Echinops_telfairi Locus ENSETEG00000008891
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000008891
Echinops_telfairi
ENSETEG00000008891
GeneScaffold_5193
SNORA42
45248..45363
74720
GCCTGCCTCACCTTGACCTCGGACGCATTTCTATTGCTGTCTGAGGTCCCGAGTTGCCA
TTCAGCACAAATGGGGCCCCAGTTAGACGCTCGCAGGATCGACCCCACATCCCCACCGCT
CCCACCGTTCTCCCAGCTGCTTGGGGGACCCTCAGACTGGATGGGGATGCTAGAGCAGTA
AACACACCTGCAACTCGCAAAAAAAAAAAAAAAGAAAAGAAAACGTTTTCTAAGTACTGT
TTTAAAGGAAGATTTTAAAATTCAATCTCCAAGGGAGGGCTTAAAAAATTTGAGGGTAAA
GGATTTTAAATAGAATTTTTTGAAACCCTCTCATATATAATCTCCAAATCCATCTGTATT
CAGACTGTGATCATCCAAAATAGTATGTGACCTATATTTTAATTATGCATTAAAATATCT
AACGATATATCCTTTTATATAATACGATTTGTTGTGCATGCATATGCATCATATATATGT
AACAACTTGCCTCCACAACGGTTGTCCCAAATGATCAAAAATGGCCTAAGATTGCTTCTT
CTCTCCATCAAACGAAACCCACGACAATCGAGTCCATCGCGACACACATTGTGTAGTAAT
AATTAAGAACCTACGACCACAAGTTTTAAGAACCCAATGTCTTGCTCACTCGTGGTATGG
AATCGTTTTCCCCCCCGTCTCATCTTGCGGGAGCGCTGACGCACCGCGCCGAAAGCCTAA
ATTAGCACCGGAAGGAGCGCAGCAAACTGCTAACAGCTGTAACCGCTGGGACTCCGTCCA
GCACGGTGGGCGGATGGACTTGGAGCGAGACCGGAAGTCCGCCGGGTCAGACGAGCAGAG
GGGGCCCGAGTGGCGCACAGTGCCGACGCAATACGCACGCACGTACGTTCAGTCGCTCTT
GAGCCGGCGACGACGCTGCGTCACGGGCTTTTGGGCGCTTCGTTCCCGGAGATAGCCGGT
CGCTGCGGCCCCCACCGTAGCGGGAGCCAAGGCGAGGCGCAATGAGGCGCAGCAAGGCTG
ACGTGGAGCGGTACATCGCCTCGGTGCAGGGGTCCGCCCCGTCGCCCCGAGAGGTTAGTA
GGCCTGGGAGGAGCGGTTGGCTTCTGGCCCTGCTCGGGTCCGCGGCCGGGTCCTGGCGCC
GGCCTAGCGGCTTCAGGCCTGCCTGCACTCGGTAGTGCGTTCCGTTGGTCGCCGGTCCGA
TCGCGCGGTCCCGTGGGCTGCGTGGCGCTCGCGAGCCTGCTGTGCGGCCGGGGGACAGGG
GGGCGCGCGTCCCGGAGGGGCGGAGGACCCGGGACGGCGTGGGGCCTCGGCCGCCAGCCG
TTGGCGCCAGCGCTTCCTCTTTCTCACCGGAGGGCCCACCCTGGTCTGAATTTCCTTGGC
CGCTAAGCGCCGCGCCTTTAGCGTCAGCTGCTGTCCCCGGGTTTTGGCGCCTGTCTTCGC
CTTCCATTGCCTTCCCGGTGCCACCGGCGGGATTCTTTGCTGAGTCTCCAGGACAGTTTC
CTTACTGCGGCCGAGGGGGCACCTCTCAGTCGTGGAAGTTGGTGGAACCTAGCCATAACA
GACAGCCAGAGAAGGGCTTTTACCCTGGCAGTCCCTGGAGGGGACATCCTTCTTGGGAAA
GTAGAGGGCCAGCGAAAAGGAGAAAGTCCTTCAACAAAATGGATTAACAGTGGGTTCAAA
TACAGGAACGGCTTTGAGGATGGTGCCGGAGGGATCATTGTTAAGCTCTGTCGTACATAG
GGTCCCGCCCTGTGAGTTGGAATTGATTCTATGGGGCCTTTCCAACAGGCATTCAACTGA
CCGCAGCAGTGGCTTCTACAGTTCCATCTGCTTTAACACATAGCCCAAATGACAAGGGGT
ATTCCCCGTCTTGAGGTGTAGTTGACAACGTGCTAGTAAAGTTTCTGCCCCTTTATATTC
ACTCTTTGAAAGCGACTTTAATTTGCTTTAAAAAAAAAAAGGACTCCAGGTTTCTTTACC
GATTATTACCATGGTTTAGAAGTTAAGATATTTTCCCTCTTTTGAGATAAACCGTATCTT
TTAAGTTCAACAGAACTTTGAATGTGGAAGGTTAGGAAAAAGCTATTAAGTTTGGGTCTG
CACAGTATCTGAAGTTGGTTTGCCAGAGGTGGAATCACTGCTCTTTCAAGTTTTGGAATT
GGGCAAGTTAAACTCTTCTCACTAGTCAGATAAGCTTGTAACCTTGATAGGATTAGATGG
GATGATTTTGTTAAACGTTTAAGACAATGCTTGGCACCTGTTACGTGCCATGGGGTTGAG
ACTTACAGCTCCCCAAAGGACGGAGTAGAGCTACCTCAGGATTTCCAAGACTATAGTTTT
TAAGGGAGCAGACTGCCACATCTTTCTCCAAAGGAGCATTTGATTGTAACAGCTCGCTTT
TTGTTTAGCAGCTGAGCGCTTCAACCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
TGCTATGACATTGATTCCAATTCAACTAGATATATATAGCTATATATTTCCTAGACTGCA
GATCTTCCTTGAAGCACAGTCTTTTTCACATAGTGGTGGATTTGAACCATTGACCTCACA
GCTCACTGTTTATCCTACAGTCCTACTTGGACTCCTTCCTGATAGCATAATAAACCCTAA
ATAAATGTTAGTTGCAATTTTTGTTGATATGAAAAGAACAATTATTCAAGATGGGGGGGG
GGGACAAGAGCCTATGAGAACAAAGAGGATCTATTTAAAGAAATAGAAGGAATTTTTTTT
AAAAAAAGGAAAATTCTAGGGCTATCATGATAGTAAGTAATAGCCACATAGTTGTATCTT
TCCCAGCCTTCTTTCCCCCCATATTCCAGGCTTATACCGAGACATGGAGAAATTAGAGAT
ACAGGTTAGTTTTTTTAAGAGCAGCAGAGTTCTATAACTTTATTATTTCTCAGGAGTAGG
CATCTACATCTGGTTATAGTTTTGAACTGTTGACATAATAAAAAAAATAGACTGGTGTCA
GAGTCTGGAGCAGTAACATTTTAAGGTTTTTCTATATCCCGTTGGTTAATAAAACTCTTT
GTTGTTGTTCTTAGGGAGAGAACATTGACTCCCTGAAGATTAAGAACTATTGGACCCCCT
CAAAGGGGTCGCGACCCACAGGTTGAGAACCACTGCCTTAGGATTAATGTTACTCTGTCT
TGTAGTGTTGCATGAATCCAAACCAACTCGAAGGCAATGGGCTTTGGTTGTCAAGAGTAC
TGAATGAAGTTTAAGATGCTTGTAGGTCTTTAGAGTTTTAGCATCTATCTTGTTAAGATT
TATAGACAAAAATACTGTCACTTGGAAGAGTCTTGAAAAATTGTAGCTTAGGAAACCTAA
TAGGACAGTTGTATTATATCACATGGGTTGCTATGAATCAAAAATTGATTCAATGGCATG
CAGCAACAGCAATGAAAATATACTAGGTTAAGTAAAAATGTATTGTTACTAGGGTTACAG
CTCATATACATGCACAGGTTCATTCTAAACAAAATGTGTTTAAAAATATCTCTGTAAATA
GGAGATGGTTGCAGACAAGTTCTCTTTGATGTAGACGCATGTGGGACAGGGTAGAATTGC
CCCTGTACATTTCAGAGGCTGTAGTTCTTTATGGACGTAGAAAGCCTCATCTTTCTCTGG
TGAGAGGCCTTTAGTTTCTAGCTGCTGACCTTGTGGTTAGAAGCACAATGTAGTAACCCA
CTAGGCCACCAGGGCTCCACTTACTCTCTTAGGCGGGTGTTAAAAAAAAAAAGCTCCCCC
CAAAATAAAAAGCAGAACCTAGAACTCTTCACTTAAAAACCCTTGATAAGAAAAAGATGA
CACACATGATTCGTAGAGCTTAGTTGTATAGCCTAAACTTGTCAGAAGTGTGTAATTATT
AGAGGGAATGTTGATTTAGGACTTCAAAGACAAATAAAGCCAAACTGCACCCCTCCTTCG
CCCCCCAAAAAGGCTCAGTCAAGATAGCACCTTCCAAAGAGCTCCTGGGAGAGTTAAATT
CATGCCAAAAACATCAGCTCTGAGCGTTATGCTGACACTAGTTTTGAGATTTCCATGGGT
AAGTCTTGACAGATTTTCTTGAAGGACATTGGGATACAGGGGATCATTATGTAGAAGTTT
TGTGAAAATGGAAATCAGCATTGGTGAGAAAAAGGCCAGGAGAGGTGCAGTACTGACAAG
TTTTTTCCATTCTGACATTGTCTTGTTATTCAAGAATGGCAAGGACTGTTGGGAATCCTT
ACCCCATTCATCTAGTAGACCTGATAGTGCACTGTTCAGATATCCTTTTGCTTCCAAAAC
TCAACAAGGAAGGGAACATGATTGATTCTCTCCGGGATATCAAACTACTGTTTTGATGTT
ATGTAAATAAAGAAAGTACAGAATTGTTTTGGGGAAGGATTAGAGAGGGAAATGTTGCCT
TTAGAAGTGTATAAACCAGTGTTTACCAAAGTGGGTGTTAGTGCCCTTCCCCGCCCCCAT
GGAGAGCACTGGGGTGACCCAGGAAGGCCTGAGAAGCATGTGTACACTGCATCCTGGCTT
AGAGCTGTACTACAAGAGCCTTTTGTTGCCAGAGGGGCCTTTGTTGCCAAAGTGCCAGAG
GGGCACTTTCTTTTCTTTTTCCTGAAAAGGGGGTGGTAGGCCAAGTAAGTTTGGGAACCT
ATGATCTAGAGCAGAAGTTCTGAACCTTCCTAATGCCGTGACCCTTTAATATAGTTTCTC
ATGTTGTGCTGATCCCCCCAACTATAAAATTATTTTCATTGCTACTTCACGACTGAAAAT
TGGCTACTGTTGGGAGTCAGGGTTGAGACCCACAGGTTGAGAACTGTTGCTCTGGAAGCA
CACAGCTTACACAATAAGGAATTTTTAAAAAGCCATCTCTGTAGAGATCAGATTCGGTTT
CAAAATTATGGATTACACTATTTACAAACGTCTACATTCTAAGTCACTTTTATATTGTCA
TTCCCTCCTTTCAATCCCTACTTAGGGCACAGAAAGCAGGGGCTCCAGCACTTTCCATTA
CTGATCCTAAAGGGGCTCTTGGGGGGGAAGTGTTGGTGGGCTTCTTATTCTATTGGCACC
AGCCCTGGGGTGCTGTCCCCTATTCCAGGTTGGTGGAATGGCCAAGGGTGTGGGGGCATG
GAAACGCAGGGGGGACTAGACAACGTAGGTGGTTTTGGACAAATCTCTGAAGGCACAGGT
ACCCATGCCCCTTCCTGGACCTGGCTGGTTGCCCAAGCCTCTCTCTAACAGGAAGAATTG
AGGTAGCAAATGGCTGAAATGCTCCAATAGGGGATATGACAAGTGAAGGAAGGGAAGGTC
CCACTAAGTACAGCCCCTGCAGTCCATGCGCTAGAAGAAGGAAGGCTTGTAAAGTGCTGT
AGCCTCTGCCAGGACTGAGCTCAGGCAAGCTTGGAAGAAAGGCCAGGCAAGGGCACAGGA
ACCAGACCTTTCTGACCGGGGTTCCTTCATCCCTTTGTCAAGCTCTTTAAAAGTTGTTCA
GCAACACTCGCTGCCTAATAGTAGTAGTGCATTGTAAGAGCAGAAAATATATACAGGTGA
TATCTCACATTGCTCCAGATTCAAACTTTCCACTACTTGAACAGTACAATTTGAAAAAAA
TCTCTGTGTTTGTAACTACTCGGTAGTCAACCAAAAATCTGACTTGACAACATAGATAGT
GCTTGTGTTAGTGCGGTAAAATATTTGTCATTGTGCTTTTCCCTTGCACTTTGTGTAAAA
TATTGTAACATTTTTAAACTGTATTGTGTTTTGATTTTTAATGTACTGTATTCTGTCTAG
ATATTTTGGGGTATTTCTTCAACCAAGGGCTGTTAACTTGGTGTTAAGGTCCTGGGAAAT
GAGTTTATAGGTGTAATTTTTGGGCTTCTGAAACAATAATTTGGTTTTCCATTATTTCTT
ATGTGAAAAATATGTTCCGTTCTTGAATTTTTCGCTGTTCAAACACGACTGGAACGAACT
CAGGTATCACTGTATTAAAAACTATAGTCTACTTCATACATTTGCGTCATTTAAAAGAAA
ACGTTGGTTAGCCATGACCATGTATTTTGTCATTAAAAAGAATAAACTTTTATTTGCTGT
GACAAGCACTAGACAATTTCTTTGTGTAGTAGAAAAGGGTTTATTAAAATATTGTAAGTG
AAATTCTTATGTGGTATAGGAGAAAAATGGATTATTGGATAGATGTCACCTGAGCAATTA
ATGGTTGTAAAAATTAAAATTTGGGGTTTAGTCCACAGTGGTTACCAAAGTAAATTTAAA
TTTAAAAGTAAAAAAGAAAAAATTATTTTTTGCTGCACAGAACTCCAAATCTTGTTTCAC
ACGTTATTCATAGACAAATGACAACCTAGGCAGACTGTTTTCAGAAAACTCCCAAACTCC
TATCTGACATTCTATTCTCCATCTCAAATTAAAGTTGGGAATGACTGAAATATATCAGCA
GGAGAAGCTATACTACACGTGCTTTTCATGTGTAAATTTAAGAATCGTTTTAGTAGTTTG
AGAAATGTCAGATTTATCTACCCTACTGAATTAGCAAAGATCAAAAAAATGAAAAGATTA
GTCTGATGCATATATACTCTGATTTAGACACATACACTTATTAGTAAATTGATAGACTTT
CAGAAGTAGAGAAGGAGAGAGATTACTGTGGAGGAGAATTTGGTCATAAAAAGGTGATCT
TTATGTTCTTTGAACGAATTTCCATATGGCAGATTTTTAGAGAATTTTTGAAATTTATAA
AGAAATAATTAAAGCTACATGAGTTTTTACATATTCTTGTAAGGAATAGACAAATTAAAA
ATAATGTACATACTTGCAACTCAAATACAATGAAGGAAATAGGATTTGGTGATAAAATAA
TGAAGAGGAGGCCTACTTAGATAGTTCAGTTACTGAAGGCCATAGGAGCAGATAATCTTC
AACCACCTTAAAATTGCTACCATGCTGCTGTCTAGGGGGGAATTCATAAAAGTGTTCAAT
CAGAGTCCTGCTGAAGCTTTGATTCATTATTTCCTCAGCTACGTGCACACACCAAATGTC
TGAACTTGTGGTTTCTCTCTCAAAATCAGACTCCCTGTCATTGAATCAATTCTAACTCAT
AGTCAGAACAGGACAGGGTAGAACTGCCCCTGTGGGTTTCCTAGATTGTAACTCTTTACC
AAAGTAGAATGCCTCATTTTCCTCCTGTGGACAGTTGGTGGTTGCAAACTACTGATCTTA
TGGTTAGCAGCCCAACTTGTTACCCACTGTGCCACTAGGGGTCTTGTTTAAGAACTACAG
GCTAAACTAAAACATGACTCACTCAAAAAACCCTCAGTTGATTTCTGACACATAGTGACC
CGACAGCACAGAGTAGAACTGCTCCACTGGGTTTCCAAGACTGTAACTCTTTACAGGAGT
AGAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATGAGAAGATGAGACTCTGATCCTATAAA
GATTTTGTGTACATATTAGGGTCTAGGGTCATTGGGTTGTGATTGGCTAGAGCAGGCATC
CTCAAACTACAGCCCGGGGGCCACAAGCGGCTCGCTGAGGACATTTATCTGGCCGGCCGG
GTATTTTTGCCCCGTTTGTTTTTTTACTTCAAAATAAGATGTGTGCACTGTGCATAGGAA
TTTGTTCATAGTTCTTTTTTTTTTCACAGTTCTTTTTAAAACTATAGTCCAGCCCTCCAA
TGGGTCTGAGGGACAGTGAACTGGCCCCGTTTAAAAAGTTTGAGGACCCCTGGACTATAA
CATTGGCTTTGTTTTTTAAGCATTCGAAGAGCTGACATAAAAAAAGCAAAGTCTTGGCAT
AGTTGGATACCAAAAGTCAATGATCAGATGGCAGCGGTTCTGACCTCTTCTGTAAAACCC
AAAAGGTCAGCAGGATAGAGAGACCTCGCTTTCAGAGCCTGTGTTTGCACTGAACATTGA
GATAACTAGACCAGTGGGTACAAGAAGGAAGAAAACGTTCCTCAGTTGATCGTGGTAGTG
ATGGCGCACCGTTCTTGCTATAAGTGAACTATTGATTTGCATGCTATGTTAATTATAGTT
GAATAAAACTAGGTATTTTAAAATGGAGATAAAGGAACAGTTTCCCTTTTACCCCACGGA
GTTTTCCGTCTTCTCTGATCTCAGTATACACCTTTTTGTTTGGTGTACTGCTCTAACCCC
CTGCCTTTTACCTGGCTTTTGACCCAGCTCACAGTGTGAAGGAAGTGGTAGCACAGAGGG
CTTCCAGCTCATGGATGGTGCTGGTCTTTCTACTGTGTCGGATGGGAGCCAACCCCACAG
GGTCTTTCTCAGGATTCTCTCAAGGCCATCCCGCTGACTGGTCTGAGTAGGACAAGGATA
ATCTTACCTTCATGTGTGTCACTAGTTAGATGAAGCGTTTGGTTTTATCAGTCAAGCCAA
ACCAAATCCACTGCCTTAGGGTCGATTCCAAGCAACTCAACGACTGTAGGACGGATTAGA
ACTGCTTTTAGGGATTCAGGGCATAGGCAGTAGGCCTTCTTCTTTTTTTTTTTTTTTTTT
GTCAAATAGCTAAATGTATTTTTATTTTTTTTTAAACATTTTATTAGGGGCTCATACAAC
TGTTATCCCAATCCATACACACATCAATTGTGTAAAGCGTATTTGTACATCATTTCTCTA
AACATTTTCTCTCCATTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCATCTC
CTCCCCGCCCAGTAGGCCTTCTTAAGAGAATTAGCAGTGCCTCAACTATTTAGGAAATCT
CAAGGTTTGTCTCTTTGGAACCAAACCCCAAATTACTTTGTGTAAAATAGTTCTTTACTC
TCTGCTATTTAAAGAGAATCATAGTTAATTCTACAATTTAACATACATCGAATTTATTTC
AACATTGAATACACTAGGCAGAAATTACATGTTATTATCTTGTTATGGTTAATACAGAAG
TAATCGAAGTTTAATATAGAAAATTTGAAGGGTAATATCTCTTTAAAGGATGTAAAGTAT
GATGTAATTCAGAAGTAATCTACATTTTTTTATATTTATCTACACAAAAAATGTTTAATT
TGAAACAGTGCTCCCCCCTGTGTTTTTGTGAAGGCTTTAAAAATAAGATAATTAAAAAAA
AATCTTTTGATGGCTTTGTGATCTTTTTTTTTTTGGATGGCTGTGTGATCTTATCACATG
GATATAATCTGGTGGTGTGTCACAGTTTTCTGACTTTTTGAGTTTGGAATTGAAGAGCCA
GGGCATACACTTGGTGTAGTACGTGAAGAATTGAATTTTTATTTCTGTTTTGTTAAATCT
ATTGAGTATGAAATTAAAGAACACTGTCTGGAACAGGGAATTTCTTAATTTGTCTTGTAA
AAGCTTACTTGTGGTATCAGAGACATTTCTGGTATACCTCTCCCTTGGAAAATCTGATTT
CTGTTATCTATAAAGTGATAGTGGTCCAAATGAAAGTGGTTTGTAAAGCTTATTGCTTCG
GATAGCTTTCTGTTTTCTGAAAAAAAAAATTATGGCAATAATAAAAACAAGAAAATGAAT
AAAAAATAACAGAATAATATGCTTAATATTTTGACAGGCAATTAAAATACATCTTGGGAA
ATTTATAGAATGTAAATTATTTGGCATTATTCTTTCTTGGACACTTGTCCTTTTGAAAAT
AGATTCAAAATGTTTCAAAAGTTGTTTGTTTTTTTTTTAAGAAGTCAATGAAAGGATTCT
ACTTTGCGAAGCTGTACTATGAAGCTAAAGAATATGATCTTGCTAAAAAGTAAGTACCAA
ATGGTAAATATAGTTTTATTTTCTAAAATAAATGCCGTGTGCTCTTTGAAATAGATAAAA
ATATATTCTTTATTAGTTGTTTCTAAGTATATTCCAGAAAATGGATTTTTAATGACTCTC
ATAATGTTAAAAATTAATCCAAAATGATTATTTTTTGCAGGCCTGTTGATTATTACACCT
AGTATAGGAAATGAATTGTTTTGACTAAAAACAGCTTTTTTAAGAATTGCCCTATATTAG
AAGAAGAGAACCGTACTTATGTTTTAGTTTCTTCCTGCTTAGATATCTGGTTTTTCAATC
ACCCAGAAAATAGCAGTGGATGTAAAAGTTAACTGTGATTATTGGACTAAAAGGTAGCTT
GTGTAAAAGGTCTTTGGTGGGTTTAGGAGGTACCATTCTCAGGCTTTGATCATTAGGAAA
TGTCATATAGTCTGATTTCCTGACTTAACGGTGACTGATAACAGAATTTGGAGGGAGGCA
AATGACGAGGTGCATCACTGTTGGGAAAACAAATACTGATAGGAAAGGCAAATGGGGACA
TCTTTATATAACTAGCAACACTGGGCCTGCTAATAACTCCTTGCTGCTAATGATGTGAGG
TTTTTCCCCAGTCTTGGGCTTTTGTCTAATTTTTCCTATGATAGCTGTCACTGAGCCTGG
AGGGTGTTTGCTTATTTTTGTCAAGTGATTTGAGAAATGGGAAANNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAAATATTTGAC
ATTATCTTGCTGTGTCATTTTAAAATCTGAGACTCTAGGTGTGTATTTCTTATGCAAGTA
CTCCTTGGGGAATTGTAGATGGTTTCTTACATTGGACCACATTACTTTTGTTATCTTGGC
AATGTAATCAATGCAAGTATTGCAACATAAAGACTAATTCTTTGTCATTTAAATATTTTC
CTAAAATTGAACATTGTTGCTGATAACATCACATGCTTCTATCACTCTCACTATTGACTG
TCTTACTTGCAGCCGTCATTAGTTTGAGAATGTCGTCATGGTGTTAATTTCAGTTAGGTG
AAGCCTTCTAAGTAACTTGTTTACTAATCGGTGTTGCTGTTTCTAAGTATCTTGTTTACT
AGTTGTTGTTGCTGTTTTTGGATTTGAATTTATTTTGCATAGTGCAGTCTGGCATCTATT
TTTTATTCACAATCAATTAGAAAACATCACTAATTAATTTGTTCGCTCAGAATAACTTCC
CAAGTTAATAATCCCCTATTACCAATGACTAAGAGAAATAATAGCATGGATGTTACAGTC
AAGACTAGTCTGCAGAATGTGATGATTACAAAACAGTTTCATGTGTATAATTTAAAGTGT
AAGGTGAGGCATGGGTTTGGATTTATGGATGGCAGGCTTGTTCCTATGGGCTTCTCACAG
TGTCCCAAGCCAGAGCAAACTGTAGCCCTTCAGGGCTTCGGGCACTGAAGCTAGTCGCAC
AGTGGGGAAAAAGTAACAAAAATAACGTGTAAGGTGCTTGCTGTACAAAAGTGAGTAAAA
TTTAAATAAATTGGTAAGAAGAAATAGTAATTTCAGAATTCTGACTTTGATGTTTGGGAA
CCTAAAACCTTGGTTAATACCTTTTGTGTTTAGTTACCTGTGCCTCTGGAGTCTGTAAAG
GAGCTGCTTAATTCAGTCATGCAAGAACTTGAAGACTATAGTGAAGGAGGTCCTCTTTAT
AAAAACGGTTCTTTGAGAAATGCTGATTCAGAAATAAAACATTCTACACCATCTCCCACC
AAGTATTCTCTGTCACCTAATAAAAGTTATAAAGTAAGTAGGAAGGAATTACTTCATTTT
GAATTATTCCATTGTGAACTTTCTTGATTTAGATGTCCTAATTATTTTTTTTGTTGCTGC
TGCTGTTATATTTATAGTATTCTCCTAAAACACCACCTCGATGGGCAGAAGATCAAAATT
CTCTGCTGAAAATGATCTGCCAACAAGTAGAAGCTATTAAGGTAAATCACTTAGTTTTCT
AAACTGTGCCTCTATTATTCTAAGATTTAGTGTCCAACCATGTCTGTACTTCTTTCTAAA
GCTGGCAAAATGCCTACTTGCCATGCTTCTGTAGAATCATACTTCGCTTTTGCATACATT
TAATACATTTTTTAAAATGATGTGTTTGACTACCCCACAAGATAGGAAGATGGGAATCCT
TCAAAGATAGGGACAGTTTGTCCTAAATATAGGTGCTTCCTGGCATAGGGGACGTTCTCA
GGTGATAGACTTGAACTAAACTTCTAAATTATTAATCTTATCTTGGCCTGTGAGTTCATT
CTGAAGGTCAGCTTGATAGGAATGAAAAAAATGGTCTAAACCTCAAAAAAGTCTCTCAAA
ATACTTTTATATTAAACTCTTAACTGAGTAAGGAAACAATTTTAACTTGTAGGGTAAAGG
GACTTTAATTTTTGGATCTTACTTTTGGCAAGAACTAAGAAACTTTAAGAGTTAAACCAT
ATCTGTACGCGTCATCATGAGTTGCAGTGGACTTGATGGGACAAACCAACATGGAAGGTG
TTTGAAGCCAGACCATAGTGGTTTTGAAGTGTGCTGCCACACTACCAGGTTTTACAGTAC
AATAAACTGTGTGAGACTTAAAATAGGTTTGTAGGGGAACACAGTTTTTAATTTATGCAA
AGATTTTATAAGTTCATGACCTCTTACATTACATTCAGTTTTGGCCTCTGGTATCTTTCA
GGTACCTCAAATCAATTTTTGTGGAAATGTAGTAGAATCTGAAAAACTTGGCTCTAGGAC
TGACTCCCCACTACCTAATGAGATTTGGATCAGTTGTACTTTATCTTTCTGTATGGTTTT
TCTTTTATCAAGTGAGGGTTTTCTTTTTATCAGGCGAGAGAATCGGAGTAACTAATTGTC
TTCAACTTTTACTGTACATATATTGATTAAGATACTAATAGAGACCAGTAAAATTTTTAA
TTGCTCCACTCATTTCTATTATGCGTGTTCAACATGTGGACAAAGCACAGTGGAATGGGT
GTGTGGGAAAAAGTTTTAGGTTTGGAAATGGACTGAAAATGGAGACATTTGTGAACATCA
GAATTTTAGAAACCTATATTGACAAACAACCCTAGAAGAAGAAAACCGGTGTGCTAGATT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGGACATCTGATACTTT
TTTTTTACCTCTTGTGTGAAACACGGATTTCCTTGGAAAGCGAAAAGGCTTCTTGATGAA
TACCCGTTTTGTAAGGAACATTGTGTAGGGTCTTGTAGTTGGGTTCTCAGAGGTTGCCGT
TTATGTCTTTATATAGTAGCTGAGGAAGTAGCTAGCCAAATAGCTATACTCAAAACCAAA
AATTCACTGCCACTGAATCAGAGCTATCTCATAGTTGCCCAATAGGACAAGGTAGAGCTG
TGTTAGAGGGCTTCAGAGACTGTACCTCATTACAGGAGTAGAAAGCCTCCCCCCCTCCAG
TCTCCTGAGAAGGTGGTTTCAAACTGCTGACCTTGCAGTTAGCAATCCCAGGCTAACCCA
GTGGGCCACCAGGGCTCCCTAGCTAAACTAGAAGGTTCTGTGTCAACCATTTTGTCTAAA
CAACATGGTGGTGGTCTAAAAACATTTTTGGAATGAGACCTGCCTTGTTTGAATTAAATG
ATATCATTTCTTAGTCCCGTCCTACCTCACCCCACTCCCTTCTTAAGATTTGAGTTAAAA
TTATTTATCTAACAATGTATTGGAAGTAATAACTTGTGCCTAGGACATATATTTGTAATA
AATTCCAAGGAAATAGTACTTGTTGTTCTTTCACCATTTTGGTTAGAGTTAGCATTTGAA
AGCATTCATTTTGAAAGATTAATTATAATTACTTCAAACATTGATAAATGGAAAGTGATG
ATTCTAGGATAGGGAGATAATTTGTAATGTCTAATAGTAGTACCCTATGTGTAAGGTGAC
CAGATTTTAACATTGGTAAAGCGGGACACCATTGATAAAACTCATATTCTGGCGAAATAG
CCATATGGCAGCCGAAAACCGTATACCCTAGCTTGTCGTGCAGTCTTTAAAAAAAATCAG
AACTTTTAAAAGATGCCGTGGGACGTGGGACAAATTGTTAAAAATCGGGACTGCCCCACC
AAATGTGGGATGTCTGGTCACCTTACCTATGTGGCACAGTTCTTGGCTACTATTTCAAAG
CTTGGTAGTTCAGGCCCACTAGCCATTCTACAAAAGATGTGGCCGTCTGCTTTCTTAAAG
ATTTGTAGCTTTGGAAACGGCATTGGCAGGTCTTTTTTGTCTTAGAGGTCTAAGTAGCAC
AGATGGATTTTAAAAGGAAAAACGTGAAGGCTGTTTAAGCTAATAGTGCTAAGAACTGTG
AGTGTCTGAGAATGTTAAATATATGGTGGCACTGTGGTTTTAGTGAGCTGTTAACTGCAA
GGTCGGCAGTTCAAAACCCTCCAGTCACTTTATGGGAGAACGTTAGGCTGCCTGCTTGCT
TCAATAGAGATTCACAGTTTTGAGAATCCTAGGGTAACTCCGAGTTGGAATCAGTTCAGT
GTCAGAGGGTTTGTTTTTTTTAAGTATTTTGAGCAAGGGTATGTCTTGATAAGAGCTGAA
CTTAAGAAGCATTAATCTAGGCAAGTGTAAGATGGAATGAATTCCGTTGAGGAAGTTATC
TACTAATAATAGGTTAGAGTTACAGAGAGAATTAATTATATCAGTGGTTCTCAACCTTCC
TAGTGCCACGACCCTTTCATATAGTTCCTCATGTTGTGGTGTCCCCCCACAACCACTATT
TCATAACTGTAATTTTGCTACTGTTATGAATCGGGTGATCCCTGTAAAAGGGTCATTCGA
CACCCAAAGGGATTGCGACCCACAAGTTGAGAACCTCTGAATTAGATGGTGGTATTAAGA
AATGGAAGAATCTGCACAGATAATTGAGTTTTTAATAAACTGAGGATCATGTTATTAAAA
TCAGCCAGTTATTAAATCAGTTATTAAAACCAGATCACATTGAAAAATAGAATCTATTCA
AAAGTATTATCAAGTACTTAAGTGTAAGATTTTAAGATGACCCAAACAATAAAGTGCATG
AAATGTCTTTTTTTTTTTTCCCAATAGAAAGAAATGCAGGCATTGAAACTAAGTAGCAGT
AACTCAGCATCCCCTCATCGTTGGCCCACAGAGAATTATGGAGCAGACTCGGTGCCTGAT
GGCTATCAAGGATCACAAACGTTTCATGCAGCTCCACTAACAGGTAAGTTGCTATGAGAT
AGTCCATGATATGAGTAAAATTTACTATACTTCTCTAAGTTTTAATTAAATGACCTAAGA
AGTCACCTTGTCTTTATATGTTTGTTTATAAATATCTTTGAATTTCTGTTTATGCAAATG
TAAAAGCATTATTTGGTATTACTGATAATTTTATTAAAATGGGCAAGAACAATTAAGTTT
TGAGTTAAAGATAACTTCATGCACATCTCTGAGAAGCTGAGACGGATAGAATTATTCCTT
ACAATGTGAAAAATGTTAATTTATCTACTAAGAGATGTCTTCATTAAGAACTTAAGCCTA
CGGGGAATTATTTTGTTGACATTTTGAAAGGACGATAACAGGAAATAATTGTTTATAAAA
CACCATCGCCATAACATACCAAGAATGTAAAAATACACTAAGATAGTCTTTGTCTTTTAA
AAAATAATGTAGTTTCAAATCAAAGATTAATGTAGGAAACATCTAAAAGTATGAAACAAT
GTAAAGAAAGTGGAAAAAGAACTACTGAAAAAAAAAAAACCAACTCAAACTACTTTTCTA
TCATGTACAGTCTTATTAACATTTGAATACATTTCCTTTATTTTTTTAATACATAAAGAA
TTCTTAAATATGATTGTTATATTGTGTGTAGGTTATTTAGCTTATTTCTAAAATAAGTAC
TGAGCATTTTCCTATTAAATATTCTTCAAAAATATTTCTAGTAAATACATGGTATTACTT
CACGTGGAAGTATCACAATTAAAAAAAAAATCATTGTATTGGGGATCGTATCACTCTTAT
GACAATCCACACATACGTCCATTGTGTCAAGCACATTTGTACATTTGTTGTCATAATCAT
TCTCAAAACATTTGTTCTCCGCTTGAGCCCTTCGTATCAGCTCCTCCAAATTCTTTTTTT
ATTTTGTGTCATTTCTAGCTTTTCCTACTGTAAATAGTTCTGTGGTTGCGTTACTAGAAT
TCTAGGGTATTATAAATTTTTATTCAGTTGTGCTGGGAAATTTTCAGAAAGAATAATCAG
TTGCACATTTACCAAAAGTGTCTGGCCCCGTTGCTCCCTTCATGATAGTGTTGGCGTCAA
TTGACTTACCAAAAATCGTGTGCCAGTTACTAAGAGCAAAATGGTATTCATGTTTGTTTC
ATTTGTTTACTATTATGTTCATGGAATTGTCAAGACTTTGAATCACTTGGATGAAAACAA
CAGTTTTGCTTACTACTGTATAATCTTTAATTAAACATTTTTTCTTTTAATTATCGTTAG
GAGTTTTGTTGTCTAGTCAGTAATTGAATGTTGAAATCTAATACTCTTGGTTCTAGTTAT
TCAGTTCATTCTGCGCTCTGCTTTTCTCCTCCTGTATTTCCAAAAGAATTATCTTCTTTA
TGGATTATTATAAAAGTGATAAGAGCTCCCAATAAAATAATCTTTAAATAAATAAATAAT
ATGATGGGAAGAAGGGGGAAAAAAAGATCATCTTCACTAGGCAGTTCCATTAATTTTCCC
AGTTTAAACTTGGGCTTTTGCAGTTTTTGCTTTTCTCAGTAAAGTCATCATGGAAAAGAT
AAATAGATGTGTGAGATTTTTTTTCAGGGCTTTATTACCCAGAGCTCTCTAGAATAAATT
GTGTGTTGTCTTTGACGTTGTAATTTTCTATTCGTTCACTTCTAAGGTTTCTTGCTTGTT
TGGTTTTCTGCCACAACTTTTGAATCAGGTGAAAGCAAATGACTGTGGGTAGCTTGCCAT
CATGAGCACCTTCTATTTTGCTTTTGATTTTTGTTTCTACAAAGCAGGTGAAGTCAAATA
CTTTTGATATCATAATGAGTGTCAGTTGTGATCCCACCCCCCCACCCCCTTTAATAAACC
AAGAATTACATTTTGTGTTACTTGGGAGAGCCTTCCCATGAATAAGTAAAGTTATTTTGA
CCTGAAAATCATCAGCTGAGTTTGATTTTATATAAAACATTCACATTCATCGGATTTTCA
GGGCTCATTTAAAAATGCCCCTTGTGATTACCATAAGCCTTTGGGTTCCTTCACTTCCTT
TACCTAGTATTCTAATTTTCTAATGTGGAATATGACTGATTTCACCCACAAAATCCTCTT
TAGAATGGACCAATTGCTGACTTCTTGGCCTCCCTTTTTTTTTTTTTTTTTTTTTCTGAT
GAAATGTTTTATTGAAGGGATTTTTTTTTATTATTTTCTATTCTTTTTTTATTCATCATT
TTTGATTTCTTTTTTTCTTTTTTAACATTTTATTAGGGGCTCATACAACTGTTATCCCAA
TCCATACACACATCAATTGTGTAAAGCGCATTTGTACATCATTTCTCAAAACATTTTCTC
TCCATTTAAACCCCCGACATTAGGTCCTCATTTTCCCCCTCCCTCCCTGCTCCCCCCTCC
CGCATGAGCCCTTGATAGTTTATAAATGGGTATTTTGTCATATCTTGCCCTGTCCGACGT
CTCCCTTCATCCACTTTTTGGTTGTCTGTCCCCCAGGGAGGAGGTCACACACAGTTCCAT
GTAATCAGTTCCCTCTTTCCTACCCATTCTCCCTTTACCCTCCCTGTTTTGCCACTCACA
CCACTGGTCCTGTAGGGCTCATCCATCCTGGATTCCCTGTATTTTCAGTTCCTATCTGTA
CCAGTGTACCCTCCTCTGGTCTAGCCAGTCTTGCAAGATAGAATTCGAGTCATGGTAGTG
GGAGCGGGGAGGAAACCTTTAGGAACTAGAGGAAGGTTGTATTTCTCATCATTGTTACAT
CACACCCTGACTGGCTCATCTCCTCCCCGAGACCCCTCTGCAAGGGGATCTCCAGTGGCC
TACTAATGGCCTTTGGATCTCCACTCTGCACTCCCCCCATCATTCACTATGGTAAGATTT
TTTGTTCTGATGATGCCTTACACCTGATCCCTCGACACCTCGTGGTTGCATAGGCTGGTG
TGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCCGCTTGATTACCTTCAA
GCCTTTAAGACCCCAGACGCTATACTTTTTGGTAGCCGGGCACCATCAGCTTTCTTCACC
ACATTTGCTTATGCACCCATTTGTCTTCAGTGATCCGTTCGACACCCCGTGATCACACAG
GTTGATATGTTGTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCGCTTGTTTACC
TTCAAGCTTTTAAGACCCCAGACGCTATATCTTTTGATAGCCGGGCACCATCAGCTTTCT
TCACCACATTTGCTTATTCACCCGCTTTGTCTTCAGCGGTTGTGTCGGGAAGGTGAGCAT
CATAGAATGCCAATTTACTAGAAGAAAGTATTCTTGTGTTGAGGGAGTACTTGAGTGGAG
GCCCAATGTCCTTCTGCTACCTTAATACCAAACCTATAAATGTAGGCTCATAGATCTATT
TCCCCATCCTCATATAATATATTTGTATATGTACATGTCTTTATCTAGAGCTCTATAAAT
AACCTTTGCCTCCCAGCTTTGGCCTCCCTTTTTACTGCTTGTGAGGTACCTGTCCTTTTT
GGCCACTTGAGTGCTAGTCTTTTATTCTTTATTTGTCCTAGTTTGTGGTTCCCCCCCTCC
CGATTGTTTTAATTTTCTTTATGATATATTTTGATGTAAAATTTTTTTTGACTACTGTTG
CATTTGTATTTACAGTTCTTTCCTGCTTAGATGGTCTTGTTGTAGTACAGACTTTTAAAC
TGTTTTTGTATTTGTGTTTTTGTTTTAGTTGCAACTACTGGTCCATCAGTGTATTATAGT
CAGTCACCAGCATATAATTCCCAGTATCTTCTCAGACCAGCAGCTAATGTTACTCCCACA
AAGGTAACAAAGGAATACTTTATACGTGAATAAATACAGTTGATTCTCATAATTCATGGT
AGTGGTCTGTAAAGTATCCTAGACTACTTACTTAGCAAAATAACGAACCATTGCTTGTAG
AATACAAGGGGGTTATGTTCCTGTGTGCTTTTATCAGTTACTCAGTACATGATCTTTTGT
TATGTGTGCTTTTTAAAGATTAAATATTAAACATCTATTGCTAATTGATTAACAGCATTG
TGAACCATGACTGAGTGAAGCATATCTAACATTTTCTCCCTGAGGCAACAGCATAGTTGT
CTTGGGCTTAGGAATTGTAGCGAGCACTTTGCTGCTTTGCTTGGGGGCCACTTTGATCAA
TGAAATCACCAGCCCCAGAGCATAAAAAAATAGGCCATTAAATAGCTTGCAAAAAGGATG
CTGCTTTATAGTATGAGGGCTGAAAGCAGTGCTTCCATGCTCAACCTCAGCTGGAAACAT
GTATATTGAGCGACCCAATTTTTGGTGCTCTATGTGTGTCTGCCTATGGCTGTAAACGGC
CGTAACTATTGTTTGTGGGGAATTAGCTATAACATTGCACTATAGGTGAGTTTGCCAATG
TGGAATCCATGAACAGTGTGAGTCACCTGTATCAAATTTTCAATTGTTTAGGTTTCCTTC
AGAGAAATTATAGGAGAAATGCTTTATTAGTACTATTCCTTAAGAATAGATCTTTTAGAT
TTCTTTCTAGATATAGAAGTGGTACTTAGTTTATTTTTGTATTCAATGTGAATATTTAGG
ATTATTTTTAATATGAGATGGGGGTAGACCCTTCTTCATTCTGCTTTGGCAGAAAATGAT
CCTAGAATATTTTAGCCTGCTCGTCCTCTGGGTAAGTAAGTAGCTAATGGCTTGAAAATG
TGACTTAAAAACTATTGATGGAGAACAAATATTAAAACAGTAGTGAGGATTTAGGTGCCT
TTAAACCTAGATTTTCTACTTATTGTGACCTTGGGCAAGTTTCTTAATCTCTGTATGTCA
GTTACCTTATGTATAATAATAATAATACCTTTCTTCATTGGGTGCTATTAAAATGAGCTT
ATAAATATGTAAAGTGCCAGTTGCTATATTAGTAAATACTTAGTAAATACCTAGTAAATG
TTAATCTTCATCAACACTGCCACTATTATTGTTAACATTATTTGATGCATTATTTAGGAA
TGAAGAAGATATGTGTTTTGATTTATTGTGGCAGATGGTACATTTAGAACAATTTTCAAT
TTATGGCATGAAGGGTTATAAGCTTCAATTGTCTTTGTAGGTAGCATTGCTTTCTTGAAG
TGATGTGTTATAAGCCCTGATCATACCGTCTTTATCTAATGATTCTTAGGTTTGATGTTT
GTGAGAATTTGTCTAGTGATGCTTTTTTGAACAGCCTACAAACATTTTAACTTTTTTTTT
TCTTGCAGGGTCCAGTTTATGGTCTGAATAGACTTCCCCCTCAGCAGCATATTTATGCTT
ATTCACAACAGATGCACACACCACCAGTACAAAACTCATCTGCTTGTATGTTTTCTCAAG
AGATCTATGGTCCTCCCCTGCGCTTTGAGTCTCCTGCAACAGGAATTTTATCACCCCGGA
GTGATGATTACTTTAATTACAATGTTCAACAGACAAACACAAATCCACCTTTGCCAGAAC
CAGGTTATTTCACAAAACCTCCAGTTTCAGCTCATGCTTCAAGATCTGCAGAATCTAAGG
TTATCGAGTTTGGAAAATCTAATTTTGCTCAGCCTGTTTCAGGTGAAGGAATAAGGCCAT
CTCTGACAACACCAGCACATGCAACACAACCAGCTCCTTTTAAATTTAACTCAAATTTCA
AATCAAATGACGGTGACTTTACGTTTTCCTCACCACAGGTTGTGACTCAGCCCCCTTCTA
CAGCTTACAATAACAGTGAACGCCTTTTGGGGCTTCTGACTTCAGAGAAACCACTGCAAG
GAGATGGCTATAGTGGACCAAAACCTACACCTGGTCAAACCATTGGACCTCGAAATACTT
TCAACTTTGGAAACCAAACTGTGTCTGGAATTTCCTTTACAGAAAATACGGGGCCAACTC
GGCAAACAAATTCTGGTTTTCGCCTAAGCAATGATACGTTTACTTTCCATGGTTCAGGGA
AAGCCGTGTTTGGAACACCAGCTCCAGAGTTGGCGCACAAGAACCATGAAACAGATGGAA
GCAGTGCTCAAGTTGATGAAGATGATGATGGCCCTCACTTTGAGCCGGTGGTACCTCTTC
CGGATAAAATTGAAGTGAAAACTGGTGAGGAAGACGAGGAAGAATTCTTTTGTAATCGTG
CAAAATTATTCCGTTTTGATGCAGAATCCAAAGAATGGAAGGAACGGGGCGTTGGCAATG
TGAAAATCCTAAGGCATAAAACATCTGGTAAAATTCGTCTTCTAATGAGACGAGAGCAGG
TTTTGAAGATCTGTGCGAACCATTATATAAGCCCCGAGATGAGACTGACTCCAAACGCTG
GCTCAGACAGATCTTTCGTGTGGCACGCTCTTGATTATGCAGACGAGTCCCCGAAGCCAG
AACAGCTTGCTATAAGATTCAAAACTCCCGAGGAAGCAGCACTTTTTAAGTGCAAGTTTG
AAGAGGCCCAGAACATTTTAAAAGCCTCAGGAGCAAATGTAGCCACACCGACAAATCAGA
CTCCCAGAACTGTAAAAGAGCCCCTAAGTCGTGACAATAAGGATATTTGCAAACCTGATG
CCGGAAGTTTGAATTTTGAATTTCAGTTTGCAAAGAAAGAAGGTTCTTGGTGGCATTGTA
ATAGCTGCTCACTAAAGAATGCTGCAACTGCTAAGAAATGTGTATCGTGCCAAAATCTAA
AACCAAGTAATAAAGAACTCTCTGGCCCACCATTAGTTGAAACTGCTCCCACTTTTAAAA
TTGGCCTAGAAAGTGTTCAGGATAGATTTGCAATGAGGACCCCCAAGAAAGAAGGTCACT
GGGAGTGTAGTACCTGTTCAGTCAGAAACGAACCCACTGCGTCTAGGTGTAACACATGCC
AGAATACACAGTCTGCTGGCAAAAGTGGGTCTTCATTTGTCCAGTCATCTTCCTTTAAAT
TTGGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCATGTATGCTCAAGAAAGCA
TGGACAATGGGACTGCAGTGTATGCATCGGTACGGAATGCAGCAAGTGCCTACCAGAATG
TATGTTCGTGTCAGCATCCTAAGTGAAGAGAGCCTGACATAGCTTCTGCTGCTTTCAGCA
CCTGCCTCATCAGAGATGAGCCAGGCTCCAAAGAGTGGAGTTGAGGGTAATGTTCACCAA
GAAGGAAGGACAGTGGGATTGCAGTGTGTGCTTGGAACGAAATGAGAATTCTTCTTTAAA
ATGTGTGGCTTGTGACAACTCTAAGCCAACCCACAAGCCGCCTGTTGCAGAAACTTCAGT
TTTAACTGTAGGCCCCAAATCTGCATTAAGGGACTCGTCTGGAAGTCAGATGGGCACAGG
ATTTAAAACAGGCTTTTCAGGAAAAGGTTTTAAATTCGGAAGTTCTGAGCAAGGTTTTAA
ATTTGGGCATGTGGATCCAGAAAATATACCTTCATTTACATTTCAGAGTTCTAATGCTGA
ATCCAAGTCAACAAAAGAAGGATTTAAGTTTTCCATCCCTGTGTCTGCTGATGGATTTAA
ATTTGGCATCCAGGAGCCAGGAAACCAAGAGAAGAGTGACAATGAGAAGCCCATTGAAAG
TGACACTGGTTTGCAGGCCCAGGAGGCCAGTGCCCAGAAGAATGGAGGTGGTTTGACTTT
TGGTCAGACTAGTAGCACTTTTACCTTTGCAGATCTTGCAAAATCAACTTCAGGGGAAGG
ATTTAAATTTGGCCAAAAAGATCCTAATTTTAAGGGATTTTCTGGTGCTGGAGAAAAATT
ATTTTCATCACAGAGTGGTAAAATTGTTGATAAAACCACGTCAGCGGACCTTGAAAAAGA
TGATGATGCCTATAAGACTGAAGACAGTGATGACATCCATTTCGAACCAGTAGTTCAAAT
GCCTGAAAAAGTAGAACTTGTAACAGGGGAGGAAGATGAAAAAGTTCTTTACTCACAGAG
GGTGAAATTATTTAGATTTGATGCTGAGATAAGTCAGTGGAAAGAAAGGGGCTTAGGGAA
CCTAAAAATTCTCAAAAATGAAGTAAATGGCAAACTGAGGATGCTGATGCGAAGAGAACA
AGTGCTAAAAGTCTGTGCTAATCATTGGATCACCACCACAATGAACCTGAAGCCGCTCTC
TGGATCTGATAGAGCATGGATGTGGTTAGCTAGCGATTTTTCTGATGGTGATGCTAAGCT
AGAACAACTAGCAGCAAAATTTAAAACACCAGAGCTAGCTGAAGAATTCAAGCAGAAATT
CGAAGAATGCCAGAGACTTTTATTAGACATACCACTTCAAACCCCCCATAAACTTGTTGA
TACGGGGCGAGCTGCCAAGTTAATCCAGAGAGCTGAAGAAATGAAGAGTGGACTGAAAGA
TTTCAAAACCGTTTTGACAAATGAGCAAACAAAAGTCACCGACGAAGAGAATACGAGTCC
AGGCTCAAGTGCTGCCAATGTTTCAGACACGAGTAAGCCAAATTCTGAAAACACGGGGCC
TACATTAGAGTGGGATAACTATGATTTACGAGAAGATACTTTGGATGACAGTGTGAGTAG
CTCAGTACACGCTTCTCCATTGGCAAGTAGCCCTGTGAGAAAAAACCTCTTCCGATTTGG
TGAGTCAACAACAGGATTTAACTTCAGTTTCAAATCTGCCTTGAGTCCATCTAAGTCTCC
TGCCAAGTTAAATCAGAGCGGGACTTCCGTTGGTACTGATGAAGAATCCGATGTCACTCA
AGAAGAGGAAAGAGATGGGCAGTACTTTGAACCCGTTGTGCCTTTACCTGATCTCGTCAA
AGTATCCAGTGGTGAAGAAAATGAACAGGTTGTTTTTAGTCACAGAGCAAAACTCTATAG
ATATGACAAAGATGTTGGCCAGTGGAAAGAAAGGGGCATTGGCGATATCAAGATTTTACA
GAATTACGAGAACAAGCAAGTTCGCATAGTGATGAGAAGAGACCAGGTATTAAAACTTTG
TGCAAATCACCGAATAACTCCAGACATGACTTTACAAAATATGAAAGGGACAGAAAGAGT
GTGGGTGTGGACTGCATGTGATTTTGCAGATGGAGAAAGAAAAGTAGAACATTTAGCTGT
TCGCTTTAAACTACAAGATGTTGCAGACTCATTTAAGAAAATTTTTGATGAAGCAAAACT
CTCTCAAGAAAAGGATTCCTTGATAACTCCTCACGTTTCTTGTCCCAATACTCCCAGAGA
GTCACCATGTGGCAAAATTGCTGTAGCTGTGTTAGAAGAAACCACTAGAGAGAGGACGGA
TTTGATTCAAGGCGAGGATACAGCAGATGCACCTTCAGAAGTTGGAGAAGTGTCTAGCAT
ATTTGAAACCACGACAAAAGCTGTGGTTTCTCCTCCAAAGTTTGTCTTTGGTTCAGAGTC
TGTTAAAAGCATTTTTAGTAGTGAAAAATCCAAACCATTTGCTTTTGGCAACAGTTCAGC
CACTGGGTCTTTGTTTGGATTTAGTTTTAATGCACCTTTGAAAAATAACAATAGTGAAGC
CACTTCAGTCGTCCAAAGTGGATCTGAAAGAAAAGTNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
GTCTGCGGCTCACGACACATTTAAAGCACCAGAGAGGGTGAGTGCTTAGTCTTCAGTGTT
AACATTGGGCCGTCAGCAGTGTTTTGTATCTTGTGAATACCCAAAAATATTTGAACAGAT
TTTTTCCCCTCCCAAAGTAAGTTTGCCTCTGAGTGCTTAGGTGGCAACAGTGCTATCTAG
ATTTCACAGCTGCAAGACATTTATTCTTCTTAAGGCAGAGGGTTAACTTACGTAGTATGA
AAGCATTCTGACTCATGGACTGAGGAGCATCGATAGCATATTTCATTCCTTCATTCTTCA
TTTTACTTGTCACTCAAAGAACATGGGAGTTGCATGCTCAGATTTTGTTTACGTCTTGCT
TTGATTAAAGGGAGCACAGAATGAAAGCACCAGTGTAATTGAGTAGGTTAGGCCAGCAGA
TTAGTATAAATTGAGGCACTTTTTACATATATTCATATTCATTTTGTTTATGAACATGTT
CAAAATCAAATGCTCTTTATTTTCTAGGATTTAATTTTAGCCTTTTTAAATCTAATCCAA
TGGCTTTTTGGACCTGCGCCCCATCCTCACAGCTTGAGAGCAAAGGTATAGAGCTAGCAT
ACTCAGTATGAGATGACACCTGGTTTCTCAGTATTTAAGCTTGTAACATGCATGGTAGAG
AATGCCAGTTTTAGCTAAGTACTTTTGTCTGTTAACATAACATCTTTTAAGGCTGGTTTT
TTCTTACTTGGATGTAATTTTTCTCATCAGACAATATTGATTTGAGTTAGATCAAGGTGG
TCCTCACCTTTTGCTGCTTTGTATTTCATTGTTCTATTATTTTTACTTTTGCTTAAGCAG
ACATTTTTACCTAACTTTTGTCTTCTGCCACTAATGTTTGCCAATACCTAAACACATGAT
GACTGCCCACAGTGTGCATGCAATCTTGGAACACAAAGTTTTCAGTAGGGCTTTTCCTTT
GTGCATAGTTTAGAGATACTGTATTTCAAAGACTCCAATTTTGACGCCACCAGTATATAC
TTTGGCAGTTTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCCCT
CAACTATATTACCTGTTAAACAAGTGCAGGGATACCATGTGTGGTATATGGGAGCTTCCA
TTTTAAAGTATACCAAGCATAATTCTAGCTACCCCAAACCCTTTACATTAAGTAGCTAGT
TACTCAGAGCCTTCTGTATTGGACAAGGCAAAACTGCCCCATGGGTAAGGTGACCACATT
TTAACATTGGTAAAGCGGGACACCATAGATAAAACTCATATCCTGGTGAAATAGCCACAT
GGCAGCTGAAAACCGTATACCTAGCTTGTCGTGCATTCTTTCCAAAAATAGGGACTTTTT
AAAAAAAAAAAACTGGGATGCGGGACACATTGTTAAAAAGCGGGACGTCTGGTCACCTTC
CCCATGGGGTTTCGAAGGCTGTTACGTTTCATAGAAGCCAACTGCCTCATCTTTCTCCTT
TCTATCTAAATACACGGCAGCAGCTTTCTAATGTCCCGTGGGGTAATCTGTAATCTAACC
ACAGGTTGGCAGTTTGAAACCACCAGAGGCTTCATGGGAGAAAGACTGGGCTTTCTACTT
CTATAGAATTACAGTCTCAGAAACTCATAGTGAGTTCTGCCCTGTTCTTTAGGGTTGTAA
GTCAGCATCAACTCAATGGCAGTGAGGGTGTTTTTGTTTTGTTTTTTCTTTGGAGCTTAA
CCTTTATGGAAACTGCCACCTGGTGGGTTTGATAGGTGACCTTTCTTCAGCATTTGGGTG
CTTAACCATTGTGACAGCAGGGCTCCTTTTACTAGCAAAAGCTCCTTTTAACCTTTTTAT
TTTTTTAAGGATGCAAGCTTCTAGAAGTGTAAATGACAAGTGTGAACTTTACAGACAAGT
GGGAATACCTTGCACCATTCACTGTGGAGCCCAGACTAGAATCTCAGACCCCAAACCCAA
ATTTACCAGTGTCTCTCAATAGAAGAAAAGACTCTTCTGTTTTGAGACAAAGAATATGAT
AGTCCCAAGGAAACTTAGAGACGAAGAGTGTCAATAGGAGGAAATTGAGGCCCAGAGAGG
CGATCTAACTTGCTCCGTGTTGTCATTTCTAGCCAGTGGCAGAATTCTGGAACAAGAATC
TGTACCTTAAAATGTTCTTTTATTGATGCAGGCCAGGGATTGATAAAGGAATGGGCGTGA
AGTCTGCTTTGAAGATGCTAAGAAAGGGCTCTAGTTCTCCAGAGCCCTTATAATCCAATA
AGATTATAATGTGAAGTATGTAATTCTAAAATTTCTAGTTGCCATTTAAAAAAAAAGGAA
AAAGTGTAAAATTATATTCCTATTTTAATTTGTTATCCAAAATACCATTTCAGCATCTAA
TCAATATGAAAGATTACTAATGAGATTTTGCTTAAAATTTTTTTTTCAAGCTTTAGGTCT
TCAAAATCGAGTGTATATTTGAAACTTTAACATAACTTAGTTTGGACTACCCACATTTAT
GGCTAGGTGCTATCATATTGGAAAGCATAGCTCTGGAGCAGCAGTTCTCAACCAGTGGGT
CACGACCCCCGTGGGGGGGGTGTTGAACGACCCTTTCACAGGGGTCGTCTAAGACCATTG
GCAAACACATATTTCTGGTGGTCTTAGGAACTGAGACGTCACTTCTCTATCCTCTCCAGG
CGGGTCTGCCCACATGTAAATATGCCCACATAGGAGTACCCGGTGTGAAGAATGTTACTT
AGGGTACACCATGGTTCAAGACAAAATTTCACTTAATTTTCAATTAGAATCTTTCACTAT
ATATAATTACATACTGTTTTTGTGATTAATCACTGTGCTTTAATTATGTTCAGTTTGTAA
CAATGAAAATACATCCTGCCTATCAGCTATTTATATTACGATTCATAACAGTAGCAAAAT
TATAGTTTTGAAGTAACAACAAAAATAATTTTACGGTTGGGGGGTGGTCACCACAACATG
AGGAACTGTATTTATAGGGTTGCGACATTAGGAGGGCTCAAAACCACTGCTCTAGAGAAT
TTGTCGCCCCTCTTTGTACATGCTATGCTTTGTGACTTGCGTACACTATTAATTTCTTTG
GCCAGAAAATTCTTTATAGATCAGATTGTATATAGAATTGTTTTTTTCAGTTGGATTTAA
ACCATAGCAATTATCTTAGATTCTTAAGAGTTTTGTTTACCCACAGGAGACTAGTGTTTA
TGTAAATGTATTTAGTATCATACTTGGAAATAGGAAAAACTGAATGCATAGTCACTAGTT
GCTTGCAACTTTATGGGAACTAATCAAGGTTGCTCTGATTAGTTTCATATCACACTAATT
GTTGCTTTTGATGTAAGCCTTTTCAATTCTTGCAAATGCATGAGTATTTTGCTAAATTAT
TGTTTAGCATGCCAAAAGTGATTATGACAGCATAGTACTTTAGTATTTTAATTATGTAAA
GAGTAGTTTGTTATTTTCAATGATTATAGCTTAAAGCAGGGTGCTAACTGTTTTTAAATA
GACCCTGTGTTTACTCAGGTATTTTGGTAGGACACTCAATAAGGCTGCTAATTTTAATTT
CTGTAGACCTCTGTCCAGTATAAGTGTATATAGATTTTTTATCATGCTATTTAAATTGGG
AGATCAGTTCCCTGAGTTCTTATTTCCAGTTAGAAAATTCATGCTAATACTTAGACCAAA
CTTCATCTTTTATCAACTTTTGACTTTGGTTGTAGAAAAAGAGAAGGAGCCACCAGGAGA
AGCTCCTCCAGATGATGACGTTCTCATTGTGTACGAGCTAACTCCAACCCCTGCGCAGAA
AGCCCTTGCCAGCACACTGAAGCTCCCTTCAACTTTCTTCTGTTATAAGAATAAACCAGA
TTATGTTAGTGAGGAAGAGGATGACGGTAAATGTTTTGTTACTTTTAAAGCTCTCTGTTC
AGATGCTGATTTCCGTGGTTGGGTAATGTTGTTGTTAGGTGCTGTTGAGTCAGTTCTGAC
TGAACAAAACACTTGGTCCCGCTCCAGCCTCACAGTTGTTAAATTACCTTTGCAGCAACA
GTCAACCCAACCAGTCGACTGTCATCCATGCCCTTCACTATATCCATGCCCCTGTACTTT
ACCAAGCACGATGCCCTTTTCCAGAGACTGGTCTCACCTGATAAAATGTTCAAAGTACAG
AGCAGGTGTTTTAGGAGAGCTGAAAGCAGTCATAATTTTTCAGAGCCATAGAGTAGTTTG
AGATTATGGAAAACTTGGTATGCTATGTCAATATTTAAAGCAGAGGAGTTTACATTATTA
AGATTTAGAAGTATCACGTAGTGGCATAGAGCAGGATCATAAGATCAGCCATATCCCAAG
AGGAAAGCGTAAATTCAGCTCTGACGTTGGAAGAAGCAGTCGCTGCCAGGGACTCATTTC
CGACTCAGAGAGCCGACCTGCCCCGGGCTCCCAGGGCTGCACAAGGCACAGAGAACTGGC
AAGATTAGTTGCTGTTTGGATGTGAGAAGTGGCGGAAAGGGTGAAGTTGGGAATAATTCT
GAGGTTTCTGACTTGGGACCCCCAAATGCTTACAAAAATTTCACATAAGCTTTGTACTTT
AAGATGAAGATTTTGAAGCAGCTGTGAAGAAACTGAATGGGAAACTGTATTTGGATGACT
CAAAGAAACATCAAGCAGGTGTGTTAAGCTTAAATGACAATATGTGTGTGTGTGTGTATT
TAAAATCTACTTAATACTGCTTTTTTGTGTGTGTTTCTGTATATGAAATCTAAGCTAGGT
GAATCTAGAGAGCTCTCTTACCACCCCCACTGCCACTGTGTGTGTCCCCCTCTCCCCCCA
ACACTTACTGTACATGCTGCCCCTATAGGTTCATCACATAAAACTCTTCTTAATGTGACT
GAATTATCGAATTGTATGATAGGTGAGTATATGCCAAACAAGTAGTTGTAAACACAAAAT
CTGCTTAACCTTAAAAGGAGCTTGGGTTTTTTTGTTTGTTTGTTTTTTGGGGTTCTTCCC
ATAGTAGCTGCGGTGATGTGCCTAAATAATTTTCTGCTTACTTCACTTAGATAACCTCAA
ACAGCATGCATACTGAAAGGTTCAAGTCTTTGGGTCTATTTAAGAATAGTTGTGAAACTA
CCTGGGCCATCAAGGGTTACTGTATACATCTATTCAGACAGCCACCAAGTCTGAAAAATT
TCATTTTGTAGAGGCAGTGTGCCATGTGGATGTTCAAATGTTGGAGCTGGTAGGTGTGCC
CAGGCCAAACAGTAGGATTGGTGGGCCAAAAGGACCCTGAATGTTTGTTGTGTGTGCTTA
AAAAAGCAAAGTCATGCTGAACTGAAAAGTTTAGATGTGGATTCTCTGGTCATTGAGCAC
ATCCAGGTGAACAATGCCCCCATGATGCAATGCCAACTCAGGCTAGGACTAACCCACACA
TGAGCTCCAGTATATTGAAATGATTAGTAAAAGGTGACAAATTACTCCTAAACCAGAAGA
GGAGATTGCACTGAAGAAAACACATCCTAGAATTAACTGAAGGAGCAAAACTTTACGGCT
TGGGAGTAAATTAAGTTAAAGTAAAAGTTTTAAAAAAGGAGAGGGGTTTAATATGATAAT
TTCTATATGTCACAAATTTACTTATGTTATAACCCTTGGATATTTAAAATGAGCTGAAAA
ACATTCTTCTTCTGATGGTCCTTGTTCCTCATTTAAATTTACAGTTTTTCTTAACTGGAC
CTGTAGTTAGTAGATTACTTTGAGATTCGCTGTTGTAGAGTGGTTGGACATCTACTTTTC
TCTTAACTTTCTTTTATGTGTGTTGTATTTATTTTTCAGTTACCGACAAAGAATGTGTTA
TTGTTTGGGAAAAGAAACCCACACTTGCAGAGAAAGCAAAAGCAGATATATTAAAGCTTC
CACCTACCTTTTTCTGTGGAGTATGCAGTGATACTGAGGAGGACAATGGAAATGGGGAAG
ACTTTCAGTCAGAGCTTCAAAAAGTTCAGGAAGCCCAAGTAAGAATACCACCATTGTTTT
CTTCTGTAATGGTCTTTGTGGATGTTGTAAACTTTAGAATAGTCACACGGCTACCATGGA
GTTGATTCTGACTCATGGCAACCTTTTAGCACACAGTTAAACTGCTCCCTAGGGTTTCAG
AGACTATGTGTGGTTAGCAACCCAAGCCCACAACACTCTCAGGGCTCTTCCTCTTAATGG
ATTTCAAATAGATTAGATTCATGGATCATTGATCCATGATCATGGATCAACCAACATACC
CAGGCAAGATAGACTCTTGTTACATAAGCGGACAATCAGGACCCTTCCTGTGTGCGTATT
CGATTTTGGGGGGATAGGGAGAATGAAAATATTCTTAAGAATACCTCTTACAATACTAAG
AAAGGTACTAACTAGTGCACTGGCTTCACGTTGAGTTGCTGAGTGCAAGGTCAGTGGTTT
GAAACTATCAACCACTCTAAGGGAAAAAGATGAAGCTTTCCTTCTCCAGAAAGAGTTCCC
CTCTCGGTGACTCCCTCATGCCTCTGACTGTCTTTGGGCGCTCTCTAGCACCAGATTGTT
TCAGTGCCTGAGATCCTTAGGCAGTTTTTTTCGATCCTTCTTTCAGAGCTTTCTAATAGT
TGATTCATCTGTTTCAGCTCAGGTGTGTTAGAGTGGGGGTTTGGGGTTGAGACTGTGGCT
ACTCCTATCTTTCCTGAAAACAAAAGTCCTCTATTTTTTTGAAAAGGAGGTATATGGTAC
TTTTTGGAAATCAGTGTTTAATAGCATAGTAATTTGTGGTTTCTGCTTTGCAGAAATCAC
ACAGTGAGCAAATGAGTGTTACTACTCCGTCTGAGAGGATGTGTACAGGTGGGATGAAAG
TGTCCCCTCCATTTTTCTGTAACTCTGAAGAAGCAGGTTCTCAGATCAAATCTGTTACTT
CAGCACCGATTTCTTCGGGAACCGAGGACAAACCTGTAGATCTGTCTACAAAGAAGGAAA
ATGAAACAGATTCCACAAGCCAAGGTAAATCTTGATACCTATTTATATAAGCCTTATCGG
CATGCATTTCATAAATAAAACCGATTTACTAGAGAAGGTACACATTCAAAGGTAGACTTA
AAAAATTTCTTAAAACAACTTTTTAAAGGGACTTAAAATTATTAATAATGACCAGAAACT
CCTACTGGCTTGCTCACAAAGATAATAAACATCTATTTGTATCATTAAGAGTTGTGGATT
CAGGGAAAGACCAGGCATTATGGTGATGGTCTGTCCCATCTGATCATAAAGGTCAATTGT
TTGCATATGTGGGAAATTTCTTTGTAGTAATATTTTCATTGGAATATGATCTGAGTTGTA
TCATCACTCAAACGTACTTAAAATATTATACGTACACATGAAGTAAATGTATAGTAGGTT
TGTCAATTGCTTATGGTGCTACATAAATATCTTTCTTTTTCATTTTCAGTCTTGTAGCTT
TCTCCCTTACCTTTATATCTCAATTGGTATCTGGGAGTCTCCTTAAGTTTTCTTGCTTTG
TACATGTGTATTAGCACCCTGGTGACACAGTACTTGGTGCAAACCTACCAGTGGCTTCCT
GGGAGAAAAGACCTGGCAGTCTGCTCCTACAAAGATGAGAGCCCAAGGAGCCCTGTGGGG
CAGGCCTACTCTGGTGCCAAGTTGGCACCAACTCAGCAGCATGCAATGCTGACTACATTA
CCAAAATTAATCAGAAGTAGGTAAACATTTTACCAATATTTTTATAAACCCAAACCAAAC
TCACTGCCTTCAAGTCCCTTCCTACCCATGGTAATCCCTTCAGACAGGGTCGAACTGCGC
CGTGGGTGTTCAAGCCCATAACGCTAATTATGGAGTAGAAAGCCTGCCTCTCTTCAGTGC
CGCAGCTGCTGCTGGTTTCAAGACACCCGGCTTTGTGCTTCGCTGCCCCCCTCATAACTA
CTGTGCCACCAGGACTCCTTTCAAACTATGGTAGGGGAGAAAAGTCTATCTGACCTCAGT
CATCATGCAGTTTCTTAAGAGGAAAAGGAAGGCATAGAACTTTCATGAATCATGCTGCAT
CCCATTGGCAGAATTAATATTCTGACCCCACAACTCCTGATGATTTGCTACCCTACATCC
TATAGAGGAGACATTTGATTCTTGTCAGTTTAATGCAGAAGACAAATGTTGTTATGATGG
ATAACTGAAATTGCATAGCTTTCTTGAAATCCTTTTATATTACAACCCATTGCTCTGGAG
TCAATTCTGCCACATCACAACCCTCTAGGAGCGAGGACACCCTATGGCAATCCAGACAGA
AGCAGACAGTCTCCCTTTTGTCTGGGAGAGCTGGTGGGTGGATAGCAAGCGGGTGTTTGA
CCACACCACCACAGCTCCTTTCTAGATTAAAGGAGCCCTTATTAAAGCAGGAACTGTGTA
GCTTGGTCATCTGGTTTAACACAGTTACTTCTTATTTTTAAGCCATTTTATTGGGGGCTT
GTAACAACACTTATCACAATCCATGCATACATCCATTGTGTCAAACACATTTGCACATTT
GTTGCCATCATCATTCTCAAAACATTTTCTTTCTACTTGAGCCCTTGATATCAGCTCCTC
ATTTTTTCTCCTCCCTTCCCGCTCCCCTCTCCTTCACAAACCCTTGATAATTTATAAATT
ATTATTATTTTGTCACATCTTATACTGTCCGGTGTCTCTAGTCACCCACTTTTCTGTTTT
CCATCCCCCGGGGAGGAGGTTATATGTAGATCCTTGTAATTGGTTCCCCCTTTCCACCCC
ACCTTGGCTCCACCCTCCCGGTATCCCCACTGTCACACCTGGTCCTGAAAGGATCATCTG
TCCTGGATTCCCTGTGTTTCCAGTTCCTATCTGTACCAGTGTACATCCGCTGGTCTAGCC
GGATTTATAAGGTAGAATTGGGATCATGATAATGGGGGGGAGGAAGCATTTAGGAACTAG
AGGAAAGTTGTACATTTCATCAACACAGTTCCTTCTTTAACGTGTCTTCAAAAATGATTT
TTCTCGTGGTTGTATTTTTGCTGTATTCTTTGCGAATAGCTCCTGCAAGCTTAATACCTC
AGGAGATCAAAATTAGATATGTATCAGCTCAAAGTTCTTTGTCATATTTTTTGCTCCTGA
GGAAACTGTACAAGGTTCTACGCCCTTGAGTTCTGGATGAAATTGTGATGTTTTAAAAAT
AATTATTAAATCATTGATTTCTTTTGCCAGTGGAAAGCAAAACAGTTCCAATTGTGTTTG
GATGCAGCACAGGGCTATCATTTGCAGACTTGGCTTCCAGTAGTTCTGGGGATTTTGCTT
TTGGCTCTAAAGGTAAGACCAAGAAGATAGACATTAATGATTATTTATAGACTCAAGCAC
AATGGTAAGAAACATTCGTTTTCCACAATGCTTTGTCAAATCTGGTAATTCTATCCCTCT
TCTGTATTTTATTGTTTTAATAAGGGAGGGCTTTTTTGGGGCTATTTTCTCAAGTTTACT
GTAAGCCATGCTGCTTGTTACCCCAGGAAGAAGTTGAGGTCAAGAAATTAAAATGTGCTT
AGGCTTCTGTGGCAAATGTGGAACTTGCAAATCTGACCTCTTTGTGGGCATTCTGTGTTC
ATTTTTCTAAATGTGATCAAAGGTTTCAGGAAATTAACTGTTCACCTACGTTTCCAATGC
TTTTAGGCACCGTGCCTTTTAGTAAACAATTTCAAAAAGTCTCATCTTTGTATTAAGGTC
AAATAGTATGCAATGTGTAAATGTACCGTATTCATTAAATGAAGCAAACTTGTAGAATAA
TATAGTTTTAAACACTTTCACAGAAAGTATTTTTATCACATTGATAGAAATTCCATGCAT
TGACAAATACAGAACAAAAAGCTTATAAAAAATGATGCCTTTATTTAAATATACTAATTT
ATTTATCAGATAAAAATTTCCAGTGGGCAAATACTGGAGCAGCTGTGTTTGGTACACAGT
CAACCAATAAAGGTGGTGAAGATGAAGATGGTAGTGATGAAGAAGTAGTTCATAATGAAG
ATATCCATTTTGAACCAATAGTGTCATTACCAGAGGTAAACATTACAAAAGGAAAATCTT
AATAACTAATTTCTCATTTTAGGTTTAAAACACAAGCTTAATTATTAGGGCTCATTTCTT
TGTGAGTGTTCAGAATTTGAGGTGTAAACTAGATGTGCATTAAGTGTACCCTTGTAATAA
TGTCTTTTTTAAAGTTTATATATATATATGAGAAGGCTTCTAAAAACTTGTGGGGAATAT
GTATTCTATAAATTTTTGAAGTTCATGCATACACATTTCTTATAAATTCTATTCACATTA
TTGTCTAGAACTAACAAAATTCAAGCATTATTAGAATATCGTTTGTTTTCATAGGATAAT
TCTGGGGGCCTAAGAAGACAAAAAAAAGTCTTGTATTTTCCAAAATACTTTCAATAAAAT
GTAACAGCTGTATTTTCTGTAGAAGAATGTTGCTTTAAGCAAGTATTTTGTAGTTTTTGA
ACCACAATCAGTAGTTATTATTTCACTTAAAAAATAAGGAATGTTTGAAGCATTTAATTT
CCAAAAGTGGAAGAACAGCATGTAAAGAGAAATGATCTATAATGACCAATTAGGTCTTCA
GTACTTCCTGAAAATCAGATGTATTCCTAGCTCTGGGATATTACCAATTATTTTGATACT
AAAGTTCAAATTTATTAATTTGAACCTCAAAAAAATAAAGCCTACAGAATGTGTATATTT
GGAGTGTGTTATAAACAGCTTATACATAGATCATTTCCTTTGCTATTAAAGGTAGAAGTA
AAATCTGGAGAAGAAGATGAAGAAATTTTGTTTAAAGAGAGAGCCAAACTTTATAGATGG
GACCGAGATGTCGTTCAGTGGAAAGAGAGAGGTGTTGAGATATAAAGATCCTTTGGCACA
CAATAAAGAACTATTATCGGATCCTAATGAGACGAGACCAGGTCTTTAAAGTATGCGCAA
ATCATGTATTACAAAAACAATGTATAAACGTAAATGTTTCAAATAATGCTTAGTTTGGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTCATAGATGGAGAAGCAA
AAGTAGAACAGCTTGCAGTGAGATTTAAAACTAAAGAAATGGCTGATTGTTTTAAGAAAA
AATTTGAAGAATGTCAACAGAATTTATTGAATCAGACAGAACAAGCATCACTTACAGCAG
AATTATCCAAGGAAACAAATCCTGTGGTATTTTTTGATGTTGGCGTAGATGATGAATCTC
TAGGACGTATAACCATGGAGTTATTTTCAAACATTGTTCCTCACACTGCTGAGAACTTCA
GAGCTCTGTGCACCGGAGAGAAGGGCTTTGGTTTTAAGAATTCTATTTTCCACAGAATAA
TTCCAGATTTCATTTGCCAAGTAAGTATTACTACATATTACAGCCGAAGGCTAAACGAAT
TCACCACATGTTTGGGGAAATTGGAGTTTTTCCCTTTGCCCTCATCCTGTAGTTTTTGCA
ACATTTCTTTCAGTTCTTCTTCTCCACCGCCCAAAACTTTGAATTTAACTTGGTTTATAT
TTATGACCTTGTTACCTGCTAGGAATTGGGTGGGCAAAGAACTTCTTTATGTGATCTTTT
TTCAAAATTGGGTACTTCTTAGTTTTCAAACTACATTCTTTTTTTTCTTTCTTTTTTTTT
TTTTAATCCACAGGATTTTATTCTGCCCTTGCCCTCGCTTCCTCCCCCAATTCCCTTCTT
TGTTTTTTTTTTTTTTTTTGGTATTCATTTTATTGGGGGCTCGTACAAATCTTATCACAA
CCCATCCATCCATCCATGGTGTCAAGCACATTTGTCGCCCCCATCATTCTCAAAACATTT
GCCTTCCGCTTGATCCCTTGGTATCAGCTCCTTATTTTTTCCCTTCCCTCCCCGCTCCCC
TTTCCCTCATGAACTCTTGATAATTTATAAATTATTATTATTTTGTCATATCTTATCCAC
TGCCTTCACTCACTTTTCTGTTGTCCGTCCCCCAGGGAGGAGATTATATGTAGATCCCTG
TATCGGTTATCCCTTTCCCCCCACTGTACTGCCACCCTTCTGGTATCGCCACTCTCACCA
CTGGTCCTGAAGGGGTCATCTGCCCTGGATTCCCTGTTTCTAGTTCCTATCTGTACCAGT
GTACATCCTCTGGTCTAGCCAGATTTGTAAGGTAGAATTGGGATTATAATAGTGGGGGGC
GAGGAGGAAGCATTTAGGAACTAGAAGAAAGTTGTATGTTTTCTTTGTTGCCACACTGCA
CCCTGACTGGCTCGTCTCCTCCCTACAACCCTTCCGTAAGGGGATGTCCAGTTGTCTACA
GATGGGTCTTGGGTCCCTAATCTGCACCCCCTCTCATTCACAATGATTTGATTTTTTTTG
TTCTTTGATGCCTGATACCTGATCCCTTTGACACCTCGTGATCACACAGGCTAGATGGCC
TCTTGTTTACCTCCAAGCCTTTAAGACCCCAGACACTGTAACTTTTGATAGCCGGGCACC
ATCAGCTTTCTTCACCACTTTTGCTTATGCACCCATTTGTCTTCAGCATCAAACTACATT
CTTACGAAAGTTAGGTTTTTACAGTTATCCTGTAGTCATGAGTTCTGTGTGTTTTATTCA
GGAATCCTAAATTGGATTTTTTTTTTCCTCCCAGGGAGGAGATATTACCAAACATGATGG
AACAGGAGGACGGTCCATTTACGGAGATAACTTTGAAGATGAAAATTTTAATGTGAAACA
CACTGTTCCTGGGTTACTGTCAATGGCCAACCATGGCCGGGACACCAATAATTCTCAATT
TTTCATAACACTGAAAAAAGCAGAACATCTGGACTTTAAACATGTAGTATTTGGGTTTGT
TAAGGATGGCATGGATACTGTGAAAAAGATGGAATCATTTGGTTCTCCCACCGGGTTGGT
TAGTCGAAGAATTTGTATCACAGAATGTGGACAGATATAAAAATCAATGTTTTTCATAGT
TAACTTTATCTGTATCAACAGTTAAATTGAAGCTTAGCTGTCACAGACAATTTGGCAATT
ATGTTCAGCTTTTGAAATTGGACGCTTCCCATGTATAAATGTAAAATTGCAGCTTATAGC
TGTTGTCATTTTTTAATGTGTTATAATTGACCTTGCATGGTGTGAAATAAAAGTTTAAAC
ACTGGTGTATTTCAGGTGTACCTGTGTTTATGTACTCCTGACCTTTGTATTAAAAGTGGA
ATACTAATCTTGTTAAAAGCAATAGACCACCTCAATCTATTGAAGAATATGATATATGCA
ATTTTATTTTATCCTTTTAAGATATTTCGACTGCCTGCATGGATATACTTAACCTTTTGA
ATAAAGGGACCATAACTTAGATTTTTATTTTTAAGTTTTTTAAGATTTGAAGTATATTTG
GTAATCTTAATTGTTGTGTGCTCATTTGTGCAGACTCATTTATGAATGGGTAGAGCCACA
GAAGCTAGAGACCTAACCAAAGTGCTCTTCTACAGTCTTGCACCTCCTGTATAGTTAGAG
GCTAACTTTTAAGTAGGATCCTTTTCTTGAAATGATATGTAGCTTCCTGTGCCCTTTGAA
AGGCAGTAATTTTTACATTTTAAACAAGTTGATGATTTCCTTTGAGTTTTTGTTTTATTT
TATAACTCTTCTGTCATCTGTCTCTACTACCTCAGAAACTGCAGCTTAGTTCTGATGAAA
AGAACTTGATTTTTTTTCCTTGAAGTTATTGTGATAAAGTATGAATATTTTTAAAAAGGT
CTATATCGTGTTGTTTGGGTAAAGATTTGCTTTATTACTAGATTGTTGCAGTACCTTTTC
TGGTGAATTTTGTAGCAGAAATAAAGTAACTTGATAACAGCCATGACATTTAAAAAATTC
ATTACTTGTGCATTTAGTTGTCTGTTCACCAATTCTAGTACCAGCCATAAAGGAGGGCAA
TTAAAGATCACTAAATAAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1072, 2528..2595, 2696..2807, 2908..3060, 3161..3391, 3492..3637, 3738..3930, 4031..4118, 4219..4428, 4529..4710, 4811..4986, 5087..5210, 5311..5472, 5573..5710, 5811..5957, 45513..45692, 45797..45880, 49107..49242, 53008..53102, 54548..56223, 56483..57260, 57525..57530, 57532..57564, 57566..57588, 57590..57594, 57596..57602, 57604..57618, 57620..57638, 57647..57649, 57654..57706, 57708..60095, 60250..60383, 64355..64525, 65223..65297, 66459..66637, 67433..67643, 69870..69971, 70569..70714, 71451..71555, 71558..71644, 71647..71661, 71666..71689, 71692..71716, 71808..72139, 73414..73717, 73719..73720
1001..1072, 2528..2595, 2696..2807, 2908..3060, 3161..3391, 3492..3637, 3738..3930, 4031..4118, 4219..4428, 4529..4710, 4811..4986, 5087..5210, 5311..5472, 5573..5710, 5811..5957, 45513..45692, 45797..45880, 49107..49242, 53008..53102, 54548..56223, 56483..57260, 57525..57530, 57532..57564, 57566..57588, 57590..57594, 57596..57602, 57604..57618, 57620..57638, 57647..57649, 57654..57706, 57708..60095, 60250..60383, 64355..64525, 65223..65297, 66459..66637, 67433..67643, 69870..69971, 70569..70714, 71451..71555, 71558..71644, 71647..71661, 71666..71689, 71692..71716, 71808..72139, 73414..73716
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved