGCTGGCATGTGGGGGGGGGGGGGGCGCAGCACTGGCCTGGAAGGACAGG
CGTGACCCCAGACTGCCACCACAGATGAACGTGAAGCCGTGCAGAAGAAAACCTTTACCA
AGTGGGTGAACTCGCACCTGGCCCGGGTGACCTGCCGCGTGGGGGACCTGTACAGCGACC
TCCGGGATGGACGCAACCTTCTCCGGCTGCTGGAGGTGCTCTCGGGAGAGACGCTGGTGA
GCCGCCATCAAGGTCCCGTCCCCACCCCCGCTCCCCAGCGGGGGCGGCTGAGAAGGAGCG
CTGAGGGCAGGCGGGGGCGGGTAGTCGCCCATGGAGAGCCGGGGGAAGAGCAGTGTTTCC
TTCCCCTCGGAGGGTGGCTTCCTCTGAGCGGCTTTGCTGCCAGGATTAGCCAGGAGGGTG
GCTTCTCGGGGACAAGAACAGTGGCCCCATTGAAAGCATTTCTTTTTCCCACCCACTCCT
GGTGCAGTTAATTCTCTTGGGAATCTTAATCTGCCCCTAGACCCTCAGCATTGACTCCCT
GGCCCTGGGCTTCACCGCCCTGGGGGCTGTGTCCTGGGTTCCAGAGGTGGAGCCTGCCGA
GGAAAGGGGGGGGGCCCCATCACTCCAAGTCCCCTGTGTCCACAGCCCAAGCCCACCAAG
GGCCGCATGCGCATCCACTGCCTGGAGAACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTG
TGCCCACCCGCACCGTTCACCGCGGTGAACTGAACCCAGGTGTGGCCAGCACCGTGTCCA
TCCACCTGGTCAAGGGGCTTCCTCTTTGCCACTGGCCTTCCATGATGCCCTTCCCTGTGT
CACATTCGCTAGGTCTAGTATGGCAGTTCTCAACCTGTGGGTCGTGACCCTTTTGTGGGG
GGTGGGGTCGAACAACCCTTTCACAGGGGTCGCCCCGATTCATCACAATAGCAAAATAAC
AGTGATAAAGTAGCAATCAAAATAATTTTATGGTAGGCGGGAGGTCGCCACCATATGAGG
AAGGTTGAGAACCCACTGGTCAGGAACCTCCAACAGCCATTCTCATGGCTGCCCTTGCTG
CAACGTCCCGACAGGGGCCAGTGGGCGGAGGAGCAAGATCAGTAGACTTGCCTTCCTGAG
CAGGTGGAGGGGCCAGATGAGTTGTGGCTGACCTCAAGTCCCCACTTCCCTGTGGCCTGA
GCTGTGTGCGAGCATGTACCATGGGCCAGGCCGCTCCTGTGGGGCTTTTGAAAACTGCTT
CCCCAACAAAGAGTTCGAGAAGGACCGCGTCAGTGGGCCTACCCTCAGTTGCACCTCTGC
TGCCTTGGACGCTGCTTCTCAAAAACTCATGCCCGTGAGTCGATACTGACTCATAGCAAC
CCTGTAGGGCAGGGTAGAACAGCCCTGCTGGGTTTCTGAGACTGATTCTTTACTGGAGAA
GAAAGCTCTGTCTGCTCCCGAGGAGCGGCTGGTGATTTCAATCCATTGACCTTGTGGATC
GCGGCCCAACACATAACCACAACACCAACCGCTGAACTCCACTAATCCCCCCCAGGAGGA
GAGCAGTTATCTAACTCCTCCTTATCTCCCGAAGGCACCAGGGGATACGCTGAGTCGGAC
TAGAACTGTGCCCCCCTAGTTTTCTTTTTTTGGGCCCCCCTAGTTTTCAATAACCATCTC
AACAGAAGATCACCAGGTCCTGTGGGGTGGGCTCACACCTGACGGCTGCCTGCGTCACCC
AGGGACTGCTCTTAGGTGCCGTTGACTTGATTCTGACATACAGCGGCCCCGGGACAGAGT
AGTTTCTCTGTTGCCCCGTTGGGTTTCTCAGCAGTCTTCTCAAAAGCATGGTCATCCAGG
TCTTTCTTTCTCAGAGCCTCTGGGTAGGTTCTACCCGGACACTTGCCTTGAGTCTGGTAC
CATTGGGTCCCTGGTTCTGCCAGGAGCACCTGCCCCAGGAGTGAGGGCCGGCCTGCCTGC
CTTCCTTCCTTAGATCCAAGACATCAGTGTGGAAACAGAAGACAATAAGGAGAAGAAGTC
TGCCAAGGACGCGCTGCTGCTGTGGTGCCAGATGAAGACTGCGGGGTGAGACCCCAGGGG
CTGGTGGTGAGGAGGGATGGCCTGACCAGGACCCGCTGCTGGGAACCAGCCTTGAGTCTG
TGTCAGGCCCATTGGGCACCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAAAACTGCTTCCCCAACAAAGAGTTCGAGAAGGACCGCGTCAGTGGGCCTACCCTCAGT
TGCACCTCTGCTGCCTTGGACGCTGCTTCTCAAAAACTCATGCCCGTGAGTCGATACTGA
CTCATAGCAACCCTGTAGGGCAGGGTAGAACAGCCCTGCTGGGTTTCTGAGACTGATTCT
TTACTGGAGAAGAAAGTTCTGTCTGCTCCCGAGGAGCGGCTGGTGATTTCAATCCATTGA
CCTTGTGGATCGCGGCCCAACACATAACCACAACACCAACCGCTGAACTCCACTAATCCC
CCCCAGGAGGAGAGCAGTTATCTAACTCCTCCTTATCTCCCGAAGGCACCAGGGGATACG
CTGAGTCGGACTAGAACTGTGCCCCCCTAGTTTTCTTTTTTTGGGCCCCCCTAGTTTTCA
ATAACCATCTCAACAGAAGATCACCAGGTCCTGTGGGGTGGGCTCACACCTGACGGCTGC
CTGCGTTACCCAGGGACTGCTCTTAGGTGCCGTTGACTTGATTCTGACATACAGCGGCCC
CGGGACAGAGTAGTTTCTCTGTTGCCCCGTTGGGTTTCTCAGCAGTCTTCTCAAAAGCAT
GGTCATCCAGGTCTTTCTTTCTCAGAGCCTCTGGGTAGGTTCTACCCGGATACTTGCCTT
GAGTCTGGTACCATTGGGTCCCTGGTTCTGCCAGGAGCACCTGCCCCAGGAGTGAGGGCC
GGCCTGCCTGCCTTCCTTCCTTAGATCCAAGACATCAGTGTGGAAACAGAAGACAATAAG
GAGAAGAAGTCTGCCAAGGACGCGCTGCTGCTGTGGTGCCAGATGAAGACTGCGGGGTGA
GACCCCAGGGGTTGGTGGTGAGGAGGGATGGCCTGACCAGGACCCGCTGCTGGGAACCAG
CCTTGAGTCTGTGTCAGGCCCATTGGGCACCGCTAGTCTATTCTCACTCAACACAACCCA
TACAGCAGGGTCATGGGGCCTCCTGGATTTCCTTGGCTGCAACCTTTTTGTTTATTTGTT
TGTTACATTTTTATTGGCACCTGTGTTAGTTCTGGTAGACTTAATTCATAAGCATGCATA
TATGTATAAGGAAGAGCTTTATCTACAGGAACAATTGAATATTGAGAAAACAGCCAGTCC
ATAGCAAGTCTCTAAGTTCAATATTAGCCCATATGTGGAATACTAGTCCATAAATTCCTC
TTTAGACTCATGCAATGATACCGAATGCAGGAAGATCACAGGCCAGTGGGTGGGAGGTCT
TGTGGATCCAGTGGTGGTAGAAGCGCTGGCAGGGGACTCCATGTGGCTCCTCCAGCTCCC
ACGGCGTGGGCTCTATCAGCGTAGCTCCATGTGTCTTGTCCAGTAGAGCATCTCTCGGAG
TGAGTCCACGCTCTGCCTCCAGGGAGCTAATTTAATTCCTTANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCCGTGGAGCCTCTGAGTGGGTTTGAACTGC
CAGCCAGCTCTTGCAGCTCCAGGCAGGGCTCCTTGAGACCCCAGGCTGGGTCTGCCCTCT
GCTGTTGTTAGCCAGCCTCACGGCCCCCCACCCACCGCGGGACCAAATGCTGCTCTTCGC
CCTGTGTCCTCCCTGTGATGGGTTTGTGTTTGGATGATTGTGACCCTTTAGAACAGTGAT
TCCCAACCTGTGGGTCTCGACCCCTTCAGGGGTCGAACGACCCTTTCACAGGGGTCGCCC
GATTCATAACAGTAGCAAAACGACAGTGATGAAGTAGCAATGAAAAGAATTTTAGGACTA
GGGGTCGCAGCACGAGGAAGGTTGAGGACCGCTGCTCTGGGGCTGGTGCTTGAGCACTGA
GCCACCAGGGCCCCTCCACCCCACAGCCCTCCTGGCTCAGCTCTCTGCTCAGACCTGCCT
CCTCTCTGTGTGTAGGTATCCCAACGTGAACGTGCACAACTTCACCACCAGCTGGAGAGA
CGGGCTGGCCTTCAATGCCATCGTTCACAAACACAGGTGAGAAGGCGGGCTCAGCAAAGG
CCTCCGGAGGCACCAGGGTGGAGGGTGGGGGTGGGGGTGTCTGGTTCTAGACACCACTGA
TGGGGGATCAGGATGGCCCTGGATGTCCTGTCCCTTGGAGGATACCACATGCTTGGGGTC
CCTTCTCTCCTCCCGGCAGGCCAGACCTGCTGGATTTCGAGTCCCTGAAGAAGTGCAACG
CCCATTACAACCTGCAAAATGCTTTCAACCTGGCCGAGAAGGAGCTGGGGCTCACCAAGC
TGCTGGACCCAGAAGGTGGGGGCGCCGAGCTGGATAGAGTGGGGTTGGTGAGCACCAGTA
CCCAGGTGCTCAGCCACTAGTCGCTCCTTGAGAGAAAGAAGTGGCCCTGGGCCTCTGTGA
GATGGACAGTCTTGGAAGCCCCAGAGGGAGTCCTACTCTATGAATCGGAATCAATGAGAC
AGCAGTAGGTTTGGATGGGTTTGTGTTTTTTTGTGGGGGGAGGGTGTTGCATAGACAATA
CGTAGATTAGTGGTGGACAGGGGCAGAAATGACTGTTGATCGGTACAGCGCTTCCCTTTG
GAATGATGAAAAGACCCTGGAATCAGGCAGTGGAGGTGGTTACACAACCTTATGAAGACC
CTAAAATCCACCGATTTGTACGCTGCGATGGTGAATCGTGTGAACTCTTTGAAATGATCA
GAGGAAGGTAGAACTGCTATGAGACCCGGAAGGAGCCGTGGGACAGGGAGCGGACCCGTG
TGGCCGAGGACAGCCGCCTGGCCTCTCCATGGCTGTTTCTCTGTCTCTAAAACATGGAGA
GCCATGACCTGGTCTCCAGGGGGCCCTATTTAGTCTAGGGTTTAGACTTAAGCTCCATGA
CCTTTAAGGTAAGGCCTCATGGTCCACCGGCCCTGCCAATGGGCTCCGGAGGTGCTGACC
CATCGCCAATGATGTCAGCAGTGCAGAGTGAGCTCTGATTTGGCACCTGGCCCCCCCTTA
AGCCCTTCAGTCCTCCCAGCAGCCCTTTGCAATCAGCAGTTATCGCTGACAGTTGACAGT
TCCCCGCCCAGGGACTCTTGTCAAAACCAAAAAACCAAACTTGATGCCATGACACCCATT
CTGACTCTTAACAACTCTACAGGCAGAGTAGAGTTGCCCCACCTGTGGGTTTCTGAGACT
GTAACTCTACGGGAGAAGAAAGCACTGTCTTTTCTCCCGAGGAGGTGGCAATGGTTTCAA
ACTGCTGACCTTGCAGTTAGCAGCCCAGTGCCTCACCACTGTGCCACCAGGACGCTGGCT
TAATGAAGAGCATCCAGGGATGTCAAGTCCTAGTCTGTCCTGTTGGCGGGTGAGAGGGGT
GGGTGGGGAGGACTGGAGTGTAAGGTCATTGAGCCCTTGGGCCCACAGCTGGCTTCTAGG
TTGAGATTGGAAACAGCCCTGGCCGAGACCGGAGAGGTCTGGGCTTGCAGGTTCCATGGG
TTTAGCTCAGCTGATGACCCTGAACCTGCTAACTTCTCAGGCAGCTCTCCAGCCTGGAAG
TCCACAGTTCACACTCAAGAGGGAATGGAATCTTGCCTTTCCTCCCCAAACAGCTGGCCC
TCATCTCCCCCATGAGCCCTGGGTAGGATTTCCTGGGCGTCTGGGTTTATGTGCTGCCCA
GCGAGCCCTTCCCTTGCCTAGCGAGGGACTTGCCCGTAGCCTTTTCGTCTGGCTGATGCA
ATAGTTGTTCAGCTGTGATGAGGCCCTGGGAAGCAGGTTGGGGTAAGTGGACCCCACTGC
AGGTGTACCTCCAGGGGGAACAGGCTTCTAACCTGAGGGGGGGCCTTCCCGCAGACGTGA
ATGTGGACCAGCCGGATGAGAAATCCATCATCACCTATGTGGCCACATACTACCACTACT
TCTCCAAGATGAAGGCCTTGGCCGTGGAAGGGAAAAGAATCGGCAAGGTACTCTGCACCT
GAAGGCGCTCGGCGTCGGGGCCCCAGGAGGCCTGGCCCAAGGGTCTTCCCTTTGAGCTTA
CCGGTGGGGCAGTGGAACTAACCACAGGAGGCAGCTTTCTCAGTGGGCCCCGTCCGGCAG
GTGCTGGACCATGCCCTGGAGGCAGAGCGGCTGGTGGAGAAGTACGAGTCTCTGGCTTCG
GAGCTGCTGCAGTGGATTGAGCAGACCATCGTGACCCTCAATGACCGGCAGCTGGCCAAC
TCCCTGAGCGGCGTCCAGAACCAACTGCAGTCCTTCAACTCCTACCGCACCGTGGAGAAG
CCGCCCAAGTACGTCCCTTCCAGACCCCACCCTGCGGGCCGTGCCTGCCCAGAACTGGGC
TCCCCCAAATCCCTCTAAAACACCCCAAACTCGCTGCCAGGCAGTCCATTCTGACTCGTA
GTGACCCCGTAGGGCGGGGCAGGACTGCCTCTGAGGGGTTCCCGAGACTAAATCTTTCTG
GGCGTGGAGTCTCATCTTTCTCCTGCAGAACGGCTGGTGGTTTCAAACTGTTAGCAGCCC
AGCACGTAACCCATTTACCTCTAGGGCTTCCACAAAACAAAGCCTCAATCCGGGCGGCCT
TTCAGGAGGACGTGTGTGCTGGTCTGTCTGGGCAGGGCAGGGTCCTTCCCCCTGGCTGAA
GATGCCACAAGTGGTTCCAAAATACTGCCTTGTTTCCGTATAGCTTTTTACTTGGGGTAG
AAACAGAAAGAGTGAAGCGTGCATCCATTCAGCGATGTCTACTCGTNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGAATTCAGCTAGCCTATCTTCTGATCAAATAGTCTCCTGACATCCAGGTCCAGAA
GAGACGTGACCTTGGCTTGCAGAAAGCAGCGTCCTGTAGCCTCGATGGCTGGAGTGGGTG
CAGTCCTCACAGATAGGTGGCCGGTGGTGGCGTGTCTCACAGCCCATTTGCAGCCGATGG
CTAGGTGGGATAGGATCTCGATAGGCCCGCTCACTTCTGGCGACACAGCAGTACAGGTTG
AGTAGCTTGCATGTTGCACATGCCTTCGCTATTACTGTCTTAGCGATGAGCAGGTTTCAT
GAAGTCTGGCTCACTGGTCGGCAGCTCAAACCACATACTGGCACTGCTGGCATTGCCTTT
TTCCTCTCAGTGAGCTTTCTCGGTATCAAAAGCCCACGAATCCAGGAAACCTCTGTGTAT
GTACATTCCAGGGAGTGATTTGATGTCTGCCGCTCGACCCAGACCGTCTGTGCTGGGCGT
GGAACAAAGATGGAGCCAACAGAAGGTTGTCCGAGGACACACAAGTCACTGTGTGGCCAG
GGGAAAGAGTGTCCATGAAATGTACTTGTGACCATGAGGAGGTCTTTGTGGTATAATGAG
CGAGAAAGCCGGTTAGAGAGGTGCTTTGTGGGCCGCAGAAGACAGTGCGAACATCCCGGG
CTTATCTGCCTGCGTCCCTGTCCTGGCTCTGCCTGGTAGCAGTTGCAACCCTTGGGCACA
GTTTGAACCTCGAGGTGCCTCAATTTTCTCAGCTGAAAAGTGGGCGCGAAGGGAGGGACC
ATGGAGAGCGGTGAGAATGGCACGCAGGGGCCCCACGTGGGTGTGATCGGATCCCCGGGG
ACTTGAAGGACAAAGAAAGGTGCCCGCAGCCTGGGCTTTGGTCCCGGTGACTGTCGAGTG
GTTGGGGGGCTGTGTGCTCTTTTCTCCCTGGCTAGACAAGGGTGTGAATCGCTTCTCTGC
GAAGCCATTCGGGTTGGGAAAGGGCCTTGACTCTGGCGCCGCCTGGCTTCCTCCCTCAGG
TTCACAGAGAAAGGGAACCTGGAGGTGCTTCTCTTCACCATCCAGAGCAAGCTGCGGACC
AACAACCAGAAGGTGTACACGCCCCGGGAGGGCCGGCTCATCTCCGACATCAACAAGGTC
TGCCCCCTGCTGTCCGTCCTCCCTCCCTCGCCACGCTTCTCGTGGGTGCCGGTAGCTGTC
ACCTAGTCACCCACACATACCACTCACAGTGACCACACAAAACAATGCCCAGCCCTGCCC
CATCTTCCCATCTCTTGCTACACAGAGAGTTTCATTGACTGGGCTTTGGAAGTGGGCACC
AAGCCTTTCTTCCTTGTCTCTCTCAGTCCAGAAGCCTGTGCAGCACTGGGGCAACACTGC
AGGCCCCTCTGCCTGCAATAAGGGGTGGTGGCTGGGAATCGAACCTGAATCTCCAGCCGA
GGGGAGAAGAGCACTCTCCTGCCGAGCCAAACTCATCACCAGATCCCTAACTGGAGACCC
CAACTTTTTCTAGTTATTGTCACACATCCTAAGACGGAAATGAAAATTGGGGTCGCCCGC
CAGGCTGCCAGCGTCACACTCCAAAGGGTTTCCATGTTCCCTCCCCGTGCATGTTCATAA
ACACACCCCGTAGTCATGCATGGCTTCCTGGCTCTCATGGCGCCACCCCTGGGGACTCAG
GAGTCTGCCCGACCACATTCCCCAGACCCACTAGACCGAGTTTCTGTGGGACAGCTTTGC
CACGCAGGCCTGCCCTGAGCCCTGACCCCGTCCCTGCCCTGCAGGCCTGGGAGCGGCTCG
AGAAGGCGGAGCATGAGCGGGAGCTCGCCCTGCGCACGGAGCTGATCCGCCAGGAGAAGC
TGGAGCAGCTGGCTGCTCGCTTCGACCGAAAGGCGGCCATGCGCGAGACCTGGCTCAGCG
AGAACCAGCGCCTCGTGTCCCAGGTACAGGGCGGAGACTGAGGGGTGTCCAGGTGGGCGG
GAGAAACTGGAAGGGACCCTGGAAGACAGCCCCACCGGGTGGGGTCCGTGCAGTGAGATA
CATACATACCAAGATAAGGAATCTTGAGATGGTGAAATCCAGGGCCCTGAGGCTGGAGCA
GGAGGAGGGGTTATTGAGACCCATGGGGTGGCCTGGCGGGACCAGAGAAGAGAGAACAGG
AACCTAAGGGGCACCTGCAGCAGGTGCTCTCTGGCGACCAAAAGGGTGAGCACGGGGGCT
GTGCCTCAATCCCCAAGACTGTGCTCCCTGCCACTGCCCCAGGACAACTTTGGGCTGGAG
CTGGCGGCGGTGGAGGCCGCGGTGCGGAAGCACGAGGCCATCGAGACCGACATCGTGGCC
TACAGCGGCCGGGTGCAGGCGGTGGACGCCGTGGCCGCGGAGCTGGCCGCAGAGCACTAC
CACGACATCAAGCGCATCGCGGCGCGGCAGCACAACGTGGCGCGGCTCTGGGACTTCCTG
CGGCAGATGGTGGCCGCCCGGCGCGGCCGGCTGCTCGTCAACCTGGAGCTGCAGAAGGTG
CTTCAGGACCTGCTGTACCTGATGGACTGGACAGAGGAGATGAGGGTACGGAGCGCGGGC
ACAGGGCGGGGGCATGGGGGCCACAACAGACAGGCCCCTGCCCCGGCGGGGTGCACTCTA
GTGGAAGGAGGCTTAAGCCCATGCCATCGGTCCATCCTCCCCTGGAGACCTCACAGGACA
GAATTGAACTGTCCCGTAGGGTTTCTAAGGCTGTAGACCACCACCCTCTCTACCTGAGGG
CAGCTGCTGGCTTCAAACGACTGGCTTTTCTGTTCGCAGCCCAGTGCGGGCTTCCCCGCT
GCACCACCGGGGACCCTCGTGGGGCTCTAACCCAGAGGCCCAGGGTCCGTTCCAGCCCAT
AGCAACCCTGTAGGACCCAGGGCTCTCGTCTCTCTGGCCACATATGCCATAGCTTTTCTC
CCTTCGGAGCAGCTGGTGGTTCTGAAGAGCAGCCCAAGCACTTTCCTTCTCGGTGCCACT
GGGGCTCTTTGGAGATCTCTGAGGGCTTATCAATACACACGACAGCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGTTTCCTTGGCGCTT
AGAAGCCGCATGAGAGTTCAGTTCCCATCCAATCAGGACCCACTGGCTGACTTCAGGACG
CTTTGAAAATGAAGGCGATTCCGGCAACATTTTTGGAAGGTCACTTTGTGTGGTCACCGC
CGAGGGTCCAGGAGCAGGGTTTAGGAAGAAAACCATTCCCAGGGAAGGGACATGAGGACA
GGGAGGCCGGGGTGCCCCGACAGATGCAGCGGGAGCAGATGGGCGCACCTGGAACCGCCC
AGGCACTCGGAGTGAGGTCAGCACACCGGTGTGACTTGGCCACGTGTCCCGCAGGGCCGG
CTACAGTCACAGGACCTGGGCAAGCACCTGGCCGGGGTCGAGGACCTGCTGCAGCTGCAC
GAGCTGGTGGAAGCCGACATCGCCGTGCAGGCCGAGCGGGTGCGGGCCGTCAGTGCCTCT
GCGCTGCGCTTCTGCGACCCGGAGAAAGGTGAGCGTCCCTGGAGGGTGACCTGAGGGTGG
GGGCTGGGGGGTGATGGAGCTAGACCAGGGTGGAGGTGGAGGTGGAAGGGGTTCCCTAAT
GAGAGTGGAGGCTGGGGGGGGACAGCGAGGAGCTCGGGGCAGTGCTCCAGCCCAGGCGTG
GTCTTTCCAGAATACAAGCCGTGTGACCCTCAGCTGGTGTCAGAGCGGGTGGCCGCCCTG
GAGCAGAGCTACGAGGCGCTGTGCGAGCTGGCAGCTGCCCGGCGCGCCCGGCTGGAGGAG
TCCCGGCGCCTCTGGCGCTTCCTCTGGGAGGTGGGGGAGACCGAGGCCTGGGTGCGGGAG
CAGCAGCACCTCCTGGCCTCCGCGGACACGGGCCGAGACCTGACCGGCGTCCTGCGCCTG
CTCAACAAGCACACGGCCCTGCGGGACGAGATGAGTGGCCGCCTGGGTCCCCTGAAGCTC
ACGCTGGAACAGGGCCAGCAGCTCGTGGCGGAGGGCCACCCCGGGGCCGGGCAGGCAGCT
GCCCGCGCCTCAGAGCTCCAAGCGCAGTGGGAGCGGCTAGAGGCCCTGGCGGAGGAGCGG
GCCCAGCGGCTGGCCCAGGCCGCCAGCCTCTACCAGTTCCAGGCCGACGCCAACGACATG
GAGGCCTGGCTGGTGGACGCGCTGCGCCTGGTGTCCAGCCCCGAGCTGGGGCACGACGAG
TTCTCCACGCAGGCCCTGGCCAGACAGCACCGGGGCCTGGAGGAGGAGATCCGAGGCCAC
CGGCCCACCCTGGAGGCCCTGCGGGAACAGGCTGCAGCCCTTCCTCCAGCCCTGAGCTGT
GCCCCGGAGGTGCAGGGCCGGGTGCCCACCCTGGAGTGGCAGTATGAGGAGCTGCAGGCC
CGGGCCGGGGAGCGGGCACGGGCCCTGGAGGCTGCCCTGGCGCTCTACACCATGCTCAGC
GAGGCCGGGGCCTGCGGGCTCTGGGTGGAGGAAAAGGAGCAGTGGCTTAACGGGCTGGCC
CTGCCCGAGCGCCTGGAAGACCTGGAGGTGGTGCAACAAAGGTAGGACGCCGGCGGTGGG
CTCCCACCACAACTGCAGGGGGCGGGAGGGCGGGGGAGGATGCACCCCAAACCACCAGCT
CTGGCCACCGCCCTTGAGCCCTCATGGTCGTCGGGTCTGGGTCTCAGAAGCCTCCAATGG
TGCAAAGGTCAACACGCTTGGCTACTGACCCAAAGGTTAGAGGTTGGAGTCCGCCAGGGG
CAGCTCGGAAGAAAGGCCTGGCCATCCGCTTCTGACCAAACAGCCACTGAAAACCGTCTG
CGGCATGGTTCTTTCTGGCCGGCAGGCGGGGTGGACTCGCAGGCAGCTGGCAGCGGATGT
GTTTGAATGGAACGCGTTCAGCATGTGCAAAAGTGAGCGAGTTAGGCCGAACAACAACAA
AAGCAGACCTGCTTCCATCCAGCCTGATTGAAACTCTTAACATCGTGACGGGCGCCGACA
GCCTCGTCTATCCTCCTGAGGCTCCCTCATGGCCATCGAGTCAGTGCTGACCCACAGCGA
CCTTGTAGGACAGGGTAGAACTGCCCCCGGGGGTCCCGAGACTGGCGCTCTCCACAGAAG
TAGAAGGCCTTGTCTGTTTTCTCTGGAGCAGCTGGTGTTTCGGACCACTGACCTTGTGGT
GACCTTGTGGTGAACAGCTCGGTGCATCGCTCTGCGCCACTACGGCTTCTCAGTGAGGCT
AGTGGGTTTGGATCGCTGCTCTCGAGGGAGAAAGAGGAGGCTTTCGACTCTCTGTAAAGA
TAGACTCGTGTTGGAAATCTACAGGGGCAGTCTCTACTCGTGTCTCGTGAGTCGGAATCC
ACTCTAACGGCAGTGGGTTTTTTAGGCAGAGATGCTGGTTCTAAGCCCACTGCCGATGAG
TTGATCCCAACTCCAGGTGCCCAAATGGACTTTCGTGGAGCTGCCTAGTAAGGCTGCCAC
CTGCTCGTAAGAACGTTCTGTCCAACTGGGCAGCCCACCTGAGCCCCCTCTTGTGAAATA
CGGAACAAAACGAACGTCTAGACATCTGCCACATGGGCCTCTCGTCAGACTGTCCCCTGT
GATTGTCGAAAGGGTTTCCTTCTTTCCAAGACGGCCTGTCACTGGGTCAGCAACTACAGC
CCTCGGGCCAACTCCCGCCTACTGCCCGTTTCTGTGAAGAAAGTTTTATTGGAACGTGGC
CATGCTCATGTATGTCGTAGAGTGTCCAGGACGGCTTTTACTCCACAACAGCCAGGCTGA
CCCGTCGAGCCTGCGGGACCATCAGGCCCTGCAAACGCCTGAAGTACACGTTTGCTGACC
CTTTACAGAGAGGTCTACAGACCTCTGTCCAAAGTCCATTGTGAATGAGTCCCCGGGAGA
AGCTAGACTTCGCATCGGTATCCTTTCAGCACTTTTCTGGTTAATCACCTTATTCCTTGA
CACTTACTGGTAGGATGGGACCCAGGTAACAATTAAGGGTTAAGTCCCAGGAGGGATCAG
AGATAGTGGAGCCCTGCACCTGGGATGAACTTGACCTGTTGGGGCAGCTGTTCTTGGCCT
TGGACTCTCTCTTCCTGAGCAACTCTCAAAGTGGACTTCAGAGCCCTGTGCAGGGGGGTG
GGGCCACAGAGACCAGGACTGCAGACAGAGTCCCTGTAACTCAGTCTTGTGTGGAAGTAG
CAGCATTCTCTTGGGTGTCCGGGCAGCCGCGCCACACCACGCAGGCCCACCTTTTCTCCC
TCATCAGGTTCGAGACCCTGGAGCCGGAGATGAACGCGCTCGCCGTGCGGATCAGCACCG
TGAATGACATTGCAGAGCAGCTGCTGCGAGGCCAGCCCCCCGAGCAGGAGAGAGCATTGT
GGACACCCAGAAGCAGCTCAACCACAGGTAGAGCTGGAGAGCGGAGACGAGCCTACGCGG
GCCGGGAGGGCAACCAGGCGTTTTGTAGGGCCTGGAAGGGCAACTGAACATGTCAAAGGA
AGCCCGTTTTGGCGGGAGGCAAAGGGATGAAAGAGACAGGAGTGGGTGGGGGGTGGGAGG
GGGCAGTGTTGGGAGGGGTGTATCTAAGAGGCTGGCATTCTAGACAGTAGAAACGGAGTT
AAGAAGGCAAGGAGTGGGCAGCGAATGGCCTCTGGCTTACATTAAAAAAAATTTTTTTTT
AACTAAAACCCCAAACACTATGAAGTCTGCTGCACACATGGGGTTGCCTTGAATTGTCAT
CTCCTCAGTGGCAATTGACCAGCCCCCCCATCGTCCACACTGACAGTAAGAAACTCAGCT
CCACATGAGCTCTTAGCCTCAAACGACAGCCTCCGCTGAGCTTTTCAGCAATGCTGGTGT
TCACCTTATGTGTAAGTCTGAGTAGACTAAAGAAACAAACCCAGGTAGACTCATGTGTAA
GATAACTTTATATGAAAGAGCAATTGTACATTAAGAAAACATCCCAGCCCAGTCCAGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCCAGTTCCAGATTCCAAGTC
CTGTAAGTCCGATACGACCCCCACAAGGTCCAGTACCAGTCTGTAATCCTCTGCCGATTC
ATGCACACAGGCAATGATGCTAAGTGCAGGAAGATCACAGCCAGTGGATGGAAAGTCTTG
TGGATCCAGTGGTGGTGGAAGCACTTAATGGTGGTGTGGGTCTCCACGTGGCTCCTCTGG
CGCCAGGGCTCTGGCTCCATCAGCGTAACTCCACGTGGCTTGTCAACAGGAATGTCTCTT
GGGGAGTGACTGAGTGTCCTACCTCCAGTGAACCATTTATCTCTTTAGAGCCTCCAAATG
AGGTCATCAAGCTGCGACCTGATTGACAGGGTAAACTCCACCCCTTCACTCTTAATAGTC
TCTAGTTGACAACAGATCATGTAACTACCACACCTCACTAGTGATTCCCTTACTATGGTG
AAGGCAATGTCCAGCTGACTAGCCGGTAGGTTCATAGGTTACATAAGAAACACCTTCTAA
GCTTCTCATTGCTTCTGCACCTTTCGTTTATTTCCATTTTCTCTTCCGGGCCCCTCTTAC
CCTTGGATCTTTGCATTCAGGCAAATGCTGACCATTTCCTAGAGATGATTGTTTCGGTGT
AGTTTTCTGCACCAGCCTATTATTTCGCTGAATGGTGACCTCCAGATGTGATTTCAGTGC
ATAGTGAAAGCAGCGCTTAGCCAGTGTGGCCTATTTTAAGAATCTGCGGGGGGGGGGGAA
TCATTCAGTCTAAGCACCGTGGGTCAGCAAACCCAGATCCCAGAGGCCCCCCACTCTGCA
AGCCAGCCTCTTGCACAAAAGCACTCAGCTTTACTTGCTCTCGGGTTGGGAAGCCCATCC
CTGTTTCAGTCTGGCCCCTGGTTCTGCTGCTGCTCCTCTGATGGAATAGTTGTCACCTGG
ATCCAGGAGGTTCTGTACACAGGGCTTTTGGGTCCAGAGGACATGCTCCACTTCTGGCTT
TTGATGTTAATGAGATCTCCCCCCACCGCTCCCAACAAGAGCCTTGGTGGTGTAGTGGTT
ACGTGTTGAGCTGTGATCCACATGGTCAGCAGTTTGAAACCACCCGCGGCTCCCGGGGAA
AAGATAGAGCTTCTTACTCCCATAAACAGCCTCGGAGTCGGCATTGACTCGATGGCAGTG
AGTTTGGAGTTGTTGCTGCTTCTCAGGGGGGTGCTTTTAGACCCTGATGCCACACCCGGG
AAGCCGCCTCTTAATGGCTCACAGGTGGACCCTATCAGTATCTTCCCCCACCTTCTTACC
CGACCCATGCCGGGTAGAGGTCATTTGGTGAGAGTCAGAGACTTGGGCTGGAAGAAACAC
GCTCCGTAGTTGACTGCCCCTGCACGGGGACTCAGCCCGGACACTTGTCTGCTGATTTCC
GTGGGAGTGCACTCGGGACAAGAGCCAGAAGGTAGAAGCTACTCAAGTATCTGTCACCCT
GCAAACAGATCAGCCTGAGTGAACCCAGAAAACACGTGAGGTGAAGGGAGGCTGACACAC
AGGCCCATGTAGTCACGATGCAATTCTACGTACGGTTCCAAATGGAAACATCCTTCGAGC
AGAGCCGTGGTTTCAGGGGCTGGGAAGGGAGAATGGGGAGTGACAGAGCACATCTTTGTG
ACGATGGCGTGTCCTGGAACTTGGTGGTAGCACAGCCTCAGCATGTGCTACATGCCATTG
GGCAGGGGAGGGAGGGAAAGATGTGACAATGACTTGCCCAAACTGACGTGGGGAAGAAAA
TTGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATACAGCAAGGGG
GAGAGAAGTCAGAAAGCGCTCTCAAGGGGGCCTGGCTGGGCGTACGGAAGCGGAGCCATT
CCGTGCCCTTCCCCCCCATCCTCAGGTGGCAGCAGTTTCGGTCCCTGGCCGATGGCAAGA
AGGCAGCACTGACGTCAGCCCTGAGCATCCAGAACTACCATTTGGAGTGCACGGAGACCC
AGGCCTGGATGCGAGAAAAGACCAAGGTCATCGAGTCCACCCAGGGCCTGGGCAATGACC
TGGCTGGAGTGCTGGCGCTGCAGCGTAAGCTGGCTGGCACCGAGCGGGACCTGGAAGCTA
TTGCCGCCCGGGTGGACGAGCTGACTCGAGAGGCAAATGCCCTGGCCACCGGCCATCCAG
CCCAAGCCCCCGCCATCCATGCCCGCCTCGGAGAGGTGCAAGCCGGCTGGGAGGACCTGA
GGGCCACCATGCGGCGTCGGGAGGAGTCTCTGGGCGAGGCGCGGCGACTGCAGGACTTCC
TGCGCAGCTTGGACGATTTCCAGGCCTGGTTGGGCCGCACGCAGACTGCCGTGGCCTCTG
AAGAAGGGCCAGCCACCCTGCCCGAAGCAGAGGCCCTCCTGGCCCAGCACGCAGCCCTGC
GGGGAGAGGTGGAGCGGGCCCAGAGCGAGTACAGCCGGCTGCGGGCCTTGGGTGAGGAGG
TGACCCGGGACCAGGCCGATCCCCAGTGCCTCTTCTACGGCAGCGACTGGAAGCCCTGGG
GACCGGCTGGGAGGAGCTGGGCCGCATGTGGGAGAGCCGACAAGGCCGCCTGGCCCAGGC
CCACGGCTTCCAGGGGTTCCTGCGTGACGCCCGCCAGGCTGAGGGCGTGCTCAGCAGCCA
GGTGAGAGCCCGGAGATGGGGACCAATTCCCCTCCAGGAAGAAGAGGGGAACCGAATCGA
GGTCCACCTTGACATAAATAGGAGAGTGATGGACCAGGCGGGGGTTCTGCTCAAGGGGGT
AGAGTCTTTGGCGGAACAGAATGCCCAAGGAGAACACGTTAGAAAGCCCCAGGAATGAGA
GGAAGGGGGGGAAAAAGAGGTTGACAAAATTGACTTAGATAGAAGGAGGAATCCTGGCTA
GTCACGTCACGACTGAAACAAAAATAGGAGCCCCAGCCAGCTCCCTTATAACTTTCTGAG
ACTTGTGCCTAGCAGTCAGGCTACCAGAGCCAGCCACCCTCCCTGCCCCTTTTCCAAGCA
GCCTCTGCCACACAGATGCGCCCTCTGGGGAGCTCCTTCCTGAGCCGCTCTCCTCCCGCA
AGGCTGACTTGTGCTTCCAGAAGGGAACTAAACAGCTCCCCTCCCGCCCAGGAATACGTG
CTCTCTCACACGGAGATGCCGGGGACGCTGCAGGCTGCAGACGCGGCCATCAAAAAGCTG
GAGGACTTCATGAGCACCATGGACGCCCACGGGGAGCGGATCCACGGGCTCCTGGAGGCC
GGGCGCCAGCTGGTGTCTGGGGGCAACATCCACGCCGAGAAGATCCAAGAGAAGGCCGGC
TCCATCGAGAGGAGGTATGGTGAGAACAGCGGGCAAGCCCTCGCAAGCAGGAGGGCCTCA
GACAGACTGCTGGGTGGGAAGGAGGGCGGGCAGAAGACCCGTGTGGTTGGCGATGGACAC
CTTCCCCCAAGGCACGCTCCATCCACAGTGGGGGCTAGACCCTGGAATCGGGCTCTTGGG
GGACCCTGTAGGGCTCGGGAGGTGGGCTCCCTACCGTGGGAGGTTGAAGACCTCCGGTGT
TGGTTAGAGGCTCATAACCCTTCTGCAGCCAGTTGGAGGGTTCTCACCACGGGCTGTCTT
CACAGACATCAGAAGAACCAGGAAGCCGCCCAGCAGCTTCTGGGCCGCCTGCGGGACAAT
CGAGAGCAGCAGCACTTCTTACAGGATTGTCAGGAGGTGAGGCCCCACCCGCGTCAGTGC
TGCCAAGCCAGCCCTTTGCCCACAGTGCCACCCCTCTGAGGCCAGATCAGGCCAGCGAGG
CGTTGCCGAGCATACGAGCACCCTTCTTGGCTTCTTCCCACGTGTCCACCATCACCACCC
AGCTTTCCCACTTCTCCCAGATCGCCCTCAAGACACCCCCACCCCCCCACCCTTCTCCTC
CCTCTGACATGCTCTCTGTGTCCTCTGCCTCCTGCTTCCTGCCGGTCCAGCTGAAGCTCT
GGATTGACGAGAAGATGCTGACCGCCCAGGACGTGTCCTATGACGAGGCCCGCAACCTGC
ACACCAAGTGGCAGAAGCACCAGGCCTTCATGGCCGAGCTGGCGGCTAACAAGGACTGGC
TGGACAAAGTGGACAAGGTGAGGGGTGCAACGAGGGCATGGGACGGGGGGCGGAGGGGGC
TTCTTCCAGGTAGGGTCCTGGAGTCATTGATTGTGTGGCCTCTAGTGCCACAGTCCAAGG
GGACAGACGTCTCAGGTCTGTGGGACAATAGGCTCTAGTTCTTCGAGAAAATCCACATCT
CTCAGGGACTAAGCTACAGCTTGGGTGAACACAGACACCGTTCCCGGTTCAAAGCAGGAC
AACAACCTTCAGAAAAAGTCTGTCAGAGGCCTATTAGTCCGTCCTGAATCTGCACGACCA
TGCGGTTTATGCTTCAGCAATCCGGCTCTGATGTCGGAGCACAAAAGCTGCCTTACTCAC
TGCCACCGGGTTGTTTCCTGCCTCATAGCGACCCTTCAGGACAGGGTGGAACTGCCCCTG
AAGGATTCTGAGGCTGTCACTCTGTATGGGAGTAGAAAGCCTCATCTTTCTCCCTCCGAG
CTGTTGGTTTCGAACTGCTGACCTTGTGGTTAGCAGCCCATCGAGGTCCCCACTACATCC
CCAGGGCCCCCGACAGCAATCGAAGATGACACACAAACAAATGAGCTTGGCTGTGTGCCA
ATAAAACTTTATTGACAAAAAAAAAAAACGGGCAGGGGCCTGGGTTCCGCCCCCAGGCCC
TAGTGTGGAATTCCCTGGCTGTTATTGAGATGAGGTTTGAGCTAGACCTGGCCGGGGGAG
CTGGGTTCAGGTCAGCGATGAAGTGGGACAGTTTAGAAGGGACTGTGAAGAGAGAGTGGT
GATGAGAACACACGGGACTTGGAATAATTGCCCTCACTTAGATCCCTGAGGAGCCCTGGT
GGGGTAGTGGTTACACATTCGGCCGGGATCTGCATGGTCAGCAGTTGGAAACCCACCAGG
GTGAAAGATGGGGCCTTTCTACTCCTGGAACAGTTAAAAACTCGGAAACTCAAGGGGGCT
TTAAAATCATCACTTTGACTCCCTGGGAATAAACTAATTTGGGGGGGTGGGGGCCCCTGG
GGCCATGGTCGGGGTATCCAGTTAGGGGGTTCCAAATCTGGCNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCTGCTCTGCCCTGGACAGCTGGAT
GGAGAGCCTGCAGGCCCAGCTGCGCTCTGACGACCATGGCAGGGACCTCACCAGCGTCAA
CATTCTGCTCAAGAAGCAGCAGGTGTGTGTCGTAGGCCTGTGACGGGGGTAGCGGGGAGC
CGAGGGAGGAGGGCGAGGGAGGAGGGAGCAGTGGCTCTTGAGACGGCAGTTAGTATCTTT
ACTGGTGTGTCCCAAGGGACAGCTGCTCCCAGTATTTAAAATGCCAGAAGAGCCACACGT
GCTGGAAAGGTTCCAGTGGAGCCTCCAGAATGACAGTGAAAACCGCCGAATAGCAGCGGA
ACTTTGTCTGACATGGTACCAGCAGAGGGAGGAGTCCCTCAGGTTGGGAGACACTCAGCG
TAAGACTGGGGAAGAGACTTGACCTTTAAGATGTTGGCAGAGTAAAGCTTTCAGGTCCTT
CCTCTGCGGGTGGGACACAATGCAGAAAGAAGAAAACGGCTGCAAGCATCCGTCAGTAAT
TGGAATGTGGAACGGACGAAGTATGAACCTCGGAAAACTGACATTGACAGAAATCAAATA
GAGCACTTGATGATCAATAGCTGAGGCACTTGCAAGCCGGAACAGACCGGAATACCAAAA
TGTTGAGTCAGACAATGCGTAGCATACTGTGGCAGGAATGGCCGAGTGAAGGAGTAGCAT
TGCATTCATCGTCACAAAGAACATTTCAAGGTCTCTGCCGTTTACATGAATAGCAATGAG
TACAAGGAGGAAGAAGATGTTCTAGAATTGAATGTGGCGATTATCACACAAGTCTTTTTA
ATGTGATTGAATTCTTGAATTGTGTAACGTGGACGAAGGGTTAATAAAGCTGTCTTTTAA
AAATCGTAACCAAAAGACAGCCCTGTCAGTTGCTAGAAGACTAGCCACATGCCTACAAGG
GAAGCCAGTTCATAGGACTGTCATTTCATTTTTACACACCAACCACTCCTGCCAAGATGA
AGGAATTAGAGATTCTAACCAAATTCCACCATCTGAAATTGATCACACTTGGAATTGAGG
AGCCCCGGGGGCGCCGTTTCTTACACGTTGGGATGCCAGCCACAGGATGCATTGGCGCTT
ACGGTGATGGAAATGTGAGCGTTGGAAACAGGAGGATGCTGATAGGATGTCGTGATAAAA
ATCTGGCGAGTTGGAGTCCGTGGTGGAATTTTGCGAGATCAACAACTTGTCGCAACTTCC
ACAACAACTATAACCACGGACCTCGCTGAAAGCCAAGCATCAAATGGACTACATCTGTGG
AAAGTTGACAGAGAAGCTCAGTGTCATCAGTCAGACAAGGCCAAGCCTGGGCCCCCTGCA
GAATAGAGCACTCGTTGCTCACCTGTCAGTTCAAGGTGAAGGTGAGGGAAATTAACTTCC
TGTGAGTCAAGTCCAACATTGAGTATATTCCACCCAAATTTAGAGACCATCTCCAGGATG
AATCTGATGCTCTGAACACCAATTACTAAAGACCAACCGATGTCTGGGATCACATCAAAG
ATACCATATGTGTAGAATGCAAGCGGTCATTATAAAGACAGGAAAGACCAAACTAAGTAG
CAGACGAGACTGAAATAGCTTCTTGAATGAGACGTAGCTAAAGCAATGAAAAGATGGAGT
AAAAGAAGACTTCGAAGGAAGCTTGAAATAAAAGTAAAGCTTGATAAGGAAATGTCCAAA
AGTCTGAAATTCAAAAACCAAAAGGGAAGAGCATGCTTCGCATTTCTCAGGTTGGAAAAC
TCAGGCCGACCATTGCCGTATGGAAGATTCTGAGACAAAACACAGAAAGACGCAGGAAGC
AGCAAAAGAAGATGGGAGGGACACACAGTCGCTCTACCAAGATGAGTTGGCCCGTGTTTA
ACCATTTCTGGAGATACCGTGGCCGGAGAACCAATGGTTTTGAAGGAGGACGTTCAAGCT
GCACTGAAAATAACGGTGAAAAAACAAGGCTCCAAGAATTCATCGAATACAAGTTGAAAG
GTTTCAACAAATGAATACAGTACTAGACGTGCCCACTTGCTTATGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACACACAAGTAAATTTTACTGAA
GATGATTCAAAAGCAATGCAGCGGGTACACTGCCAAGGGAGCTGCCAGAAATTCAAAGCA
GATTCAGAAGAAGGATGTTGGATGAGGATTTTCTTGCTGATAATAGATCTATCTATTTGG
CTGAAAGCAGAGAATGCAAAGAAAGCATGTTTCCCTGTATTCTGTTGACTACGCAAAGGC
ATCTGACTGTGTGCATCCTAACAAATGATGCATAGCATTGGGAGGAGTTGCAGTTCCACA
GCACGCACTTGCGCCCCTGCAAAACATGTACACAGAGCACGTGGCTGGTAGCAGCCATTC
CAGCAGAACAAGGGAGAAACTGTGGTTTAAAGTCCGGGAAGGTGTGTGTCAAGTTGTATC
CTTTCACCGTACTTGTTCACTCTGTGCTGAGCAAATAAGCTGAGAAGCTGGACGAAGATC
TTCGAAGAAGAGGGTGGTGTCAGGATTGAAGGACGACCCCTTAACAGCTCACAAAATGTA
GACAACCCAGCCGTGCCTGTAGAAAGCCAAGACCTCTTGAAGGACTTGCTGAGAGATCAA
AGATTTCAGTATGAGGTCCACTTCCACGTTGACATAGATACAAATCACAGCATCGTGGAA
TAAAACATGGACATCAAGGAGTTCGTTTATTTTACTCGCATCCAGAATCGACATTCACCA
AAGCAGCAGTCCGGAAATCAATCAGTGTGTTGCGCTGGGCAAATATGCCGCGGAAAACAT
CTTGAAAGTGTGAAAAAGCAGAACTTTTGAGAACTGCAGCGTGCCCGGCCTGAGCCGGGG
TATTTTCAATTGCTTCATCTGTACAGAAGCTGGACAAAGAATGGCTGCCTTCTGAGTCAC
GGTGTGGGCCGCCAGAGAAACGTGTCTGTGCTTGAGCTGTCCAGCCATCATGCTCCTTGA
AGCAAGGATGACAAGACCGCCTAGACGGGTCCTCAGGAGGGCCCAGTCCCTGGAGGAGAA
CCTCAGGCTGGGGGAGGAAGGAAGCTCTCCAGGAGATGCTGCAACAACGGGCTGGAAGCG
CAGTAGCAGCGATCGCAAGGCTGGCGAGGAGCGGGCGGTGTTTGGCTCTGTGTGTGTACG
GTCACAATGAGTGAGAACGCCCACAGCCCGAGTTAGAATTGACCTCACAGCTGCAGCATT
GGATAGTAAAAAGTCAGAAGAAAGATTACATCAAAGGATTTGTGAAACTCTGAAGCAGGG
GTCAACCCACTTTTGCTGTAAATTCCAGGTAGTAAACATCTTGGGCTTATTGGGGGGGTG
GGGGGGGCGTCACTATCGTCGTCATGTGAAAGCAGCCGTCAGTGATACCAAAGTGGGCGG
ATATGGGGGCTTCACCGTGAAGCTCAACACACAAGCACCAGCACCGGCATTCTTACGTGA
GAGAATGGGCAGTAAAGCTTGATTTACAAAAATATTTTTGGCCCAAATAAAATTTGATTA
GCAAAAGTAGGCCTTCGGCTGGTTGTCAGCTCCTGCTCTGAAAGACAACAACCACAGGGA
GCAGCTACTGCCTCAGGGCTGAGGGAAGGCCACCGGGCAAGAAGCCGCTTGGAAGATGCC
CTATGCCCACCTGAAGGCAGGCAGGGCAGAGGGCTGATGGTGGGTCTGGAGCTGGCGAGC
CAGAGCTGGCAGGCAGCAAATATCTGCCTAGTGCCAGCAAACGTTGCTGGAGGCGGTGGC
AGCTCCAGGAACCAGAAGGAAAGGCATGCTGTCGCTCCATCGCCCTCTGCTGACGAGACC
TAGCGCCGCACCAGCCGGTGGAGGAGAAACGTGTACCCGGACAAAGGAGGGTGGATCTGG
AATTGGGGGTAATGAATGGACAACTAGCGTGGTCGGCAGTTTGAAACTGCCAGCCACTCC
GTGGGAGAAAGATGGGACTTTCTATTCCTGGAAAGAGTGACAGTCTCAGAATTCCATGGG
AGCAGTTCTACCATGTCCTATAGGGCCACCAGGAGTTGGATCAACTGGATGGCAGTGAGA
GGCTGGGTGGAACATGGGACCCTGCATTATTAACAACATGCCCCCCTGAGCTGCTTACGT
AGAGCTCTGGGCTGCGAGGGGATGAGATCCTGTGGGATGAGGTGGTTACCCTTGGAGATC
AGGAATCCAGATCTATGAGCGTGGAGCTAACCCACACCCCCACCCTGGGCTGGCAGATGC
TGGAACGGGAGATGGCGGTACGAGAGAAGGAGGTGGAGGCAATCCAGACCCAGGCGAAAG
CCCTGGCACAGGAAGACCGCGGTGCAGGGGAGGTGGAGAGGACCTCTCGGGCTGTGGAGG
AGAAGTTCAGGTCCCTGTGCCAGCCGATGAAGGAGCGCTGCCAGCACCTGCAGGCCTCTC
GCGAGCAGCACCAGTTCCACCGGGACGTGGAGGATGAGATTGTGAGTGGTGGGGCCCTGG
GCCCTGGGAGCAGGCGGGGCCTTCATTCCAGGCTTGGTCCCTGGTTAGTATTCTGTGCCC
ACCTGTCTCTCGTGAGATCGGGGCGCACCCCTCTGCTTCCTTTTCCCTGAACCATACCAG
GGCTGGTCCTTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNACAGACAGCAGTATGAGAGCGAGCAGTGCAGTAGGAGTG
TGCTGCAGACATAGAGCTCAGAAGTGCTCATGAGCACTGAGACATCTTATGCCCGACTTC
ACTACTCTAGAGAAGGACATGCTGAGCACTTACTGCAGACAGTAGTCGTAGACTAGGACA
GCAGCGAGCTCCTGTGGTTGTCCCACTGATAGAGACAGATCTGGAGGTGCGTGTGTCGGC
AACAAAGCACAATCTGACGAGAGTCTAGTGTCATGTGGAACGGTGGTGCTTCTCGTGGTT
GCAAAGTGGTTTGACCTGGCAGTTACGCTTTCCTTGTGTGTTTACGTCTTTGGGGATAGT
GCTGCACGCCACGCAGGTTTAAAGATGATTCTCATCTTCATTGGGTGGGGGTGGGACAAA
GGGACAGTGAGGAGAGGAGTAAGGAAAGGGCCTCTCAGAACAAGCAGAGTGCAGACAAAA
TGGGTGAGCCTCGGGTACAGACTACACCTCCTCCCCTTTTTGGTATTGGGTTGGGTAAAA
GGAAAGAAGAAACACGTATGAGGTTAAGTCTCCAAATAATGCTGTGTGGGAGGACAAGCC
AGCGGGGAGAGTTGGTTGTTCTAAGTTTTTGGATGCAAAAATGATGTTTTCTGAACCTCC
CCCTAATTCACAAAAGTTAATTTTTAAGAAGGGAAGTATTCCCACTCAGGTTCCAGTTTA
CACACGCACTGTTTTACCGCAAAGTGTGTCTGCTCCCTTTCTTGTGCCCTTTTAAGGTTG
CTGCGGTACTTTAAGAGGCTAACACAGAAGGGTAAAGCAAGTCTCCATTAAACCCAGAGA
TGAGGTCGGCAGAACTCCTCTTTGGATCCTGTCTGGAGTCACAACTGAAAAAAACGGGGG
AAATGTGTCTGATACAAATTCTGTCTGTAATATACTTGTCTTCGTCTTGATGGGGATTGC
CTGCCAAACAGTGCCCTCTGATGGAGGCTGCTGACTTGTGTCACTTCAAGCAGAAGTCAT
TCCAGTGACTTGCTTTGGAGATTCCCAAGGGTAATCTTGATCATTTTTCCTAAAGGACAC
AGTAGGGTCATGGAGGCTTATTATTGAAGAAAATAGGGGAAAGGCCAAGAAGTTGAGCAA
TTTATTTATTTATTTTTCATCATGAACATGCTGTGCCTTGCTTTCTTTGAGGGTGGGTGG
CAAGGGCTGTTTTCCAGAAGTTGTGTTGGGATTCTCTTGCGCATCCACCCGATATCCTTG
ATCTTGCCCTTTAGGGCTTCTATCTGTTCTCACATGTAGAGAATGTGTTAAGGAGCACAA
CTTGAGTCTGTGTCGTATGTCAGATTCTCATTTGAAGAGCACAAGATGCTGCATGTAGCG
TGAGAGGTGTAAGGCTGCTCTGAGTGTAGAGATCAGATAGAGCTATGTCAGACAGACTNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCCGACTAC
GCACAGACCATCCACCAGCTGGCGGCCAACAGCCACGGACTTGATTGATCATGAGCACCC
AGAGAGGTGGGCAGCCTGAGGGCACCTAGGGAGGGGAGAGCGGGCGGCACCAGGAGGCGT
CTGCACCACCCGTACAGAACCCCCTGGAAAGTCAGCCAGGAGGGGCTGCAGTCTTATAGT
TCCCCAGTGACATACACAAGTGGGTGGCTCTGACCAGCGGAAAGTTATTTTCTCATAGGT
GAGGAGGTGAGAAGTCTGAACTCAGGGCACTGGCTCTGGGAAAAGGTCTCTTTCTTTTCA
GCTTCTGTGTCATCTGCCTTCCCCAACCTCCGCTCTCTCGCTTAACCAGCCAGCCATCGA
GTCACTATCGACTCAGAGCGACCCTGAGGACGGGGGAGAACTGTCCCTGTGTTTCCAGGA
CTGTAACCATGTTCAGGAGTAGAGAGCCCCATCTGGTCCCAGCACATAACCATTCCCCCC
CTCTGGGCTCCCGCTGAGTCAGTGCTCTTACATCTCAGAGGAGATGGACTCCCAAGGCAT
CCTGCACGAATACGGCCTGGTCCCAGACGAGATTATAACCCCAGATACCACGGGGTTTCC
CGCAGGGCTCTCTGGATCAGGCAGGCTCCAGGGCCATGTCCTGAGGCCAGCGGCCCCCCT
CCTCTGCCCGCAGCACGCGGCTCTCCATCCGCCAAGCCCAGGTGGACAAGCTGTATGCCA
GCCTGAAGGAGCTGGCAGGGGAGCGGCGGGAGCGCCTGCAGGAGCACCTCCGGCTCTGCC
AGCTGCGCAGAGAGTTGGACGACCTCGAGCAGTGGATCCAGGAGCGCGAGGTGGTGGCCG
CCTCCCACGAGCTGGGCCAGGACTTCGAGCATGTGACTGTGAGTTGTGTGGAGGACGCCT
GGATGGCAGCCGCCCGAGTGGAGAACACCTGGGCACGAGGCCGATGCCAAGCAGGCTGTC
TCCTCCAAGGTGTGGAGGGAGGACCCTCGGCTGAGCATAGCAGGGCAAAGGGGAGTTCCC
AAACCCTCTTCGTCATCTGTACCCAATAGGGCAGTGTGGGGAGGCGATGACATGGTTGGC
GCCCTGCCACAGTGTGGGGTCTTGTTGTCTGGAAGCTGAAAGTCCAAGTACCCCAGAAGG
TTTGCCAAAGCTGCAGTGCCCTGGGAACAGCTACATCAGCTGCGTAAATTTAGCCTTGTA
GGGGAAACCCTTTGGACTCAGGTGACTCAGGAAAGGCAGCTGGCTAGCAGTCTGAGCTGA
GCGCATTCGGTCTCTCGTCTCAGGCTCACAGCATCATCTCGTGTCACGTCCTTTACTTCA
CCCCACTCTCTGCACACTCTCCCTGCCACCAGATGCTCCAGGACAAATTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCTGCAGGGAAGCTCGCCGCCCGCCGCCAGCTGCTGCTGGACACCACAGA
CAAGTTCCGCTTCTTCAAGGCCGTCCGCGAGCTCATGCTGTGGATGGACGGCGTCCACTG
CGGATGGACGCCCAGGAGCGGCCCCGGTGAGTCCACCGGGCCAGCCGCACCCAGGGCTGC
GGCCAGGCTGTGGGCAGCGTGTGACTTCATGTCTGTATCCCCTCAGGGACGTGTCCTCGG
CAGACCTGGTCATCAAGAACCACCAGGGCATTAAGGCCGAGATCGAGGCCCGGGCAGACA
GCTTCTCCACCTGCAGCACCATGGGCCAGGAGCTGCTTGCCAGGGGCCACTATGCGGCAG
AAGAGGTAAGCAAGGGGGCCGTCCTCCCCTGGAGGGCTTCAAGGGGCCTGCACAGTCCAT
CTGTCCTGCTCGTCCCTCGCTCTCTGACCCCTCAACACTATTTGGGAAGTTCCCACCATT
TCCCCACAACCTGGTGATCTTGGTAGATCCCGCTTCTGAGCCCCCCGCCCACACCCCGCT
GGGTTGACTCCCACCTCTGCCTGCAGATCTCCGAGAAGCTTTCTCAGCTGCAGGCCCGGC
GCCAGGAGACAGCCGACAAGTGGCAAGAGAAGGTGGCCTGGCTCCAGCTTGGTGAGCTGC
TGTGTCCTGCGTCCAGGGATCCTGGGGGGGCGGAGGGGTCTGGGAGAGAAGCTCATATCC
TGCAGGCTCCAGGGCCAAGGAAGCCAGGAATCCTGGCACTCTGGGCACTGGCACTGCTCC
CCCTGGAGGTGGCCAGGGGCGGCGGCGCCCACCCTAACCTGGCCTCGCCCTGCCCCACCC
CCGCAGTTCTGGAGGTGCTGGTGTTTGGCAGAGACGCTGGTGTGGCGGAGGCCTGGCTGT
GCAGCCAGGAGCCGCTGGTGCGCAGCGCAGAGCTGGGCTGCACAGTCGACGAGGTGGAGA
GTCTCATCAAGCGCCACGAGGCTTTCCAGAAGTCCGCGGTGGCCTGGGAAGAGCGCTTCA
GCGCCCTGGAGAAGCTTACCACGGTGAGGGGTCTGGCCCGCAGCCCAGTGCGCTGGGCAC
ACTCGGAGCACCTTCTAGTGGCTAGGGTGGGCACTCACCCCATGCCCCCACCCAGATTGC
TGAGACCTGACCCCAGTACGCTCTTCCTTCTGAGTCCTGGTCTCCATCCTGCCCATCTTG
CCCTGCCTTCCCCAGGCTCTGGGCCTCTAGAGCATGACCTTCTGTGTTCTGACCAAGGAG
TGGCACCTTGGCTAAAGCGCTCGGCTGCCGACTGCTGTGAGGGGGAAAGCCATGGCAGCC
CGGGTCTGGCGGTGTCAGCCTCGGGAACCCCACGGGGCAGTGCTGCTCAGGCCTACAAGA
TGCTGTGGGTGCAGCCCAGTGGGTTCGGCTTGCCCTCTGATCTCGGCTCTCTGGGCAGCT
GGAGGAGCAGGAGAAGGCGAGGAGAAGAAAGGAGGAGGAGGAAGAGCGGAAGAGACAGCC
CCCTGCTCCTGAGCCCACGGCCACACAGCCAGAAGCGGACCTGGTGGACGGCCAGACGGC
TCCTGACGCTGCCTGGGACGGGTGAGCGCCGGGCTGACATGGGGGAAGACAGGGCTGATC
CCAACCCACCCGGGATCGATTGTTCTGAGCCCCTTCCACCATTCCAGGGCCCACCCACGG
CCGCCGTCATCCACGCCCACCGTCAACGGGGTCTGCACGGATTTCTGAGTCCTCTCAGTA
ACTCCTCCTGGGGCTGGGGGCTCAGCGGAGACCCGGTCTCAGAGCAGTCTCTGATGCTTG
CTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGCA
AGGCGCCCCGCCCACAGGGCCCGGGGCAGGAGGGTGAGGGTCAGGGCTGTCAGCTGGAGT
CTGTCCATCCAGAGGGAGTGGGGACAGGGGCCGTGACCATTGGAGCAAGACCGGCCAGAG
GGGAAGGCTGACGGTTGGAAAAGCTCATTTCCAGCTGGGGACTATGAGCCCCCTAGACCC
CTAAAGGTGAGGGCGGCTCAGTCCTTGGCAGCTCTTCTTAAAGGGCTTCTGCGTGGAATC
TGAAAAAAGGCGTAAAACCTGCCTGCACTGTGCTGGGGCTGCCACCAGGAGTCCCCTCAG
CCTGATGCCCGGGGCGGGGGGACCAGGATACTCTAGCCACCCCAGAGGGGGTGGCAAACC
CCGACTGCCAGCTCTGCTCTGAGGCCTTTCTCACTACCCCCCTCCCCAGCTTACAGGATG
GAAAAGAGTACCTATTCCAGGCCAAGGATGAGGTGAGCAACCCCCCTCTCCCTGGGCCCC
CAAAGAACTCACTGCTCAGACTCCCCTTGCCACTTGCTCCTCTCTTCCTCCAAGTCTCAC
CCCTGTAACAAGGTAGCCCAGGATGCTGTTTGGAGTGTCCCCCACCCCCACCCCAAAGCA
TGCTCCCCATTCTCCAGGTCCTTTTCTATCAGGAGAACAGAGTCCCATAGTGTCTCTGCC
CCCCCTTTCTCTCCCCACATACCCACCATCTGCCTGCCTGCTGCCCTGCACAGCTGCCCC
AGGGCTGATGGGGCCTCCTTCCACCCACCTTGCAGGCAGAGATGAGCTCGTGGCTGCGGG
TGGTGAACGCAGCCATTGCCACCGCGTCCTCTGCCTCTGGAGAGCATGAAGATCCAGTGG
TGTCCAGTGCCAGCCGGGGCATGACCCGGGCCATGACCATGCCCCCAGTGCCAGCGGTCG
GAGCTGAGGGGCCCGTGGTGCTCCGCAGCAAGGACGGCAGAGAACGAGAGCGGGAAAAGC
GCTTCAGCTTCTTCAAAAAGAACAAGTAGTTGGGGGCCAAACTCCCAGGACAGCTCCCTC
CCTCTGCTGGGGAAACTGCCAGGGACTGTCGACAGGGACCACCCTCTTGTCAGGACAACT
GCCTGCTGCTAGGGTCCTTTGCCAAGGCCAACCCATCACCAGGAACTGTCATGGGGACTC
TTCAGAGTCTCCCAGGGCAGTCCTTCTGCTATTTAATTCCAGACTGGTGGTGGGCCCCAG
GCAAGCCCCAGTTCCACTCCCCACCTTTATTTCGTCCTTCGCCCCCCCCCCCCCAGCCTT
GTGCCTCTACCACCCACCACAGTGCGGACAGCACCCTCAACACGGGCCACGTGGGGACTG
GCTGCCCTGCCTCAGGGTCGTTCTTCCAACACAGCGAGGGCACTCCTCCTGGGGCTCCGC
TCCTGGGGGCCAGTCGGGAACCTCTCAGAGCCAAAGCAGGACCTGGGGGCAAGTGTGCCG
GAGTCCGATGCCGAAGCCCTCCCTCCCCGTCCTGTCCTCATCCTCTGCCCCGAGTGGCCA
CTCCACCTCCAGTCACTCAACGGCTTCCAGGTGGGAGTCGCCCAGGGGCAACACACAGCC
TTGAGTTTGGCCAAGGAGGTGATTAAACAGCTCAGCTTCTCTTCTTGACTCCAGGTGTCC
TTCCTGCCAACGACCAGGGACTCCCCTTTGGCTCCAGTTTTGCATGTCATTTTCTGCTCT
GCCCGCAGCCTCCAGGCCCTCAGACCACCTCCCTGTTTTGGACTCCTGTCCACATGACGA
TGACCCCCTTTTCTGGGTTGATCAGGTCCCAGCATCTTCTTAGATCAAACAAGTTCCATA
CAGGTCGGGAGACTGCCCGCAAGCAGTGTTAATGCTGACAAAAAGCACTCGACTGCTGCT
TCCTGTGTGCACAACTTTCTTCACACTAGAGCCTCCACTGTTTTCGAAAATGAACCCCAA
AAACCCGGCTCCTCTACTGTTCAGTAGTGTTCAGTGTGCACATCCTCCTGGGTGTAAGGC
AGCAAGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1150, 1560..1733, 4599..4690, 6030..6110, 6274..6389, 7929..8041, 8175..8362, 10154..10271, 10919..11077, 11397..11699, 12849..13002, 13165..14035, 15742..15820, 15822..15840, 15842..15881, 18520..19126, 19129..19275, 19746..19948, 20240..20330, 20585..20731, 21793..22056, 26531..26755, 45616..45705, 45806..46066, 46167..46224, 46327..46369, 46371..46400, 47008..47212, 48284..48658, 49238..49357, 49360..49452, 49455..49480, 49561..49699, 49901..49985, 50181..50377, 50773..50915, 51002..51059, 51061..51072, 51740..51790, 51891..52111, 52212..52385, 53404..53446, 53750..53983
1001..1150, 1560..1733, 4599..4690, 6030..6110, 6274..6389, 7929..8041, 8175..8362, 10154..10271, 10919..11077, 11397..11699, 12849..13002, 13165..14035, 15742..15820, 15822..15840, 15842..15881, 18520..19126, 19129..19275, 19746..19948, 20240..20330, 20585..20731, 21793..22056, 26531..26755, 45616..45705, 45806..46066, 46167..46224, 46327..46369, 46371..46400, 47008..47212, 48284..48658, 49238..49357, 49360..49452, 49455..49480, 49561..49699, 49901..49985, 50181..50377, 50773..50915, 51002..51059, 51061..51072, 51740..51790, 51891..52111, 52212..52385, 53404..53446, 53750..53980
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved