Echinops_telfairi Locus PICALM
snOPY snoRNA Orthological Gene Database
Echinops_telfairi PICALM
Echinops_telfairi
PICALM
GeneScaffold_709
SNORA9, SNORA42
52624..52758, 88192..88340
98575
CCTGTTAGGATCTAAATTTATACCGGCAGCAACGTGTCGCGTTTTCAGAGATAAACAAA
AACAGGTGATATTTCCAAAGCCACTCCGGGAGAGGGGGAAACCCTTCTGGGCGAAGCGAA
CAGGGGTAGCGTCAACAGTTTCAGACTAGGGCGAGGCCTGCTGGCAGGTTCCAAAATCCA
GCCGACACAGCCTTTGCCTTTTCCTTCGCGCCCAGAGGCCGGCTCAGGGCGTCCCCAAAC
ACATGGCTGCGTCTGCTGGGACGGTCCCGTAGGCCCGAGCCTGGCTGCCCCCTTTCCGGG
CGCAGCCGTGCCCGCCAGCTGCTCCTCCTCTTTGTCAAGTCGTGGGTTCCCACCAGGGGC
AGAAGGGCACCCCTGGGGGCGGGGAGGGGGATGCCAGCGGGGTGACCCCGACAGCCCCGC
AGCGCAGCGCTCCCGGGGGCCAGCCGAGCATCGCCCCGCCCTCCCCTCTGTGACCCCCGC
GGACCCAGCCTCCGGAGACCTGTTGGCAGGGCGTCACGTGACGCGGCCGGCGCGCGCTCC
TCCGGGTGGGCCTCCTGTTGCGCCTGCCGGGCGGGTTCATCACGCAACGCGGGGCGCTGC
TCCGCTCTTCTCTCGTCGAGCGAGGGCGGGCGGGCGGGCGTCCAGGAGAAAGGGAAGGGA
AAAGGGGCGGAGGAGGCGAGCGCGAGAGGCTGGCCTGGAGGGGGGGCAGGGTGCATGGGG
GGGGGGCGCCCCGAAGTCACTTGGTCTGGGGCAGCCCGGAAAGCTTCGAGGAGAACCTGG
GGCCCCATTTTTCTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTT
GAGAGGGGTGCGGTGGGGGGGTGAGGACCCCTCCCGGCTCTTGAGAGTCCCAGTCCCCCG
CCGGCTGCCGAGCAGAAGAGGGTGGCGGAGGAGCCGCCGAGATGTCCGGCCAGAGCCTGA
CGGACCGCATCACCGCCGCCCAGCATAGTGTCACCGGCTCCGCCGTGTCCAAGACAGTAT
GCAAGGCCACGACCCACGAGATCATGGGGCCCAAGAAAAAGCACCTGGATTGTGAGTGAA
GCCGAGCGCGCCCCCGCCCCCCTCCGGCCTGCGGTCCGCTCCTCTCCGCCGGCTGCCCCC
CCCTGCGGCTTCTCCGGCCCAGCGGGGGCTTGGCTCGCCGGGGCCGGGGCTCTCTGCTGC
CATCACACCTGCCTCCACGGCTTCCGTTCCCTGTGGCCCGTCTTAAGAGCTGACAAGCCA
CTCCCCTCCCGGTTCCTGGGAGACCCCCACTCTCCTCCGCTCGGGGCGCCCCCACACCCG
TCACCCCGACCCCTGGCCCCCAGGCCCCCGCCGGCTGCAGCCGCTGCTCCTCGCCCCCCG
GGCCGGCCGGTGCTGCTGCCTCGATGCTTCGCCGCCCATTGTTCCCCGCAGCGGTCTCGG
GTTTGGGCGCCGTGGGTCTGAATCCCTGTCGCTCCGCACCGGAAAAGCTGCTTCCTCGCC
ACAAGCCTTTCCCCCCTTCCTGCCCGGCTTGCTTCCTACCGTCTCCCCCCAGCCCCTTGG
AATGACTTCTTAGCTCCAGTCCAGTCCCTGCGTTCCTTTGAAAATGTTTTACCCACCACT
GGACTTTTATTTCCGATTACTTTCTTTGTGGGAGTGAAAGTCAAGGCATTCAGAAAAAAA
GACATTCGGATGGATGTAGGGAAAAGCTTTGTGAAAAGTTAGCCTATCTTGCCGGTGGGA
TTTCATCAGTTATTGTCGGTGCTTTGGGGTGAGATGTGACTGTCACTACTCCCCCCCCCC
CCCCTCAGATGGGGATGAGTTTATGGAAAAAGGATTTCTTGATACCGGTATCAGTTCCTG
GTACCCTTAAGCCTGGCGGTTTGAATTTAGAAGCTTGCTTGTGAACGTAGACGATTGGAA
TTCAAAATGGATTAAAAATCAAATTTATCTGCAAATCGCATACGTTTCTTCAAAAGCAGT
GGTAAAACGATCTTGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCGTTTTCAGTATGGC
AAACTATCGCTCCATTCACGAAATTACCTACGGTTACTAGACCGGACGGCGGAGCCTGGC
TCGTGCGGCGGAGCGTCGGGCTCGCAGCGGTCGGAGCCCCTGGGCGGGAGCAGGCGGTGC
GGGCCCCGCTTTCGGGAGATGGGCAGCCGCGCCAGCCGCAGAGGGAGGGTCACGTTGAGT
CCAGATCAACTTGGCCCCCGTGCTTTTTTGGGTTTTTTTGTTTGTTTGTTTGGGCGGGGG
AGGGAGGATTTAGCACCAACTCCTCCCAACTTTTCCCAACCTGGATGCCACCTTCTCTCC
ACTCGGGCCTCAGGGTACAAAGCTCAGTGGAGCACCCAAGGTTGGACTCCCGGCGCTGCG
GCCGGAAACGTCTATGGGGAAAGTCGGGAAACGGACACAGCGTTAGATTCCCTTTTCCAT
GACTTCGGGACTCGGCAGCCGGCTGCCATCCTCCGCGAAAGTTCCTTTGCGTTGTTACTG
TTGGAAACAAGAGGGAGCATGTACTGAGGGAATGAACTGCCAGCACTTCTATTTTGATTG
CTCATTTGGACTGTGGTTGTAAAGTTTGCGTTAAAAATATGTACAAAATGTGAATTCTTT
CAAGATCGTTTACTCACGAAGTGTTGTTAGAACAATTTATTGCTGCAGACAACAAGCTCA
TTATTCGTTGTGATTTGTTCTTCCATGGTGGAAAAGTTAGAAAAAAAAGATCATTACTGC
TTGGTTTTCTTTGCTATCCCGGGTCTTGCCAGCTAGTAAATTCTTATTCCTAGTGTTTAG
AGAATAGACTATATTTCAAGGGTGACATTCTAACTGACAGGAAATTTATGAAAATGCTTT
GGAAGACAAAGTGTTATTTTGATTATCTGTCATTTTTGAGTAGACACATAAACTTTTTAC
TTCCCCTCTAATGATTACTTAAAGTCAGCAATTTTATGGTTTGCCCTACCACTTTTGCTA
GTTACTTTATTATTATTGATTTTTTTAAAGGATAAGGTGGGGGAGGGAGGGATTGAGAAA
CTATTTGTGTCTGAATTTGACTGTTTAATACTTTTTCTCAATACAAAATGATAAATTGTA
ACAAGAATAGATAATAGCTTTTAAAAGTCCTTCTAGAGACTTTTGTCTTATTTTAAATGT
AGCAGCAATTCTTTTTAACGCTTTTCCAAGAAGGACAGAAAAGAGGTTACAGTGAGGATG
TATTTGTCTATGGCTTTATAGAGGTTAGCGTTTTCTGCCCTAGTAGCTGCCAAAGCTGAT
GCTGATTGGCATTACATTTAGAGGCTAATGCCACATTGGTACTTTTTTTCCTTACCACTG
CTGTGTGGTAAGTTCCAGACTTGTCAGTCTCTATGAATCAGGTGCCACTCATTACTCTTA
AACAGTGGTTCTCAACCTTCCTCATGCCGCAACCCTTTCATACAGTTCCTCATGTTGTGG
TGACCCCCCCAACCATAAAATTATTTTCGTTGCTACTTCATAACTGTAATTTTGCTACTG
TTATGAATTGGGTGACCCCTGTCACAGGGTCGTTCGACCCCCCAGGTTGAGAACCACTGC
TTTACAATGAGGTTTTAAAATAAATACCTTAATGCTACTTTGACTGCATTGTTGCTTAAA
ATACCCATGCAATGGTAAGTAGTTCTCACAAATGAGATTTATTTTAAGTAAATTCTGACC
AATGAGTGGTTTAACTAAATGTCTGCCTCCCACATGCACTTGAACTTAGTTTGAGGAAGT
TTTCCACAAACAGCTCTTGATCCTGACACCATGAACTAGGCTTTAATGTAAAGCCCTATC
ATTTCAGATATTTTTAGGATTTTTTTAATATGCTGAAATCTTAGTTGTAGCTTTTAATGA
CTCAAAAAAAAAAAACCCCACTAAGCCCTACAAAGTGGAACTTTAATAAAAACTTTATTT
TTAAAATCTCAGTATTTGACATAGATGTGCTGTTCTTCCTTAAAGTGTGGAGGTGGTTTG
GGGGAACTTTCTTGCCAAACTTAAGCACACTTTCTTTTGTCTTCCATGTATACTTGCTAA
GAAAGATATTTTGCTTTCTTCTTATAGGTGTCAGTTAACAGTGCTGTCATGTCCTTAGTG
CGAAAAGAGTTGTGCAAATTGAAGCATATTTGAAAAAGTAAACATGCTTTGCATTTAACT
TAAGGCCTCTAGTGGTCATACTTAAATAGAAGAATAGCAGTCCTTATATTTGAAAGTCTT
TAGTTTGCCTGGCATTTATTAACCATTATCTCATTTAGTTCTATGGGCTGTGGGAAAGGG
CCCTACCAGAATGCATAGATACTTACATCTTACTCCATTTAAGGAAGAAAAACAAAGCAA
ACTCATTGCCATTGAGTTGATCTCGATTTATATTGACCATATAGGACAGGATAGAACTGC
CTCTGTGAGTTTCCAATAAGGTAACTCTTTATGTGACCTCCAGGAGTGACTGGTGCTTTT
GAATTGTTCACCTTGTGGCTAGCAGCCCAAGCCCAAGGCATAACCACTATGCTACCAGGT
ATAGAATGCTTAAAATAATTCATTATGACGGAAGTATAGACAAAACACTATTTTAAAAAT
TTCTAAATTTTAATAAATTAAGATATGAAAATCTGAGATATCTCTGCTGATCTCCTTTTA
TATTCTATCCAATATATGAATACTTATTATACATTAAAATTTTATTATCCTTGGTCATAT
ACATTGTGGCATGTTTTGTTGAGCTATATTTATGTTTATGATTAGAATGCCTCCTTTTTA
GACATGCTAATTTTCTTCTCTTACCAATGGTACTTCATCTCAGTCACTATCTTTCTTAAC
ATTTTTTAAAGCGAAAACAAGATCAAGTGGTTCCTAGATGTCCACTTGAGCTTATCACTC
TGTAGACACACCACCTGGGCATTTGTGTTTAGGGAACTGGTCTACCAGTACCAGTTGCCA
TCCAGTGGACCCCCCAACTCCAGGTTCCTCATGTGTATCAGTACAGCTGTGCTCCTTGAG
GTTTTCAGCAGCTGATTTTTCAGAAGTCAATCACTGGGACTATCATCTGAGGGTGAACTT
AAAACTCCAGTTTTAGGCTAGCGCACACTCCTTAACTGCACTACGTGGGGACTCCTGCAC
AAATTTAATACCGTATATACTGTTATGCTTCTCAGGAATATGAGTGATGTCAGAATAATT
GTAGAAAATTGGAATTAAAAGATAGGTAATTTTCCCACAATGTTATTGAAGCCCCCTTGT
ATTTATAGAGGGGACATTTGCAGTTAGGCTTCTGTGGTGGAAAGCATGGTTAATATTAGA
CTTTAGACATCTGCTTTCCATCTCTATGACTAAACAAAAACAAACAAAAAACCCCGAAGA
AACAGCCAACTAAAACTCACTGCCATTGAGTCTACTCTGATGCAATGGCCCTGTAGGACT
GAGTAGAACGGCCTTTGGGGGTTTCTGAGCCTGAAATCTGTAAAGGAGCAGAAAGCCTTA
TCTTTCTCTGCCGGATGAACGATTGACCTAGTATTTTGCTACCCAAATTATAACTCACCA
TGCCACCAAGGCGTACAATCCTTATAACAGTGCTCTTCTTGTGTTAACTTTCTGGGCCCT
TTTAGATAACATTTTATATATCTGAGTAATCTTTTGGAGGGGTCTTTGAATTTAAAGTTA
GGGTGACAGGTAAGAAGTAAACCATTTCATATGAAAAGATGGCTTTTTTTCTCATTTGAT
TTATGAAGCACATGTAGAAAATTCTTCATTTGATGTTTACAAAACATAATCTTTGGCATT
GCTTTAATTTAAGTATTATTTAATATATTTAATGTGAAAGTTCACTGTAATGCACAGAAA
ATATTCTGTTTTCTGAAGTTTAAAATTGATTAGTCTTTCTATTCCCTAAAATCAAAGAAG
CTAGAAAAATAAACTTAAAGGCTACTTGGCAAGAAATTAGAACTATGAAGTAGGGTTAGA
CTACTTTTAAAGTAAAGACCTAGTACCTGCTCTTCCTGCTCTTTTGGTGGCTAAAGGGAC
ATTTCTGTTGCTTTGTGTTCTGTCTCTGCGTGTTCCCTGTTAAAATGATTTTATACATTT
CTCTGGAGAATTGAAATTTGAGTTGACCTTTCAGAGTTTAGTACATTCATTGTGTCTGTG
GTTCTTTTCTGATTCATTGTGTATGTGATTCTTCATTCCTGGGCCATTAAGTTTGATTAG
TGATATTTCTATAAAAGGAAATTTTGATAAACCTAAACCTTTGTATTAAAAATTATATTA
TGTTTCACAATTTTAATTTACCAGATTACAAGACTATCAAGGGCTTCTTAAGTTATCTAA
GTATGTAGATAGTAACACTTGTAGCTAGACATGTTCTTTGTGCTTCTGTCTAGGTTGATA
TTAACCAAAATATTTGTGTTCATTTTGTACTACTTTTTTAGTATAGCTTTATGCTTAGTA
TAATGTTTACTGTAAACATTTGTTAACGTGTTTATTCCTTCTAATAAACCTATTCCTGTT
AATAACCCTCTATGAGATTTTTCATGTCCATTTTACTGCAGAAGAAACTTTTTTGATAAG
TTAAACAATTCATCCAAGAGCACACAGCAACAAGGGAAGGTGGGATTTGAAGCAGGTATT
CTGAAGGCAGAGACTGCTTTCATCTCAGAATGACTTTTTACATAAATGTTTTTTTTTCTG
TTCCAGAAAAATGAATAAACTATATCCATTTATTCATGGTAGTAGTTTTGAAAGTGTAAT
ACAGGAACTTTTGGATTCCCAAAACCCTTTTCACGTGCTTTGCAAGGTCGAAAGTGTATT
CCTATACTAAGATGTCTTTTGCCTCTTTTTCATTCTTTTGTGAGGTGATAGTAGAGTTCT
CTATAATCGATGTGGTATTGCAGCAGATTAAATGTAGAAGTAACTATGAGAATCCAGCTT
TAATGTGTTAAGCAAGTAGTGGTTCTGATTTGCAAAATTGTAAAGCAGTACTTTCTAAAT
GCTTATTTTGTAAAATGATTTTTCATGAAAAATGTTAACATGGGTGTACATTATTTAAAA
ATGAATTAATAGTTTAAAATCTTCTTAGTCTTAATTTCTAGCTGTAATTATCAATATAGA
AAACCCATTATAAGCAAAATCTTTATGGGATCCCTGTTTGAGTGTGTAGGTTCCGAGACC
AAAAAGTACAAGGGAGATAGCACGCTGTGACTAGACATTTGTGAGCAGTGTCCAACTGCT
CAGCACTTCTGGTATTTAGTTCTATGCTAGTAGATTGGAGCAATTGATTTACTTCTTTAG
AACTGAAGTCTCAGGAAAACTTCTTAGGACCATCTATAGTTCTTGCTCTGATAGGATTCT
ATATATTGAACAAGAAAGATCAAAGCCCTCTGATTGGTAGAATAATATGCATAGGAACAT
TTGTTATCTTTTTTCATATATACTGTGATTTTGATGAGGGGCAAGGGGAGAGAGCAGTTC
ATATTTTATTTGAGGGAGAGTCCCAAATGGCTGTGTGAAATCATTCTATGATGGACCTGA
CTTAGGGAAGAAAGGGCATCTTTCTGTATCTTAGTTTTGGGAGTTTAAATGTGATAGTGA
AAAATAGATAGATAGAAGTGATCATGAACTGGAACTGAACTGGAGTAAATTTGGTCTTGA
GGAAACTTAGAGGTAAGAGGAACAAAATCAGAATGAAAATGGTTCCTCTAGGGGAGAGTC
TGTAGCTGATGAGACGAGAGGTGCTTAGAGAGCTTAAGAGATCCTTTAACTCCAAAAGGA
GTCTGTTGGTGGCACAAACGGTGACGTGCTAGACTACAGTCTTGAACTGAAAAGTTAGTG
ATTTGAACTCATCCAGAAGGGCCTTAAAGAAAGGCCTGCTGATTCGTTTGCTACTGACTA
CAGCTTTAAACCTTATGGAGTACACTTCTGTGCATATCTTGGGTACCTATGAGTCTGAAT
TACCTAACATGATGGTAATGGTTTGGTTTGTTAAGGTTCAAAGTAATTTTGGATTTGATT
TGATGGCTAACAGTGACCCACCTTTTTGAGAGCATTGAGCAAAACATGTAGCCTAATACT
TTATGTCATACTGTTATATAGATTGGAAGGAATATGCAGTGTGACTTGGAATGGAGACTG
CTAGGGACAAAAAGAATCTAACAATAATATTTAAATATCTTCTCCAAGGACTGTATAAAG
TCCTGTATTAATAGGGACTCATCCATTTGTTCACAATTTTTAAGTTAATTAATTTTTCTC
ATCCAAGCTCTTCCTCACTAGCCAGTTGTCTTAAAATAGGTTCCTAACTCCAAATCTACT
GGCCCTTTGCACATAACCATTCCTTGGACACAAAAATGTCCTCCCTCATCCCAAGTGTCA
CAACCAGAATCCTCCTTTGTAAGTTTCCTTTTTTTTTTTTAAATCACTTTATTAGGAGCT
CATACAACTATTTAGGGGCTCACAATCCATACATACATCAATTGTGTAAAGTACATTTTT
ACATTCATTGCTCTCATCATTCTCAAAACATTTGCTCTCCACTTAAGCCCCTGGCATCAG
CTCCTCATTTTCCCCCCTTTCTTCCTTCTCCCCCCTCCCTCATGTACCCTTGATAATTTA
TAAATTATTATTTTGTCTTATCTTACACTGTCCGATGTCTCCCTTCACCCACTTTTCTGT
TGTCTGTCCCCCAGGGAGGAGGTTATATGTAGATCCTTGTAATCGGTTCCCCCTCTCCAC
CCCACCCTCCCTCCACCCTCCTGGCATTGCCACCCTCACCCCTGGTCCTGAAGGGATCAT
CTGCCCTGGATTCCCTGTGTTTCCAGTACCTATTTGTACCAGCGTACATCCCCTGGTCTA
GCCAGATTTGTAAGGTAGAATTGGGATCATGGTAGTCGGGGGCGGGGGCTGTGGGGACGG
GACGTGGAGGAAGCATTTAGGAACTAGAGGAAAGTTGTAGGTTTCATCGTTGCTACACTA
CACCCTGACTGGCTCCTCCCCACAACCCTTCTGTAAGAGGATGTCCAATTGCCTACAGGT
GGGCTTTGGGTCTCCACTCCATACTCCCCCTCATTCACAATGGTATGATTTTTTGTTCTG
ATGATGCTTGATCTAAGTCTTCTTTAAGCTAACTTGTTTAACACTTTAAGTTAAACTCCT
TTTTAAAAGCATTACAGTACTGAAAAACTCCCCCTAGTTTTATCAGGATGTTGTTACCAC
CATTTAAAGTGTATATGTTTTTTAAACTGTAATTACTCTCACACTTTTATATATGCTTTG
GGTGCATCTGTGTTTTCATTGTAGAACAGGAATAGTTGTCTTTTTTTTTTTTTTTCAGGA
ATAGTTGTCTTTATGGTGTTGTATCTTTTCCTAAAATACTTAGTCAATGATCTTGTGACT
GCTTGGTAAATATTGAATGGGCGATTAGACAATCTCCCTATATACCTCACACTACTCCTT
GAATATCCTAAAGACATAGTTTAGAGATCTAGTCCAGTAGTTTTTTAATACATTTAATGT
TATTTTTTGTGACATTTATCTTAGTTGTAGTGAATAATTAGTTAACCTGGTTATAATTTT
ATATATAAAGCCAATCATTTGTATTGGTAAAAACATTTTAACAAATTACTTTGTGTTTTA
TGGAACTTATTAGCATTAAGAGTTTAGTTTGTTATGTGTTAGATGTTTTCCAAAATTGTT
ACAGCCACAAAGAAAGAAAAAGTTAGGTATAGCTGCTCAGTTTGAGAACTAGAATGCATA
TATGGGTGACATTTTTGGAAGTTATACATTTAATTTTAAAAATTAAATGTGTCCAGAAAC
AGATTTGAAATGCTTATCAAAGCTGCATCCATATACCACTCCAAGGGTGTACATTATCAT
GTATGTAAATACATATTTGTGCCTCCAAGAGTATTACTATATGGTAGACACAGTTTACAC
ATAAGAGATAAAGTATACTCATTATCTCCATATTGCCAAAATGCAAAACAAAGCCACTTT
TAGAAAGCAGTCTCAGTAAGTGTGGAGTAAGGGCTGGAGTGGTGATAACTAACTGGAGTG
GTGGTGGGAATAGTCTAATAGGATAACTAAATCTATATTAGTTTTTCCCAAATGGTCCAT
CTAGGAAGCTTTGAGAGCAAACACCTATACTTTATCTTGGATTAAGGGATATAGTACAAA
AGTTTTTTATTGCCAAGGATGATGAATACTTTTTTTTACCTTCCCTGTAAAGAGGAAGGG
TAGGCCAGTAAGTTTGGGAACCTATGATTGAAACCATTAGATTCGGATGATTCCAGGGAC
CAGTGGAATTACTGAAAGTTTTAATACTTGGAGTTCTAGCAATGATTTCAGGAATTGTAC
TGGTATTTGCTTGTTACTTGAAAATGCCTCAGGGTTCCCAAATGTTTTGTTTAACAGATA
ATTTCTCTAAGTAGTGGAGGGATTGAAGCTAATGTAAGACAATTTTATGCAACAAATCCT
AAGTGCGGCAAGTGTTGGATTTACTAATATTCAGAGAGCAAGGTCCAATCAATGTGGCTT
CCTAGGGTATCTACTGGACCACATAACTTCAAAGCGGAGTAGTCAGCTAAGAAGGCTATG
GCAACTTTTTATAAATTGCAAAAGAGGGATAATCTTGATAGATGGTCTCCGAGGACACAG
GTAATTAGGGAGCTTATTAAGAAGACGTTTTTAGGAAATAGGAAATGGCATTGGTTGCTG
TGAATTATTTTTTTTCCTTATCACAACACTGTACTTTCGTCCATTCATCAAGGGGAGCAA
AGGTTGTCTTTTGAGAATTTTGTTGGGAAACCTTACCCCTATCAACTCTATCACGCCCTT
ATTCTTGTTCCCCAAATTCAATTGAAAGAGAACAGGATTTGAGTTCTTTGAAGATGCCTA
AACTACTATTGATGTGCTTGGTAAATCAATGAGTACAGAATTCTTTGGGGGAAGGGTTCT
TGAGATGGAAACACTGCCTTTAGAAATATGTAGACTTAGGTTGAGGGTGTAGAGGAACAA
TAGCTGCACATGTTAATATTTTTATTTAGTATAGTTTTCTATGATTTTGTAGCAGAACTT
TGCACTGTATTCTTTTATAAGCATTGAGAAAACAAAGGTTGTATATGTTTAAAATTTCAT
GTGCTGGTAATAGAGTTAGTAACTCTTCGTACATAGATGTACCATATTTTAGATATATTT
AATGTATGACAGTGTTAAGCCATCAAAGTATGAAAGAGCTTGAGAAAGTCATGGAAAAAT
TTCGTTATATTTTAAGTTAATTTTCAACAAACTTTGAAGTCCCTTATATATTCAGAAAGT
AAAAGTGGTGTGGCATCTGCATTTGAGAGGCTTAGGCTTGACAAGCGTTTTTGATATACT
TTGAATATTGTTTGTAGAAATTTCATTCATGCATAATACTGATTAATTTAAAACATTAAT
CAGATTAGTTAACTAATATGAAGGTAATATGAAAAAGGTCATTGTGAGATAAAGTGCTTT
AAAATATTTTTAGATATAATTCACAGAACAAAGTAAAACACAAAATTCACCAATTTGAAG
TACACAATTTGTGCTATTTTATTTACAGTCTATGGTGCAGTCATCACCATTATAATTCTA
GATTATTTACATCACTTTCAAAAGGACATCACTTTCCATCTCCCTTACTTCCAAACATTA
GCAACCATAACCTACTATAAACTTTGGATCTACCTATTCTGGGCTTTTTATTATACTTAT
TTTGGGATTTCCAACATGTAGTCTTTTGTGTCATGGTTCTATAATGTTTTCAAGATTTGT
GCATATTGTAGCATTTTCTTTGTTCATTCCTCCTTATTGGCACATATGATGAAGCTTCAA
AAAGTTGGTGTAAAAATTTGATTACCCTTTTTATTTCTCTCTAAGAAAAACAGTAGGATT
TATGGAAAGCATAAGAACATTTAAATGGGGAACCATAGATGTCCAGCGTATGGAGCCCAT
CAACCCCGGTGCTATTATCTTTAAATTTTGTTTTCCACAGACATTTGGAAGCACTTTTGT
AATATTCTACTGTATGAAATATGCCACATTTTATTTAAACATTTGGGTTGTTTCCTCTTT
TTGCTATTATGAATTTTGTTGGCATAAGCATTAGTTATTACAAGATTTTATGTGAATATA
TTTTCAGTTTTCTTGAGTATGTATACTCAAAAGTAGAATTGCTCGTTCATATAAATTTAT
CATTTAAATTTTTAGGAATTTGTCACTTTTTCACAGTAGCTGCATGCATAATTTTACATT
TCCATCAGTAATGTATGAGAGTTCCCATTTCTCTAAAACTTGCATAGCACTTTTTAAATG
CCCATTAAAAAAAACAGCAACAAAAATATATAAAATTATAGCTATCCTAATATATAAAAT
TATAGCTCTCCTATCCTAATACTCCTAATACGTGTGAGGAGTCCCTGGGTACTACAAATA
GCTATCATGCTGGGTTGGTAAACAAAAGCTTAAAATTCAGGTTTGCCTAGGGGTACCGCA
GAAGAAAGGCCTGGTGATTTACTTCTGAAAAATCACCCGTAGAAAACCCGGTGGAGCACA
GTTCTCCTGTGCTCTAAATTTTCATTCAGATATATAACACACATGGGGGTTACCATCAGT
TGAAATCAGTTCCCTGGCAACTGGTATTAGTGGTGGATGTGAAGTCTCTCATTCCAGTTT
TAATATTCATTGTATTAGTGACTAATAATGCTGAGCATCTTTTTATGCTGATCATATTCT
TAATGCTACAAGAGTTCTTTGTCTTACGGATATTTATATATTCTGGAAGCTCTTATTACA
TGCATTATTTTAAAATCCAACCCCCAACCCCATTTCATGGATTGGGCCCCCCCCCTTCTG
TTGATAATGTCCTTTGATGCATAAGTTTTTAATTTAGATGAGGTCTAATATATTTTTTTT
CTTTGGTTGCTTGTGCTTTTGGTGTCTTTTAAAAAAAATCATTTTATTGGTGCCTCTTAC
AACTCTTATCACAATTCATAAATACATCCATTGTATCAAGCACATTTGTACATTTGTTTC
CAGTTCCTAAATGTACCAGTGTACATCCTCTGGTCTAGCCGAGTTTGTAAGGTAGAATTG
GGCTCATGATAGTGTGGGGAGGAAGCATTAAAGAACTAGAGGAAAGTTTTGTTTCTTCGT
TGCTACACTGCACTCTGACTGGCTCGTCTCCTCCCCATGACCCTTCTGTAAGGGGATGTC
CAGTTGCCTACAGATGAGCTTTGGACCCCCACTCCGCACTCCCCCTCATTCACAATGATT
TGATTTTTTGTTCTTTGATGCCTGATACCTGATCCCATCGACGCTTTTGGTTGGTGTCTT
ATTTAAGAGACCCAACTCAAACCAAACTTGATGTCAGGTGGATTCTGACTCATAGCGATG
CTAAAGGACAGTGTAGAACAGCCTTTTAGTATTTCCAGATATAAATCTGTGTGGAACCGG
ACTGTATGGGAACCAGTGCTAATGGTTACTTCGAACTGCTGACTTTGTGGTTTACATCTG
AGCACGTAAACCTCTGCACCACTGGAGTAGAGTGCCTTTTATAGTTAAGATATTGTTGCT
TCATCCAAGATTATGCAGATTTATATTTATGATGTCAAATTTTTAAGTTTTATAATACGA
CCTCTTACCTATAAATCTTTGATTAATTTTGAGTCAATTTTTGTATACGTTGTGAAGAAC
AAAGGTGTTCTTAAGAAACATGGATATTTGTGTTTTCTTTCTCCTTGGAAATTTTTTCAC
GTGTGACCTGTCCTTAAAAATTTGGAAATAAAGGTACCATGTGATCCAACAATCCCAATA
CTTGGTGTGAGAACACTACTATAAAAGTCAAGTAAAGATTTTTACAATGAAAGTAGTTTT
TGACGGTTCTTAGGAAAGTGGGGAAGTAGAGTAGAACACTGACTAGAGGGGGAAATACAT
CATTATCCTGGGGGAAAGGGAAAGCAAGACAATCTGATCACATAAATAAACTAATAAGAC
GCTGACAGTGGGTATAGCTCTTTTACCACCATCTGTTGTAGAAATGGAGAGTTGCTGGGG
AGTTCTTGATTGCAATCTCTAGTACTGAGTATAGCTTTCTGACTCCATGGAATTACTTAA
GTCACACATTCTCTTAGCTATATGAACTGCTTCATCTGCTCTCGTGTGGTTTTTTTTTTT
AGATTGTCAATGTGTGAAGAGATAATAAATAATTTTAGGAGTATCAATAACTGGTTGGTT
TTGTCACACACAGTTCCATGTTTCCATAGCATCTTGAACTTCTGTTTTAATACAGTGATT
ATTTATAACATCTATAATTGTAATTTAAAGGTGAGCTCTGTGTGTATTTGCTACTGCGCT
AAATGTAGGGCTCGGCACCAAGTGTGCAGTTTAAACAAGACTGAATGAGTGACCGAGAAC
CCAAACCAAACCCACTGTCACAGAGTCAACTCTGTCTTGTTGCCAGTGAATGACCCTGTG
TATAGTTTCTGTGGCTGTAAAATCTGTATGGGAGCTCCCTCAGCGGCTGCTGGGCTTAAA
TCACCAGCCTTGCGTTTAGCCCAGGAGTGTATAAGGGTGGGATGAATTTTCTCATGGGAT
CGATTACTAATAAGTTATTAATGTTTTCGAGTATTTACATGAAGAAAAGGTCCCTGTCGA
AATAGCACCATATATACTCATGTATAAGCCGAGTTTTCCCAGCACATTTTAAATGCAGCT
TTTGTGGTAAAATTTGGTGCCTTGACTGATATTGGAGTTGGCTTATACTTGAGTATATAT
GGTAATAACCTTTCCTTTAAGTAGTTTGTAAAAAAAAAAATTTGTTTTCTGTGGTTAGGA
GGAAAAAAATGAAGTTTTTTTGGGTGGAAAGTTTGCAGAACAAATTAGGTTCCCATTGAA
CAATTCCTACACATATTGCTGAGAGACATTGAATGGCATATTTCACAATGTTTTGCCTTT
CTTCCAGTCATCTCGTTTCCCTGCCCCCTTACCCTTTCATCTTTGCTTTAGAGTAATTGC
TGGCCATTTGGTCTCAAAGAAGTGGCTGTCTAAAGATGTGCAGTACTCATGGTAATAATG
TTTATTTTATGAGCTAATTAGCTGAAAAAGGTGTCTGGGGATGGGTGAGGGTGTGGGGGG
AGTTTCAGTTCAAGATTTATGGGGTACTTGAGGGTAGTAGTCTCCAGGGGTTCTCTCATC
TCAACTGGTCCAGTCAGTCTGTGCTTTTTAAGAATTCGAGTTAAAAAAAATCGATTTATA
TTTAATGTCTTATTTCCTTTGACCAGGATTCTCCTCTTGTGGCTTTGATAAGAATGGTTC
ATAGTAGCAAGTATATCAAGTAGCTATTGGTTGAAAATGCAAAGAATCACAAACATGGGA
ATAAGCTTGCAGAGTTAGGTTATTAATGTGAAATTAAGGCAGTTTGACACTAAAACATCA
TTCTAGAGTGTATTTATTGTTGGAATGTTTGACTTCAAACAAGTAAATTTAGTTAAAGCT
TGTGATTTTTTTTTCTCTTGCTTTTTTGTTACATGTCATTGTTAAGAGGGAATTTCCTTG
TTAGACTTTGTGTTGTCTGCGTTAACCCCATCTTTTAATGCTATGAGGTTGCTTGCTTGC
CAGCTATTTGTGTTCATGAAATAAGATATTGGCAAAGCATTAAAGCTGCAAATAAATTTA
ATAAATGAAGTATATGAAAGGGCTTAAAATTTTTCTGGAAAAATGACATTAGAAGATAAT
GGAATTTTTTTCTCAAACTTTTTGAAGACTCCTTGTATTCTTTAAAATAAAGTCCATTGT
TATTGCCAATATATCATTCAAATCATATACCAATTAAAATGTTTCTGCATGTCCAGTTCA
GTGACATTGATTACATTTTTTAAAGTTGTACAATCATCTCAGCTTCCTTTTCTGAGTTGT
TCCTCCTTCATTAACATAAATCCACAGTATCCTGAGTGTTCTAGTTAGTCTTTCTGAATT
GCCTTTGTGAAGTTGATCTTATGGAGGTAGATTTTGAAATACTACAGTGTTCAAGGCAGA
CTTTTTTTTTTTAACTAAACTGTTTGACTTTTAAGAATTCAGGGGATGTTTTTGGTTTAA
AGTCTAAACATTTTTCTTGTAATAATTTCATGGGTTCATTCAGCTTTCATGGCTCTATAA
AATCTGGAGTGAGAATTTGAAATTCTGTTCAACATTTCCATCTTTTGATCAATATTCTGC
TATAGAACCTTTGATCAAAAGTGTTCAGTAATGGTAGCCAGCACCATCGAATGCATGGAT
TATATACTTTTAATGAATGAGAGGGTAATGGTTTTGATTGCTCCTTTCTCTTGCTTGCTT
CAGACTCTCTCTCTCTCTCTCTCTCTTTCTGCCCCTTTCAATTTTCCATTTGTTTTTAGG
AAGTCGACATTGTAGTCTGTGACTGATGAATGGTTTATATTTCTCCAAATTAGTTTTCTC
TTAAAAATGAAGCATGGCTAAACCCTAAGTCATTTGTATAAATAAAGTCCCACAAGTTTC
TAATTTTTGCTACAGTTTGTGAGTAGAAAGGAGATGATGAATTATAGGAGCAAATCTTTA
CTTCATGATGATGTTATTAGTAAAATCCCCTATGAAACTTTATATTCAAAATTCTGTATT
TTATGAGTTAAAATGTATAAGACAAAAGTTCTGAGGTTAAATTCTGTTGTACATTGAGGT
TCATGCAAATCCTCATCAGAAATAAGTGTGCTAAGAGAAAGCGATCAAGGGCCATAAAAT
AAAAAGATGAGTTTATCTGATCTTTACATTAAATGTATACACTCTAATAGAGTAACAGTA
TGCAAACAAATAATATATTGAGATTAAAGCACTATTTCTCACTTGAAGTATCACATTAAT
GCAAGGAGTAATAAAGGTTGGGGATGGTGAATGAAAGCTTCATCAGGGAGGCAGCGAGCA
AGGGTTTTAAGGATACCTAATAATTTGCAACATCATGAAAAATGGAGAAAAATTAAAATT
GTTAGCAATTTCATTCTGTTTAGCTCTACATAGCTCACTGTCCATGGAAGCAAAGAAATC
AAAAAGCCTGTTGTTGTTAGGTGCTCTTGAGTTCGTTCCCACTCATAGGGCCCTTTGTAC
AAGAGAAGGAAACCCCACCTACTCCTGTGCCGTGTCCCTATTTTGGGGCCAGTTGATGTA
GCAACTGTGGCAATCCATCTAATTGTGGGCCTTCCCCCTTTTTTGCTGCCCCTCTACTTT
ACCAAGCATGTTGTCCTTTCCCAGGGCCTGGTCTCTCCTGATGTGTCCATAGTATGTGAG
ACAAAGTCTCGCCACCCTTGCTTTCAAAGAGCATTCTGGCTTGTTTGTCTTCTGGNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAGC
TGGATCCACGGAAGAAAGACAACTGAAGAATAATCGTTAGCTGAATTGTGGTGTTGTGAA
GTGTATGAATATCCATGAACAACCAGAAGAGCACATCAGTCTTGCAAGAAATAAAAATGA
ACAGTTACTCAGAAGTTAGGATGCAAAACTTTAGTTACTTTGGGCACGCCATCATGGAAA
GTCCCAATCACCAAAAAAGGACATCCTATTTAGTAGAGTAGAAGGTCACTGCTCATAAGG
AAAAAAGCCCTCATGGAGATGGATGAATGTAATGGCTTCAAGACCATGGAGATGCCATAG
GATTGGACATCTGTAAGGTCGCCATGAGTCAGAGATGGCTTGATAGTAACCAACAGTGAT
TAGCCAGATGGAGAGAAAGCCACCTTTTAAATAGATTAATACATAGTGTGATGTGGACTT
AAGAAAGAACAGTATGGTGTGTTGAGGAAAACTAAGTCATTTTATGTGATGGAATGCAAA
GTGTAATGGGAGTAAGTGGGATGAGGCTGCAAGGATCTTTCTAAGGGCATGTCTTGTAGG
GGCAGGAGGTATCTTGATAGATTCTGGTATCTTGATAGATTCTGGTCTCTTTCCCATTCT
TTTCCCTAATTCTCTTTGGGACCACCCCCAGCCTAGTTCCTCATTTTAGAGTCTCATTTT
CTCCCTTTGATTGGCTGTTTGAGATGCCAGTGCCATGGACTGGGAAAGTACCTTTCCTTT
TATCACGTGATTTGTGAGAGGGAGGGGAAGAAAAGAACCTTGAAACTTGTTGGGAAGTGT
ATCTGCCATTGGATCCCTGAATATTTTGATAGGCAGCGGTTTAGGTCTTTAAATAAATGA
AAACCAGTGTCATGGCTTTAGTGGGGTTTTTTTATTCCATATTTATGAATGAACTTAAAC
TTACCTGATGGTCAGTGTAAATTTTAAAAAAATGTTTGATTAGCTAAGATGAGTAATAGT
TTTGAGGGCATGTGCCATTTATGTGAGTGTACTTCTGATACCTTTTTACTGCACACGATA
CATTAATTATCAGTCACTCTTACCCGATTTCAAAGCTGGACCTTAAGACTTTGCTAGTCT
TGTGGATATAAAGGAAATCAGTTACTTGTATATCTAACAATTATATATTGAGAATCTACT
ACCTGGCCACATTACTGTGTTGAGATACAGAGAAACCTAAATGTGAAGTCATTGATAGTG
TCCTTAATCTAGTAAGGAATAGTATGAGACAGATAACTGGAGCCCTGGTGACACAGTTGG
TTACTATTTGGACTGCCAATTGCAAGGTCCACTTACTGTTTGAAGCCACCAGCCATTAAG
CTGGGGGTGGGTGAGTGGGGCAGAGACAGTGCTTTGTACTCCCATTAAGAGTTAGTCTCA
GAAACGCACAGTGGCAGTTCTTTACTGCCCTGCAGGGTTGAAATTGAGTCGGCATAGACC
TGATGGCAGTGAGTGAGTAGTACCAGACAATATGACCTAAGTACGGGACAAATATCAGTG
AAACACAGACTCCTTTTGACGAGTAGAAGAACTGGATCTGTAGAATCGAGAGTACTTGGC
AGGAGCAATGGTCTAATTAGGGACTGTTGTGATGGGCAACAGAAGCCCTGGTAACTTACT
GGGACTGCCAACCACAAAGGTCAGCAAGTTTGAAATCACCAGCCTGTCTGAGGGAGAAAG
AGGATGCTTTCTGCTCCTGTAAAGGTTTACAGCCTTAAACACCCACAGAGGCAGTTCTGT
TCTGTCCTCCAGGGTCACTATGAGAATCGACTCAGTGGCAATGAGTTTGGTGTATGTTTT
GTGGTGGTCAGAAATGATAGTTTCTGGAGATACAGATAGATGAGCCTTCAATTTTTCCTT
GTTCCTATCCTCTCCTTTTGCTCTTGGGCATTATTTCTTGGAGAATTCCTTAACCTGAAT
TATTTTTAAGTTTCAGGTAGAGAATAAAGTTTCTCTTCTACCCCTGTTACTAAGGAATGT
TTTATCTTAATATTAGATTTGCCTTTTTGGGTCATGTAGGCTTAGATTGGAGCCATGGTG
TGTAATCAAATTGCTCCCCAATCGCACTGTAGAGGTGTTTTATTTTACTGTGGTAGCATC
TTGTCTTTGTTTCTCTCTCTTGAAAATTGGGACTCCATTTTGGTAGTTTTAGAATCCTTA
ATACCCATAATATAATCCCCTGTACTGAATATTTGATAATTCTTTGAGAAAGATAAGTGA
TTTAGTGTGCATAGACTGGTACGTTGATTTAGGCTTTTTTTTTTTAGGTTTTGTTTGGCC
ACTAAGTGATTTACTATGGGTAATTGGCTTGTATTTGTTGACTGTTAGTCATCAATGGGG
ATCAGTTGAGGATGTACAATGGGGCATCACTAATCTATCACCATATGCTCTACCACAGTA
ACACCATCATCTTAAAGTTGGTCAAGCAATGAATTTGTGGTTGATTGCATCAAACCTGGT
TTAATCCTGTGTTTTAATTTCATAGAACTATGGAACTTAAGGAACCCTGGAACCCTGGTG
GCACTTTTGTGTGTACGTTGGACTTCTAACACTAATCCAAGGGTGATGATTCAAAACAGC
TAGAGTGATTGTGGAGGGTGTGGTTGGGGGATGCAAAAGCATGTACCTGCACTTGATTCT
GAATTACGGGCTGTAGTACAGAATGTTTTTAATTTCCAAGGGGACACTGAATAATTTTTG
TCTGGAAAGGGGGTGGTAGGCCAAATCACTTTGGGGACCTATGCTGTATTGGGTCACTGG
GAGTTCAAATGGACTCTCATTTCTCCAATGGAGAAGCTGGTGGGTTTGTACCAACCACCA
ATCTTTCGGTAGCAGTGGGGTTTTGGTTTGGGGTTATGGAACTGCAAGCATTGTTAACTC
AGTTTGCTTGCTGGAAGGACTGTGTTCCTTATATAATATAAGTATATTCTCTGTGTTATG
TGTGTTTGCATGTATATATACAATTAAAAAATGATGGGTTCCCTCCCCATCCCATGAACT
TCTTGAAACCCCTTTGTGCTGTTTAATCTATTTCTATTTTGTCTTTTTTTTTAAAGGCTT
TTGTGACTTGAAATTAAATAAACTTAGCGGTCTAGTTTAGATCCTTTAATTATATTCAAT
ATGTGCTTATATATAGAAAATTTGCTTTAATAGTTGAGTTGTTTATACACAGCCCCCTCC
CTCCCCCCCCATTTTTTTTTTTTTTTTACTCCTGAGTTTGTATGTCTTTACATTGCATCT
TTGGAAAGCATTTAGCACAGAGAAGAAAGCTGCTTTCACTAATTATTGTTACTAGCTTTA
TTTCAGGTGACCTATTGTTAGGGATTTGATCTAGTTTTTATTTATAAAACCAATGTGAAG
ATGTGTTGGTAAGTACAAAATGGAGTGTGTTGACCTACAATGAATTTGTTTTTAGAAACA
GCAGAACCAAGAGAAAGTTAAGTTATAGGATAGCTGCACTTTTTCTTTCACCAGGGGACT
AGAGGAAAGATCTGGTTTGTTCTTTACATGACCACTTTGCCTTGTTTTTTGGAATTGGCT
GATAAAACGGGATTGTATTTCCTTTTAGAAGCAAAGCCTATTGCTTAATGGCCAAGAAAT
TAAGATTCAGCAGGCAGTATTTCATTTGTCTTTCTTTTTTGAACATCAAGTTTTATTATG
TTTGTTCACAGACATATAATTACTTATGAATTGCAACTTTCGAAAGTAATGTTAAATATT
TATTTAATATTGGGTTTTGTAGAGTATAAGCTATTTATTTCTGCTTTTCATATTCTTGTA
AAATAGAATTTTCATCCCCAAACACTTCATAGAGCTAAGTAGCAATAATATCAGTGTTCC
CTACCCCCACTATCCCGTTGATTCTGACTCCCAGCAACATTATAGGGCAATAGAACTGCC
GGGTCAAGGGTTTCAAAGGCTTTGTGGAAGCAGTTTGCCTTGTCTTTCTATTCTGGAGAA
GCTGGTGGGTTTGAACCAACCACCAATCATTCATTAGCAGCTGAGAGCTTAAACATTGTG
CCAACAGTGTTCCTTTTCTTAATGCTAGAACTTTTATAACACTAACATTAATAAAGTGAC
ACACAACTGAGTGTCGGTAAAGCACAACCATAGGTACTGGCTTAAAAATTGGTTATTTGG
TTCCCATTCACTGCCATCAAGTCAATGCTGACTGATAGTGACCTCCTGTGGGTTTCTGAC
ACTGTTTACCGGAGTAGAAAGCCCATTCTTTCTGGAGCTGTCTGTTTCTTGTTAACTTGG
GTTGGATAGTATGATGTCTTCCTTATATCCTGTTATCTTTTAGTTCATTGTAGCTGGGAT
GATGATGCCAATGTGCAGGGCATTGTATTATCAGATAAGAGGTGCTAATGGAATATACTA
AAATTACATTTGTGAGGACTAAGAGGAGAGAATGTGTATAATTTAGAATAATTAGAAATC
ACGTGCTATGGAGAAAGGAATCCTGGTGTCCTGGTGGGTTATGCATTTAGCTGCTAACTT
CAAAGTCAGCAATTCAAACTCACCAGCTGCTCCATGAAGAAAGATAAGGCTGTCTACTCA
TGTAAGGATTTAGTCTTGCATTCCAGGCACTTCTACTCTTTACCTCCAGGGTTACGAGTC
TGAATCAACTCAAAGGCAATGAGTTTGGTTTTGAGTTTGATATTGAGAGAACCAACCTTT
CTTCCGTCCGTCCATCCATCCATCCATCCATCCATCCATCCATCCATCCATCCCCCTTAG
CAGAAAGGAACACACACACTAGTTTGCGTAGTTAGACATGTATTTAAACCTGTGCAATGG
TGCTAACATCATTGCTTGCCTGTTACAAGGATGGTTGTAATAATCAAAAGACAGGATATG
AAATAATTTTGCAATGCTTAAAGACATCTGCACTTTAAAGATTTTGCCAGTCCTAGATGC
AGTGCAATTAATTACAGCCACATTTCCCAGTTAGTGAAGGAATTTGGCATTAGAAAAGCT
TTTTGAGAATTAATTGAGTTTAAGGTGGTTTCGTAATACTATAGTAGGAAAGTAATAGAG
GAATCATCTACTAGCATGGAGGAAAATTTACAATAAAGCACGGTGCTAACTAAAAATGTC
TTACATTTGTAAGGGTGCTTTGAAGCTTATAAAGTACCCTAAAATGAGTACATTGGGAAT
ATTAAGCATTAATATTGCTATTTTCAAAATGTAGAAATCGATAGTGAGTGACTGCTTAAA
CTGTCCTAGGTTATATTGGTGAGTCGGGAACCTGTAATTTGATTCTGGATCCATTACACA
TTCAACTATCCCTCTCAATTCTGGTTAGAGTGCAGCCTTCGTGCGTGGAAATGGATAGGG
CTATGCATGGAAGAGGAAAGCGAACCTAGAGCAGAATTTTAGTGGTGGAACAATGACCTC
ATTATTAGTTGAAGCTTGAGACTGGAAAGGACTAGCACTTAAGGCTATCAAATAGATGTG
AGGCAGAGAAGAGCTGTAATATGGAAAAGTGAACATTAAAGAGATGTCATTTGTTTAAAA
AAAGAAAGAAATGTCTTTTAGAAGGAGTTAAAAACAAATCCATTCCCTCACTTGCCAATC
TTAGTCATTCTGGAGAGTATCCAGTATAGCAGTGAAATAGTAAATTAGTGGGCACCACTG
TCCTTTAGGTCATATTCAAAATGATAGCATTTAGTTGGACAGAGGCTTAATTTGAGGAAT
CTTTATCTGCATAAGGAGCCCTGGTGGCCCTGGGTATTACTGGGCCTATGTGACTTAAGC
CAGTGTTGTTTATGGGTCAAGTGTATGTACTTTCAGAAATATAAGGGACTCTTCAAAGAT
CTATTTATAGGAATTTTGAAAACATGAGAGGGCTTCAAATGTTCATGGAAAAGCAGGATG
AAAAGACAGTGAAAACTTTATATGTCCCCTATATGTTATCTATCTATTTACACATAGATC
ATATCTATATTAAAAGGTGCTTGAAGGATTCAGCTATTTTAATTCTTAATTAAGGTCTTT
TATTAGAAAAGCAACAGTTATTATTGTGGTTAGTTTATACAAACAGAAGAACTAGTCAAA
ACCAACTGCATTTGTACAATGAATGTTAAGTTTCAAGTTAATTCTTTTTAAATTCTCTAG
CAGCAGAGTACACTTTACCAAAATAATATATAGTAAAATAAACTTAAAACCTGTAGTTGG
ACAAAATAGGTCTGTAACAGTGCAGTGTGATCATAACTAAATTTTAATAGAAGTAATCTC
TTTTTTTTTTCTGGTGGCAAAGTTTTTATTACCAAACATCTCCATAAAAACATGTGTTAA
AGAAGCATTGCAGAAAATATGTGCTATATAATTTCTTTTGAAATATTTTTCAGAGTATTA
AGTCATGTTAAGATTATTGCTGTCATATATTTTAATGGCTTTTAAATTTAGAGTGACACA
AATAACACTTTATTTTCACTTTAAAATTTAAATAAAACATTTTAAATGAACTATAAGCCA
GTCCACAACAATTGAGTCAATTCTGACTCATATTGATCCTCTTATAGGATTTCTAAGACT
ATAAATCTTGTATGGGGGGAAGCAATCTTACCTTTCTTTTAAGAACTAGCTGGCAGGTTT
GAACCACCACCCTTGTAGTTAGCAGCCCAACACTCTAACACTAACCCACAGTGTAATTCA
GAAGGAAAAATATACCTTCCCCCCATCAATGAACAAATACATTTTAATTGGCTAAAGCTT
GGAGTTTTAGATTAAATTGGTAGGGTTTTTTTTTGCTTAGATTTAACTTTATTAATTATG
AAATATTTGAGGATGGAGATCTTTCATTGTTAAAATCTTCAAGTGTCCATTTTTTCTTGT
AGACACTTAAAACTTATCAGGAAAAGACTTTAGCCTTCTTATGTGTTAAATTATTATTAA
TTTAATTTATCTTTTTCCACAATTTCCACTTAAAGAACTTATTTGAAATTTTAAAGTTGT
GTGACTATACTATGTTATTACTAGCCACATCGATCATTACTGTTTCCAGCCATTTGACAA
AAACACTTTCTAGAAATGACTTTCACTTTTTACTCAGTGGCTTAAATCTGGGTGTCCTAA
AGTGGGTGATACCCCCACCACCACCCCCAGGCATTGGAGTAATCCAGGGGGATAGCAAAA
ACAGATACTTACACTTTATCCTGGATTATGGGCTGTAGTACAAACGTTTTCAATTGCCCG
GAGTCATTGAGTAATTTTTTTTTTGGAAAGGAGGTGGTAGGCCAACGAAGTTGGGAACTT
GACTTAAAGGTTTCTCTCTATTCCTACGTGGCATTGATGTGGCATTTAATGAAGTGTAGT
AAATGGTTAATGTCATTTTCACCCACTAGTGACTAGAGAGTTATTATTATTGCTGTTAAT
AGGTGCCATTGAGTCTGTTCTGACTCCTAGCCACCCTGTGTGCAACAAAGAAAAACACTG
CCATGTGCCCGGACCTATGCCATCCTCACGATTGTTATATTTGTGCCCAGTTACTACTGC
TGTGTCGATCCATTTCATGGAGAGGCTTCCTCTTTGTTCTCCTTTACCCAGCATTGAAAC
CTGTATTTGGGAAAAATAGATTACTTGGACTTCATTGTTGAGAGCATGCATGAATAAATG
GGTTTCCCACTATGTCTATTTACTATATAAAACTTGGGGCTTTGCAGAATCAGCAAGAGC
AGATCTTGCTCAACATGACTTTCGTCTGTAATATGTACAATGAATGAGATGCCCCAGTAC
TTCCTCACTGTGGGAGGTGCTAGTTGATTGTGGTATTTCACTCCAAAGGTTCACTGGCCA
CTTGTGAGACACTTGTGTGGCATCATTTTCACAATTCCCAAGAGGGACCCTTCCCTGATC
ATCATGTAAATGGTAACCTGGTGAAGCACTCATACTCTTTTTTATTTTCTCCTTTGCATA
TATCACCATCTAATATATATTAGGATACTCCAAAAATTTTGTCAAAAATGGAATTAAAAG
ATACTGGGATTTTACATGACCCTGTTGAGGCTACCTCTTATTTGTTCATTGTCTCCCCAC
CCTACCCCCTTAGAATATAAGTTCCCTGGTAGCAGGAACTTTTGTTTTGTTTACTATTAT
ATATTACTAACTCCAAAGGCACTGTTTTATAGTATGTTGTGAATCTTTGTAGTGCACATG
GGGCTCTCTAATTGTTTTTACTGAGGTTTGCAAAGCTGTGAGAAGATGGAAGACCATAAG
GATTTTTGTTGTTCTAATTGTGCTTGTGCTCTATGGGTGAAGAAGGCTCTGGCAGAGAGG
GTAATTGCAACCCTTATTCTCTCTGATGAGGCATAATTTGAATTGTTAAGGTGAGATAGG
AAAATTCTTTTGTATTCTTATTTTATACACATAAGATTTTTGTCTGGTTCCTTTCTCTAT
CTGTATGAGTTGAATTGTATTATGGCCTCCCCCTATCACTGGTGGATTCAACTTTGGACT
TTTCTGTAGCAGCTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAT
TAGGCCACCCGGGCTCCTTTTTTTGAATTTTTTTTGAGATATAAAAACGATTAAATAAGC
CAGTAAGGCAGATATGGGGAAAGAGAGATACCAAGCCACATGCTGACAAGTCAGCTCTGA
TTTTTACTGCAACAGAGTGAGAAACACTGTCCTGTGCCATTCTCACAATTGTTATTATAC
TTGACAGTGTTCTACAAGACTTTCTTTAAGACTTTCACCATACTTGACAGTGTTGTTTGT
GTTTATGAGGTTTTCAGTGGTTAGTTAATCTTTCCCAAGTAGACAGCCTATTTCTTCTTC
ATAGTCTGACCTGGGGTGACCCTGCTGGTATTTGAAATACCTTTGACATAGCTTACAGCA
GTACAGCAACACACAAACCACTGCAACACCACCCTTTCCTTCCCCTTCTCCATGTTCATG
AGCAGAAAAATGGGCTTTTGTTTAACCTGTAAATCATAAATATTTATACCATCATGTGAA
CATAGCTACAAGGCATTGTGTTATATACATTGTGGATGGTAGGCATAAGGAATCAAAATT
CCTGAGTTTCTTTGAATAGAGTAAGTATGGTCTTGATTATTTAAAACAAAAAGGAAGGCG
GGGGAACTATTACCAAGGACTCAATAGAAAGTAAATGTCTAGAAAAGAGTGAAGAGTGTA
CAAACATGCCTGATTCAATTGATGTATGGATTGTGATAAAGAGTTGTATGAGTCCCCAAT
AAAATGATTTAAAAAAGAAAAAGAAAACACTTATTAAACTCAAAAAAGGGACCACCTGTT
GAGAGCATACTTTTGTTTTCAGATAAAAGGTAATTTTGGATATAGATATGCAAACATTTA
ATGTCACCAGCTCCTCAGAAGACTTTGGAATGATGTCCTGAAAAGTGATTTGGGAATGTT
CTTTTGTAGACATTTTTATTCAAGTTAGGAGATTAGATGATTGTCCCAGGATGGGAAAAG
TAGAATCAGAGATTAGTACTAAGAGGAGATGTTCAAGGATGGGAAATGAGTGCACAATGT
AGCTAACCCATTGGAAGTACATGTTGTGTTATAGGAAGGAAAGGAATGACCAGAATATAG
CACCTAAAGAAAAGATGGCAGTAGCCCATTCACTCTTTGTAGCTCTGTTATAGACTCTTA
TTAGTATTTCACTTACAACTAATGTGACACATACACTTTATTGTTCAATTTGGATAACCC
TTGAGAGTGAAAGGGTGTTTTCTGAATGTGAGAATGAGACACAGGTGTAAATCAGGCCTG
TTTGGCACTTGGGCAGGCACCTTTATTTATAATGCAGATTTAGTCCCATTTGTTTTGACT
TCTCCAGATAAAAAGTTTGGTTTTTCAAACTTTGGCTTTTGACCCCCAATTCTTATTGGA
ATGAAAGGAGAATTTGTTCCAGTTTTTCCCTCCGGATTGTTCTGGTTTACAGTATTGGTG
GAGGTAAGTTCTCATACTGTGTTGATCTTTTATTTAGCGTACAAGTAAGGTTTTCTGTGT
TTCTGATTCAGTAATTGTTCTTGAGAATCATGATTATATCAATTGGGTAATGAGTTGATA
CTAAGTTTGTAGAATACAATTCAAAAAGGAATTTGTAAATTTGGCATTTTCTCTTAAATG
GTTTAATATGTTTTCTTTCCTACAGGTAGTACTATAATTCAGAAATTTGAGATCTTCAAA
GAAAAGAACATTACGTGCTTATTCCTTGGACATATGTTTTTGATGTTGGAGCTATTTAGT
TTAAATAATTACTTGCTTTCATTTATTAGTGATGACTTTCCCCCCACCCCACCCCCAAGT
AATTTAGTATAATCAGCTTTTGTTTACTGTCAGTTAAAGTTAACATAAAGATAATAGCTA
GCTTTGGAGTTCATGCTTACAAAATTCATGGTTTCCTTGCCCTGAGAGCCTTATTTAGAA
TCTAAGATTTCAAATCCCAGGCATTAGGGTCTCTGTGTTTGGGAATCACTGCTTTAGAGT
CCTAGAATGTAATCATAAGAGAGGGAAAATAAATAAATCCATTGCCATCGAGACTATTCT
GACTCTAAGACTGTAAAACCGTAAAGGAACTGATACTCTCATCTCTAATGCAGCTGGTGG
GTTTGAACTTTCAATCTTGGGGGTTAGCAGCCCAATACTTACACAAGTATCACCATAGGA
AACACCTGAAAGTTAAAGTAGATTATTTTTAGGTGAGATTGAGCTGGTCTGACCTATCTC
TGTTTTAAACACTGGACTGCTAACCTACCAGATGCTATGCGGTAAGAGTCAGAGTCTGTA
AAGCCTTACAAACAGCCTGAAGCCATCTACTGGGTTTTATACTGGCAGTAAGACTCAGAA
TTACCTCCACAGCAGTGGGTTTTTTAATCTTTCTATGTANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNACCAGAACACCAAAGAAGAAACACTAGATGTTTTAGAATAC
CTTGTATTTAGAGTTCTTACTGATTAGGCTAAATCATTTTGATAGAGGGAAACAAAATGA
TAGTTGTATAGATCAGAGGCAGTGAATTTTAAGAATATTCCAAGACTTTACCTTTTTGAG
CACAGCATTTTCATGCTAACCTTTCTTACATAGTTTAACTGATTTGTGGGCAGTCATAAT
TGCAGAGATAAATCATTTCAAATGACTTGAAAATGATGTTTTGTGTATTGATTAGCATTT
TAGGGCAGTTATATAATCATTTCATTAATTTATTATTTACTTTAAAAATTATAGGTCAAG
TTTAGTAAACTTGATTCAGCTATGACTTAAGAGCCCAAGTTTTAGCCAGATTATAAAATG
GTTATGATGTAGATTATAAAATGATTATAAGATTATAATCTTATAATGTAGATTATAAGA
TGGTTAGTTTTGTTTACATATCTTCATCCGAATTCTCTTCTCCAGATGTTCTCTCTTTAG
TTCCTATTCTAGCACACATTAAAAACACGTCAATCCCTTTCTATCAGGAAAATGTAGTTT
TTCAAAACTCCTTTAAATTTGCCTCCTTTATCTAGAGACTTTAAGTCTGAGATACTTTAT
TTTCTCATGATAGTGCCCAAGGGAGGGAAGTGAAGTGTAAACTTGAATTAGCAGTTACAT
GACTTTCTAGGTTGCTAACAGATTGCTCTCAGATTATCACCACACCACAATTTAGACTAA
ATAAAACAGCAGTACTTTCTACAAACAATTTCTGAGTTACATTTCATTTGTCTAATTCAA
TAACTACTTAGAACTTACATGCTGGGGACACAAGCACGAAGAAGACACATGCTACTTCTC
TTAGTTTCATCTTTTGGGAGAAATGGGCAATAAACTAGTAATTATAGTGAAACATGATGA
AGTACTCTAATTCTTATGTGGAGAGCTAAGGGAATAGGAAGTTGGAGTCAGGGAACATTT
TCTTTCTCCTAAAAAATAATCACACCCTTCTCTGCTATTTCTCAACCCTATGCATATCGG
TTGCAGTCACCATAATGTATTGTGGGTTTTATCTTTATTTTTGAAAAGCTCAACCTAATG
GATGAGAAATTCCTTGTCATCTCACATGTATATATCTAATTCACATGATTTGTAGGAAAA
TTCCATTATCTTTTAACTCCATTTTTCTCTGAATGTTTTGAAGCCCCTTCTTGTATCGTT
TCAAGTTTGTGTATTTGGCATCAGTAGGTGAATCAAATGGTAGTTGATTCCTGTTGTGTG
CAGTTCATTCCTAGCAAAAAGGAATAGCATAAGGACATAGAACTCTAAAAGTGTGTAGGA
CATAGAATGCTGGATGTATGTGGCACCACCCTTAGACTCAATGAAAGAATGTTGGAATAT
CTCTCATGGCCATTGAGTCGATGCAGCCCTATCAGACAGACTCTTCAAGATTGTATCTCT
CTACGGGAGTCACTGGTGGTTTCGAACTGCTGACCTTGTAGTCAGCCACCAAACATGTAG
TATATATACAATAACACGTAGATCCATACACTGTCTTACCTGAGGCAATCCCAACTATAG
AGCAAGATCTCATTTTAAATGAGACAGTCCTTAAAGATTTGTTTACTTTGCCTATTGAAA
TATGTAGACCTTAAGGATATAGAACTCAAAGCCAAACCTGCCATGGAGTTGACCCTGACG
AATTGCAGCCCTGTCTTGAGTTTCTGAGGCTATGAATCCTTAGAGGAGCAGAAAGCTTGA
TCTGTCTCCTACCGAGCAGCTGGGTGGGTTTGGTGAACCACCAACCTTGTGGCTAGCAGT
CGAATGCTTAAATTGTTATAAAAATAACACAATTTTAGAATAGTACTTTTTCCATTTGTG
CTTCACAAAAATATCTCATATTCAGCATTTGTGTGCACCTGGAATAATTTTTTTGTCCTC
AACCACTTTCTGAATTATATAACATGATCACTGTAAACTTGTACAGTAGAAATTTTCTTC
CATGTTATAAGCATTTCTGAAATACTAGGGTAGTTGTTCTTTAATATTATATGTGTGAGA
AGGCTTCAGAAAGTTCGTGAAAAATTACATTTTCCCCAAACCTTTTGAAGTTCTTTTACA
TATCTTTGATAACTGCAGTGGAACTTTATATTTTGCTGTTCTCTGAAAGGGGTCTGAAGA
CACCTGGCTTTTGTCATGGTGACGTTATATTTGCAATAATGCAAGATAACAAAATAAGTT
CAGTTTTAAAATTCTATTTGTAAGAATTCTTTGTGGGCTCTTACAACTCTTATCACAGTC
CATATTACATCCATTGTGTCAAGCACATTTGTACATGTGTTGCCCTCATCATTCTCAAAA
CATTTGCTTTCTACTTGAGCCCTTCATATCAGCTCATTTCCCCCCCTCCCTCCCCGTTTT
CTCCTCCCTCATGAACCCTTGATAATTTATAAATTACTATTATTTTGTCATATCTTACAC
TGTCCGACATCTCCCTAAAATTGATTTCTTTAGGTGATGACTCTCCTTAAGAACCTGAAA
CTAGTATTGATGGAGATCTTTTCATATTAATGTATCTTCTTGTAAAAGGACTGTGTATAA
AATAAAAAGATGAGTATTGACAGACTTTTCAAAAATCATTGGGGGCTTTTATAGCTCTTA
TAACTTTCTATAAACATCAGTTGTATCAAGTATAGTTGTACATATGCTACCATCATCATT
TTCTAAACATTTACTTTCTATTTGAGCCCTTGGTATCAGCTCCTCCTTTTTCCCTCCACC
CCTCTCCCACCCTCATGACCTCTTGATAAATGATAAATTATTATTTTTGTATCTTACACG
GACCTCTGTCTCCATTCACCCACGTTTCTGTTGTTCGTCCCCCTGGGTGGGGGGGTGCCG
GTGGTGCTGGTGGTGGTTATGCAGCTATCCTGTGATCGCCTTTCCCTTCCTCCCCTACTC
CCCCTCCTTCTCCTACTATCCTGGTATCACTGCTCCCATTTCTGTTCCTGAGGGTTTTAT
CTGACTTGGATTCCGTGTTTTGTGAGCTTCTACCTGTACCAGTGTACATGCTCTAGTCTA
GCCAGAACTGAAAGGACTGGGGCCATAATAGTGGGGGCTGAGAAAGAACTAGAGAATATT
GTGTGCTTCATCAGTGCTATACTGCACCCTGGTTGACTCATCCCTTCCTTGTGACCCTTC
TGTGAGGGTATGTCCAGTGGTCTACAGATGGGTTTGGGGGCTCTGCTCCGACCCCCCTTT
GTTGTCAACAATATGTTTTTGTTGGTTAGCTTGTTTGTTTTGGATCTTTTGGTGCCTGTT
ACCCAATCTCATCAACATCTCATGATCACACAGGCTGGTGTGCTTCTTCCATGTGGGCTT
GTTGCCTCCTTGCTAGATGGCCACTTGTTTAACTTCAAGACCCCAGATTGAGAGACTGTT
TAATGACTTAAATGTTTTTCTTGGAAAGTTTATAAGGGGAAAATATTCTCCTTTTATACA
TGATGACTAAAACAATCAGTTAAAGGAGAGAGAGCTTATTACTCAATAACCAGGTAACAT
GTATTGCTGACTTATTACGAAGTTAGCCATTTGTTTCTCAGTTTTCACTTGTGTCTTTAG
TCAAGGCTCTTTTCATAGAACAGATCGACAGAAATAGTTTATATATTTGCATTGATAGAC
TTTTCTTACAGCTGCAACTTTTTTGTTTTAAGTAAAATGGGACATTGTCTCACTTCCATA
GTGAAATTTGGAGAGTCCTAAGGTGTCTTCTTCCATGGTAGAAGATGGCATTTGTTTCTA
AAATGCCAACCTGTCATGAAATAATGATCACCACATTTCTAGTCGCATGTTGAAAGTCTT
CTGCTTACTCCATCTCTCACATTCCTGAAGAAGGAAAGAAGTCTGTCCTGGCTGCCCTGT
ACACTACTGGTGATATGCTCCAGAGGGCCTGGAATGAATTACGGCATTGGTGTGTGCTGT
GTGACATTAGAAGTGCTTACTCCACCTTGTATGATTGTGTTCAGACAGTGATAGAGTTCT
TTCACAAATTCATTTTGACTACCTGTTTATATACAAGTATGCCTTCATTACTGAATAATA
AATTCTGAAAGTGATAAGTTCTTACTACTCTGAAGAATGAACGGTNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGACTCCTAGCCACCGTGTGTAAAACAGAA
TGAAGCGCCACCCAGTCCTGCACCATTTGCACAATTGTTCGGTTGTGTCCATTGCTGCAG
CCACTGTGCCAATCCATCTTGATGAGGGTCTTCCTCTTTTTCACTGCTTCTCGACTTTAT
CAGGTATGGTGTCCTTTTCCAAGGACTGGGCTCTCCTGATAACATGTCTAAAGTGAGACA
GTCTCCCCACCCTCACTTGTACGGAGCATTCTGGCTATACTTTTTCCAAGATAGTTCTGT
TGGTTTTTTGACAGTATTCTTCACCAGAACTGTAATTCGGATGCATCTGATTCTTCATTA
GTCTTCCTTATTCAATGTCAAACTTTCACATGCATGTGAGGCTATTGAAAATACCTTGGC
TTGGATCCAGGGGCCCCTTAGTCCTCAAAAGTGACATCCTGCTGGAATCCTAAAAAGCAG
TTGCCATGATCTTCTGATTTAACCTCTGCTTTGAATTGATTTCCTGGGTCTTCTGAACGT
TCCTTCAAATACTTGATTTAAAACTTGTTTTATGTAGCACAGCAGAGTTTCAGTGATTTG
GGATGATGTCTACTTGAAGTTTGATAAAAATTTAATTAGCTTTCACCTCAAAATAATTTT
TCTACCATATACAAACATATCCCCCTTTTTTTGAAGGCACCCTAATGAGACTTAAGACAA
GTTTATAACTGAGAGAACTTATCTGCAGCCATCCATTGATTGGATGTTTTGTTTGGAATA
AACACATAAATGTATGAACTAGAACCTTAGAAGCAAAACACCATTTTAATTTACCCACAT
GTGAGGGTATGCATGCATGCTTGTGTATCTATATGTATGCATCTGGGTTTGTTTAAGTTT
TTAAAATCAATTGTTTGTAACCAGTTTTTTTATTAGAAAATCCGACTTGGATGCCATCAG
TTTTGGTAGAGCCTACTGAGGGCCTGTTTAAATGGGCACCAAAGACCTCTCCATTCTTAC
TCTGTTGCAGGCTGCAGAAGTGAAACCTAAGGTTAAGTTTCTAAAGTTACTGAGCTTTCC
TCTGGTGAGGTCAGCTCAGGTGGGTCTGCACTTGGAATGTGGACAAAAGATTAATGAAAC
TGTGTAGTACCTTGTTATTTCTAAATGTTTTATACTTCCTGAACATTTCTCTCAATGTAA
AAATAATATTTTGCCTTAAAATAGGTGATTAGGGCTTCTATCATGGTGGCTAGTTGGGCA
TTCTTCTTGCTATATGTTTCAAAGCATGTTCATTCTTTATAAAATTTAAGTTGTGGTTCA
TAAACAGTGCCCTGAGGTGGGGTGGGGTACATATTTCAGTAAGTTCAGTTACCATCTGCT
TTACTTACTTCAAATATTATTTGTTGAAGAGAATGGTTAAATAATAAAACTGAGAGCGGG
GTCGGGGTGGGGGGGAGAAAAAAAACAGCATTTTATTTGTGTAGCAGGGATTCATTCCTT
CCACTTTTTTTCTGGTAAAGTGCTTCATTTCTATGGTAGGCCTTCCCCCTGCCGCTGCAC
ATAAGTACTAGCAAACCTCATTAAGTCACAGACATCCGTAAAGTAAAGAACTTACATGCT
GGCTGCTACTTAATTACTTACTTTGAATTTGAGGTTAGGAATTATTTTCAAATGACGTAT
TTGAAAATATATTTGTTTTGATTATGGGGGGGAAAAAACAAACCTGTCTTTACTTTGAAG
CTCTTTTGATTGGTAAGGAAAGGTTGTCACAGAGCTTTTACTTTTTAAGAAAAAGTGTCT
CCCAGATTACAAGTGGAAAAAGTAGTGGCTGTAGCTATTCCCCATGATAATTTGACTTTT
GTTCTGAGAAGTTTGCTTTTGGCTAGTTAGAGGTGGGGAAAACACTTCCCTTCCTGAGTT
GTTGGAGCTCAGACTTGGAAGGATTTTCAGGTTACTACTATATAGAAACATTGTGCAGAG
CAAACGCTACTCCGTGGAGAAAATGACTGGTGGAAAATATTGCTGGAAATGTGTACTGCC
GGGAAAGTGTAACATTATTTAGGACCCCTTTTCACCTCCGTAATGTTTGCTATGTGATCA
CAAGCTGAGCATTTATTCACATCACAACACTTTTCCTGTCTTTATGTGAGGAGTTAATTT
TTAGGTTCTGGAATTAATTAGTTTTCATAAGCATTACAGGGGAAATCCTTTTTTGTTACA
TCCCTTTTAACTTAGAATTTGAAATTTTACATACATTTTAAATGCATTTGCTTATCAGTT
GTTACTTAGTTTAATAAGTGGACATACCAGAGCAAATGTTTTTTAAGGGTTATGAACAGA
TAACTGGCTAGGATTACATTGACATCTCTTGCCATCTGGAAAGTTAGGTTAATTATTTTT
CTAACTTGGATTATATTTTGCATTACTGTCTTCATTGAACTTGCCGATTGTGTCTACTAA
GCAGCTGTTAGGTAAAGGTTTTTTGTTTTTCATTTTGGTGCGAAGATCATTGTTCATAGA
AATGCTTTTCTGGTGTGAAATGTGGAACTTACTTTATTTGAACTGCTGTCAGGTTAGTGT
TGAACAGTAGAGTTGCTAATTCAAGTTTGCTTTGGAAATGTCTTCAAAGGTTTTTGAGTA
GTAAGAAAAGAAAATTTGTCAAGGCCTTAAAATGGTTCTTTCACAGAAGAATGAAGTTCT
TCGGCGAGAATTGTTCCTTGGAGGAATTTGGTTTACTTTTTGGTTTTATTGATCATTTAT
GTGATCCTAATTAGTACTCCTTTTACTTCTCAGGTAGATTATAACAGACTTGTTCTTGAG
AGATTTTGAACAACTTCTGCAAACTACTCATTGCTGCTTTATTCTGTTACCTCTTTTCCT
TGTAAGCATGCAGATCTGGCATTAAAAATAAATTAAAACCAGAGGGTAAATTAATTAAAT
TTTTTTTAATGTTACAGATTTAATTCAGTGCACAAATGAGATGAATGTGAACATCCCACA
GCTGGCTGACAGTTTGTTTGAAAGAACTACTAACAGTAGTTGGGTGGTGGTCTTCAAGTC
TCTCATTACAACTCATCATTTGATGGTGTATGGAAATGAGGTAAGCAGACTTTCGGATGA
TAGTATACTTGTATTATAAATTGATTCATCAGCTGGCTTCTCTCAGGAAACTTAAAGAAT
CACTTCTTAAGCCAGATAAGATGTACAGGTGAAAATAGCAAGACACCTAGCCAAAAATAA
ACGTTTAGGTCCTGAAATTTGGAGAAGGAGGTGTCCTGTAAGCCAGGAAGCAGGAAAGGT
GAGGTCAGAGCACAGAGGACTTGATTGCTGGTATCATAAAGCATANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAGCATGATGCTCTTC
AGAGATTTCTCTCTTCTGATAATCTGACCGAAATACATGAGACGAAGTGTCACCATCCTC
ACTTCAAAGAGTGTCTGGTTTGCTTCTAAGACGGATTTGTTCAATCTTCTGACCAAACTA
AAACCAAACTCACCTACTCATTTTGTTTTTTATTCTTCTGACAGTCCATGATATGTTCAA
TATTCTTCATCAATACCATAATTCAAAGTCATCAGATTTTCAAGTCTTACTCATTGTCTT
GCTTTTGAGTCCATATGAGACCATTTAAAATACCATGGCTTGTGTTAGGTGTTCCTTAGT
CCTCAAAGTGACATCTTTACTTCTTACACTTTAAAGAGGTCTTTGGTAGCAGGTTTGCCC
AGTACAGCACACAGTTCAATTTCTTACTGCTGTTTCCATAGCTGTTGATTATGAATCTAG
GTATGATTAGAAGCATTTTATATTTTTTTAAAAAACATCAAAATTGGGGGCATTCAGATA
GCTGTTTAAAATAGAAATGACATCAGAGTATGGTTACGTGCATCTCTAATGGGCTACAGT
AAAACCAAAATAACCGGTTCCGTTTGTGCTTCAGTTTTATATTGACTTTACTATTATAGG
TATGGTTTTTAAGCTTTAATGATTTCTCGTGCTACTGAAATATGTGCATTATATTTTTAG
CTTTAATAACTAGTTAATAGGAGATATAAGGATGAGAAATTTGAAGTAGGTAAACTGAAT
GGAATATGTTAAGATTAGCTTGCCCCCCTCAATTACCAAAATCAGCATTGTGAGATGACA
GTACCTTATATTGACATAATTATTTGTTGGTGTTTTTTATAGCGCTTCATTCAGTATTTG
GCTTCAAGAAACACGTTGTTTAACTTAAGCAATTTTTTGGATAAAAGTGGATTGCAAGGT
AAAGACAATTTATTCATTATAGAAAATCAAAAGTGTGACCACACCCAGTGATTATTGCAT
AGTTAATACCCGTATCTGTTGTTTTATTTACTTATTTTTAATTCAGTAGCTTGAAACTGC
TAGATTAGGTGGCATGTTCTCTCTGAATGGGATCTATTGTACTTAAATCCAGAACTAAGC
CATTAGCATTTAGTCCGAAATAATTTATAAGGCTGTTCTGCATTGTAAATAGCTAGAGAT
GTCAGGAATATTATTAAAATTATAATTTGAGGAATGAAGTGGTTCCATAAGAAGTTAAGT
ATGAAAGAGATACATTTTCCAATTCCTGTTGAAGTGATAAGAATGCTAATCACAAATAAA
ATAGACTATTAGTACATTCTAAAGGAAGATCACCCCAACCCCATCCAATTAAAGACATGT
GACATATGTCTTACCAGACTTTTAAAAAAATTTTGAAGTCTTTGAAAATTTTATATGATA
TTATTATTCATTAGCTCCTTTCTACCATTAAATTAAGTTGGTATATTAAGACGTGATTGC
TGTTGGTATATAATGTGCTGGTTTTCTGAGCAAAATGGAATTATAATCACTTATGAAAAA
CTACTTTTCTCTTACAGGATATGACATGTCTACATTTATTAGGCGGTATAGTAGATATCT
CAATGAAAAGGCTGTTTCATACAGACAAGTTGCATTTGATTTCACAAAAGTGAAAAGAGG
GTGAGTTGAACTTTTTGGGTTTTTTTGAAAAATATAATTAGATTTAATATTTTAAAATCT
AATTTTGGGATTTCATTTTTCTTTTTTTGGTTCAAGGATATTTGAAAGTTCCTATTTTTA
CAACAACTTCATTCAGCTACAAGTCAGATACAATAAAATTCATCATTTTAAAGTATATAT
TTCATTGGTCTTTAGTAAACTTGAAAATTGACATACATTGCTGCTATCTAATTAAAGAAC
ATTGTATCACTCCCTAAAAGAGATCCCCATGCCTATTAGCAATCACTTCCCAGTCCTCTC
TCCTCCTACATGGCAGCCACTAATCTACTTTCACTCTCTATGGATTTAGCTATTTTAGAC
ATAGTATATAAATACAATCATATGAGATGACTTTTTGTGACTGACTTCTTACAGTCAACA
TATTGTATTTGAGGTGTATTCACATTATAGCATATGCCATTCATCCTTTGTTCTGTAGGG
TCACTGTGGGTCAGAATGGACTCAATTGCCGTGAGTTCGGTTTTGCATGTTAGGGAACTA
AATTGTTAAAAGTTACTCTTGACTTTCTCCACAATCTTAATTCTTGTTTTTTTTCCTTTT
AACACTGTTAGAAGTTGGAGCTTTCTACCTCTAAATGATCGGTTATTTATGTTTTTATAG
ATTTATGGATTCAGTATTTTATATTTAAATCTTTGATTCATTTTTTGGGGTTTATTTGAA
GTTAAAAAAGTGAGGTAAGGGGACATCAATATTTTTTATAGTAGAAATATGAGGTATTCA
AATAGACAAAATTAATTCTTACTCAGGTAATGATTAGATGGCTTTTCATGGGAAGTGCTT
TTTTTTCTTTCTGTAAAGCCGTGATTTTCAACCTTTTCTAATGCTGCGACCCTTTAATAC
AGTTCCTCATACTGTGGTGACCCCCCCCAACCATAAAATTATTTTCGTTGCTACTTCATA
CTGTAATTTTGCTTCTGTTATGAATTTGCGTGACCCCTGTGAAAGATCGTTTTCCCCCCA
AAGGTGTTGCGACCCACAGTTTGAAATCACTGCTGAAAAGTCTCTTTGATGTGAATGTGC
CAGGTTTTTAGTTATCCTTTAAAAATTCATTTAGTTTTTTGGGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCAGCAAAGCAGGAAAGGCAAACAAGAAGAAAGGGGAACCAAAGGAGCTTT
GTGGCTTTGTGTCCAACCCTCTTGGCCCTGCTTGTGTACCTGCCTGACGAGCCAGTCCTA
CCATGCTTGCATTCCTCCTTTAGTGTTCACAGTGGTCCTGGCACCAATGGCATTCCCTTT
GCCCGGAGTCCGCAGCAGGTCCCTTTTGTGTTCCTTCCTCTCAGGTAGCTCCCCCTCTCC
CCCTGGGCCATACCTGGGGGGTGAAGGGGTTACCCCATTGCAGTCTTTTTTATTCCTATG
GGACTCATCCTAAAGTATTAAATGTAGCTTTGTTTAAAAAAAAAAAAAAAGAATTATTTT
GGGAGACAAAGAAGTATGTTCTGAAAGGAAATGGATTATCAATAATAATAATTCAATAAT
TGTGTTAGTCTGGGTAGACTAGGGAAATTCATAGAAATACTCATGTGTATAAAAAAGAGG
TTTATATACAAGAGCAATTGAATGCTTAGAAAACATCCCAGCCCAGTTCAGATCAAGTCC
ATAAGTCCGGTATTAGTCCATATGTCTGATACCAATCTATAAAGTCCTCTCAGACTCATG
AAACACATGTAATGACGCCAAATGCAGAACATCAGGGGGTTGGAAGTCTGGATCCAGTGG
CGTTGTAAGCATCTCAGCACTGGCAGGGATCTCTATGTGGCTTCTCCAGCTGCATCAGGT
CTGGTGCGCGTCAGGGTATGTCCACATGGCTTCTCCAGCTCCCCTGGGCATAGCACTATG
TGTCTTGTTACTATAGCGTCTCTCCAGGAATGAGCAGAGAGAGAAGAGAAGTATTGCCTA
TCTCTAAGGAGGCAAATACAGGAATTCTCAGAAGGGCCATGCCCACACAGAGAGGCCTTA
CTGTTTATATCTTGATTGACAGGCCAGGCTCTACCGCTTCACTTGTAGTCCTCTCAAATC
GACACCAGATTATGTAATCACCACAGACCATCCCTTGTCCATTTGACACTTACACATAAC
TCTTTAGCGATATATAGTTTTCAAACAATAATAAAATCTTATCTGTAAGATAAAGATAAA
ACTAAAATGCATATTCAATAGGTATGCATTTTGAACTCTGTAAGTGAACAAAACGAAAAT
GCCCTATTCCTCATGATTGTATTTAAGAACTACCTACTAATCCTATAATCCTATGAATAT
ATTCCCACACCTATGAAAGTTTGTAAGCCAACCACTTCATGCCTTTATATGCCCAATTTT
GGGTATCCCATGTCTATACTGCCCACATACATCAACCCAGTGCTCAGAGGAGACAATCAT
ATTCTTCAACATGAAGAATCTTCATTCCAGTTGGAACCTTGTGAAGTCTGCATCCATAAG
CAAAGTCAAATTGGGACAGGCCGTCCATAAAGTCGGCAGCAATATGTGCCAGTTCACAAA
CTCAAATATCTTCTTTTCATCTGATCGGTTTCTGGTCAACTTAGTGTGGGCCGTCTCACA
AATTCTCAACAAGCTTAGCCCCTTCGTGCTAGATTATGTACTTCAGACCAGTCAACCCAC
TCTCGTCTTCTCTAGTTCCTGTAAATCAGGTCCACACGTGTCAGTGGCCAGACTCAACCC
GTTTCTCTATAGCTGCATTTCTCCCACTTCCACTCAACAAGTGGATTCAGGTAGTTGCCT
AGCAAGCATTTCATCCTGTCCACAGGCTCCCTTTAACGATAATATTAATAATTTAGATAT
TAGTGAATTGTTATCTGACAGGTTACTGTAGATGGAAGCTGTTTATTATGACTGGCATCA
GTAGATGACTAGAAGTTTTCTGATCTCATTTAGTCATCCTTAGGTTTTTATTTACATTAA
TATTTTAAAATTATGAATTTTATTTAGAATTCTTACTCTTGAGGTTTTTCTTAATTATTC
ATTGGTTTTATATATTGAAGTGGTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTAAAAATATTG
TCACAAAGAATGTAAAGAAGTGATTTTTAAAGCATATAAGGGAGATTTAAGGTTTGCTTA
TATCCTTAGTCAGCAGTATGACATGAACTGCATTTAGAATAAGTACCAGGGGAAAGCAAT
TTTAAAAAGATCGTTTGATTAGAGTGTAGAGAAATAACTATGAAAATCCAACTAGGCAAT
GTGGCTAGAAGTGCAACAGTGACAGTGGCAACAGAGATGTGAATACATTTGAGAAGTGAT
TAGGAAATAAAAATATCAGAACTTGCTGATGAAGATAATATGAAAGTTAATGAGAGAGGA
AAGACTAAAGAATACATCTAAGTTTTTGGCTTATGTTACTGAGAAAGTTAAATGGGAAGG
ATTTTCTGGGTGTAATGGTAAAGAATCCAGGACTGAGTTTTGGAAATATTTATTTTGAGA
TAACCTGTGATGTATGCAAGTTGACAAGTCAAGTAGGCAGTTGGATAGACTAACTTGGAA
CTTGAGCGTTCTAGTCTGGGAATATAAATTTGTTAATGGCATTTTGGTGATCTCTGCCAC
GGATCTCTGCCACAGATGAGCAGTAGTATAAAAATGAGGGAAGAGAGGATCCAGGAATAC
TTGAGTTAAGTGAGCATCTAGGAGCTAACAGACTGAACAAGTGTTAGGTAGGAAGACAAT
CAGATGAGAAGAGCTTTAGTGGATACTAAGAGGGTAAGTAAAGTACTTCACGAAGGAGGG
AAACTTTTGATTGGTGCTGAGAAGTCTGCTCAGATGAGATTTGAACAGCACCCATTGGAG
AGAACATAGATGTTCCTGAAGATGATTTATACTAGACAAATTTAAACGGGGGAGTGAGTA
GGAGCTCATCTTGGTAATGAGTTGAAAAAAGGAATGGAAAGTGAAGAAGTGACAGCTCTT
TGAATTGCTTTTCTCTGAAAGAGGTAGCTGGATGGGAATTTGGGATTAGAGGAAATGGAG
TGTGTATATTGATGATCCTAGAGCAGTGGTTCTCAACTTTCCTAATGCCACGACTCTTTA
ATACAGTTCCTCATGTTGTGGTGACCCCCAATCATAAAATTATTTTCATTGCTACTTCAT
AACTGTAATTTTGTTACTGTTATGAACTGTCATGTAAATGTCTGATACACAGGATGCATT
TTCATTATTACAAATTGAACATAATTAAAGCATATTGATTAATCACAAAAACTATGTAGT
TATATATTGTGAAATATTTATTTCTAATGACAAATAAATGAAATTTTGTCTTGAAGCATG
GTGTAGCATGGGTAACTGTCTTCACGCCAGGTACTCGTATGTGGGCGTATCTGCATGTGG
GCGGACAGCCTGGAGATGAATAGAGGAGCGGTGTGTCGGGACCCACAGGTTGAGAACCAC
TGTCCCAGAGCCTTGTTTGTGCATGGATATAAACATACAAAATTGATGAACTGCACTGTC
TCACTATGGTAGCTACTTGCCATTTATGTGCCTAATCAAATGTAAAAGGACTGAAATACA
ATAAAAAATTCAGTTCCTCAGTCATAACAGCACAGTTCAGGTGCTTAATTAGCTGCTCCT
CCGTTGGTGTTTGATAGAACATTCCCATCAGTTATACAACAATGTGCTAGAGCAAAGGAC
AACACAGGATTGAGAACAGAGCAGGATCTAAAGCAGTGTTTTCTAGAGTGGGCAATCTTG
TCCCCCTGGAGGGTGTTGGAGTGATCCAGGGGGGTTGCAAAAGTAGATGCCTACGACGTT
TTATCCTGGATTATGACTATAGTACAAATGTTTTTTATTGCCAGGGTAGCATTGGGTAAT
TTTCTTTTCTGAAAAAGGGTGTGGTGGGCCAGATAAGTTTGGGAACCAATGATCTAGAGC
AGGAATGGAGAACCTTTTTTTCTGCCAAGGGCCATTGGATATTTATAACATAATTGGTAG
GCTATACGTAAAACACCCCAATGTGGCAGCTAGAACTGCTTCTCTTTGGTGAGGTGTGTG
ATGTTACCTGGGAGTGATGATTTCTTGATCAAGAGGGGGACCTGTGGGAGTAGTATTTAC
TTTTGATAGGTACATTTCCTTTGTTGTAACAGTAGCACAACAGAGAGATGTAGATTGGGT
CCTAAGATCAGGCAATCTTTTATTTTGGTGGGGGTTTTTTTGAATAAAATATTTGAGTTC
TGAACTGAGAATTTTTGTTTTGGGGGAGAGGGGTGGGGGCTCCAGGCAATGAAGGAGGGT
AGAATGAGGAGGTTTGAAAATAGATTCCAACATACCAGTTTGATAATTTGAGGAGCAAAG
GTTTTTTTGTTTCTCTATTTTGATCTATAAGACCATTGTTCTTCACATAACATTAGTGGT
GGTGAGAATTATGATTTCTTCATGTGTAAAGTACACGGTAGACTTAGTCAAGTCTATATA
AAATGTAAGCTTTTGTTATATTTTATATCTTGTTAATATTCTTTTTAGTGTTAAATGAGC
ACTTTGAAGCTGTACATAGAAGGCTTCTTGTGTAATTTTTTCCCCCCTCTGTATGATTTT
TGCTTCTAGTTCAGGTTTGATAATGACCTAAAAAATAGAGCATTTCATCACAACTTTGTA
CTCTGTTTAAACAGAGTACAAACGTTGTGCTATGTTTAGAACTAGATGGGAGCTCTAAAC
ATATTTATTAACAAACTATTTATCTTTGAACAGGGCTGATGGAGTTATGAGAACAATGAA
CACAGAAAAACTCCTAAAAACTGTACCAATTATTCAAAATCAAATGGATGCCCTTCTTGA
TTTTAATGTAAGTTGATTGTACAAAAGCTTTTGTAATTTAAGATTTAAAACAATAGATGA
TAATTCAGAAATAAAGGGACGTTCTAAGCAATCCTTAATAGCCCTTAACTTGCTATGTAG
CTATTGCCCAAAGACAAATATGTTCCCTATTATTTTCTTTTTTAAAAAGTTTTATTATGC
AAATTTTAAAGACACAGATTAGCAAGCATAATTTTGTGATTTCCATGTGCCCATTCCCTA
ATTAATAGAGTCATCAATTCAATTCTTTGTGATGTTTAGACTAAAGTACATGGATTGTTG
ACTTGTACAAATTAAAAATGTTAGTATTTACATGGACAATGAGGTTTGAAGATAGAGAAA
AACCTTTAACACTCATTGCATAAGACAGAATTATGCCTGTTGGACTAAGATGTCATAAAA
AAAATCAAAGAAGTATGAAAATTATAAATGCGTGGTAGTCTTAGGTTGCCAACTATTGGG
CACCCTCAGAGTAAGAGATCTGAACCAAAGTCCTATGACTTCCAAATCCACAACTTCGTG
ATAGCTGTCATCTTCTCACAGTAGGATGTTGTCAGTTCAGCCTTATGTACAAGGGAGTAG
AGTAGTTCGGTTCCTCTTGGGATATAGGTCTATACCTGTTTTATATGGCCATTGTTGCTG
AGCCCGTGTTTAGTATGGTTATCTGTATAGGAAAACTGGGATAACAATAAAGACTAGCTG
GATTGGTGATTGCCTGGGGGCACAGAAGAGGAGGGTGGGTCAAATGGGGAGTTGGCTTCA
ATGAGTACAAGAAGAAAGGGTTCTTCTGGATGGTAATGATTGATTGCACCCTTCTTCTTG
TGGTGATGATTGATTGCACCCTTCTTGATATTGAATTGTATGAGAAAGAAATTACCTTTG
ACCTCCATAACTTGTTTAAGCAAAATTGATTAATGTTATAGGACTTATACTTAATTGGAG
TTCAGCTATAAATCTGAACCCACTTGACCATCAATTTTGTGGTCAATTGGCTTTACCTGA
TTTCAGTAAATAAATGTCTTTTTTTCTTTAGTATGCCTAAATGTATGAATTTACTCTATT
TTAATAAAGTCTTTTTGTCAGTTTCCTTTAAAACTACCTAACCTTACTTAATGTTTATTA
AAGTTTAATTAAATTAAATTTTTATTCTCATTCCTAGGTTAATAGCAATGAACTTACAAA
TGGGGTAATAAATGCTGCTTTCATGCTCCTGTTCAAAGATGCCATTAGACTGTTTGCAGC
ATACAATGAAGGAATTATTAACCTGTTGGGTAAATATTGCTGTAGTCTCATTTTATTTCT
TAACTTGTGTTATGTTGATGAATATATTGACTGAAATGTTACTTAGAGCTGCCAAAAATC
AAATCCTTGAGGTATATATAGGTTATCAAAGCAGTTTATTTGGAAAAAAGGATTCTACAC
TTAGCTGCACATGCTAAGTAATTCAACACTCACGTTTCAGAATGCTCAGCTACATGAATT
ACATATTTCTTAGATATATCTGGTTTTCTATCATTTTAATAAATTAAGTTTTTAATATTT
AGCATTTATTAAAATTTTTTTAAACCAATCACATTTTGTCATAATTTACCATATAAATGA
AAGTTTGCTTTAGAATTGTTCTTTTTGTATACTAATTTTAAAAAGCAACTATTTTAAATT
TATTCAACATCAATTTTTTTGATGTCTTACTTATGAGATCCATTAGGGATTTGTGATGCC
TTATTGTCTATTTCATATGTATAGACTCAGTTTTGTTTATAAAATATTTATTTCAGTGGG
CTATGTAATTGCTAAGGGCACCAAAGTATCAAGTATAGATATCAGTTATGTTTACTTATT
TGTGTGTTCATTCCCCCACCTCACATCTTTTAAAATTTTATTTTAATCCATTTTTATTAC
TGGCTAGGTTAATACAAACTCATCAGCGATGCTTTAATCCATGGTAATATGCCAATTTGA
TTTACTTTTCCCCCAGGGAAAAATGGAAATTTTTCTTCAAAATTTTGTTGAGGCATAGAC
TTTCTACTTTATGACTAGTGCAACTTTTTTTTTCTTGAGGAGAACATTTAAGTCTTAAAA
GGGACAAAGATAACACAAAGACATAGTCATGTCATCTGAATGAGGAAGGCCATTAGCACA
AGGTCATAATAGTGTCCCAAAACACAAATGATTTTTTATGTATTAATCTTGTATCTTGCA
ACTTTGCCAAATTCATTTGTTATCTTTAATTGTGCATGTACAGTCTTTATAACTCAATAA
TGAAAAGACAGGCCAATTAAAATAGGCAAAGTATCAAATAGACATGTCAGCAAAGAAGAT
AAACAAAAGGTCAATGAAAACATGATAAAATGTTCAGCATCATTAGCCATTAGTGAAACA
GTAAGATACCATTTCACACTCACTTGGATGGTTATTAAAAAAAAGACGGATAACAGCAAA
TATTGTTGAGTATGGAGAACTTGAAACTCACAAAGAATTGCTGGTGGGAATGTGAACTGG
TCCATCTACTGTGCAAAATAGTCTTCTCATTCATCAGTAAGCTAAACATAGAATGACCAT
GTAACCTAGCACTTCCACTCTAGGTATATCATCAGAGATGAACAGTGTGAACAAACTGTG
TATATATCATAGCAGCCTGAGCAGCAGTCTGCTTTTAATCCAGAGATTTGCTTCTCCTGG
ATATCTCATATAAGTGAAATCATGTAGACATGTGTGTCTAGCTTCTTCCATTGAATAATA
TTCTATCTTAGGGGCTTTATGGACTTTATCACTTTATGGACATTTGATTTATGTGGGGCT
ATTGTGAAAAGTGCTGCTATGACTAGTGCAACTTAAGCTTCTCCCTGTCTATATATTTGC
TGAATATCTAATTTTAATTTACCACTAATAATTTTATCTTATGATGACTATTCTTTGACC
TATATAATCTATAGAAGTACTGGCCTTTTGCTTTCTGAGAATTTTATCTGTGATGTGTGT
GAAAATATTTTGTGTCAGATTAATGTTTTTATATACTTTTGGCAGAAAAATATTTTGATA
TGAAAAAGAACCAATGCAAAGAAGGTCTTGACATTTATAAGAAGTTCCTAACTAGGATGA
CTAGGATCTCAGAGTTTCTCAAAGTTGCAGAGGTAAATTATCTTGACTGTAGTAAGGTAT
ATCTTCAATCATAAATATGCTATATAGAATTCAGTGCTGTATGATACATTGAATAAAATG
TATTCTATGATACTAAGTTCAAAATTGAGTATTGAAAGATAATCTTTTAAAACATTTACA
CCACCTGCAAGCCTCCAGCGTGTCTGGGTCTGGAGTGACCTTGTGCATTCCTTCAATGCT
TGCAAGAACAGTTTTGAAACGGTTTGAGGCCTTCCTCTGCACCATCTCCAGAGCAAGGTT
ATAGAAATTTCAGACAAACGAGAAAAGAAAAAAAAATGTTTACACCAGTGTAAAATTAGG
TTGGTGGTACATAGAAGTGGTATTGGTTTTGTTTTATCCACTCATTGTCTAAGACTTACT
GTGTTAAATATGGTAGAAAATATTCTGTGTGTGTGCAGATTCTTTTGAGCCACATGATTT
AAAACATTTTTGTTTCTTTACAGAAATGAATTTAGGGTACTTATTGTTTGACTGTCATTG
CTTAAGAAATTTTGTAAGTGTGGGTTTTAGACCTGCATCCCCCTTGACATTAAAAAATTA
CTCAGTGACCTCCTTGCCATTAAAACTTTTGTACTATAAATCATAATCCAGGATAAAGTG
TAGGTATCTGCTTTTGCAGGCCCCCTGGATCATCCTTGCATTCCCAGTGGGCGATTATCA
CCTACTTTGGGAAACTCTGTTATAGATTAATCATTTTGCAAATCTTTAAATAACTTCTGA
AGTTATCACAGATGGCAGTGTGGTAATATTTGGCATTATTTTGCTAGACCAGAAGTGGCT
GGATATATCTTTCTGGAATAACTTTGGAAGTTTCCTTTCTTATAATTGGTTAGTTGAATC
AAAGTTGTTAATCAGGAACTAGTAAAATTGATAAATCTAGGCTCAATTTCTGTAGTGGTA
TTTCTTTTATAAGCAAACAGAATAGGAGAGAACAAGATGACAAAACCTGTGGAAAAAGCA
GCATTGTTGTTACTCAGGTGTTGCTCCATGAAATCTACTGACTTTATTCAGATTTAATTT
ATTTTTTCCAATAAAAGTCATTGAGTTTTTCCATTTCCTGCTAAGTAGTTGAGAAGCCCT
GGTGGCGTAGTAGTGACACATTGGACTTGTAACTGATAGGTCAGGAAAAAGATGGGGCTT
TCTACTTCGGAGAGAGTTACAGTCTCGAGCACTGATGGAGGGGCAGTTCTACCTTGTCGT
ATAGGAGTATGAGTCAACTACTCCAGGCCAGTGAGTTTGGGAATGTGGTGTAGTTACAGT
TACCAGTTTAAGAGTCAGTCCTTACACTTACATGTCTGCAAATTTTAATTTTAATTTGAG
ATAAAATAGACTCGCCTATGATCTGAAAAATATGAGGACTCTTCTGCCCTAAAAATATCC
AGTCATGAAGTTGTCTTTAGATTTGCTGTTTCATCAAGGGGTTTTAATGCTTGGATTAAA
GGCAAGAATAACCTCTTAAAATATGATCAGTGAGGGACAAATGTATTTGGCAGTGATTGG
CTATGATAACATCTTAGTATGAATTGGTTTATTAAATTTTCTACTTATATGCTGGAACTA
ATCCCAGAATACTTGAGGAAAAGTAGAGAGAATGATTAGCAAATGAAATTTAGCCATGAG
TCGGAAAACAGTTTTCTAATTTGGGTTCTGAAATTGGTAAGAACAGACTTAAACCTTTTC
TTGAAAATTGCTTAGTGTTTAAGCATCATGAAACTCTCTTGGGACTGCTTTGGGTGTTCT
GTCAGTTATATCGTGGTTAGACATTACTTGACTTTTATGTAAGAACCTCACCTACTATCT
ACCAATGTAGAAAGTGTTTTACCATGTGACACATCGAAGTATTGTTTTGTTTTTAATAGA
ACAGATGGATTTATCAGGTACTATTAAGGCTATTTAATATTGATGCTTAGAAGACATGGT
ATTGGTAACTTTAATAGCCTGGTTGAATTTCTAACTCTGTAGTTTGACTCCTGTAACAAC
TTTCAGAGGCATCAAATAGCATGTAAGCTATTGAAATAGGGAATGATAATTTTAGAAAGT
AAATTTTTTTTTATTTAAAAATATCTGCCCAAAATATTGTTCACATAAAAATTACACAAA
TGTAATTTTTCTAAATTTTATTGTAAACACGATTGTCATACTTATCTATTAAAAGCAATG
CTATTTTCTTTTTATAGCAAGTTGGAATTGACAGAGGGGATATACCAGACCTTTCACAGG
TAATTATTGTTATGATATCAATGCACTACCTATTATGTACTGGTAGTTGTGAGGTTACGA
ACATGAATAATACACATTCTCTACTGCCACAGAGATTAGTGTTATTTTCCTTGACAGACT
TTGTTTTGATATAATGCTGAAGATTATTCTAGCATTTTGACTCTATAAAATTATCTATTC
ATTTTATGCTGTCTCGTTTAGTTTACCAGGGTTTTAAACCATGGACATAAGATTCATTGT
ATCCACTAAAAGTGCTTTTTGCAAGTCCTGGTATCAGTGGCTGTGATTGTCATCACATTT
GAAAACCTGTCATGTTTATTATATTAATGAGGCAAGATAGTGGGTTTTTTGGTTATGCTT
ATTAATAACTTTAGTTCATGTGTATATATGCCAGAAACACCTTGGATTCTTTATGCATTT
GATTTTGCATTAATTTTTGATCATTGAAGTTTAAAAAGCTTTGTGTAAAAACCAAAAAGT
AAAAAGCCTTGTGCTAGACGGCACTTAATTTATTTTGACCAATGTCATGGTTTTTGTGAA
AATTATTAATATTTGTACCGTTTCAGGCCCCCAGCAGTCTTCTAGATGCTTTGGAACAAC
ATTTAGCATCCTTGGAAGGAAAGAAAATCAAAGATTCTACAGCTGCAAGCAGGTACTTTA
CTCTTTATTGATTGAAGTATGAAAGTGATGTGTTTGAAGGCATAGGAGTAGAGCTCAATA
GGGCTACTGTTAGGATTAAATGGTTTAGTGTGTGTAAACTCTTAAAATAATTTTGACCCT
CAATAGCAATCTGTTAAAATGATGATATTGACTAGTTGAATTAAAATTATGTTTAGTATC
AAAATTTTGTTTGATAAAACATTCATTTGTATGATGCTCTACATTAATTTGATTAACCCT
CAAACTATCACTGTGAAGTATACATTTATAATACTGAAACCCAGACCTAAAATGTCTAGC
ACCAAATTTTATCATCTTTCTCCTTTGCTATCATGTGGTGTGTTATTGACATATTTTAGG
CAGTACATGTTGAACTAACTTAGGTCAACAGTTTAAAATTATCAGCTACTCCTCAGGAAA
AGATGAGGCTTTCTATTCCGGAAAAGCGTTAGATTTGGAAACCCACAGAGGCAACCTGCT
CTCTAGGCTTGCCATGATTCAGAATTGACTTGATGGCAGTGAGTTTGGTTTTGGACTTTG
AACTGATTTCCAAAACTAAGACCAATTAACTACCATATTGTGAGTAACAGAAAACATCTG
AACATCTGCTTTGGTGGCATCATGGGTTACATGTTAGGCTGCTCCGTAGGAGAAAGATGA
GACTTCTACTTTACAGTCTCGGAAAACCCACAGGGTCAGTTCTACCCATTCTATAGGGTT
GCCTTGCCCGTGCATCAGAATTGACTTCATGGCAGCGAGAGTTAACAATCTTGTTTGATG
GTGATTTGACTGATTCTCGTGTTTTCTTAAGAGAATTTTCTTTTACAAATGTGAAGGGAG
GATTTGTATAAATTATAGGGGGAATTTTCCTTTGATTCTTTTCAAACAGTTTTGTTGTTT
CAGAACTTTAAAAAACTAGCACCATTTCCGTAACCACACCACCTCGCTGTCATAGAGTCA
GTTCCAAACCTTATCGCTGTATGCACGGTCTCCAAGGCTGTCTAGTCATCATTGCTGTAT
GCACGGTCTCCAAGGCTATCTAGTCATCGTTGCTGTATGCACGGTCTCCAAGGCTGTCTA
GTCATCGTTGCTGTATGCACGGTCTCCAAGGCTATCTAGTCATCGTTGCTGTATGCACGG
TCTCCAAGACTATCTAGTCATCGTTGCTGTATGCACGGTCTCCAAGGCTGTCCGTCGCTG
TGGAAGCAGAGGCTCTTCCTTCCTTGGGGCAGCGGGGGTGTGAACCACTGACTTCATGGT
TGGCGTTCCAGTGCTTACTGGGAAGCACCTTGAGGACTCCCTGAGTATTTTGTAGAGAAA
ATTAAATTTGTTTAAATGTCATTATAGATTTTAATGTTTTAATCCAAATATGCTGTTTGA
ATTATTGTAGTAGATTAGAAAAGCCAAAATTACCACGCCTAAATTATTTGCAAAAGGAAT
GAAAATATTGATGAAGTGTAAAAATATACTTCAGTAAGTGAGAAACCCAATACTTCTTGC
CTGTAAGGTTTTCCTAGGCAAGTTTTGGAGCTCTTTCCCGTTTGTGTTGATCCCTTCCTT
TAGAGCTGAAAAGAGACTGCGCTATTCTCTTGTGAACCCTCTCCATGCTCTGACATTTAT
TTTTAAAAGCTGTGGCTCTAGTGTATAAATCAGCATTGTTCTGATTGCTATAATCTTATA
GGTCAGTCAGTAGACGATTTCCTCTGAAGTACTGGTTTTAACTCCAGGGTTAAATTCTAA
ATTATAGTGCCTAACCATAGTGAGGTTGCCAAGTCATTTCATGACTTGTTTGTGATGTGA
TATGTTGGCAAAAAGCCATATCACCTCTGTCCATTTACCCTAGGGCAACAACACTTTCCA
ATGCAGTCTCTTCCTTGGCAAGTACTGGCCTCTCCCTAACCAAAGTGGATGAAAGGGAAA
AGCAGGCAGCACTAGAGGAAGAGCAGGCTCGTTTAAAAGCTTTAAAGGTAGGTGTGCATG
TTCTTTTTATATGGGAAAACAGATACATGTGTTGAGAAAGTAAAAGAGCCTTCTGAACAG
ACTTGGCAGTATTTAATGTACACTTATCTAAATGAAGGGAAATTAGTAGCTTTAATTTTT
TTGTCCTGACAGTGAATATTGAGTGAATGAAACAGCAAGCAAATAACTCGTTCTCAAAAC
AAAATAAGTAAATGAATGCTGTGTTTTGTTTGTTTGAGGCCATCTGAACAAATTTGGTTT
CTGAATTTTTTAAGCTATTTAAGCTATATTCTCAACAGGAACAACGACTAAAAGAACTTG
CAAAGAAACCGCATACCTCTTTAACAACTGCAGCCTCTCCTGTGTCTGCCTCAGCAGGGG
GCATAATGACTGCACCAGCCATTGACATATTTTCTACCCCTAGTTCTAACAGGTAAGTGA
AAAGCTCAAGTGACCTTTGAATATTTAGGTTGAAAGTCTTCTAATTTTGCATAGCTTTTC
AGTTTCCTTTGATTTGTGATTTTATGACTGTAAACAAAGTGGTAATAAATGGTGGTGGTA
GTGGGTGGCAGCAGCAGCAGCACCATGCAAGACCAACTCATAATGACCCTGTGTACTATG
TGCTACAAATGAAACATTACAATCCCAAACCATCCTCATCATCTTTGTTCTGTTTGAGCC
CTTGGTTATAGCCACTTATTCCATCTCCTTGAGGGTGGTTTTCTTTTTCGCTACCCTCTA
CCGAGCATGAAGGCCTTTTCCAGTGACTGGTCTCTCCTGATAACTTGTTCAGAGTATGTG
AGATGAAGTTTCACCATCCTTGCTTCTAAGGAGCATTCTGGCCAAATACATCGATCCTTC
TGCAGTCTTCCTTATACATTGTTCAACTTTCATATGCATTTGAAGCGATTGAAAATACCA
TGTCTTGGATAAGGCACACCTTACTCCTCAAAGTGATGTCCTTACTCATAAACACTTTAA
AACGAGGTCTTTTGCTACAGATTTTCCCAGTTCAGGAAGTCATTTGATTGCTTGACTGCT
GCTTCTATGATCATGTTTTGGTGATAGTGGTATAATACCTAAATAGAAGATGATAAGATT
TTGTCTTTTACATTTTAGGAGATGGAGTATGCTAAATTATAAATTTATAATAATTGTTAT
ATTGTGGATTATCTATGGGCAAACTTGATTATATAAAAGTTATGACTGGACACATTTGTG
AAGTGTGGTAGTGGTCCAAGATAATTTTACTCTAGAATATGTGTGTTGTGTGTGTGTGTG
TGTTTCATATATTATAATACATCCTTTCATTGGATATTAAATATATCTCTGGTGTTAATC
TCTAATCTAGATCACAGTACCAGAGTTTAGTTGCTAAATTTCTGCATTATTGAAGTTTTC
CAGACCAATCTAAATAATCTTGTTTTATGTAAGCTACACAACGATGGGGATCTAATATTT
CCAGGTGAATTAGAATGATTGGCTTTTTCTTAATCTGTTCTCCACCCCACCCCACCTCCT
TTTTTTTTTAAACCTCACAGTGTTCAAAAGTGGAAGCTAGATCAGTGGTCTCAATCTGTA
CCGTGTATCAGAATTACCCCAGAGGGTTTATTAAACCACAGATATTTGGACCCCACCTTC
AAAGAATTTTTCATTAGTAGGTCTAGAATGGGGGGATGGGTGCAGTTCCAAGCATTTTCT
TTTCTATTATCTCCTGGTGACTCGAATTTAGTGTAGTGAGTGGCATTTGGCTACAGTGCC
ATAGAATGTGGTAAGCGTTTTTTCCCTTTGATTTTGTTGTTGATGCTATTTACTTACCTC
AGCCTTAAATTTTTTTCTACTCTCTATTGAATCTTGCCACAGCTCAGTGTGAGCTTTACT
AACTTGGCTTCTCTTTGCTCTCTGTTCCCTGAAATCCTACTATATATTTGTTGAATATAG
GTTTGTGTTTTTCCATCACTTTGTGTGTTTTTAGGAGTGATGAATGGAACGAATGTTGAA
TATTTGAGGAGGGAGACATATAGGATAAAGAACTAATTTGACCATGTGTTATTTTACTTT
TATACTATAAATTTTCATTCCTTTAATAGTAATTGGGACAAATCTTATAACCCACTTAAA
ATATGCTTATTTTATATCCTGCATTTTTCCCAAGTGCACAAAATATATTTGTAATTTTGT
TTTTAATGTTAACTTGAAGTGATGTTAAGTAATTATGATTGAGTAGGAAATTTTTGGATA
TGAGATTTTTCTATTTTAATTTAGGTTTATATACTCTCAAAATTAGGCTCCTTGAGATCA
TATTGTTTTGTTTAACTATATAATTTTTAATTTATACATTTCATAAATGCAGGGAATAAG
AATAGATAAATGATTAACCAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTGGTCGAGTAGACTCCGGTTTACAGCAACCTATAAACTGACAAGAATTGTTCCGTA
GACTTTCTGAAACAGTTAATCTTTGTAGGAACAAGCAACCTCATTTTTCTCCCATGTTGT
AGCTAGTAGGCTTGAGCTTGTGCACTTTTGGTTAGCAGCCCAGCACATTACCCACTGTGT
TACCAGGGCATCTTAGAGGGATGATAGCTCTCTACTCTTTATATTGAGACTTACGGGACA
CTAGATAAATGCTAGGTCTTTATTTTACGTCTTGAGATTTAAAGTATACATCTTTCTCAT
TGAGAAAAGTTTTTAAGTATTTTTGTAATTCTATATAGAAAATTGTTTTACATCCAAAAG
TTGTCTTCAAAACTTCTTTAATTGTGTATATGGTAAAAATTATCTATGCCACTTTTCAGT
TTCTTATTTATGTGAAAATAAAATATTAATTACCGGGCCTAAAACAACAGTCTCTTTCTG
GCTCCTTTAAATACTTAAAAATATGAGGGAGATAATGTGTTTTGGAATTCTGCAATGGGA
TGGCTCTTTTATAAGCTTATACCATAGATAAGTGTGTGATTTCTTTCTGTATCGCTGATC
TGCTGTACGGTTATAGAGGGCAGTGGAGGTGAGATTAAAAGGATATTTTGCTTAGGAGCT
TTGGTATATTAAATGCGATTCAACTTATGGGAAGTTAAAAGGTGAGGAAAAATTTAAATT
GTCATAGTATTTTATATTTTTAATCATGTCTAAGTTGAGTGACAGAATCAGGACTTTTCT
GGAGAAGTCATTGATCTTTTTTGAAGAAACGCTATTATCTGAATCCTTCAAAAGTGTATG
ATGTTTGAGTGTTTTTTCTAGACCTTTTTGGATTGTTTCATGGGGGTTATTTGTTATCTT
GTTGAAATGGCCACATTTTCAGATTTGTATTACTGCATTTTTCTCTTCCTTACTTACCTT
TTTAATGCTTTCATTTGGGGATGGTGACAAATGTAGCAAAAATTACCTCATACATTTTTT
TCTCACAATATCTTTCTAGCACATCAAAGCTGCCAAATGATCTGCTTGATTTGCAACAGC
CAACTTTTCACCCATCTGTACACTCGTTGTCAACTGCCTCTCAGGGCACAAGTACATGGG
GAGGTAAGTATGAATGAATTTACCTGGGTGTCACGTAGCCATCCCTCATCTTCATGCTGT
AGTGTTGGAGTTTTGGAGGGTGTTTGGTTACACTTGATGCTTGAGGGATTGAGAAATATT
AAGGTGGTAATGAAATAATTTTGTTCCTTAGAGACATTTTCATTTGTATAACAGTGTAAT
TTTGAAATGTTTATTTAGATTAAATTATGAAATGAGGTTTAATAAAGATAAAATGAAATG
TACTGGAAGGATCCTATGTGTGCAAGTCTGAAATTCTTCTTTCTATGTTCTGTTCTATTC
CATAGCCAGGAAATACATGTTGGCTATTTTACTGTTGGATAGCTCCCAAGAAAAGTTTTT
GTACTTGATGGGGGAAACCTTCCTCTTGTTTAAGTATATAGCAAGGTTCTAGTAAAGGTC
AGACGGGATCTCATGAAAAACTTTATGCTATTTATGTTTAAAATTTTAATTTAATTTATA
CTTACATTCTTTTAAATTTTCTGCTAGTGCCAGCAGGAATACTTTCTGCCTGCGTGGTTT
TAATGTGACACTATCATTTCTCTTGCACTATTTTGAATGCAAAAGAAGAGCTTAGTTCGT
ATTGGTATTTAAGCTGTCTCACTTAGACATTTAGTGCATCTTCAGTTGGGCTCGTTCTGT
TGTTTTGGTACTTCTGCTTGTATGTATATGTGCATTATTTTAAGGAGCCTTGATGGTGTA
GTGATTAAAGTGCTTGGCTGCTAAGCAAATGTCAACAGCGTGAACCTGAGGGAACAGTTG
TGAACAGTGTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTTTG
GCTTTGATTTATGTATTCATTATCTTATAAATATCCAAACATTGTTAGGGAGAGCAAGAT
ATTTTGAGAAAGGAGACATAATCTAAGAAAAAAAATCTTAAATACAAATGGCAAGCTATT
TTGGAATTTATGTTTGCTCACTTAAAAAATCTGAATCTCCTAACAAAGATAAATCATTTA
TCTATCTAATGAATTTCTATAGCTTATGAAACATGACTTTAAAAATTTTTATTTTCATTA
TTTGGGCTTTTAAAGTCTGTTTTTCTGTTTTACTTAGTGTATTTTATGCAAATAGCAAGT
TGTATATCCACTCTTGTGTTAGTTTCCAATGCATGTTATATGTGTGTGTACTTTATGTAT
GTGGACATGTTGCATGTGGAAAAATAACTTTTAGGGCTGTATTCTGAGTATTAAAATATA
AGCTGTGTGAAAATAGGACTTTGCTAATATTTTGTTCCTTGCCGTATCTTTTACTGCCTA
AAACAAATACATCTTGATATATAGTAAGTGCTCTCTGTATATTTTTGCTGAATGAATAGA
TACTGCCCCAACCCCCACAAAAAAAATTTTTTTCTGTCAAATTAGGGCAAGAAACAGGGA
CATTGAATATTAAGGAAAATGCGAATTTTAGACTAAGTTTTGAACATTAATTTTCATAAA
AATTGACCTGACTTTTGAAGGCTAGCTTTAATTTAGCTTAAATCTATAATTTCTAAAAAT
TATATGATAATTTCTGTCAAAGAAATATATTAAATTACTTAAGAATGAATTAATTGTAGG
TTAAGAAAGCAGTTTAATATCTTAATGATATGTCCTGATTGTAAGATTTTTAATCTGCCC
GAATTGTATATACTTATTTACTGCTTTATTATGAATTTCTTTAGAAAAGATTAGTTGTAG
AATTAATGTGATCATTTTAGTTGTTTTAGCTTGACTACTTTTTCAAAAGCAAATGTAGAT
TTCTTTCTAAATAGATGAGAGAAAAAGAGAGAAAGAAACACTCTCCAGTTTGCCTCATTG
CTTTGTTAATAATCCGCTTACTTCTCGAGAAGTAGTCTGGAAGCTAAGCAAGCACGGGGT
TGCATACTGATATCTGAGGAGACTAAAGTTTTTTCACCCTGAAAACTTTGAGTTACAGCA
GGTCTAAAATTCACACATTATATATCAGCTTTGTGCATTGTTGTGCGTTTTAGGCAAGAT
TTCAAAATTTAAATGAAATGAAAAAGATTGGTCCACCCTGAGTCTCAGTTAGCTTTACTT
GGGTCATGTTGTGCAGGATATACCTAACATTTTCTTTAAAAAACAAACTATTCCATTTTC
GATGTGTAAATGTACCTATCAAGCATGGTGGTAATAATTCATTTCTTTGGTATTAGTTTA
ATTGTAGTAAATTTTTTGAATTATTTTGAAATTTCTAGTGTAGTTTAAAAATAAGTTTTA
TGAGTAGTGAGAACAATAATGGGGAAAAAATTTAAAATTGTGAGCTTAGATAAATCAATT
TTAAGTTATAATAGCTGGAATATTTATTATTACTAATTCCTGAAATTGTTATTGTTTGTA
ATGTTTTCTGTCACTAGAAAATTAACTTCACCTAGATTACAGTGTTCAATTAGATTTGAA
GATGATTTCATTTGTTGGTTGATTAAATGTACATGCATTTGCACATATTTATGCACATTC
CTTTTGAAGATGCTTCATATAATAAGTTACTAGAATTCAGGGCTGGGATAAAATAGTATC
AATTAATGAAACAGCTGATAATTAGTAACCTTTCTCAGATATGTCTTCTTATAAATGGAT
CTGTTACAGAAGTCATGTCCCATTTTCTGAGTAACGTCTCTCATGGCTTCTTTGTTTTTC
TTGTCCATTGAAGTTATATGTTAACAACTTTGCCACTGATAACTAAGTATCCAAAAAATA
CATACTATCAACCTAACTGGTCATCTGTAGACTTCATGCAGTTAACCTTATGCACCAAGA
AATTAGAGTGGTCTTTGTTAAATTCTTATTTTCATACAAATACCTAACATATATTACCAT
TTTATAAAATACCATCTATTTTCCATTTTAATTTCTGAATTAGTTTTTCATTCCTTCCTC
TCCTCTTACTCATATTCTGGGGAGTGGATAGGTGGGAAAGATGCTGAGAAGAGAAGAGGT
TGAAATATGCTCACTTGAGTTTGAGGAGCATTATGAGAGTTTGTGGGAAAATTCCATTTC
CTTTCACTTCTGTTTTTCCATGAAATTTCTGAAGCCCTCTCCTATATTTTGAAACTTTTG
TGGGACTTTATTTTGGATGTGAAGGGATGTTCCATAAGAATACTTAATTCCTAGAAAGCT
TCTCATCTGATGCAAAATTTCAAGTTTTATTTTTAAAATTGTTGTACTTGAACCAATGTC
CTAAATATTTTTTGGTATTTCCATTTTCAGCAGTGGTGTATGGGACACTTAACTTTAATT
TACTGCCTTTAAGGAAATGTTCATATTGTCTCTCAGACCATTGCTTTCATCTTTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCTACTATTGTTTCTACCACATTTGTTCATTTATTGGTGGACACCAGTATTAATTCCA
TCTTTGGGCAGTTATGAATAATTGTTCTGTGAATATTGGCATACACGTATCTGCTTGAGT
TCCTGCTTTCAGTGCTTTTGTAACTTCATTGAGGAGTGGATTTATAGGGCCTCTTGAGAA
ACCACACAACTGTTTTCTGTAACAGCAGTACAATTGCAAAACATTTATATACCTCTCTGT
TTTGAAATTTTACTGACCCCACACACATATCATTTGCTCATATCAGATGTTAACATAAAT
ATAGCTATGCCACCAAAGGCAGTGTGCTCTCACCTTGGGCAAGGAAGTGGAGTTCTGAGT
GGGTGATTCTTTCATAGACATATTTTGGTTATTATTGAACTATCTGACCCTTGGCTTCTT
GCTGTTGAAAAAGGATTCTGTACTTAGTAGTAGGCCGTTACTGTTATAGAGATACAAGTG
TTTTGTCTTTAAGGATTCATTTTAAAATATGTTAAATACAGTCTTCCCTCATGATAACGA
GTTTTTAATATTCATAATTAATAAAGAATAATATAGCTACTACTTTTCACTTTGTGCTTT
TTGACTAATCTCAATACTAATTTATTTGCCTCCTTTCTTCATTTTGCCATAATTGACTTG
GACTGCACAGATCCTTTCTCTGCTACTGTAGATGCTGTTGATGATGCCATTCCAAGCTTA
AATCCTTTCCTCACAAAAAGTAGTGGTGATGTTCACCTTCCCATTTCTTCAGACGTATCC
ACTTTTACTACTAGGACACCTACTCATGAAATGTTTGTTGGTAAAGTACCACTTAACCTT
TTTTTTCCAATTAATGTTTATACTGCTAAGTACTTTTCACATATTCATTACTTATTTTAA
GATAATGTAATTATTACTTCGGATTTTGAAATAAAGGAGATAGCATTAATGTGGTTAAGT
TTTAAATAAACATTAGTAACTCTAATTTTAATACAAGTTCTTAGGAAAGAGTTTCTTTTG
AAGTTGAACTTTTTTAGTGTCAAAACTCTAGGTATCATCATAGGCAGCATTCTGGTTATT
AGTGCAGAAGATTGGTTTTTAGGAGAGTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAGTGTTCATGT
TCGCATAGTATGGATAGCATCTTTGAGTTAAAAGTGTTTTAAGGCTTGAGTAATCGTAGA
ACAGGACCAAACTCATATACCCTCTAAAAATTGGTGACCTACTGGATATTCATTTATGAC
ATAAAACACTGCTTTTAAAATAGCAATCTTAGGTAATATTGGTGTGTACCACCTTGTGTA
GGTCGTTATAGTCCTCTGTCTTTGAGAACAATCTTCCCCATCCCACCAGATCTTGCCTAC
ACTTTTCTACTTTTTGAAAAATTTTATTGGATTTTTTTTTTTTTTTAATAATAGCATCAT
TGTACATTAAGAATTCAAAGTGAGAGTCTGACAGACTGAAGGTTCTTTAGCAGAGGTCGG
GGGAAGAGAGAAAATCTGTTAGTAGTCAAGAAGTTGAGCTTTTTCCAAATGTGTAGGTGT
TGATCTTTTCATATTATATTTCTTTAACACCCTGACTTTACATAATTTGGAGATGGGAGC
ACCCTTAACAGCCATTTATTGCGTCCTTCTACAAAATGCAAGAATTCCTTCTTTGTGGCC
ATTGCCAGCTTGTTTTCTGCTTGGATATGCTTAGAAATTGAAAGCACTCCAAGCCATCTT
GACAGCCTTAATATTTTTAGATTATTTTAAATCTTCTCACCCACTAGAGAATCAGAACTT
TACCTAAACAAAACAAAAAACTGCTTCATTTAATTGAACATTTCTTGCTTCTGCTACCTT
AGCATTGACTGGTTTCAAAGAGCTGAGCATGGTATTTACTTATTGCCACTAGCGTCTTTG
TAATGTACAAAGGAACGCAAAAGTCTTGTTTTATGGTCTGGTGGTAGTTCAAACTGCTTA
GGTAAATTAGCATATTTGATTGCATTCTTGTCACCGTCTGCTGTTGGAAGTAGTAAGTTG
AAGTTAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTTCAT
TGTCAAATGTGTGTATTTTGTTTTATATTAAATCTTGAATTTTAGGGTGTGTTTAAAAAT
TATTGTAATCATATAAAATTAAAGTAAAATACACAATTTTTAAAATTTCTGTAGTAAAGC
AAAGTAGTGATTAACATCAGTTGCTCTTTGTCAGATTGTTATGAAAAATGTCACTACCAA
AATAATGTGGTGATATAGAAAATGTTTTCCTTGAAGACTTGAGTGTTTTTGGTTTTTTTT
GTTTTGTTTTGTTCCGTTTTTTGCTCTAGGAATTTATTGTTCTTTCAATTTTATTGTTAT
CATTATTAAAGAATATAAATGTAGGGTTATTAAAGAATTGTGCTTTTTCCATTTTGATTT
GTTCAGGATTCACTCCTTCTCCAGTTGCCCAGCCACATCCTTCAACTGGCCTTAATGTTG
ACTTTGAATCTGTATTTGGAAATAAGTCTACAAACGTTATTGTAGATTCTGGCGGTAAGA
GAAAAAAATATTTTTCTTCTGGTAACAATATTATAAGAACTTAGAGTCTGTATAGGGAAA
TATAATGCTACTTTGAACATGTATAAGTAGATAAAGTTGGAGTAGCCAATGAAATTACCC
CCAGCCCCACCGAAAGAGAACTCTAGGGAACTACTACTATTAGCCATTTCCCTTCTCCTT
TGTGACAGTTTTGATCAAATCTTGGGAGATTTTGTTTCTTACAGAACTAATGAGAGATAC
AGATTTTGCTCATAAGTTAGAATGCAAAGTCAGTAGTAAATATTTTTAGAAAGCCTTTTT
AGTCATTATTGAGGAGCCATGGAGATGCTGTGGAGTAAGTGTTACTAGATTGCTAAATGC
AAGGTCAGTGGTTCAACCCCAGTAGTCACTCTGCAAGAGAAAGACAGGCTATTTAGTCCC
ATAAAAATTTATAGCCTTCATTCAGAACCCTACATAAGGTCTCCAAGTGTCAAAATCAAC
TTGAGTGGGTCAGCCATTATAATTCCTATATTTCCTAAAATAGATAATCTGTTTTAATGT
AGGAAACCACCTGATTTTGAAAACTAAGAAATTAGAACTTTTAGCTACATTGACTTGTTA
GATGGTATTTCCATAAACACTGGACTGCAGGAACTTTTTCGTGTTTCAAGAATGACTACT
ATAATGTGCTTATTCAGTTGTATTAAAAGAACTTTATAATTCTTGGATCTAAATTTCTAT
TTAAATCTTTAGTTAATATATTGTTAATTTGAAATTTGTGAAGATTAATAGTTTCAGTGC
TGGCACTCAGTAATTCTACTCATACCTGAAATAGTTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGTTAACTGGAGGATCTAACTGGCACC
AAAGGTTGCACCAACAACTGCTTGGAATGCTGCCACGATGATGAGTTGGAAAATTCATGA
TATTCTTCCACATGAAAATGTTTTTAAAGTGAAAGGCATACATGGATTGTTGTTGAGCTT
TAGAAATATAAGTAATTTATATTACTTTTCTAGGAATTTTATTGACTATCTGTGAAGCAT
GTTTTAAAGCTAACATTTATTTGTGGCTTACTACGTGCCCAGTATTGTTCTAATAACAGT
GTAGTGCTATCTTATGTAATCTTCAAATTAACCGTATTTGATAGTAATCATCTGCACTTT
ACAGATGAGAAGACAGAGGCACAGAGCTTTGAAGTAATATGTTTATGGTAGTTGGGTTCT
TGAGTCATTGGATGGGTTGCTGGAGCCAGACAGCTTAACACCAGAGCATAAGCTCTTGAT
TACTCCCTTCTCTATATGGCTGGGTTTCAAATTTATTACTTAACCTATATACTCGAGTAT
AAGGCGGCCCGAATATCAGCCAAGGCTCCTAATTTTACCACAAAAACTGCATTTAAAATG
TGCTGAAAAGCACAGCTTGTACAGAAGTATATATATTTTTTAAACTTTATTTATTTATTT
TTTAAACATTTTATTAAAGGGCTCATACAACTGTTATTGCAATCCATACACACATCAATT
GTGTAAAGCGCATTTGTACATCATTCTCAAAACATTTTCTCTCCACTTAAACCCCCCACA
TTAGGTTCTCATTTTTCCCCTCCCTCCCTGCTTCCCCCTTCCTCATGAGCCCTTGATAGT
TTATAAATTGGTATTTTGTCATATCTTGCCCTGCCCGATGTCTCCTTTCACCCACTTTTC
GGTTGTCTGTCCCCCAGGGAGGAGGTCACATATAGTTCCTTATAATAGGTTCCTTCTTTC
CTACCCAGTCTCCCTCTACCCTCCCTATTTTGCTACTCTAATCTCACTATTGAGATCAAT
CCAACAAGTCTCCCTGGATCACAGAAAATCTATTTCTTACAGAAAAAATTAAAATGTCTT
CTTTTAGTAGTGTACTAGTAGTAGCATTTAGATCACACAGGCTACATATGCCACCCTTTA
TTTTTGTTGGATCCACACTGTCCTTGTTATAGTCACTTTCTTGTTAAATTCCTTCCAGAG
TATTGCCCTATTTTCTCTTAATTGTTAAGTTAGTAAGATTGAGCTAAAACTATAATATAC
TGATAAATGTTATGTTACCTTATCTAAAGTATTTTATTTGCACCATACCTCACAAATGGG
AAATAATATAGACACTTAGCTCCTTTAAGGCAGTAATTATTTACTGGTAGAAGTAAGTAT
CATTACTAATAATGAAACTTCACATTTAAATAGTTTATACATTTTACATATTATCTTTGA
ACATGTAATTGGTGCACTATTGAGGTGATTTCAGCACATATAATTATCTCAATTTTAAGA
CATGTTATATAAATTTAAGGTATGTTTCTCCTAAAAGTGAAGCAGCTAAAAAGTAAATTG
AAATCCATTTTTTTCTAACATTGAATTCACTGTTTTTCAGTTCTATTACAGTTTCTTGAC
TTAGGGGATAGTAGGAGATTAGTGGATTTTATAGTCTCAAGTATGAATTATGCACTGACA
GTGTGTGAATGATGATATAAATACCCAGACTAATATCTTCTTATTTTATCGTAAATTAGT
ATTCATGTGAAATATTAATAGTTAATAGACCACTTAATATTGACAGCTAGGAAGGATGGC
ATTTAATCTTCTAGACTATGTAAGTTGGTGATATAATAGCAGTGTTTATGGTGCTGTGTT
GTATATGGCAGTGTCTGTCATCTCTTAATGATTTTGTTAACGTTTCTTTGCATTGTATTT
TATAGATTTGCTCTTTAATGGCTAAAGTTTAGGGCTGGTGATGAGATTCACCAGTTAGAC
AAACTGCTGCCTGTGACATTTCTTTACATTTCTAACCTTTTTATTAATCCTTAAACACTG
TCAAGGTTTAAACTCTTTTTGTTTTTAGAATTTAAAACAAATACTTATGATTTTATTAAA
ATAAATGATACTTTAATACAGATTCTTTTAATAACTTAATTGCTTGCCTTTTCCCTCACC
TATGATAGATGCCATTAGATACAACTCTTTTTATGGTATGCATTCGATTGAATTTTTGCA
CCATTGACGCTGATAGAGTATATATTCTGAAGACACTTGTAATCATTAAACATTGTTCAT
TGAATGTCCCTGGTTGGTCCACCTTGACAGTGTTTCAATGTAGATGTTCTTTCATTTGAT
ATACCGGAATTACAGAGGATTTTAAGTAGTTAGTGAATGTACATGTGAACTAAAATGCTC
TCTGTGTATTTTGTGTTGTGTAAGTACTTGTTCTAATCCAGTGTTATTGCATTATGTAAT
TGTTCTTCCCTGGGAAAAACAGAATGGCATGCATTTTCCACAATACGTAAGTGACCAAAA
ACTAGCCTTTTTGCAATAAATTGGCATGCTATTAACCACTGCTATAGCAGAATCTCATAA
TCTTCCAGCTATTACTTGTTTTTACATTCAGATTTTCAATGTGCCAAAAATTCTCTCTAG
CATCTACTGATTTCATGGGTGTGTTTCAGAATTAATTCTGATGGTGGCATGGGAAATACC
AGTTTTTTTTCTGCTACTATTCCACCATTGCTGCCAGATGCTGGGTGTCTGTGTGTGTAT
CTGTGCTGCCACTGTGCACTGATGACTTCTGAATGGGAAGTGTGGATTGTGACAATGTTT
AAAGTAACAACTGCATGAAATCTTACAGGCTTCTGCTATTTTTGGCAGTTTGTCTACTGC
TCTTGCAGACTTTGGTTTTTAAGTAGGGAGAGACCAATAAGCCCTACATGCTCCCCCAAA
TACTAAACTTTTAACTATTCACTTTAGTGTTAATTTTTAAAAGTTATGCTTTATTTAACT
TCTTCTCCATGCTCATATTCAAATTGCCACATAATTTCAGTTTTGTTTTTGTTTCTTTTG
ATGTTTCAACAGTGTTATTGGTCTTTCACCTTTATTGAGTTTCAGCTTTCATTATTAGAT
AGCACACAGGAAATGTTGTTAAGACAGCAAATATATCTAAAATAATTTTGTGTTCAGATA
ATTCATTAAAAAAAGAAATAATACCTATTGATCAAGTCAGTTCCAACTGATAGCAATCCT
ATTACAGATGATGAATTAAAGCAAGAGGAAGAGGGGAGCTTAAACATCTCAGTGACTGAT
GGTTCTTTTAAGCTTTAAGGCATAAGCTGACCTTAAAATTTAATACCCTCTTTCAAATTA
GTGCTGCACAGAAAATAGTTCCATTTCTATGAAATTAAAAGGAAAGCTAACTTATAAACT
CTTTGTATGAGGATTATTATTCATAGAAATAATTTATTCAGTAGTGGTTTAAATCATTGA
GCTTTGAAAAGTGAATGAGATCCTTAGAAATTAACTTCTTAGAAGACTAGGTTATAAATT
GATTTAGGATTTAAAATTTTTTCTTTGAATGCTTAAGAAATGAAGTACCAAGAAAATACT
CAATATTTTTTTTCTTGGCAAACATTCTTTGTGTTATTGGTAGACTATACATTTTAGAGC
TTTGAATTTTTTTTTAAGTCTGAAAATTTTTGATGCTCTAAAAACTCAATGAAATCCTGT
GTAACTGTTTAAAGTGATATTTTTCCTTTCTAATAATTTTCTGCTTATTTAAATTGTTTC
CCCCATTGGACATTAATTGACCATTATTAATGATCACAAGTGCTACTTAATCACAGCTGT
CTTAGCAATTCTTTTTAGTGGAACTACAGCTTTTGATTCCTTCAATTCAATATAAACACA
TAAGTTATACTTCCTTTTTGTTTTTTCATTCACTATGTCAGGCACCCCCAGTCATGGCCT
ATCCTGCTACTACACCAACAGGCATGATAGGATATGGAATTGTAAGTATATTTTTAGTTT
TAAAAAATGTTTTCATTTATATTTATAATGTTCTTATTATAAGCATAACTGGAAGAATGT
ATTCCACCTTGTGCCTAATAGAGTTTCTAGTATGATAGTAGTTACGATTAATATTCCTTA
GAATAAATGTTACACGATATATGTAACTTAATTAAATACACAATATTACTGTGGTATATT
TATCTGCCTAGCACTTTTTTCGATAGGCATTATAGTGATAACAAACTCATTTAAGTGCTG
TAAGAGTGTGTGCAGTGGTGGCACCTGACTTCACAAAGGTGAAGAAGAATCAAACTCAAC
ATGAGCCCAAGGCCAATTCCTATGAGGAGGAGATCATGCCTTCACCCTCCAACCTTCTTT
ACCAATTCGGGTACCAGCTGCCCCTCCCATTACACTCTATTTCATTGCAATCGCCACACA
GGAACTCACAGCCGATACAATTAATGGCCTCATTTGGGGGAAGTAAACAGATTATAATTC
AGGATAAAAAACACACAGGATACAGTTTTTTTTTTTTTTGGTCAGTACAGTCTCTTTTCA
GTTGTTCTTGCTTGTACAACTCTCTCGTCTAGCCACATGACCTCTTTGCTTCTATTCTGC
TTAGGCAATGTTATAAAATTCTCTTTACTGCTTCCAATAAATGCCAACTCAGCCATAAGC
TTTAGCCCAAGGCGCTCATCTCTAATGCCATGGACCAGAAAACCTAGCTCCCCTGTTAAG
CACCTAGAGACAGTCCACGCCATTAAGGGAACCTCTTCAGTGACATTGGAACTTTCTTGC
TCCACGGGCTGAGAATGTGGGCTCACTGTTCTGTCGGGAACTCGTGGTGCTACACCCTCT
GGAAGGCACGGCTCTGTGTCTTGGTTCAATACACAAGGATCTTAGGGTCAGACGTTGGGT
TCTACTCCTAGTTCTTATTTTCTTTTGGTTGTGAGATCCTCCAGCCTCACTTCTGAGATG
GCTCCTTGGAAATCCAGCAGGATTGCAGACTGATATATCTCTTTAGATTTCCATATACCT
TCTTTACAGATAACCACCCAGCCCCACACCAGTCACGTGTGTGGGAGACTATTGCTAGAA
GAGCCATAATCAATATTCACAGCACCAGCAGAGTTAATATTAAATCTGAGCCTTTGTTGG
ACTGACTATAAATTTAATACCTGTAAGGTTTGTATAATCATAATAAACTATAGGGGGAAA
GAGGCTCACGCTTCTTGAATTCCTTAGCTGTAAATTTAGCTAGGAAAAGCCATTTCTCCT
GTGATTTTATAGGACAAAAGCAGCCTGTTAACCTCTAGGCTCCTATAATGCTGCAGTCTA
GACCGGGATTTACAAGTCCTTGTCTATACAGACTTACTTAGATACGAATGCCAAGGAGTG
ACTTCATCCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATCTCTA
ATGCCATGGACCAGAAAACCTAGCTCCCCTGTTAAGCACCTAGAGACAATCCACGCCATT
AAGGGAACCTCTTCAGTGACATTGGAACTTTCTTGCTCCACGGGCTGAGAATGTGGGCTC
ACTGTTCTGTCGGGAACTCGTGGTGCTACACCCTCTGGAAGGCACGGCTCTGTGTCTTGG
TTCAATACACAAGGATCTTAGGGTCAGACGTTGGGTTCTACTCCTAGTTCTTATTTTCTT
TTGGTTGTGAGATCCTCCAGCCTCACTTCTGAGATGGCTCCTTGGAAATCCAGCAGGATT
GCAGACTGATATATCTCTTTAGATTTCCATATACCTTCTTTACAGATAACCACCCAGCCC
CACACCAGTCACTGTGTGGGAGACTATTGCTAGAAGAGCCATAATCAATATTCACAGCAC
CAGTAGAGTTAATATTAATTCTGAGCCTTTGTTGGTTTGACTATAAATTTAATACCTGTA
AGGTTTGTATAATCATAATAAACTATAGTGGGAAAGAGGTTCTCACTTCTTGAATTCCTT
AGCAGTAAATTTAGCTAGTAAAAGCCATTTCTCCTGTGATTTTATAGGACAAAAGCAGCC
TGTTAACCTCTAGGCTCCTATAATCTGCAGTCTAGACGGGTTTTACAAGTCTTTTTCTAT
ACAGACTTACTTAGATACGAAGTCAAAGTAGTGACTTCATCCAACTGGTTCATCAGGGAG
GAAATATTTGCTCATTGAAGGCATCACACTGCTCCTTGATTTTGCTACTATGGCTCCTTG
CACCAGTGTAAGTTTCATGGTTTATAACTTGCTTTGGTATCCCTTACATAAAAATGGAGT
CTATGTAAAAATTCAGACCGTAAACCTAAAGTGAAGTTCTCATCTGTTTTTAAGCTTAGT
TGCTAGAGAATTTCTAGGGCTGCAGGCCTAGGGTCCAGGGTCCTTCATCTACTTGGAAGA
AATTGGTTTGTGTTAAAGAAGAAAAGTGAACTGTAGCAATATCAACTTTTTGAATAGTAT
TATAAAGAAATTAATCTTGTCCACAAAGTAATTTTAGCATTACAAATAAATACACATATC
TGAAATTTAAGATCTAAAGAACCATTCATCTGTAGTTAGTGAGATTTAGAATTGGCTAAA
TTAGCATCCATATATTATTCTTTCCATGTTATCCCAAGAAGAGTTTAAATCTTTCTGTGT
CTTTGACTAGAAGTCATACTTAGTTACTTACACGGCCACTATAATCTTGAATTATTGAAT
TCCATAACACTGCAGATAACAGGATCACTATGAGTCGAAATGGCAGGAAGTTTAGTTTGG
TTATGGGAGCCTACTTGATAGACTAAATATAACATGTATTTTGTATGCTGGAGTGGTGAC
TTTTTAACGAACATATTGATTGACATTCTATTTTCAGTTATTCAGAAATTTGTAATCTAA
GCCCCTTTTTGGTTCTTCATAAAAATAACTGATTGAATCATCAAGAGTAAACATCTCCAA
AGAGCCAGATATCTTTATATGTAATCCTTCCATAATGGATTAAGAACTTGATTTGATATG
TAAAGACAATGTCCTTTAAGTACCTTAGAGTTCTATACTTCTTCTAAGTTTTCTCTTTGT
TTAAAGTTGGCAAATTTGGGAATTTTCGAAGATTTTCATCGAAATTATTTTGTATGCTGT
TATAAAGTTTAAAGTTTGTAATTCATCAAATACGGTTACTTATTAGACTGTGTTACATCC
TTTTTTTAAAATGACCATAGTAAATATTTTTCTTGAGAAACAAAAAGCTTATGCCTGGGT
TTGGATTTTTATGGCAGGCCCAACCCCGTGGTCCTCTCATAGTGTCCCTCCTCAAGAACA
TAAACTGTAGACCCGGACCATTGCCGTATCTGCTCTTCCAGCCCATACATCGGCTTAGGC
CCTGAAGTGGGTTGTACAATGGGGGGACCTTCGGAAAATGTTTGGCTCTGAGTCTTTCAT
TCAAAGAAATTTTTCCTTTGGGTCAAAGCAGAGATCCCATGGTTTTCATTCTAGTTATCC
TTATGTATTTACTACTAGGAAGCACTGAGTTGATACCCTTTAACTTGGTATTCTTTCATT
TTTTTAGCCTCCTCAAATGGGAACTGTACCAGTAATGACACAACCAACCTTAATCTATAG
CCAGCCTGTCATGAGACCACCAAACCCCTTTGGCCCTGTATCAGGAGCACAGGTATTACA
TGCTACATGTAGCTGTTTCAGTGCATTTGATGATTTAGAAGGAATAATACTGGAAAATTC
TTTTATATGATTTTACAAACAATTTTCTTCTTTGTGCTAAATGTTACTTAATGTCTCACA
CAAACGTTTTAAGAACATTGGTCATTTGGAGGGAAAGAACAAGCAAATTTAACATTTTAA
ATATGGAAAGTTTGTGATGATTTATAATTGGTGGACCTTATACTTTTATAAGGTTAAGAA
ATTTGCTTTTGAAATAGAGGAAAGAACCTGGAGGCAAAAGACATTTATAGAGGCCTAAAT
ATAGGCATGTACATATATAAGTATAAATATAACGAGAGGGGAACAGAATTATGTACTCAT
ATCTATATGTTAAGAATTAAGGTTACAGATGGACATTAGGCCTCAACTCAAGTACTTCCT
TAACACAAGAACATTTTGTTCTAACAATCTGGCATTCTGTGGTACTCACTTTTCAAACAC
AATCACTGAAGACAAAGCGGGTGCCTAAACAAATGTGGTGAAGAAAGCTCATGGTTCCTG
GCTATCAAAAGATAAAGTTTCTAGGGTCTTAAAGGCTTGAAGATAAGCAAGCAGCCATCT
AGCTCAGAAGCAACAAAGCCCTTGTGGAAGAAGCACAGCAGCCTCTGTGATCATGAGGTC
GATGGGATCAGGTATCAGGCATCTAAGACCCAGAATAAAACCATACCCAATGTGAATGGG
GGGCGGCATGGAGTGGAGAACCAATGCCCATCTGTAGACAATTGGACATCCCCTCACAGA
GGGGTCACAGGGAAGAGATGAACCAGTCAGGGTGTAGTATAGCACCGATGAAACACACAC
CTTTCCTGTAGCTCTTTGGTGCTTCCTTCACTCCACTATTATGATCTCAATTCTACCTTA
CAAATCAGATTAGACCAGAGCATGCACACTGCTACAGATAAGAGCCCGAAACACAGCAAA
TCCAGGATAGATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAACATTATTGACAG
TTACATTATTTACATTATTTACTCATTAATTACATGCAGCTATAAAAACACCGCTCCTGT
TTCATTCTTCTGGGTTTTTTTAACCCTTTTCTCAAATTAAAGGAGCCCTGTTTGCACAGT
GGGTTGGGTTCCCAACCACAAAGCCTACAGGTTGGAACCCTCAGTCATTCCGAAGGAGAG
ATGAGCCTCTCTGCTCCCCAAATATTGACTGCCTCAAAAACCTGCACGGGAAATTCTATC
CTGCCCTATAAAGTCATTGTGATTTCAGAATCAACTTATTGATGTGAGAGAGTGAATGAG
TTTCTCAAATGGCTTCTGATGCAGCTGGTTGGTTTTATTTTATGTATTAAATATTTATTT
GAAAATGTGTGAACATTTGGAAATACATATAGCATCTTAGAATGCATGTAGTATGACATT
AACCATTGAATTACTGTTGCATTGCCACAATTTGTATTGACATTGTTTGATTATATTCTC
TCTATATTTTATAGATTCGAGGAACATAGGGACTCGGTTTTCAGCCTTTAGAAAATTTGT
TTATGTACAGTAGAATAGATCAATTCAACAATTTTTACTTGTACAATTCAGTCTCTGATT
AATGAAGTCATTTAATTGGCCTTTCTTTTTTTTTTTTTTTTAATTGTCCTTTCTGTGCCT
GGCAATGGATAGTAAATTTAATTATGATAGCTTTTACAATAAACATAATTGAAGTCAGAA
TAATTAGTGTTTTTATATCAATTTCTTATCATTTACTTTTCTAAAATAGAGAATTTATAA
TTACCCTTTTTTCGGGTGACATTAGTTTTACTTGTTTAACTTGATTTCAAAAATTAGAGT
TAATAATCTTTTTTAAAGAACATTGATGATTTCCCTACCTATCAGTATAGCTGTTTTCAT
GAGACTGTACAATTAGAAGCTCTCTTCACATCTTTCAGTTTATTCTTTGGTGTTCATTCT
TTCAACTTCAGAGCGTCATTTATTTTCATAAATTAATGTGATTTTATGCTTTAAGGAAGT
AAGTCATAAAAACTTTAATGTCATTAAGAAGAAAGCTATAGTCCGCAGCTGTAAACTGAA
TAGGACCCGCTGACAGAAGTTCTTCCTAAGCCCTGCACCCAGTATTCCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNACACTTAAGAGAACCCCTGTCTTTCAAACCTT
ACCTACATAATTGGGAACAGTACTGTATCTCTACTGTAACAGATTGAAATGCAACATTTC
CTTGGAGATACTATGAAATACCATGGATGTACCTCTCTCTATAGCTGGGTTCAAAGAAAT
CACTGACGACCTGTGTCCAGACGGTGGCCATCTCCGGAGAGAACCCTGTTTAAAGCTATT
CTGGTCTCTAGGAAATTTTATTTTCACAACCCTATCAGGAAAATATTTTAAGCCAAGTAC
CCCTAGTGTATGCACATTTATGTTACGTTCATATTTTTCTGCATGATTTATTAAGTACAT
TAAAAATGTTTCAGAATATAGACTTTAAAAGGCTGTGATTTAAAAATGGAGAGAAAACTG
TTTTCTAATATCCTATTCCACTTTGGGGAGCCTGATTGTCACCAAAAAACATTTGGATTT
AATAAGCTTTAAATGCCTACAACTGCGCATTGTTGAATTGGCATATGTTCTGCCACGTAT
ATTCTCCCCAACAGTCAAAGTAAAATAAGATTTTTAAGTAAACAGAAGAATCCTCACGGA
GAGAAACACCGAGCTCAGAGCAAGAACACAGATTCATAGCATTTTAGCAGGACTGGCACA
CCAGATAGATGGACATTGATTGGTAAGCAGTAGGGAAGGTTAAACTAATATTTGAGCTGC
TGGTGTATGCTATACAGTGTGTAGGGTGTTTTATCTATTCCTTTTTTAAAAATCATTTTA
TTGGGAGCTCATACAGCTCTTATCACAATCCGTATATACATCCACTGTGTCAAGCACATT
TGTACATTTGTTGTCATCATCATTCTTAAAACGTTTGCTTTTTACTTCAGCCCTTGGTAT
CAGCTCCTCATTTTTTCCCTCCTTCCCTCCCTCCCTCCCTCCCTCACCCTTGATAATTTA
TAAATTGTTATTATTTTTTCATGTCTTACATTTTATTCTTATTTGGTCCTCAAGGCAGTA
CTGTTAAGAGCCTCTACAATATTTGGAGTGACTGAAAATTTCAGATGTAAAGATGTGACA
AAGTTGACGCTTCTTTAAGAATTGTAGGAACAGCCAGTGCTTTGTCGGAAGTTAATCCTG
CGTATTTAGCCCTGTACCATCCTCTACGCTTTTCATTGCACTCGTTTCCTGTTCTGGGCC
GACTGTATCTTCTTGTTCTAACATGAAGTTTTCCTCTAGTGTTACATAGGAGTATAATGA
TGGAATACATATTTGTTTTGTGATGTTGAGAATCGAATTCTTTTTTAAAATTTCTTAGAT
ATGTTTGCCATTTATTAAAGTTAATTTATGTTCTCTGTGCTTTGTGTTTACTAAATGCAG
TATAAAAACAATTAAAAAAACTTTCTTATGGTGATGGTTTTTTTTCTAATGTTAGAATTC
TCTTAAGATTTTAACATGTTTTTCTTGAAACATTGATTAAAATGAGTAGAGAAGTTTTAG
CTAATAGTTGCCATCATTTGTAAATATCAATTTTTTTATCTCATCCTCTTGATGCTTAGT
TTTCCTTTAAGAAAGGAAGACGGATTATGTCTATATTGGACTCATAAAACTGGCCATTTT
ATTTAAGAGACATACATTTATGATGTAAACAAACCGCACAGCTTGTCAGGTTGACTTCCA
CCCAGGGCTATCCCATTAGTACCCAAGTCTGTGACCTCACAGAAGCAAATCACCTGGTGG
GCCTACGTGGATTCCAACTGTTAACCTTTTGATGAGTGCTTAGGCACTTAGCCCTTTGTG
CCACCCAGCAACTCCATGTGTGCTTTCTAAAACGTAGTTGCCATCAAGTCAATTAAAACT
CATAGCAGTCCTCTAGAGCAGAGTACAGTGACTCCTAAGCATTTCCTAGATGTACATTTC
TACGAGAGCAGATAGCCTATCTTTCTCCCACAGTGCATCTTGTGGGTTCAAACTGCCAGT
TGTATGGCTAGCCGCCCAACACTTTACCTGCAGTGCCACCAGGGCTCGTTAAGAGTGTCA
CCAGGATTGGTTTTATTTGAGGGGGAAAAATCGACTGGTATTAATTACACTAGTTCTGTG
TGAATTTTTGTTATAGGAACTAAATGGTTAAGCCTATTTTTAGTTATATTTGATACAGAT
TTTAGGTGACAGCGTGTTTATAGTAGAATTTGAGTGGGACAGTGAATTAAGATTTGCCTT
GTAAAATAGGGTGATTTTATAATAACTAGTTTTTTATTGTTTATTATCTAGTGTTTCAAT
CTTGCCTTTTTATGTTCCTTAGCAACCCTACAAGTTCTTGATTTATGTTCAAGAATGCTA
AGTAAAGGACAGCCAGCCCTTTCAGTTTCAGGAGTCCACCGTGGGCTCCACTTCCTGCTT
TCGGAGAGCAGGAGGGGACGACTGCAGCACATGCCCTTTCCTTCTCTTTTCTTGTTTGTT
CCTGGGCTGGCTGTGCTTTCGCTGGGCCCAGAGCCACGGTGTCCGTGTGCCTGGGGACAG
GTGGTGGAAAGCCGCTCCTGGACGCTCTACAAGCAGTCAAACCAGTCCAGGCCACACTGT
CATCTTTTCAAGATAGGTTTTGAGGGCTACTAAGTGTTGTTTTTTCATTGGTAGTACCGA
TCATACTTTAATTTTGCTAGAAAAGACATATATAAGTTTGTATTTTACTGCTTTGAGAGA
CTGGCAGAAGCACTAGAAACCAGCACGCTTGCCCCCTGGGGGATTGATCCTGTTGAACCA
TCTTCAAGCCTTTCTGCCTGATTTCAAGCAGCTCTGTCCCTGAGGAGAAGAGAAGATCTC
CTCGCTGCAGTGACAGTGTTCTTCAGGGACATTTTCCTCTAGGGCTGCCAGGTCTTTTAA
CTGCTGCCCTCGTGAAAACATGTGATCTAAGAAGATGTTTCCTCGGGGAACTCGTGATTC
TGGGTGTGATCTGTCTTTAATAGAGGAAGAGAAAATCTTTTCTCTGCTTTGGACTGAAAG
CCAGTTAATCTTGAAGATTAGTGCGTAACATAGGACTCCCGTTAGCGTGATGACTGGTGA
TTACTTCACTTGAAAGCATCCCGCCTCTGAATGATCATCCATGGGCGGACTGAGCGGGGA
AGGGCCTCTTCTGACTTAGGTTACAACTTCATCTCTGCATGGAAGATGTTTGAAACCTCA
AACCCAGACATGCTGCTGCCACTGCCTGCCTAATTCCCTCATCCTCCCCACCCCCACCCC
TTCTCCTATAGTCCTCAAACATTCCCGAAACAGGAAATGGATTAGACAAAGGACTCCACC
ACTAATACAATTAAAGGGGTGATGGGGTAAGAAAGGAATGGCTGAAAAAAATGAGACCAC
AACCGTGGACCAGCAAGACAGATTTAGAGGCACAAAACCTTTATAGGGTTTGAATGTTGA
AGTCAGAATTGAGATTATTTCCATTTGGTCAGCTGATTTCATTGTAGATTACACATTCCC
CAGAAGGACAATTCATTTCATAATAGCCCTATACTTCCCGATCTAATGCAAGGCGAGTAA
AAATTGTGTCCTAAGCACAAATGCTGGTGTTTGGTGTGAAATACGTGTAGTCGGCCTGGT
GAAGGAGGTGGGGAGCTTTACCTCTTGGTTCTTCAGGGACTGTGTTTCTTTGGAGAATAC
TAAAGACATGTTACCCAGCTCAGCAATCAGCCTGCCTTCAAGTGTATTCAAATTAAATAA
TAGAAACACACATTCAAGTGGAAAGCAAAAGCAAAGACCTCATGGACTCCGTATTCAGTG
CATACGTGAGCTGTCCTCGGGTCCCTTCCATCTCCCAAATGTACAAGTCAGCTCGCACAT
GTCCAGATAAAGAGGCAAGAGAGCGCCAATGTGTGAAGTGTGTAAGCACTCGGGACAGGT
TCCGCCTCTTCCAGGGAAAGAAGGAAGGGAGTTAGATTTGCACAGCATTGAAGGTAGCCG
TGGCACAGGAGACCATCTTTGCTCAATTAAACAAAAGGAGAAACTGCTGTGCCTTCTCCC
TGCCTTCCCGACCCCATCCCTGCCTCCCAAGACAGGCACCAAAGTCTACCCACGAGTCAG
CCTGTATCGATCTCTTTGGGCAAAAGGACGATTCCTTTGTAAATGTTCAGAAGCAAGAAT
TTGCCTTCTGAAAAAGCACATGCCATTTGATACCCTTTAACTTGACATGTGAGTGAGCTT
TTTGGTTTCGTAATTCCATTTTCCACAAAGGCTGCCTTTCTAATGATTAAAGATGACACA
GCCAAGCCACTTCTTCTTTCATTACATTCCCTGCTTTCATGTTCTGTCATTCTGAGACCT
TTTTTCTCTCCCTCTCTCTGTCTCCTCTCCCCCAGCTCTCGGCAGCGTCCAGCCCCTCCA
GTCACAGTCCTCACAGAGCCTCAGGAAAGGACCCCTTTGCAGAGCTCTCTCTGGAGGACT
TCTTATAAAAGTCACTTTAGGTATTGCTGCTTGTTGGGGGCAACGGGGACTGAAATACTT
TTTAAAAAATCACCATACATGAAGCACAATTCACTCTTCTCCTTTGTGTCTTTAAAGGAT
TCCAAGCTCTCCTGTCCTCTGCTCTATTTCTTAGATGATAAGTAAAATAAGTCAAGATAG
GACATGAGGAGAATCAACTTTTGGAAAATGTGTTTAACGTAATTCTTCAGAAGGTGTGAA
ATCCAGGGAGCTTCTTCCATGTGTATATACAGACGTGAGCAGCCAGTGCTCACAGCAGAT
GAGATCAGTTGCCCCCTTTTTAAAAGCTGGGCGTTTTAGTCACTCTTGAAACCCAGTGTG
AACAACGGCACAGTTTCACACATTGGATTCGAGCTTGATGGGCAGCATCGTTCCATTAGG
GTGAATATAATCATAACCAGTGTTTTGAAGCATTCATTCCAACAATTTATGTAAAGGATT
GTATGTTTTTATGTATCCCTTTTCATTTAAAAACTAACATTTTCAAAGAATAGTCATTGG
TTAGCATTTTATTTAAGGCCAAGTAACTGTTTACGCCCTTTTCAATAGAAGAATCCTGCA
TATGACCCACATTGTAGTCTGCTCTTCATGGGGGCTATTTCTACCCCCCAATTTAAATAC
ATCTAGATCGCTGGGAGTTGGGACTCTTCTGATTTGGCAAGTTAATTAGCATACCTACTT
GAGTCATTTCTTGGGAAGGAGAGAGTAAAGGAAGTCATGAGTGAAGTGTCTTGGAATGGG
CAGTGGCATGTCACTGAAAACGGTTCCTTTATAGATCCTTGGCCTTCTGTGTTAGTAAGG
AAATGATTTAACAAGCTTAACTCTGTTGTTCCCTTTTTACTTCGGATTTTATGGCATTAG
TTTAGAAATAGTATTTCAAATTGTGCTTTGCCAAATAAAAGTTTATGTGGAATACTTAGT
GCTCCTGGAAAAAATTTTATGAACTTGTAGAAAAGTCATTTGTTCACATCTTCTTTGTTT
CCTCCATTCTCCCTGCCCCACCCCCTTGATGTTTACTAATTAGAAAGGTGTTATGCTTCA
AATATTAAATTCAAGTACACGATCAGCTGATAATAGTGACTTTGTTTTAAAATCAGGACT
TGTGATAAACATACTGTAAGCACGACTGAGGCAGTGTTCTGGGCAGCTTTTATTTGTGAG
AAGGTATCTTACAGTGCAGGAAATTAACTTCACCATTTTCTTTTCTTTTTTTTCTCCCCA
GATACAATTTATGTAACTAAGATGGAAAGAATGGAATTATTTCAAAAAGACAAGTGCTCA
AGCGGCAAATCCTTACTTCCAGCAAAATCCGAACTGCTGTCTCTTAAACTCTTTTCTTCC
ACTAGAATGCGACAGTGACCAGGGAAGGCCCGTGAAGGGAATTGGGGCTAGTCGATAGGA
GAACGTATCCGTAGTTTATAAAGCCAAGAATGGCCATGATTTAAGACTAAGAGCTGTCTT
TTTTGGTGACTAACCCTTCAGTTCTTTCAACTGCTATTAATATCCATAATCAATAACCTA
CCAAAAGAAGCCCTTATTTGGAAAGAGTGAAATTTGCATTTGGAAAAGCTGCCTGGAGAG
AAGAACTATGTCCTTTCCTGTAATTCAACAGGACTCTTTTGGAGGGATAAAAATCATAAT
TCTTAATTATACAGTATCTTTCTTTTCTCCACTCCTGACAGATACAGAAACAGTAACTGA
AATTAACTTTTCTTTTAAAAAAAATTATATATTCAGTTTGCAGTAGACATTCCTTATGTA
TTTGTATTTATTTATGATTATCAATTTATGTAACATTAATATTGTATCAAACTTCCTTAT
GAAAATGAGTATGGATGTACACAGTATGTTTGATTTTTATCCACAAGAATGAATCTGATT
CAGAATGCTTTTCAGCTGACATACAGAGCACTAAATATCTCAAGGCAAGTCCATAGGTCT
GAATCTCATAAGACTTCTCGGTCTTTATGGGAATTAGGGAAGCATTATAACTGCGTTAAT
CTTTATAGTCAATTCTGTGCCTAGGATTTTGTAAGGGGACAGTTCACTGACTAGGAAAAG
CACTACATTTCAAATTCAGCATAGTGCACCGGGCAGGAACGTTACTGCTGTGTGCTTGGC
GTGTCGTCATTCTCCATCCGACATTAGGGCCTTTCCAAAATGAATGTGAGGAATTGCTTT
CACTTCAAGACTCCTTCTTTTCAATAAAACTTAGGAGGGATTCGGGGGAGGGAGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1130, 36197..36339, 37842..37917, 38537..38639, 49233..49326, 50497..50608, 52365..52471, 54677..54718, 55286..55371, 57223..57346, 57638..57771, 60859..60962, 66250..66399, 79386..79493, 80416..80547, 80648..80678, 80779..80810, 80913..80935, 80938..80979, 84821..84880, 88507..88611, 97561..97575
1001..1130, 36197..36339, 37842..37917, 38537..38639, 49233..49326, 50497..50608, 52365..52471, 54677..54718, 55286..55371, 57223..57346, 57638..57771, 60859..60962, 66250..66399, 79386..79493, 80416..80547, 80648..80678, 80779..80810, 80913..80935, 80938..80979, 84821..84880, 88507..88611, 97561..97572
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved