Echinops_telfairi Locus ENSETEG00000018937
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000018937
Echinops_telfairi
ENSETEG00000018937
GeneScaffold_2447
SNORD20, SNORA75
55414..55493, 55781..55916
57576
TCAGAAGCACAATTCTATTCTGGCCACTTACGGGAGCCGCCCTAGTAACGGACATGAGT
CCGACCTAACAAGAGAGGGGACCGTGCGAGTAGTCAGCAGTAGCAGCATTATCTCAAGAA
CCCCCCGATCCAAAACTTGAACGACGAGCAGGAAAGTTCGACGTCCGTTCCCCACACGAG
GAAGGAAAGAACGTACGGCACGTGGCGCCTATGAAATAATGAGATATCTGATCAAGTCTG
CCAAGAAAGCCTCTAGATTAGCGGCTCCCGAAAAAGCAACTTCGCGCCCAGGGCCCGGCG
GGGACTACCCAAGCCCAGAGGGCCCGTTTCTCATCCCTAGTCCGCGAATGGACTGGAGTC
AAGTGGGAAAAGAGACGGCGAGACCCCGGTAGTCTCTGCACTTCCGGCGGTCTCGGGCTC
TCAGGTGAGGGGGACGAAATCGTCTCCAGGGGCGCCGGCGCCGCGCACGGGGCGCCGAAG
AGCCCCGGAGGCCGCCTGGTCCCCCGGGCTGGTTAGGAAACCGCGGACCCCGGGCCCCGA
CCGCATTCTGGGGCCGGGCCCCCAGACGCCAACTGCGCCCCCCCTACGGCGCAGGCGCCG
CGAGCGCGGGCAGCGCGGGTGCTCGCGGGACCGCGCGTCCAAGACCCAATCAGCGTTGGC
CTCGCACAAAGCGAGCCCGCCCCCAAGGCCCCCTTCTCCCAGCCCCTCCCCTTTTCTGAA
CGCTCAGGCCCGCCCCGCCCCGCCCGCGCCGTTCACGGGGAGGGGCTCGCGATTGGCTCT
TGGGATGGGCGTGCGCTCTGATTGGTTGAAGCGGGGTCACGAGGGCGCTAGCGTCGCCTT
TCCAGAGGCGATTACTGGGCAGGCTCAGTCTTTCGCCTCAGTCTCGAGCTCTAGCGGGCA
GCTAGGAGTACGCGCTCCGGGCTCTTCAGCACTGCGGCCGCCATCGACGTCGCTTGAGTT
CATCTGCGCCACTCGCGTTGCCATCGTCCCAAGCCGCCATCATGGTGAAGCTCGCCAAGG
TAAGCTGCCTTGTCCGTGCAAGGACGGGCATCGGGGCCTGCTTCCTGAGGAGCGCGCGCG
CGCGGCGCCGCGAGGAGGAAGGCCTGGCCTGCGCGCCGGCCCGGGCGCGTGCGAGCTTCC
CCGGGCTTGGGGGAAATCTCGCGCGACTAGCGGCGCTTCTCGCGCGTTTTGGTCGCATGA
TGGCGAAGTGAAAAGCGCCGGCAGGTGCGGGAGGCGGAGGAAGCGGCGGGGAGGGATCGT
GGGGCCGGGCGCGGGGAGGGGGCGCGGGGCCCTGGGACGGAAGGCCGAGGTGGGACCTCG
CTGTGGGCGCTGGCTGGCCCCGCCTCCCGGCGCACGTGCCCCAGCGCACGGCTCGCCACG
TGGGCCGCGCCGCGTGTCTTCTGGGCCGGGAGGACCTGCTCCGTCCGCGGTCGCCGAGGT
GCCCGGAGGCCCGGCGGTCTCTGGATCGCCCCGCCCGCAGGCACGTGGTGCGTCCCGGAA
GGAGGTGGCGCCTCGTGTTTTCTGCGCGCACGTGGTGACCCACCGGCTGCCCCACGTGGC
CCACGCGGGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACATACTGCTCAAGGGGCTGAGGCAGTTGT
GATACTGAGGCCCGGCTGCTGCTATGCCCATCAGTGACGCTGTGAGGGATCCAAGAAGAA
AGCTTGGTTGACTGTTCAGAGACACCACAGGGTGGCCTGTTTCCAGTCTCTGTCCCTGGA
ATGAGGCTGGGCTTCATCCAGTACAATCTCTGAAAACTTTTTGGATGAATTTCCTTTCCA
TTTGTGGGTATAAAGAGTATTAACTTTGTGAAGTCAATCTGTCTAGCCCTGCAAAGTAGT
AAATCCGATCTTACTTATTATATCAGATCAATCCCCAATGGTCATGAATTATTCATTATC
ACAAAGTGAAACCCATCACATTTGGGGTCACAGCATGGAGTCAGACTGACTGATGTGGAA
GAAGAATTCTGGTTTCTCTCTAGACTGTGAAAATATGGCCCAATTATTTATTGTGTCTGT
GCTCCAGATTCTTTATTTATAAAATGTGTATGAAAAGATTTACCAGGCAGTAGTTGCTGG
GAAGAGAAGGTGCGATTTTGTATTTGAAGAATAGGACATAGAGCTGGAGATGGAGGAGAA
ACCTTCTATGGCACTTCAATTTTCAATCTTCACACCCTTTCATTCTGGTTTGTCTGCCAC
TCCATTTTGCATGACTCCTTGACAGGAGTCTTATGTCTCAAGTTCCCTTTCACAGGGATC
AAACCACCATGCTCTAGGTCATGTCCTTACAATGGGTAGTAGCCCTCTGCTATGTTTCTG
GGAATCTCCTCAGGTGGAATTGCAGTTCAATTTTGTTCTGTATGACATGCTGTGCTAGTG
AATTCACTCTGTATCTAGTCATCTCTTTTCTAGAGATCAGTTGGTATAGTGACCTCAAAA
TTTGAAGTGGGAGGTAGGAGTCTCCACTGAGGTGTGAAATGTAAGCTATCTTCTCTATTC
CAGGTTTCATAAGAGGTTTGCAATGAGATGTCAAATGTTTGCCTAGATTTTTGAAGTTCT
TTATTGCTCATTGAGTGTGTATCTCTCAATGTTCATAATAGTGAACAAAGGGTGAGCAGT
ATTCCATGCCCCTGATATATAACAAATAGTGCTTAAAACATTATATGTATGTGTATATAT
GTGTGTAACCCTCGGAGAACTCGGAGCTTCCAATTGGAGAGTTGAATAAGGCACTTGTGC
TTGGAACAGTCAAATCTGGATGGGTTGGTTGATGAGGTACTACTTAAAAATAAGTTAGAC
CTAGAGAAATTGGTGGTTTTCATGTGGACAATGATCTGGTTATTGTTGGGGTTATAACAT
CAGGCAATACTGCTATGAGTTGGGTGGGTCTCCCTCACAGGGAGACCTGCTATTTGAATT
CCTAGGAGCAATCAATCTTGGGGATGGAAATGAGATAGACCTTTAATTGAAAAATGGGAA
GCGTCTACTTCCTTCTCTGTGGTCTAAAGTCCATTTGGCTGAGCCTCTTAAACCTAGGGA
GCCTGAAGTGCTTCCATTCATGGTGGTGGTCTATACACTGGCTCCAATTTGGGCAGGCAG
ACAAGAAGCAAGACAGAGGCCAGGACCAAGGTGGGCCAGGGCAGAAACTAGGTTTTGTAC
ATTCCTACAATATTCTTCCATTATTCCTGAACCTCCCAGATAGTCTCATTAAAAGTTTAT
TACCCAGTGTCTGCTGGGTAATCATTGTTGTCATCAAGGATGCCCCATGTTCAGAATAAA
GCAGGGTGTTCTTGGAACAACCAGAGTCTCATGGACTCCAAGGGCATGTTCCTGGCCCAT
GTGAGGCAGTCCTTTGGGAAATCCATGGGAAACTTGTTTAAAATGAACAACAACAACAAC
AACAACTCACCACCCTAGAGTCAATGACCCCTGATAGTGAATCTTTAGGACAAGGTGGAG
TTGTCCTTGTGGTTTTCAGAGACAGTAGCTCTTTATCGGAGTGGAAAGCCCTGCCATTCT
TCCTTGGAGCAGCTGGTCATCTGGAACTGCTGACCTTCTGGTGAACACCCAACTTGTCAC
CACTACACCACTGCGAGTGTTGGGAGTGGGTAATTGGGTAATACATAGCAAGCTTGCTAC
ATTTAAAGTGTATGCACCTGAGATTTTTCTTACTAAATTTAATGAGGTGACGAAGTTGTT
AGATAATGTCTAAGGATCCTTCCAGGCTCAAACTTCTATTATGCTAATTAAACACAAATA
CCCTTCAGCACAGGATGGCTTTCACAAAGTCAGGTTCTTTCACTGACTGGTGAGGAAAAC
CTCCTTCAAACACTCAGCCAACCATTGTATCTGATGTAGGTAGTGTTGCTGTTCTGAAGA
GGCATGTTCTGACATATTTTTTCTTATCAGAAATACATCTTTTTCTTATCAGAAAGTGGG
ACATTTTGATGGTGGAGAGGAAGGTGATTTTTAAGATTCTTTCTAGCACTAATGTTCTAT
GATTCTGGGAGCACAGAAGTAGCAGTAGGTACCAAGCATTCCATCTACAACTATGTAGTT
TTGGGACAAACTACCCTACACATTTGAAGAGCCCAGTAGAGTATGAAGATTATAACCTAC
AACTAAGCAAGTCATTCTAAGCATCTTCTAAAAGACCGGGTCTGTGTTAGGTGGTACAAA
GGGTTAAGTACTTGGTTACTAGCTGAAAAGTTGGTTCCTTGAAAGAAAGATCTACTTCTA
AAAGATCAGTCATTGAAACTTCTATGGAACAGTTCTACCAGACACACATGAGTTTGCTAT
GATTTAGAATCGACTTCACAGTATTAAAAACACTTAACAAATTCTAATTATATGGAGGTA
AACAGCATGTGAATGGCTTATATCTCATTCTCCTCATGGCAAAGTGACACAAACAAATGG
TGACTACAGTTTGTAAATGGTAGTCATAAGAGGAAGACTAATATGAGAAAGAAGGACTGG
CAAGAGGAACCAATGTTGCATATGATGATCATGATCATCTCCCTGATGTGGTGGCATGTA
AATTTGGACCTGAAGGAAGAAAAGGTACAGCGGAGCATAAATCCACAGGAAGAATATTCC
AGCAAAAATTACACATGTAATAGGAAGTTGGGAAGGTCAAAAACATGCATGTGGAAGCAT
CTGGAGGAGCCTAGCCAATAGAAATGGGGCAGGGTGAAGGGGCTAGGGGTATAAAATATG
TTTGACAAGAAGTAGGGGAAAGATCAGGCATGGCCTGGTAGGCCACACTGGAGGGCTTTA
GATTTCATTTTACGAAAAATGGACTCTAAAGGAGTAGAGGAATTATCTGCTAGACAACTT
TGTGGAGCTAGTGTGCCTTAAGGTGGGGTGGAGGGAGAGCTTCCATGCCTGAAACTGTTA
CTGGTGGCAGGTGAGAAAGAAGAGTGGACAAAGAAAGAAGTGGATGGAGTTCTGAGATAT
CAAAAAATGGAATCAATAGGACTTGGTGATGGATTGCTTTATTTCTAACATAGGTCTCAT
TCTAGAAGCATAAAAGGATGTTTTGGGGACTTCCATATTGTTTAACTTAGCTGATCATGT
TAAGTGGTTTTTATATAAGACCTTGAGTCTGAAGCCTTTCACTAGGTGTTGAAGATAGAA
GATGACCCTCAGACATCTGGCCTGAGATATCTTTTGTTCCTTCTTAATAGGATCCTAATA
ATAGGGATGTTTCGCAAAAAACATCTAATTTCCCAGCTGCTTCTGCAACATTATAATTTT
GGGCAGCATTGGGCCTGCTAACTTGCTTGTCTCCAATTCCCTGAAATTGAATAGCTATTC
CCCCCTTTAGACAGAGAATGAGCTTGCATTTGCCAACCTCCTACTCTCCCTCTTGCTTTG
TCCCTCTTCCTTTACCTGCCTTGTCCTCATGAAGACCCACATTTGCTTCTCTATCTAATT
GTAACAGAGTGAATTTGCTTTGCATATTTCTCTTGTGAGCTGTGAGGGTAGGTGTAGGGA
GGTCCTTGAATAGTTGAAGATTTGTGACTCAAGTTAAGTATCTTTCTTTCCAGAGATTTG
TAAACTGGAACCAGAAGGAATTCAGAAAATTCCAAGGGTGGTCTCCATGATTTCCACAGA
AGGAATTAAATCTCAAATTCAAATAGGCTCCTGGTCTTCTTCAGATTCTATCCCTTTCTC
TTAACTATCAGGAATAAGATGTGAACACCCTGTTCATAACAAGGAAGGTGTTTAAACAAT
CATATTCTAATAAAGAAACTACATTTGGGTGGATTTCAAGAAATATGATTAAATCTAAAG
AAAAAAAATTAAGTTTTCTTTTTAAAAGTACTACATTTCCTGGAAAGATGAGGGGTTTTG
GAATTACAAGTCCCTTAAAAATGATTTGGATAATTGGGATAACAGTTGTATGAGCCCCTA
ATAAAATGTTTAAAAAAAAATGATTTGGATATTTTCCCCATGAAATGATCTCTAAATTAT
GAAACCAGGAGGAGTTGTAAATGGCAGAAAACTTCAGCAACGGAACAAGTGTGTTCTCAG
CAAAAGTTGCCTAAAGTCTAAAAATTTTTCTTACAGCTGAAGTGAAGCAATCTCCCAGTC
TTTTAGAAGCACACTGACTTCATGTCTAAGTGAGGCTTTATTCACAGACTAGCAGCTAAA
AGGAACCTCTTGTTTCCGCTCATGAAGGAATGACTGCTGATACTAGGATAGTCACAGAAA
GGAAATTGCTATTTCCACTTACATGTTCTCCAAACAACACTAAAATATTTATCAGCAGCA
AAATGAAAAAATAAACTCCTAGAACTTTATTAAATTTCATTCCTTATACCCTTTGGCCTA
AATGTTAGGTGTTAGATAACAAATCAGGAAAGAATGTGTAGAAAGTTTGTGGCAGATTAT
TCCTAGTTATAATCTGCCTTCAGTTGAGATGTCCATAATCCCAATTTAGGGATGGTGATG
ATGGAAGTGATTGAGTGATGTTGAAAATGTATTATTAATTGGGATTTAATACATATATCA
CTCCATAATTCAATCATGTCCAAAAGTATTATATAATTGCTACCACAATCAGTTTCCAAA
TTTTTACTTTTTTTTTAATCTACATGGACCCCTTGACATCGTCTCCATTTCACCCCACCC
TACCACTGCATAGGTTTATCAATCCTGGGTGGGTCTGCTGACAACGTTTTAAATGTTTAG
GATGTGATATTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCGTCAGTTTTATTTTTCTTCCTTTTTTTTGTCACCAGACTAA
GATTTAGATCCAAAGGGAAAGGAACCTGGCGGGTTTTTAAGGCTGTGAGAGTGTGCCTTC
ACTATCATTTAACATTTTTTTTGAATTTAAAATTATTTATTTTGTTTTCTTAAAAAAGCA
TATTTTATAAAGTTGCACAGCCCATCTCAGCAAATTAAATCTGTAATAATAGCCCACAAC
CCCCGATAAAAGTGTTTTTATCTTTTTTCCTCTCTGCTCATTTGGACTCTCTACCTCTAT
CATCTCCTATCCCGCCCTGCACCCTGTCCTCCTCACCTCTCTTCCAGCCACCCCAGTCCC
TGACCTCCTTGTAGTCAAAGGCTTATCTTTTGGTGTAAAAACACTTTTCTTTTTATTTGT
TTCATCTTATAATAATGGCTTCATTAAATACTGTTTTAAAGTTTTAGTATATTAAATGAA
CACATAAATACCAGCTACCAGGAAAACTAGTTACATATTAATAAATGTCTTAAACAATAT
CTCAGCAATTAGATGCCTTAGAACAGTGCCTGTCAGGTAAGTGTTGGGCTGCTAGTCACA
AGATCGGTGGTTCAAATCCACTAGCCACTACAAGGCTACCTGCTCAGTAAAGTCTCACAG
TCTCAGAAACTCTATAGAGCATTGCTGTGCATAAGAACGGACCCCATGGCAGTGGGTGCT
TTTGTTTGTTTGCTTGTTTGTTTTAAGAAATAATTTATAGTGGAGCTGATCAATCACATT
AAGTTAGGAAGGGTGAGGAAATATTCTTATCTTCCTTGGCAAAAAGGCACTGTGAGTCAC
TGTAAATTCCCTTCCCATGTCTTCCTATCTAAAATTCCAGCCTCTATTATATTTTCCAGC
ATTTACAACTGTCACCAGCCTGTCTTTGGAGAACCGGAAGAGATTATTTTGCAGTGAAGT
GCTAAAATTGTTTGGGCTTCAAGCAAGTTGCTGTAGCAGTTGCAGTGTGGCTTTGTGGAG
TTCTTTTGCATTGTAGTGACCTTAATTGAACAAGAGATATCATTGCTTTTTTTTTCTCTT
GGAACTTCCCCTTTAGTACAGAATAGTGTCTAAAATTCTTCATTCAACCCAACTAGTATA
ATGGTAGAGAAGCAAATTGGGGGTGGGGGAAGAACGGAATGATGAGAGAAATGAGAATTT
TCTTTTTAGCAGCTGAAGAGTAATAGTGTTTACTTACATTTGGCAGTGTGGGTGTTTAAG
TATGTGGAAATGTTAAGTGATGGCTTGGGATATTGAAGAAGCTAATAACTGAAGGTCTAG
TTCACTCTTCCCCCCATTAATCAAAAATAGAAATGTTTCCCTCCTTCCTTAAAATATCGA
TGTTACACCACTGACCCACTACAGACCATTTTCTCAAAGGCCATTACAAAATAATTGCAA
ACTGGGCACAGACCCTTCCTTCTAGGGGCTATAAGAATCTTACCATAGTGAATGATGGCG
GGGAGTGTGGAGTAGAGACCCAAAGCCCATTAGTAGGCCACTGGAGATCCCTTGCAGAGG
GGTCTTGGGGAAGAGATGAGCCAGTCAGGGTGCGATGTAGCAACAATGAAAAAAACAACT
TTCCTCTAGTTCCTAAATGCTTCCTCCCCGCCCCCACTACCATGATATGAATTCTACCTT
GCAAGTCTGGCTGGACCAGAGGATGTACATTGGTACAGATAGGAACTGGAAACACAGGGA
ATCCAGGGTGGATGATCCCTTCAGGACCAGTGGTGTGAGTGGCGATACTGGGAGGGTAGA
GGGAGAGTGGGTTGGAAAGAGGGAACCAATTACAAGGAACTATATGTGACCTCCTCCCTG
GAGGACGGACAACAGAAAAGTGGGTGAAGGGAGATGTCGGACAGTGCAAGATATGACAAA
ATAATAATTTATAAATTATCAAGGGCTCATAAGGGAGTGGGGAGCGGGGAGGGAGGGGAA
AAATGAAGACCTGATGCCGGGGGCTTAAGTGGAGAGGAAATGTTTTGAGAATGATGAGGG
CAATGAATGTACAAATGCGCTTTACACAATTGATGTATGTATGGCTTGTGATAAGAGTTG
TATGAGCCCTAATAAAATGATTTTTAAAAAAATATGACTTCAGCAACATATATTTATTTT
TTTTCTTTTTCTTTGCATCTCTCATATTGCCCAGCATTGTATAAAAAAGCCCTTTAAGTT
TGCCCTTTAAGGTTCCTATCTAAGCTTTTGATTTACTGTTGTTAGTTTTATCCCACATAG
ATAGTTCTTCAGAAGAGGACAATGTTTAAGCAGATATTCTTTAAAACGTTTTTTAATTAA
ATTAATTTATTTTTAATCATTTTTAAAATCATTTTTGGGGGGCTCGTACAATTTCTATCA
CCATCCATACATGCATCCATTGTGTCAAGCACATAGGTACATTTGTTGCCATCATCATTC
TCAAAATGTTTGCCTTCTACTTGAGCCCTTAATATCGGCTCCTCATTTCCCCCCCTCCCT
CCACACTCCCCCCTCTCTCATGAACCCTTCATAATTCATAAATTATTATTATTGTGTCAT
ATTTTACACTGTCTGATGTCTCCCCCCAACCCCCTGCTTCTTCTCTGCTGTCCATCCCCC
AGGGAGGAGGCAATATGTAGGTTCTTGTAAGTGGTTCCCCCTTTCCACCCCACATTCCTT
CTACCCTCCAGACATCACCACTCTCACCACTGGTCCTGAAGGAGTCATCTATCCTGGATT
CCCTGTGTTTCAGCTGCTATCTGCACCAGTGAACATCCTCTGGTCTAGCCAGATATGTGT
TAGAATTGGGATCATGATAGTTGGGCAGGGGGGTGGGGGGGTGGAGGGAGGAAGCATTTA
AGAACTAGAGGAAAGTTATATGTTTCATCCCTGTAACCCTGCACCCTGACTGGCTCATCT
CCTCCCCACAACCCTTCAGTAAGGGGGTGTCCAGTTGCCTGCACTCACCCTCATTTACAA
TATGTCTTTTTTGTTCTTTGATGCTTGATACCTGATCCCTTCAACAGCTTGTGGTCACAC
AGGCTGATGTGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCACTTGCTT
ATCTTCAAGCCTTTAAGACCCCAGATGCTATATCATTTGATAGCAGGGCACCATCAGCTT
TCTTCACCATATTTGCTTATGCACACGTTTGTCTTTAGTGATCATATTGGGAAGGTGGGC
ATCCACTGATATGATTTTTTGTTCTTTGATGTCTGATAAATGGTCCCTTCTACACCTCAT
GGTCAGACAGGCTGGTGTGCTTTTAGTCATTTTATTGGGGGGCTCGTACAACAATTATCA
CAATCCATATAGCCATCTATGTGCCAAGCACATCTGTGCATTTTCTGCCATCATCCTTCT
CAAAACATTTGCTTTCTACTTGAGTCCTTGTTATCAGCTTCTCATTTTTTCGCTCCCCCC
CTCCCTCATGAACCCATGATAATTTATAATTTATTATTATTTTTTCATATCTTACACTGA
CCGATGTCTCTCTCCACCCACTTTTCTGTTGTCTGTCCCCCTGGGAGGGGGTTATATATA
AATTATTTTGATCGGTTCCCCACCACCACCACAAACACACCTTCCCCCTATCCTCCTGGT
ATCGCTACTCTCACTATCATTCCTGAGGAGTTTATCTGTCCTGGATTCCCTGGGTTTCCA
GCTCTTATCTGTACCCATGTACATGCTCCGGTCCAGCTGGATTTGTAAGCTAGAATTGCG
CACATGATAGAGGGGTAAGGGAGGAAGCATTAAAGAACTAGAAGAAAGTTATATGTTTCA
ATGGAGCTATACTGCACCCTGACTGGCGGGTCTCTTTCTTGGGACCCTTCTGTAAGGAGA
TGTCCAATTGTCTACAGATGGGCTTTGGGTGTCCACTCTGCACTTCCCCTCATTCACAAT
GATATAATTTTTTTTGTTCTGGGTCTTTGATGAAGCAGACATTCTTTACTAATTAAGCTA
ACCTATTGTTTGGTTTAAAGAGGACTTCATACAGCCTTAATGACATCAGAGAATTTTAAA
TTCTGCTTTGCATTTTCCTGGTTTAGATTAGGATTATTTTATATAATCTTTGATCAACAC
ATTCTGTAATAGTACCTGGGTGTCATCTAGTCTTTCTGATTACATGGAGACAGTCAGTCA
TGGATTCTATTTTTTTCCTGTTAATAACTCTCCTTCTTCCTCTAATGCTTTAGTTGAAGA
GAAATACTAATTGTGTTTTGGATAGCCATTTAGAAGCTTTTAAGACCCCCGGTACTAAAC
AACGGACCAGGAGGTAGAACAGAAACAGTAAACATATTTTTAGGCTAATAGGCAAACAAA
AATCCTCACAACATATTCAACATCATGATGAATGGACAAAATACAGATGTTGTCATGGAT
TTCATATTACTTACATCCACAATCAATGCTCATGGAAGTAGCAGTGAAGAAATTAACAAG
ATGTATTGATTGGGAAAATCTGGTGTACAAGACCTCTTTAAAGTGTTTGGAAAGCAAGGA
TATTACTTCAAGGACTAGATGTGCCTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTATAGCA
TTGTTTTAAACCAACACGTTCCATTTGCATATGGTCTTGAATTGTAGAATTCTATGCACA
TGGATAATGTGTTTCAAATCTTATCTATTTTTACAATTACATCAGATTTGTTCAAGTAGT
ACACAATAGAGAAAGGTTGTTTTCAGTTTGGACTTTACATAATCTGGGTATTTATTTCAC
TTGTTCCCATAAATCAGAGTTACTTTGTGTTGCTCACTGTCCTCTAAGCACCACAGCTAT
CAACGGAAGTGTACTTATAAAACGCATTTTAGGAATCCTTTTGGAAATGAATACTTGGAA
ATGAAGATGTCTAATTACAACAGTGAATATGCACAGGGGTGTGTTCCTTGTTACTAGTAG
GGGTCAAAGAGGACTCACTTAACATTAAGAATGTGCCCTGATATCAAGAGCCATATTCTG
GAGCTGAGATCCCTGCACTAAAACTGAAGCCACACTCCCTGCCATTGAGTTGAGGCTGAC
TCAAAAACCCAGCCCAAATCAACCCCAACCCCAAACCCAAATCAAGCTCAAGCTCATTGC
TATCTCATGGATGCTGACTAACGACCCTATACGGCACTGCCCCTGTGGGTTTCTGAGACC
GTGACTCTATACCAGATTAGAAAGCCTTATTTTTCTCCAGTGGAGCTGCTGGTAGTTTTG
AACTGTTGACCTTGAAATTAGCAGCCCAATGTGTAACCACTATACCACCAGGGCTTCGAT
AGCCTTAAAATGAGGGCTGAATGAACTTTTTCACAGTAGAGGTTCACCAAATTGAATCTG
ATCCAGTAGAGGGCACTGTATCTCTGCTCATATGTATATATTTCTCTGAAGATTATATAC
TATTAACTATGCCCTACATTACCGCAGCATATACTACTATCATATGACATTGCATCATTC
TTTTTAGAATTCACCTTTTCACGGTCCCAAAAGATGAGAGATGGCGTATGTATTAAAATA
TGGCTTGAAGACGAAACACGCATGATAAAACATTGAACTCTTAAGATAAAACATTTAACT
CTTAAGAAAATTACTAATTTATATGAACATACCTGTGGAGTAAGAAATATGAACATTTGT
TCTGTGTGATTCTGGCTTTTTTTTTTTAATCAATTTATTGGGGCTCATACAATTCATCAC
AATACAAAGATCAATTGTGTAAAGCACATCTATACATTTGTTGCCCTCATTATTCCCAAA
ATTCGCTTGCCTCTTGGGTTCCCGGAATCCGCTCATTTTCCTTTTTTTCCCCCTCCCCTT
CCCTTCCTCCTCCCCTCTCCCCCATGCACCCTTAATAATTTATAAATTATTATTGTATCT
TATATTACACTGTCCGGCGTCTCCCTTCACCCACCCTTCTGCTGCCCGTCCCCCAGAGAG
GAGGTTATATGTAGCTCCCTGTGATCCATTCCCCCTTACTACATGCCCTTTCCCTCCTAG
TAACGCCACTGTCACCCCTGGTCCTGAGAGGTTCATCTGTCCTAGATTCCCTGCGTTTCC
AATTCCCATCTGTACCGCTGTGCATCATCTGGTCTAACCTGGTCTGCAAGGCAGAATTGG
GGTCCTGGTAGTTGGGGGGAGGAAGCGTTTAAGGTTGTGGGTTTCATTATTGCTATACTG
TACCCTAAGTGACTCATCTCCCCACTACCCCTCTGCAAGGTATGTCCAGTTGTCTAGAGA
TGGGCATTGGGTCTCCATCACTCGCCACCCTCATTGACGAGGATATGATTCCCCCTCCCC
ACCTCTGGTGTTTAAAGCCTGGTCCCTTTGGCCCTTCATGATCACACATGTTGGTTCTGG
CTTTTAAGAGAAAGAAATGCTGCAGTTTTTTCCCCTAGGAAGAATGGTCATTTCTTGCCA
AATAATTTCGATGGCTAAAACACCCTGATAACGAATTTTATTTGAGATTATTTTCCGTTC
GGCTTGACCACAAAACGCAGAGGCTGCAGTTGACCGGGAAGGGTTAATGTGCAAGGTAAG
GTGGTGAGGGGCTCAGAGACTCAAGCTGCCACTCAGGTCTGGGAGCCTCCAGTGCCTGCC
TGCGCGGTGAAGCCTCCTGAGAACTTTCCTCAGGTCTTCTATTTATTTCAATTGCCCTCC
GGAAACGCACCAGGAGAGGTTGCACTTCCTGCCCTTGCTCACGCTCCATGTCTTGATAAT
TCTTGTTCGCTAGTCTTTGTTTTCCCGCCACCCATGTTCAATGTGCTGGCGAAACTGAAG
CTATCAGAGTATTAAACATAGCATAGCAAAGCAGTTTGTTAGAGTTGAGAACCTTGGCAT
TTAAACATAAAACAGAGCAATGCGGCTTCGCAAGGCAGGGATAATTTAGCTGCAGGAGCT
CCCAAAGGGAAACATCTTTTTCCCTCCAATTAACCTGAAACAGGCATGCATCGAGCATGG
TGAACATGATGACTTCTGTGTGTGTGAGACTTAATTACTGACGCTTCTGAATTTCAGCCC
ACCTGGAAAGTGAATGACTCTTGCTGGCTTGAAGGGATTCTAGTCTTTTAATTCTTTGGG
AAGACTTTATTAATTATTTGTCACGGCTATAAAAAGAGCGTTAAACGATGACACTTTCTG
AAAGGGTAGTGAGATCAAGGAAGTGTGCATCTGGATGTCTAGGTCTATTTCTAAAATTGA
AGCGATCAGATTGACGTGGGGCAGTCCCTGGAGAAAGGGAGAAAAATCCAGGCTGGTCTA
CGGGAACATTTACAGATCCCCAAGGGCCCGCAGAAGGACAATTTTCATACTTCAGAAAGC
TGCTCAATTTGGGGCAGGCAAAAGGGTGACTTTTATTTGCATTTGCAGGCTTTTATTTTC
TCTTCTTTTCTGCAATGAACACATTGTACATTTTTTATAGTTCAATAGTAATATTATCCA
GACAAAACAAAAACAAAACAAAGCCTCCCTTTAGCTAATAGTCTGTTGTCATTCTGTATA
ACACTGCCTAATGATCGTGGCCTTTTAAAAAAATTGATTTTTTTATTGTGTAAAAATTAA
TCTAACCAATATTTGCCGCTTCAATAATTTTTACATGACATTAATTATGTTTACCATGTT
GAGGAACCATCACTGATATTTGTTATCATTATTCTTAACAAAGTATTCCAGACTTAAATA
AATGGAAATGTGTTCCATGTTCATGGATTGGAAGACAACTCGAAGCTATAGATTAAATGC
CATTCAGATTAAAATTCCTACAGCCTTCTTTACAGATATAGATACACAATTCCTCAACAT
TATATGGGATGGAAAGAGGCCCCAGAGAGCTAAAACAATGTTGGAAGAGAATAACAAAGT
AAGAGGTTCACATTTCATGATTTAAAAACTTGCTAGCTGCATACAGTTCAGATGGCAGGA
AGGGGTAGGAAAGAAGGTCAGATATAAATAGGAAACACACGGAGGAAACAGGATAAGTGT
CATTGCATTGGGAGGATGGTAATCAATGTCACGAAACAAAATGTGCAGGAATTACTGAAT
GGAAAACTAATTTGTTCTTTCAACTTTCACCCAAATCACAATAAAAACTTAAAAAAACAA
CAACAATGTAAACGTGCTACACAGATACTATAAGGAGCCCTGGTGGTGTAGTGGGCTAAG
CACTGACCTACTAACCTTAAGGTCTGTGGTTCAAACCCATCAGCTGCTCCACAGTAGAAA
GATGAGTTTGTTTACTCCTATAAAGATTTAAAGTCCCAGAAATCCTAAGAGGTAGTTCTA
CCTGACCTAAATAGGATTCTTATGAGTCAGAATGAACTCATTGTTAGGAAATGAGTGATA
TAGATACAGTAATCAAAATAGCCTGGTAATGGTATAAAAATAGACACAGAGAGTATGGAG
TAGACTTTTGAGTCCAGAAATAAACCCACATATGATTTTGACAGGTGTACCAAATCAATT
CAATGGGGAAACATTTCTGTAATAAATGGTGCTGTCAAAAATTGAACATTCACGAGTCTC
GAGCTCTAGCGGGCAGCTCGGAGTACGTGCTCCGGACAGTCTGAATTTCGTGTGGTGCAA
GACTGCTTCTAAGCAGGCCTAGTCCTTCAGGTTAAGGAAAGGTATGGGTATACAGAACTA
GTTCGTTGCTTTTTAAGTTTTCTGTGGCTTGCCTTATGTTTGATGAGTTTATCTGAATTA
GAGAAGGTCTGTAATTTCACTGAAGAATATAGGGGTCCTTTACATTTTGATCTTGGTGTG
TGGTCCTGAACCAGAGATGATGCTGGATGACTTCTTTCTATGTAGGTTATCATTCCTCAG
AAAAAAGGCAAGAAGAATGCCAAAGTGCCATCAAAGAAGATGATGACTTCTCCAACGAAA
AAGGTGGTAGTTGCTACTCCAGCCAAGAAAGCAGCTCTCACTCCTGGCAAAAAGGCGGCC
GCCCCACCAGCCAAGAAGACAGCAGCACCAGCCAAAGCAGTAGTGACACCTGGCAAGAAG
GGCGCCACCCCGGGCAAAGCCATGGTGGCCACCTCTGGGAAGAAGGGAGCTGTCCCACCA
GCAAAGGGGGTGAAGAACGGCAAGAATGCCAAGAAGGATGAGAGCGAGGAGGAGGAGGAG
GACAGTGAAGATGACGACGACGATGACGATGAAGAAGAGTTCGAGTCTGCCGTGGTGATG
AAGTCCGCTGTGGCCCCTGCCTCCGAGGATGAGGAGGAAGATGATGAGGATGACGAGGAT
GATGAAGAAGACGACGATGATGAGGATGATGGTAAGATGTTACCTTAGTTCCTGAGCGGC
TTGGGTTGTGGGTTATGGCTCGGCTTGCTCTGGTCTGGTGGGGTTGTTGGACTGAATGAT
GTCCTCAAAATATCACGTGCAATAAAACATAGGGTCTCACTTCCTAGGCAGCTGTCACGT
GTTTGCTGGCGTTGTGGGTTGGCGTGTCTGTCACTGAGGTTGGCCTGAGATTTGAGTGTG
TGGCTCTTTGTTCAGACTCAGAGGAAGAGGCTATGGAGGTCACACCAGCCAAAGGCAAGA
AAGCACCAGCCAAGGCAGCCCCTGTAAAAGCCAAGAGCATGGCTGAGGAGGAAGACGACG
ATGAGGAGGAAGAGGATGAGGACGAGGAGGAAGAGGATGACGAGGAGGATGAGGACGAGG
AGGAAGAGGAAGACGACGAAGAAGAGGAAGAAGAGGCAGGTAGGTAATCAGAATGGCTTC
TGCAGCACTCTTCCCTTTACCTGGGTCGGTTAGAAGCAAACCTTTGAACATGAGTTTTCA
CCGGTAACGCCTCTTTTCCTTTGGCCTAGAACCTGTCAAAGAAGTGTCTGGGAAGCGGAA
GAAGGAGATGGCCAAGCAGAAGTCTGCCCCTGAAGCCAAGAAACAGAAGGTGGAAGGTAA
TGTGCAGGGTTTGGAGGGGTGGGGCATTAGAAAGGCACAAATGATGAACCACAAAGGGAC
TTAATACTGATCATCTTGATGTGACTTAATGATCAGCTGATGTGCTGGGTGTAGAAAAGG
TGGGGTGTGCATTTCTGCTTCACTGTGAGATTGATTTCTGGTCTTTGATCTATAGCTGTT
GAACCAACTACAGCCTTCAACCTCTTCATTGGAAATCTGAACTGCAATAAGTCTGCTCCT
GAATTAAAAACTGGTCTCAATGACCTTTTTGTGAAAAACGATCTGACTGTGATGGATGTT
AGAATTGGTACGACTAGGTAAGTAACCCTTACACACACACACACCCCCAACATGAAAGGT
TGAGGTCTTACTTTGTTCTTGGAAACACTCAGCCTGTAGAGCTGCACCGGCGTTGCTATG
TGAACAACAACCAGTAGTAACAACCACTAATTCCAGTGCTGTCCAGGGGTTGTCTCAGGA
CTCCATAGGGCTGTGCACTGGTCCATGGTGTCGAGGCTGGAGCAGCGGGTGGGTTTGATC
TGATGGTGGCCATTTGATTAGCTCAGTGCACAGTCCACTGCACCGCCAAGGCTCTGGCCA
CAGACTAGTGAGTGTGTTTAAAGCCAGACCATATTCCTTCCCTGCTGGCCTCATCAAGCA
CCTTCTTTATTCCACCTGAAGGCCGCTGACTGTGAGACTGCACTGGGTCTGAGCTGGGCA
GCGTGCAGAGCATTGATTGTATTGTGGGCGCTGTCACTGGTCTTTTGGCTGCCCAGTAAT
GGATTATGTTAGTGTTGCTGGGGTCTGAGTGGGTGGGGTGGTTCTTGGCTTTTCCCTCTT
AAATTTTGATCCTTTTTTCATCTTTAAAGGAAGTTTGGCTATGTGGATTTTGCATCTGCT
GATGACCTGGAAAAAGCTTTGGAACTCACTGGCTTAAAAGTTTTTGGCAATGAGATTAAA
CTAGAGAGACCGAAGGGAAAGGACCATAAGAAAGGTAGGTGGGTGGTGTGTGTGCAGACA
GGTGTTCCATCAACGTGATACCAGAGGACACCTTGTTATTAACAGATAGGGGAGTGTTTC
CAGGCCATGCAAAAAGACATGGAAATAAGATAACTCCTCCCTAATTTTTGGAAAGCCCTC
TGTATTTAGAGCATGTGTGTTCTGTTACTTTTACCTCATTCTTATTTCAGTCTAACGTAA
TTTTCAGATGGATGATCCATCTTCCTGACATTTTCTCTCTTTTTAATCCAGATCGAGATG
CCAGGACACTGTTGGCCAAAAATTTGCCTTACCGAGTCACTCAGGATGAGTTAAAGGAAG
TCTTTGAAGACGCCATGGAGATCAGATTAGTCAGCAAAGACGGGAAGAGTAAAGGGTATG
TTTGCTGTGCTGGGGGGCTCGAGTTTGTGCACTTCCTTGATAGAAGGCTAGGCCGTGCAC
ATTACCCAGGTGTGACTGCGCAGTTTCACTTAAGCTGTGCCTCAATTTCCTGTCCAGAAA
GTGGGTGATGGGCTTAATTGGGAAGTTTTAAGCAAATGGCTGACGTATGCAAGCACTGGA
TGTGCATCGCTCTGGTAATGCCAGTGATTTCGGCAAGGTCACTAGAAATGGGTGACCATG
GCATTCAAAGTCGTGTGAGAGTTTAAATAGAATGTGATGGAACCTGTGAGTTTCCATCTT
TTAGCAGTTTTACTGACATAGTTCACATCATCTAATGACTTAATCATATTAAAAAGTTGT
ACAAACATCACAATTTCTTTGAGTACAAAGTTTAATAGAGGATGGAAACATTGCTCAATG
TTTTTTCGTGTCATCCCTTACTGCAGGATTGCATATCTTGAGTTTAAAGACAGAAGCTGA
TGCTGAGAAAACCCTTGGAGGAGAAGCAGGGGACAGAGGATTGATGGGGCGGTCCATATC
GCTGTACTACACTGGGGAGAAGGGCCAAACCAGACCATCGAGGTGGGAAGACCAGCACTG
GAGTGGTATGACGGCAGCCTTGGCGTCTCTTCCTCCCACGTGGACTGATGGGTCAGATGA
AGATGGGGGAGGAAGGGGTGGTGTTTGGCCAGATTCTACAGTAACCCAGTCTCTTAACTA
AGGCCCTGGGAAGACATTTTGCATTGAGAAATTTAGCTTCCTTTATAGGTTGATGCTTGA
ACACAGACAGGTACGTGTGAGGCAGGTTTGCTGGGGCTGTGCAGCCGAGTAGCAGAATGA
AAGGAAGTGTTGGGGCATGCCGACGTGTGCTGGGTGCTGGGTTTGTTGAGAAACAAGTGT
GATGATTCACCGCTGTTGCAGAGCTTAAGAATTAAGTATATGGCATCTCTCTGTAGGAGA
ATCAAAAACCCTTGTTTTAAGCAACCTCTCCTACAATGCAACAGAAGAGACACTGCAGGA
GGTGTTTGAGAAGGCAACTGCTATCAAGGTGCCTCAGAACCAGAACGGCAAATCGAAAGG
GTGAGGTCACGCTGTTCCTCTTGCCAGTTACGGGCCGTTGGAAAGGGGCTTCTGTGGGAC
TCAGTGGAATAGAGGGGTTTTACAAAGGGAGTCGTTCCAGCTGCTCAGTTGAGGAAATGG
TGCCGGCAGAATGTACCAGGTGTCTTAATACAACCGTTCGTCCTCAGGTATGCATTCATA
GAATTTGCTTCATTTGAAGATGCTAAAGAAGCTTTAAGTTCTTGTAATAAAAGGGAAATC
GAGGGCAGAGCAATCCGGTTGGAGTTGCAAGGAGCCAGGGGATCCCCGAATGCCCGGAGC
CGTAAGTTTCTTCACATGGGGTGTGGGTGCAATTGTCCAGTGGGGCTCCCCCCCAAATTG
AGAGGGCTTTGGCTGACCGCTAGGTGACCAGTGCTGGACATGATGACTGCTTATCTGAGA
AGTAACTGATGAAATCACAAGAAAATTCCTCTAGATAGTCAAGTTCTGATCCACACGTGG
CCTTCACCTGGCTGTCCTTTGCTAGTGGGTTCGATGGCTTGCCCCCACTGGGGGGTGTGT
GTGTCTCATTGTCCCTTAAGGCCACTGACAAACACGGTGTATATTTTCCTTTTTTCCAGA
GCCTTCTAAGACCCTGTTTGTCAAAGGGCTGTCTGAAGAAACCACTGAGGAGACCTTGAA
GGAATCATTTGATGGCTCTGTTCGGGCCAGGATAGTCACTGACCGGGAAACCGGCTCTTC
CAAAGGGTAAGGTGGCCCAGGGCAGAGTGGCAAAACCTCAGCTCTTCTCAATGAGCTCCT
TTCTGCCGCTGGTGGCAGCTGTTGGATTCGCACGAGAAGAAGAGCCAGAGTCCCAGGCGA
GCCCTGTGAGCTTCCCTTCTGCCAGTGGGGGTTAGTTCCGCTGCCTGTGAGACATTTCTG
TTAGTGAGCTGCTTTCTGGCATCTCGGTGAAGCAGCACAAGGTTTGAGGTAGTGGGCATG
TGGTGTGGACTTGCCCTCAACTGGTGGGTCCTCCTCTGGGCAGGTTTGGCTTTGTGGACT
TCAACAGTGAGGAGGATGCGAAAGCCGCCAAGGAGGCCATGGAGGATGGCGAGATCGATG
GCAACAAAGTGACCTTGGACTGGGCCAAGCCCAAGGGTGAAGGCGGCTTCGGGGGACGAG
GTGGCGGCAGAGGAGGGTTTGGAGGCCGAGGTGGCCATGGCAGAGGAGGCCGTGGTGGAT
TCGGTGGCAGAGGCCGGGGAGGCTTTGGAGGTGAGTATGGGGGTGGCACCATCGGTACTG
GCCAGCAATGTGCACTTTAGAACCATGTGGGGCGGGGCCGGGAGAGGCCTTTGTGCTGTG
CCCACTTGATATTGATGCTCAAGGAATCCTCCCTGGTGGAGCTGTGGGTTGTGTTGAGCC
GCCAACCGCAAAGTCAGCTCAGCTACCGCACAGCCTTGGACACGGGGTGGCTGCTCATGG
TGGGTCTGGGCTCTTCAGGACCCTTTCCTCTCTTCTACAGGACGAGGTGGCTTCCGGGGA
GGCAGAGGAGGAGGAGGAGACCATAAGCCACAAGGAAAGAAGACGAAGTTTGAGTAACTC
TTGTGTCCCTGTCTTTGCTGCTTCTGTTTGAAAGAAAGGACTCTGGGTGTTACTCTTACC
GGATCATGACAGAGCCTTTGGTGGACATTCCGAGTAGAGAGAGAGAGCCCTGTGGAGACG
ACGTTTCAGCCGATGTATAAATCCGTGTTTTTCCTACAGATAGTTTTTTTTGGGGGGGCG
TTGGGGAATTTTGCCTCAGTGAATTTGGGACAAATTAAAAAGTCCTAAGCTCTGGTGCCA
GTCTTGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1672..1788, 51465..51930, 52155..52355, 52357..52362, 52469..52555, 52735..52876, 53429..53553, 53811..53934, 54386..54406, 54408..54441, 54443..54457, 54459..54467, 54469..54507, 54509..54538, 54541..54544, 54896..55019, 55187..55320, 55619..55745, 56023..56249, 56500..56576
1001..1018, 1672..1788, 51465..51930, 52155..52355, 52357..52362, 52469..52555, 52735..52876, 53429..53553, 53811..53934, 54386..54406, 54408..54441, 54443..54457, 54459..54467, 54469..54507, 54509..54538, 54541..54544, 54896..55019, 55187..55320, 55619..55745, 56023..56249, 56500..56573
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved