Echinops_telfairi Locus RPL4
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RPL4
Echinops_telfairi
RPL4
GeneScaffold_6602
SNORD16, SNORD18
3559..3657, 4040..4111
7532
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTTCGGCTTCTCCACAAAGTTAAAGTT
TTGTTTTAGCCGCGATTCGGGGGGACTTTTCAATAATTTTTTATTTCTCTCAGGAATTTA
AAAATAAATAAATAAACGTCGTGATCCGAGGCAAGACATTTAGTCTCGCGAGATTTGACC
ACGCCCCGCTGTGAATTACTCCGCCAAAAGGAGTCCCTCTTTTCTAAACAGTATTACAGG
CTTCAGAAGGCAAAGAGCACCATAATTTGACTCATATAAAGACCAACACGCGGGTTGAAC
TTCATACAGTGTGCTTGGGATGTGGTTTGCTTCCCTGGGCTCGGGCTGGGGCGGAGCAGG
GTGGTGCGAGATGAAGGTTACATATAGAGCAGGAGTACTACGTCCTTCCTTTTCCTGTGG
GAGCCGCCGGGGCGAGAGGAGCGTGGCCTTCTCTCTTCAGCATGGTGAGTGAACGTCCGT
CTGCTTGGTTTTCCCAGCTTGGTCCCGGAGCCCAGCCGGGAAGGGTTTGGTGTTCAAGAC
AGAGTTACGGGGAGAGAGCGAGGGGAGACGGACTGATGCCGAAAGGCCGTCGCTTTCTCA
AGGCTGTGTGGCGGACGGCGGCCATCTTAGCGGCAACGTGGGCATCCCGGCCCGCAGCTC
TGGGGCGCCAGCGCGGGGGCTGCCGATCGTTCCGGAAGGCACAGGGCCCATTGGGATTCT
TGTCCTTGGCGCACAGAGAACTCGGGTTGTGTTGAAAAGACAGCCCTTGAGCTTAGTTTA
GAACTAGTTGGAGCCCAAGAATCGGGACATGGGTCTGCAGGGGAGGTAGAATCTGGGCCT
TGTATTCTAATGTGCTAGCTTATTAAGGATGTTTTGTGCCATCCGGAAGTTAACGCTTTT
GAAAAATGACCTGGGTCTCTGCCTTTTTCGTACGTTTACTTGAATGATTTGGTGGGGGTT
GCCCACGTTAAAAATAGCTCCGTGCATTTTGTGCGCTGGGGAGGTTCAGTGAGGAAAATG
GACAGAGAACCGTTTTTAGGGTACCTGAATTGTAATGGAATTGGACAGAACACTGAGTGC
TCTCAACTTAAAGAACCAGCAGGCAGTTGGCAATATTTTAGCAGCCTAGAAGTTCAGGGA
AGTGCCCTGAGTAAGGCCAATGATCTTGAGGGGGAAGCCTTGTGCTAGGTGATGGTTCTG
AGAGTAGGGGTGAGGAAATCGGGAAGGCCATGTGCGTGACAAGGAATCACAGGTAAAAAG
CAGCCTGTGTGGGCCTGTAGGCCACTTCTGGACCTTCCCATCTAAGAGTGTAAACTCTTA
GGGAGTCGAGCAGAGAACCCTAACATGACTGATTTTTTTTTTTAAGTCATTAGTGTAGTA
AACTTTGGAAGGTGTGTGCAGAAGGGAAGGGGTGAAGGCAGACATGGGATTTTGGATGAG
TAGAGCCTTGGTAGGCAAGACTACAGAGAGGATGTGGTGACATCAAGCAGTTTTCCATTT
TTTACAGTGGTGGTGTCAGCATCGTGCTGCATAAGAACTTGGGTGATAGACCATCGGAAA
GTAATGAGACCGGGTTTAAGTTGTCGTGTGTAAATTAGCAGGTTGGACCTGATGCTGTTA
TGTTAAAAGAGTTTGGGAATAGTTGTATCCAAGATACTAAATGTAATCTTGGGCCATACT
GGCCCTGGGCCATTAATCTGGAGGGTGTTAGGTTTTTAAGGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTAGAGTCCGGGGTGGTGGGACACACCGTT
CTGGCCAAGGTGCTTTTGGAAATGTATCCTTGTGGAATTTAGCCAACAGACCCTTACTGG
GCATAACAGTGTCCATGTTAACAGACGGTTCAGCACAGGTTTGGAATCTGGGGATGGTTA
CTTCTACGGCAGTTCTTTTTGCAATGATGGCGTAATTTGCGTCTGACTCTGTTCTCAGCG
ACAGTTGCCTGCTGTCACTAGGCTGGTACAGAAGGTTGACGGAAATTCTTACTGAGCAAG
ACATACATGGGTTGGTTTTTTTTAACCTTAAATCTTGAGGTATGTGATTCTTAACCGGGA
AAAATAGATGTGTCGTGGAGGTCGCATGTTTGCACCAACCAAAACCTGGCGCCGTTGGCA
TCGGAGAGTGAACACCACTCAGAAGCGCTATGCCATCTGTTCGGCCCTGGCTGCCTCTGC
CTTGCCCGCCCTCGTCATGTCTAAAGGTTTGTGATAGTGGGCTTCGTAGGAGTTGGGCAA
AACTTTTCCTGTGCGTTTTTGTGACTGCCTTGTTCTGTGAGTTGCCTAATTTACCTCAAC
AAACCAGAGACTACAGCAGATAACAGTGACCTGGTCCGTCATTACAACATTTCTACTTAA
ACCCCATGTTTATTTTGCTGCTGAAATGATGAAATGCCACTTCGTTGGTCCGTGTTTCTG
AAACACATGATCTTAGTGGAAGTTCTGATTTAACAAGTTTTCGCGTGTGCTTTGTGCAGG
TTATATAAAGTAACCTGTCATAAATGGTTTCTTAATTTTTTCAAAAGGTTCAGGGTAACC
AGTGTTGAATTGGCTTTGCCAGGTCATCGCATTGAGGAAGTTCCTGAACTTCCTTTGGTG
GTCGAAGACAAAGTAGAAGGCTACAAGAAGACCAAAGAGGCAGTCTTGCTTCTTAAGAAA
TTGAAGGCCTGGAATGATATCAAGAAGGTAGGCTGGTAGGGTGCGGGGGTCAATATAATG
GCTCAATTGCTATAGCTCATCTTAAAGGCTATGTGGGGGTGCTCTAAAATTGATGTGGAG
GTGACTACAATTCTTGATATGACTGAAATATTGAATTACATGGTATGTAAGTCACATGCC
ATTAAAGCAGGGTGAAGGTAGGCTCGAGGGACACATTGACGGTTTAGTGATCCTTGTTTT
CCCATCTCTTACTTCACGTGATTCATTGAATAAGGGCAAGAGTTCTGAGCCAAAGTGATT
GGGCTTAAGTCCTGTGAGTGACCTTGGCAAGTACTTTGTTTTAGCTGTAGAACTGAGCAT
GTCCACTACAAAGGGTGTGTGTCTTCATCAGAATACAAAATCTTTTGCTTCGTTAGGTCT
ATGCCTCTCAGAGAATGAGAGCGGGCAAGGGCAAAATGAGAAACCGTCGGCGGATCCAGC
GCAGGGGACCATGCATTATCTACAACGAAGACAATGGCATCGTCAAGGCCTTCAGGAACA
TACCCCGGTAAGTCTAGTTTCACTTGTCCGTATAGGCTGTCNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGAAAAGCCCTAGGAATTCAAAGAGCCCTTCCGAGCACCCCGGGTTCGATCTAACAGGG
TAATTCTGTGACCCAGTTCCACATTATTTTGTTTTAAATTGGGACAATTGGCAGGGATCA
GTCTATCTTAGAAGCAAAGTAAACTTGCTTTTCTGCCTGTGTTCTACAGCAAGAAGATTC
ATCGCCAGAGTCCTGAAGAAGAACCCACTGAAGAACCCTGAGGATTATGTTGAAGCTCAA
TCCATATGCAAAGACCATGCGCAGGAACACCATTCTCCGGCAAGCCCGCAATGTACGTGA
TTACTTAATTACAGGTAATGCCCACATTTTGGGAAAAGATTGCAGTCTTAAGGTTTCTTT
CTCCTTTTTGACAGCACAAGCTCAGGGTGGCTAAGGCGGAAGCAGCATTAGGGGTCAAGT
CAGATGAGAAGGGAGTTCCCCGCCAGAAGCCCCTGGTGGGGAAGAAAGGAGGCAAGAAAG
CCGCTGTGGTGAAGAAGCTGAAGAAGCCTGTGGCAGGAAAGAAGGCCGCAGCTAGCAAGA
AGCCCGCGGCCGAGAAGAAGCCTGCCCCCGAAGAAAAGAAGCCAGCTGCATGAACACTTG
TTTTATGCCCTGGGAAGTTGTCTTTTGGACAGCTTATTTTGAATAAAGACCTGCTTGAAA
CAACAGTGGGAAATACTGTTGAGTGTTGAGTTTTTGTTCATATGTAAAGTGCTTGTCCAA
TTTCAGCCCTTTGTTTTGGTTTTATATCAATACCAAGTAGAGCCTTAGGGGTGTCGTGTT
TTAATAGGTGTGAAACACTTGCTCTGAAAGAGATTAAAGGGAGGTCTGTGTGACATTTTC
GAATTCTGTATGGGCTTCACACGTGACCACAAGAGGGCACATGGGTGGAAATATATTTAG
GAGCTCCAGTGGAAAACTGGTGCTGCTTCTGAGACTCCTTAAAATAATGCAGAACTTACC
TGGAATGGACCAGGGTAGAACTAGCTTTCCCCGGAACCACTAGGGCCCACAGCTTTAGTA
ACGTGAGTGTTGAGTACAAGCTTGCACCAAATCTACCTGCCTCTGCTCTGCGAAGGCTGG
CTTCAGGGGTGTTGGGGGACTGAATTACACTGCGGAGGACCTGCCTCACTCGCAGGACCA
ACTGCTCTTTGAGCAGTGAGTGCACCCTCCGGCTTTTTAGATACTTGCCAGGAGTCCCTG
GGCGCAGAACCTCCCGTGCATGAAAAGCGCTTTCGTTTTACAGTTAACGTTCCGTGTTGG
GATCGCGGAGCCCCCGTGTCTACCTGCCCCGGGGGGGTCGCTCTGGGTTGGTGTCGACTC
TATCTGGGGTATTCGTCCTAGTTTTCGGCAAACGTCTCTTCCAAGATAAGCGCGGAGGCC
GGAAGCCGCCTCCTCCCAATATGGCCCGCCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 2712..2883, 3336..3442, 3727..3865, 4222..4346, 4736..4860, 4862..4866, 5320..5476, 5897..5950, 5952..5971, 5973..5982, 6109..6124, 6126..6156, 6158..6231, 6314..6532
1001..1003, 2712..2883, 3336..3442, 3727..3865, 4222..4346, 4736..4860, 4862..4866, 5320..5476, 5897..5950, 5952..5971, 5973..5982, 6109..6124, 6126..6156, 6158..6231, 6314..6529
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved