Echinops_telfairi Locus RPP40
snOPY snoRNA Orthological Gene Database
Echinops_telfairi RPP40
Echinops_telfairi
RPP40
GeneScaffold_3098
SNORA72
34707..34839
36468
CAAAAGCTATTATGCAAATGACGGAAGTCCTGAACCTCACAATTCTCTGATCTGGGGTG
TCAGATATATACAGGACCTTCGATCGATTCGGGCGAGGGAGGACTCTACCGGAGGGGGAG
GGGGCATTTCGTGTACTTCAGAGGAGGGGCGGAGTTGAACGCGACGTTCTTAGACGTTGG
GGCCTCGGGAGAGGAGGGGAGAAGAGGAGGCACCTAGTGGCCGTGATGAGGGGCGGAGCT
AGCGGAGCTAGGGAGAGGAGGAGCAGACGGAGAGGAGGGGAGGCACCTACTGGCCGAGAT
GAGGGGCGGGGCGGGTTGATCTCTTCTATGGCCGCCTATCCTGAAACTGGCAGAGTATGG
CCACGCTGCGCAGGCTGCAGGAGGTACCGCGGCACTTGCTGGTCTGCGAAAAATCTAACT
TCGGCCACGACAAGTCGCGTCACCAGCACCTCGTGGAGACGCAATATCACAATAACAAGG
TAAGGCGGGTCAACTTCGGGCTAGCGGCATCCGGCTCCACGTGCACGGGAGAGGCTCTGG
GAGCGACGGGCTCCGCCGGTTACGGCGGAAACTCCCACAAGGTACGCTGGGTGGGGCGTG
GGAGTCGGGAGCCGGAGTGGGGCGGGAGCGAAGTCCCTTTCAGGGCATGCTGGGAGCTGT
AGTTCCTTGAGCGTTCCCAAGTATGTAGAGGTGTTGCAGGCCAGAGTGGACTGTTAACTC
CCGGGGCCTGCGGTGGAACCCGACCTGGGATGGACGATCTGGGGGCGCACGGGGCTCATT
CTGTGCGGAGGCCCCACAGTAGGGTGTTTGGAGCGCTTGACCTCAGCGTTGTTCAGCCCA
CTACGTGTCGGTCGCTTTTGCCCAACATCAGGGATGCACTGCCCCCCATCCGCACCCCTA
CACCCATTTCTCTGCGCAGCCTGGTTCCTTCTCACACCTGCGTGGCTGCAAATCTTTCCA
GAGCACTATAGCTAGCATGCCCAGGAAGCGACTAGAATTTAATAAACCGCCTGTGGGAAT
CGGATTTCTGCCTGAAACCCTCGGGTTTCTCCAATCACAGTACACCTTTTCAGCTGCTGA
TGTCTGAGCCCAATTGCGTAGTGGGAACGCGGTGAGCTGCTCACTGCTAGGTCAGCAGTT
CAAAACCAACAGCTGCTCTGCGGGAGAAAGATGAGGCTTTGTATTCTGGTAAAAAGTTTC
GTCTCCCAAACCGAAAGGGGCACTTCTACCCTGTTCTATAGGGTCTCTGGGAGTAAGAAA
CGACTCAGCACTGATTTTGGTTTTTGGAGGGTGATACTGGTTTAAACATTTTGCACTTTA
ATTAACCAAATCACCATTTAGGTTGACCTGGTGAGCCAGATTCCTCAGGAACAGACTGGC
ATTACAATTTGAGGAAAGAGGCTTCAAGTTGTGCAGCACATGAACTTGGCACCTTCTGAA
ATTTGTCAGGATTTAGCAAACATCTTCGCTTGGAGTGGAAAAAGCGAACACTGAAATCAA
GTCATTTAAGACTCATGGAGAGCTCATCCAAAACAGCACCTTGTTTCAGCCTAGAAAATG
CAAACAGCCAAGAGTATTGCCGCTTCCATGTATCCTTTCAATAATTGGATGCTGCGTTTT
CGCTGTTCGATAATAATAATAATGCCAGGGTAAACAAATTCGGGGATGTTCTGTTGTATC
ACAGGTCCGTGGATATCTTTGGGTGATACAAATGATTTGCAAGGGACTACTAATCTGTTG
TGTTGCTCTGCTAACTACAAGGTCAGCTGGACAAAACCACCAGCTGCATGGAAGAAGAAA
GATGAGGTTTTCTATTCCCATGAAGAGTTACAGTCTCATAAACTCACAAGGGCAGTTCCA
CCCTGCCCTATAGTGTCACTAAGAGTCGGAATCAACTTGTGGCAGTAAATGAAAAGGATG
CCGGTCACACCACTCAGTGATGCTGTGGAAGAAAGTCCTGGCATCTGCTTCCATAAAGAT
TAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTACAGGAAATAAGACCTC
GGTTTATATTGTATATTCCAATAGGGCGGTAAAGGGCATTCCTGAATGTGGGATACTATC
AAAAGAGCTGTTAAGCCTGGTTATGGAAAATGGACCATTTTACTTTGTGAAGAACTTACC
TCTTCATGAACTAATTTCACATGAATTCATCAACACCTTTGTAAAGAAAGGTAAGGAGAA
CTGTGTGATGTCTGTGATCTTGGGAATGATGATGGGCAGACCACACCATAGTGCCAGGGT
TCTTCTCTTGCTTTAATTAGGGTCTGTGGTGATTGTAAAGGTGCCTGGTGACTTAATGGG
TTACACTTGTGTTGCTAACCTTATTTATGGTCAGCAGTTCAAACCCAAAAGCCTCTCTGA
GTGAGAAAGATGAGACTTTTTATTTCTCTATATATTTTTCACTAAGGAATGGTTCTGTTC
CGTCCTGTAGGGTCCCTGGCAGGGAGTTTGACTTTTGGTTTCTGATGGTGATCGTGTGGC
ATACAACACTTTCCCCAGTATTCTCATCCTGCCCTTTTTTTTTTTTTTTTTAGATTCTTG
TTCTTCTTATATCTGTCCACAATGTTGTATGAGGGTGTTGCAACATGAATAATCATAATA
GTGGATAATTTCACAATGGATGATTGCATTATGATGCAGTCATCACAATGGAGGAAGGAT
GAATGGAGAGGAAAGTGTAGCATTTGCTTTGTTGAGATCCCTACTTTTGGCTGTTTATCT
GCAAAGACCACACGCTGTCTTGAGCTATCTCAAAGGGTATTTGCTTCTGGTCACCACAAC
TGCTATTTATAGCTAAGTATTCGTTGGGATTTTGTACCTTGGATTTTGTGGTTCTAGCCT
CCCTCTTCTTACCCCATTCCTAGTTATATCAACGGAATGGATTGGTTGGTTCTAGATTCC
TGACTGCCATCTGTTTAAAACTGTATTTCTTGGTGCCTTTAGAGAGTCTCTGGGTGGCGC
AACAGGTTGCTAACCAAAACGGAGGTTTGAGTCCACCCACAGGTGCTTTGGAAGAAAGGC
CTGGTGATCTGCTTTTGAAAAGCCAGCCACTGATAAGAGTACGTTTCTAGTCTGACACAG
GTGGAGTCACCAGGAGTAGGAGTTGATGGCAGTTAGTTTTGTTTTTAAAAAGTAGGTCTG
CCCTCACTACAAAGTCACCCCAGTTGAGCTCCAGGTATAGAAGTCCCTTCTTTAGCCCCA
TGCTTGTCCTCTGCAGTGGATCTGTGCACAACACAAGTGTATCTGGAAGCTGTCTTCATT
CTGATGCTACTGGGACCACAGAAAAAGCAGGGCACCCTTTCTTTGGACGCATAACATCAA
CTTTGCTTCTGTATTAGATTTTAATATTCCTTTGTTAATGAGGTAGCTACTTGCTGATTA
TCAGGTACTTTTACATTTTATTAGTTTTATTTGCATATATTTCACTTATCAAACAATTTG
ATCATTCAGTCATATTAAGAAAAGTGATGCAGTCACTACCACAATCAATTTCAGAATATT
ATTTTCCTTCTTGTTGTTAGTGCCCCATGTCCTCCCAAACCTCCTCTGCCATGCCCCAGA
TAATTGGTTTTCCAATTACACAACTTCTACCTATATAATTCAGTGTCACTGATTATACTC
TTCATGCTGTACAGCCATTATTGATACCCTTTTCCAAATGATTCTACCACCATGTCACTG
ATTATACTCTTCATGCTGTACAGCCATTATTGATACCCCTTTCCAAATGATTCTACCACC
ATGGACATAAACTCAATGCCCCTAAGCCACAACCCTTTCACCTATGGTAACTATCGGTCA
TTTGGTTCTTTTTTTCACCCCTGTGGTTTTCTTGATATAGTATTCACATGTAAATATACT
TCCATGGTTAAATCACTTTCAAAATTAGTTGCATAATCACAAGCAATTCTATTGCTCCCT
TCCCCCTCCTGCATTCATTGTTTGCTCCCCAAATCCCCCTCACCCTCCCTATCTCTCACC
ACCTATATCCCCTATAAATCCTTGCATCAGCTATTGTCTCTATGCATCTACTCCTTCTGT
GCTTCCCAAGAGAAACAATAAAAACAAGAACAAAATAAAGTGATAAGGATAAATTTATAA
GCATATAAAGAGAAAAATACAAATAATGAATAAGAAAGAAAAGACCATCATCAATATTTT
AAAAACTAGGGAAGAAATTTTTTATCAATAAATATTTTATCCAGAAATATTTGCACGTAG
AACAAATTCTGCTTGGGTCCAGAGGGAGGTTAAATGACCAAGTATCAAGTTTGATCCCAG
ATAATCAGGATTACAGTACAATACTTAACTGGCAGGGGAGATACCATGATCTCGAAGGTG
GTTTTCCCAGGGCGAGGCTTATCCATTGCACTCCAGATTGCTGACCCCTGCGATTTTTTC
CAAATGTGGGAAACTCAACTAAATAATTTGTGGTAGTGGGGTACTGCGTTCGCGCTCTCC
CCTGTAAAAAAAAAGGATTACAGTGCCAGGCAGTCCCACCAATCCCCTGCCAGGTTTAAC
TCAGTGCCTTGCACCAAGTAGTTCAATAAATATCTGTTCTGGAAAAAAAAAAAAAGATTA
CAGTGATCTCTATCTGATAGTTAAGTTGTTTGAGACCCTTGCCTGTAGCTGGAGGGAATC
TGCCAGTGGATTAATCTGACGAGATGCTCTACAGATGGGTTTTGGGCTCCTACTGCCCTC
CATAGCCTTCTACAAATTAGATGTTCACAATTTAAGCTCTGATATTTTTCCCTTCATCAT
ATTTGGATTTTGTTATTGTCATCTTTGGATCACACAAGCTGGCTTATCAGGTACTTTTAC
ACATTATATTTAAGTATGCTTTATGGTCTCAAGTTTACAGATGTGGAAACTGGAACTCAA
AGAGGTGAAATAGTTTAGAAAGCAAAATTTTGGTTAGATGTTTCATTTTAATGCTTTATT
GTTTTTGAGACTACACACAGCAGAACATCCACCAAGTCAACAGTTTCTAATGTACAATTG
AGGGTTATTGATTGCATTTAAGTTGTGCAACCATTCTCATCCTCCTTTTCCAAATTGTCC
CTGCCACATTAACATAAACTCATTGCCCCCTACACTTCCCATCTAAGCTTCTAAGTTGCT
ACTCTGAATTAGGCCCCACATAACCAAACTCCAGACTCACTGCTATCAAGCAATTCTGAC
CTACAGAGATTCAGTAGAACAGAGTAAACTGCCGCTTTGGGATTCTAAGGGTGTAAATCT
TTATAGGAGCAAGCCTCATCTTTCTCCCAAGGTGGTTTCAAACTGCTGACCCTGAGGTTA
GCAGCCTAACACTTAACCATACTTTTTAAAGGAGCACAGTGCTAAAAGCAGATCTTTTTC
ACTAATTAAGCTAAACTATTCGTTTCATTTTAAGAATATTTCAGGGGACATTTTTGGTTT
AAAGTTTAAAGATTATATGATAACAAGGTTCATTCAGCCTTTGTCGTCACGCCAGAAAAT
TTGTATTCTATGGCAATATGGAAGACTGTTTTGCAATTTCTCCCTTTTGATGAGGATTCT
TCTATATTCTTTGATCAAAATGTTCAGTAATGGTAATAAGTACTAACCAGTTCTTTTGCT
CTCAAAGTAAAGGAGGCAGCTGTTCAGAGGCAATTAATTATACTTTTTTTTGGTGGCCTC
CTTCTGTCCCTCTTTTTCCTTCCCCTCTTGCTCCAGGTGAAGAGGAGAGACCAGTTGTAT
CTTAGATGGCTACTTGCAAGTTTTTAAGTCCACAGGCACTACACAAGTTTTTAAGACCAC
AGGCACTACACAACAAGCCAAGAAGTAGAACAGAAGTACTAAACACAATCTTAAGCCAGT
TACCTGGGATATCTCATGAAACTATGACCATAAACATGTAAACCTCAAAACTGAATCCCA
TGAGATGCTTGGTTCGACCTTAGTATCCTCATCAGTTGCAATTTTTGTTGTTGTAAATGT
ATCTATCCACATTTTCCAATTCAGCTTTCTCCATGTGTACAACTTAGTGACCATTACATT
AATCATTAACCCTACCCTGAATTAATGCAATTTTCTCCCATTGTAAACTGAAACTCAGTG
TTCTCTAAGGTGTAACAACCCCCACCCCACCCCACCTGTGCCCTCATCCCCAGTAATCAC
TAAGAAACCTTGTCTATAGAAAACTTTCACCTGCTCTATTTGTTCTAAGTAAGGTCATAC
AATATTTATCCTTTTGCAATTGATATTTCACTCAGCATGGTATCTTCAAGCTCCATCCAT
GTAGAAGCATGCATCAGTATTTCGTTTCTCTTTCTGGCTGTACCACATTTTGTTTATCCA
TTCTTTTGTTGACGGGCATTTCGGTTGTTTCCACTTTTTGCCTACTAGGAATACTCTCAC
TGAACATTTGTACACTTAGATCCTGTTCCTATCACTACTTTCAAACGCATGGCTTCTAGC
AGTGGAACTGACTGTATGGTGGTTCAATTTTGATTATTTTTTATGAAACTCAGCACTGTT
TTCCGCAGTGACTGTAGGCTCTACCATTTTTCACCCCAGCTAGCAATGGATAAGCCCTAC
CCCTCATCTTAGTTATTATGTGAATGGACTTCAAAAAGGTGGAAGTCTTTGGCCATTTTA
CGATTTTTTTTAATTGTTACATTTTGAAGTTTTATGTATATATATTTGTTATTACGTTCT
TATATAAATATATTTGGTTACTAGATAATTTATATATAAGGAAGCTTCAAAATATTCATG
GAAAAATAGACTGAAACCCCTTTAATTTCTAAGTTTTCCTCCTAATCAGTTGTCTTTTCA
TCTTTGTTTTACAATTTGTTTTCCCTTTTTATTATATAAATAGCAAACATTATAGAAAGA
AATTCAGAATTACAGATAATTAAAAAAGAAACAAAACTTCTCATAATCCCACCACCAATG
GCAACCATTTATTGCAAATTCTTTTCACTTTTTATGGTAAAGTCTTTTGATAAAAATTTT
TATGAGGTCTTATTTGTTTCTATGTGTCCTTCATATTGTTCAGTTTCTCAGATTAGTTAC
TCACCATAAAAATCAAATGGTTGTATCCCTGATACAACCTTTCCTGTATATCCTGACACA
ACATTAGAAAATCCTGGGTAGAGTAAGAGAGAAATAACTAACCATTTAAGATCAAAAGAG
CAGAATTTACCCCAAGTCAAAGTTTAGAGGGTTAGGAAATGGAAGAATGGAAAAAAATGA
AACTCAAGGAGGAAGTGGGATGAATGGTGGTGCATTGGGGGGAATTACAATGGTGAGCTG
AAACAAAGGATGTATGTGTTGTTGAATGTAAAACTAATGATTTGCTCTGTAAAATTTAGG
GCCAAAGAAAACTGGACTCTGCTTAGGGTCTCTTTCTTTTGCAAAAGACCACACCCTCAA
GGAGGTGTCATCAGGCTGATTGATGGCCTCATCGATGTGTTCAGCTCCACCTGGCTCTTC
ACCCAGGAGTGTCTAGTTGACATAGACTCCAACACACACAGATCATGTGGTTCTTGTTTG
TATTAATTACATGGTGTGTTACATTGCTTGTGTTTCTAATGTTGAACTGCCCTGGTTAAC
CTGGTATGAATTCCACTTGATCGTGGTGAATCATTTTTGGATATTTTGTTGGATTCTGTT
GGCCCGAACTTGGTTGAGAATTTTTGCTGTGTTCATGAGGGCTATTGGTCTGTAGTTTTC
TGCCCTTGTGGGGTCATTGCCAGGTTTTGGTAAAGGTTTAGGCTAGTTTCATAGGATGAG
TTTGGAAGTGTGTTGTTCTTTTCTATATTCTAGAATAGTCTGTGTAGAATTGGTGATAGC
TCCTCCCTGAATACTTGGTAAAATTCCCCTGTGAAACCATCTGGTTCTGGATTTCCTTGG
TTGGAAGTTTCTTGATGACCTCTAGTTCTTCTTTTGTCAAGAGATCTGTTCAGGTTTTCT
ACATCAGTCTGTGTTAATTCGGGTAAAGGGTGAATTTCTAGATTTCCCCCTGATTATCTG
TCTTTCCTTGAGAGTGGTATGCTGACATACCCTACTATTAATGCTAAGCTATTCCTCTCT
TCAAATTGGTTGATACATTTTGAAGGTCCCTGGTGGAGTAGTGAGTTATGCGTTGGTTTG
CTACTGACAATGTCAGCAATTCCAGACTACTGAGGGAGAAAGGAGGCTTTCTACTCCTGT
AAAGATACAGAATTTTGGAAACCTGCTACTGTTTTTGTGGGATTGTGGAATCACCGTGGT
GGCAGGGAGTTTTGTGTTGGTTTTTTTTTCTTTCTTCAAATGAGAATAAGACACATGTAT
TACTGAGAGAGTTTATCTGCAGCCATACACTGAGAGCAGAAACTTGTTTAAACACATTTT
GTTTGGAACCTTAGTTACAATATTTTTTTTACTTACCCTATAACAAAGAGATTAAGAAGT
CAGAGATAAAGCATCTTCTTCCAGATCCACAGAGTGAAAGCCTTTCTTTAGAACTAATGC
CTTTAATTCTAACATCTAGCCTCTTAAACTGTAAAATAATACATTTGTGATCTTATTTTT
TAAACCCATCCATTTGTACTATTTTTGTTATTGAAGCACTAAGGTAGAAGTTGGTACCCA
AAGAGTAAGATGATGTTCTAATAGATACCTAAAGTGTGGACATAGTTTGGAATTGAGTAA
TGAGTAAAGGCTAAAAGTTTTAAGGTGCCTGATTATGAGAACCTAGAGTTGCTTGAAGAC
ACTGTTGTATAATTTTGGGCAAAGGAAGTTCTCTGTTGAGGATAACTATAGAGAATGTCA
CTATCATCTAAGGGTATGTCACCAACAATAGAATATTGCTATGGAGGAGTACGGAGTGGA
GACCCAAAGCCCATCTGTAGGCAACTGGACATCCCCTTACAGAAGGGTCTCAGGGAGGAG
ACAAGTCGGTCAGGGTGCAGTATAGCAATGATGAAACATACAACTTTCCTCTAGTTCTTT
AATGCTTCCTCCCCACCACTATCATCACTCTAGTTCTACCTTACAAATCTGGCTAGACCA
CAGCATGTGCACAGGTACAGATAAGAGCTGGAAACATAGGGAATCCAGGACAGATAAACC
CCACAGGACCAATAATGAGGGTAGTCAGACCAGGAGGGGAATGGGAAGGTGGGGGGAGAA
AGGAACTGATCACAATGATCTATCTATAACCCCCTCCCAGGGGTAGGACAGCAGAAAAGT
AGGTGAAGGAAGACATCAGTCAGTGGAAGACATGACAAAATAATAATAATTTATAAATTA
TCAAGGGGTCATGAGGGAGGGAGAGTGGGGGTGGAAGGGAAGAAATGAGCTGATACCAAA
GGCTCAAGTAGAAAGAAAATGTTTTGAAAATGATGATGGCAACAAATGTACAGCAGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAATGTGACCAAGAGGAAGCTATTTCTTGGAGAGG
ACTCAACTGTAGTGACGTGAGTTGTGTAAAGGCGGTGGGAGTGGAGCCTTTGGGATCTTC
ATTTGCTGATGGGGCAAAACTCAAGGTAAGGAGAAAGAGCTGCAAAAATCTGCCAAGGAT
CATAATTTGGAATGTGGGAAATTGGAAGTGGTCAAAAATGAAATGGAATGCATGAAGATC
CATATCCCAAGTATTCGTGAGGTGAAGTGGACCGTTTGGGCCATTTTATATCAGAAAATC
ATCTGATTTACTATAGGGGGAATGGTACAATCAAGAAGAATGGTGTGGCATTCATTGTCA
GAAAGGAAATTGCAAAAACAATCGAGAAGTACAATACTGTCTGTTACAAGATTATATCTA
TCTGCCTTCAACAACACATGGACTTCTCCAGATGGAATACAGAGAAGTCAAATTGATTAC
ATGTGTGAGAAAGATCTTGGAGAAGCTCAATATCAGCAGCTAAAACCAGGCCATGGGCTG
ACTATAGAACAGACCATTAATTGCTCATATACAATTTCAGGATAAAGAAGAAAATCAAAA
CAAGTCCATGAGAGCCAAAATATGGCCTTGAGCCTATTCCACCAGAATTTTGAGAAAATA
TCAAGAACAGATGTGACATATTGAATACTAATGACAGACGACGTGATGAGCTATGGGAGG
ACTATCAAGATCATCATTCAAGAAGAAAGCAAAAGGTCATTAAAAAGATAAAAGATCAGC
ATGAATATGAAAAAAGAATCGGAAGCATATTCTTAGCCATAGAGTAGCTAACACACATGG
GAGAAAGAATGAAGTCCAAGTTCTAAATAGAAGATTTCAAAGGGGCAGCTTGAGAAGACA
AAGCCAAACATAATAAAATGTGCAGAGACTTAGAAAACCAAAAGAAAACACACGTAGCAT
ATTTAAGACTGAAAGAAGTCAAGAAAAAAATTCAAATTTCAAGTTGCAAGTTTGAAAGAT
TCTATGGGCAAAATGTTGAATGATGCAGGAAACATCAAAGTAAGATGGAAAAAGTACACA
GAGTCACTGTGCCAAAAAGAAGTAGTCACCATTTCACCATTTCAAGAGGTAGTATATTAG
CAAGAACCAATGGTACTGAAAGAAGTTCAAGCTGCTCTGAAAGCATTAGCCACAAACACA
GTTTCAGGAATTGATGGAATACAAATGGAAGTGTTTCAACAAGCTGATGAAACACTAGAA
GCATTCACTTGTCTATGCCAGGAAATTTGGGAGACAGCTACTTGGCCAACTAATTAGAAG
AAATCCATAATTGTGCCCATTCCAAAGAAAGGTGACCCAACAGAATGCTCAAACTGATAG
AATAATATCATTGATAATCATTTGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNAACTTCAGTAATTTTCCTATACTAATTTAAATTTGAGTGTTTGTATTGCCCACA
CTCGCTTTGCTCAGAAAGAGTTTAACTTTTTCTTATCTTTAAACTTCTGATTCTAAGAAC
TATTATATAACCCAAAGGGCTTCAGAGGAGACATTAATTTTGTATTTATTTTTCTCCATC
TATAGGCTGCACTAAAGATGACAAGATTGGACATACTTCACTGCATATATTTGTTTGGGG
TTAAAATGTTAAAGCAGTAACCCAAGATAGGTGTCTGTAGCTTGCTCTTAATACATTTTT
CTCCCCTCAAGTCTTTATGATTACAGGATGCATGTGAAGAGATTGGATTCTGGTAACAAT
GTCTGGTTTAAACATTAATAATTAGGCCACTTTGTCCATAGGTAGATTTGACTTTAGAAA
AATATGAGTTAAAATATCTACTCTCCTTAGCCCACTATGTTAGAAATGCCCACTAAAGGG
GGAATTCGATTGGGTGAACAGAAGGGAGTTCAAGAGAAACAGAACAATTTTTATTAAACA
TACGATGTTATTTTAATTAGGATATTTAGCATGCTTTTTTCAAAGTGGAAGCTGTGTATA
TATGACTAAAATATTCCTTCTTTCTTTTGTTTTTTTAAGTTGTCACCATTGATTTGATGG
ATTTATCCATTAATCTGGATTCCAAGAGGTATAAAAGAACATGTTGGTCCTTCAAAGAAA
AAAAGCCTTTGAAATTTGATTTTCTTTTAGCTTGGTACCCTACAGGTATGAAGAATTAAT
TGTTTGTGATGTGATGATTTTGAAATCTCATTGTTAATTAAGAGAGTCTCTGGGTGCTGC
AAATGGTTCACTACTATCCTGCTAACTAAAAAGTTCCTGGCTTGACTTCACCCGGAGGCC
CATCAGCAGAAAACCTTGGCAAACTCATGCTTCCAAAGCTTTGTCTACTGGAATCTCTAT
GGACCCCAGTTCACATGTGGTCGCCAGGAGTTGGGACTGGCCTCCTATGACATCTCCCGG
AGCCCTCGTTTAGGGTCATCTAGACCAGTAAGCCAGCTGCCAGAGTCTCCTTGGTTTAGG
TATATAGATTCAGAGAGCTTTAGAGTGAGTTCAGAGCAGCTAACTTTTCTCTTTCATTAA
AAAAAAAAATCTTTAAAATTTTTTTCTGTTTCTTACCTTACTTCACACAGTCTTGACACT
AATATTTGAAAAGAACTCTAATTATAGTTACTTATATAGATTGTTTATTCATTATTATAG
AGTAATAACTAAAACTTGCCATTAAATGTCATCCTAACTTTATTGTAACTGTTCATTGAA
TAGATCACTAAATTTAGTTCAAAGGTTTTTGACCAAACATGTGACTGACAGCTAACCACT
GTGAACCTTGCTCATTTTAGAAGTGTGTCTTTGGCCCGTCATAAGATTGTGATGAATCAA
ATCATGAGGAATTATGATGGCACAGTATTCTCTTTCAGACACGGGAAACACATAAGTCCA
TCTTGGACATATGCTCAATTGTGTGCCACTTGAAGGAATGTTCTAGTCACTGGGTATTCC
AATTAATTCCACAGAGGCCTTGGTCTGTAACACCATGTTCTCTCCTAGGTCTGGTTGGGC
TCAAGGTGAGCAGAGTGTTTTGAGATAGATTTGCCTAAGGACGAGTATCTCATAAAGTCT
ACTGTGGGGACCATTCACACACAGGGTTCTGAGTAGCNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGCTCCTTCATTTTTTCCCCTCCCTGCTCCC
CCCCTCCTTCATGAACCCTTGATAATTTATAAATTATTATTTTGTCATATACAAATAAAT
GAAAATTTGTCTTATACCATTGGTAAGTCTTAATATAACAACAGTAAACTGCATTGCTAC
ATTTTGTGACAGTATGCATAAAAAGCCAACATCAGTGGGAAGGTTGAGATAGCTCACCAG
ATCAGAAATTCTCAGGGCAGTCTTTGCAAGAGCACAATGAAGATCATCTTCCACAACAAA
TCTACTTCTGTATTTAGACTTGATAACCAACAAAGTTGGAAAATCCTGTTTCACAAAGAT
ATGTTGTTGGAAATGGAAGAAGAAAGGTGCAACACAGTCTCAGACAGAAACAGGATATGA
CTGCCAACACTTGAACCTGAATTTTGTAACGGGCATTGTAGAGAAATCAGTTCTTGCTGC
ATCGCTGTTAATAAGTGCAATGAACAACTCTTGTGCGGTCTCAGGAACATCTTCAACTTT
CACTGTGAATGGGCTTCTCGCAAGTGCAAATGGGGTGTCAGGTAGATTTGGAAAGTACGA
TGAATTTCATCTGCAAGCATGTGCAAGTGTTCTTTCAGAGAATTATTATGGTAGTCCTTT
TGTCTGGTTCAATGCTATGTTCCTCAAAGAAAGCAGACAAAGTAGGCAACATGTACATTT
TATTTTCATCCAATTTTTTGGTTGTTGCCAAAGCTGAAGTTTCATTTGGAATGATCGGAT
CTTTTCAGACAAATTGAGGCCTGTGGCATTTGCAAATGTCCTTGTAGTGATCAATTTAGC
TCATTCAAGATGGCAAAGATGGCAGCCAAGTAAGCTATTTTCTGCAGTTCACTTTAATCG
CTGAAAAGTGTTTCGAACTGGGGTCTTGCTTTCTGATTAAAAAAAGTTTTGAGTTCATCA
CGAAGCTCAAAAACACATTTAAAAACTTTTCCTCTCGACAACCATCTCACTTCAGGGCGA
AATAGCACCCCACTCATTGCATAGCTGCAAAAACAGTCGACTGTTTAAAGTGCTCGCCTT
TACAAAATTGACAGAACTTACGACGCTTTTCATTCCTTCTTGTAACTCTGGTGGCAGCAT
CTTCATTGCTAATATTTGCCGATGAATCATACAGTGAGTTCCGATGTCTTTTGGTGACTC
ATTCAGTACTAAACGTTGAACTCCAGATCGACATCCTAGCATAGCTGGAGCACCATCTGT
GCAAACACCACAAACCTTTTCCCAAGACATCTTTCGCTCTTTCAGAAATGAACCAACTGT
GTCAAATACATCGCATGCAGTAGTTGTCATTTCAAGAGATTTGCAAAAAATAAACTCATC
TTTAAGTCACCATCATTAATATACTTCACATAAACCAGCAACTGTGAACAGTTTGCAATG
CCTGTAGATTCATCAAGCCGGATGCTAAATATTGCAAGTGGAGCAGATTTAATTTCCTGG
ATGACCTGATCAAGAATATCCCTAGACATGTCATCTATTCTTCTGTGGACAGTGTTGTTA
GATAAGGAAATTGCACTCAATTTCATAACAAATTTGTCTCCAATCATAACTCGAACAATG
TCTTTGGCTGCCCACAACAGTAAATCCCAGCAATGGTGTGAGGTTTCATAGCTCTGGCAA
TTCTGAGTGCCACCAAATACGAAGCTTCAACAGCTGCTACGTTTGGTTTGTGGTACTTGC
CACCAGTGCCAAGTCTGGCTAAGTTGAGTCCATCACCTTTACTTCTAAAATAGTTGANNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGAGGGAGTACTTGAGTGGA
GGCCCAATGTCCTTCTGCTACCTTAATACTAAACCTATAAATGTAGGCTCATAGATCTAT
TTCCCCATCCTCATATAATATATTTGTATATGTACATGTCTTTATCTAGAGCTCTATAAA
TACCCTTTGCCTCCCAGCTTTTTCCTCTATTTCCATTGATTCTCCTCCTGTCCCACTATC
ATGCTCAGTCCCCACCAGGATTTCAGCACTTCTTCTTTGTTACGTTCCCCTTGATCCTGT
TTCTTTTATTAATGTTCTTCTCTACATGATCCATTGTGGTTTTCTAGTGAAAGTAATATA
TAACAATAGCCTTAATAATACAAAAGATGATACATGGCATAGTTCAGTCAATACAGTTCA
TTAAAGTTTCCTATGGTTTACCATTCAGTATTTTTTTACATACCTGTTACTAACACAAGG
GGGCAGTATTCACATCAACCACAGCTGAATGTAAAAAGACTGATCAGCATCCAGATTAAG
TTCCTATGGTACAGATATTTTTTGTTGTAGTTGATGATTTTACAGTACATGATTTTACAT
TTACCCAGTAATTATAATTCATGAAATGTTTTACCTCCAATACTGCTGCTTTCAACACAG
TTGCTGCTTTTAACAGAGTAGCTACTTTCAACACAGCAGCTGCTTTCTACATAGTAACTG
CTCTCTACACGTGTGTGACTGGTCCACATAAGTACCTTATAGCGCCAACCTTGTCATATA
CACCTGTATTTGTACTGGGTATATGTGATGGGGTTGGCGGGATGATATCATCACGCCGGG
TACTTGTATGTGGGTGGACCCGCCTGGAGACAGAGGAGCGGTGTCTCTGTTCCTAAGACC
ATCAGAAATATGTGTTTTCTGATGATCTTAAGCAACCCCTGTGAAAGGGTCATTCGACCC
CCAAAAGGGTCGCAACCCACAGGTTGAGAACTGCTGCCATAGAAGGAGCCCTGGTGGCGG
AGTGGTTATACATTGGACTGCCATCTGCAAGGTTAGCAGTAGACCACTCGCTGCTCCTAA
GGAACAAGACAGGGCCTTCTACCGTAAATGGCTACAGTTTCAGAAACGCAGGCAAATCTA
CTCTGTTTTGTAGAGTCGCTAGAGTCAATATTGACTCGATGGCAGTGAGTTTGGCTTGGG
TTTGGTAGAGATCTAAAAGTGTGAGACCTGTCTAGAAAAAGTCTGAGAGAAGGTGAATGT
TTGCAGAACTTTGGCAAGTTTAAGGTGCAAAAGGCAGCTTAAATGATTTGTATTTGAGTA
TAGTTTTGCACCAACTTCATCTTACTTGAATCAGGGTTCTGCCTGGCTTCCCATCAATTC
TTAAATGGGGAGTCGGGTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCTTCCCATCAATCTGAATGAGAGTCGAGTACTTCCAGAACTTTAAAAAAATATCTAAGT
GACCATAAATGCTGTGTTTCAAGGTGCAGATGAATCAACGATGATGTCATACTTTTCCAA
TTACCAAATTCAGGAGCACCAGCCAAAAATAAGCCAGAGCCTGCTGACAGACCTGCAGTG
CCCAGTGCTGCAGAGCCCATGCTCCAGGGGGAGCCCGAGGTGGCATGCAGTGCCCAGGAA
CTCTTCGACTGGCTGGGAGCGGTCTTCAACCATGTGAGCTTGTACGTATCTGGTCTCATG
GGGAACTTTTGTGGAGCTGGCTTTCATTTTCTGTTTTTTTGGGTGTTTGTTTTAATGTGG
GTTGAAAGTGATTAATGTGTTTTCTTTTCTTTTTTTTTTGTGGCAGAAATAATGAGTCTA
ATAATTTCATATCAACTTATTGCTGCCCTCAGCCAAGTACAGTGGTGGCAAAAGCTTATT
TATGTACAATCACTGGTTTCCTACTGCCACAGAAAATTGGTCTCTTACTGGAACAGCTAT
GGTGAGACTCTTGCCTTTTCTGCCTTTCTGTGTGCCAACATGCTACTGTAGGACCCTGAT
GGGCTGCAAGTTATAGGGCCTTCTCACATTTTTTGTTTTCCTTTCTTAAGCTCAATGTGT
AGTACCATTATCATCTTAAATGACATAATTATCCTTCTTGATAGAAATATTCTATTATGT
CATTGTCCTTATGAGAAGAAAAAGGGTGGAGCTTTAAATTGTACTTTAAAAAAATCATTT
TATTGGGGGCTCGTACAACTCTTAGCACAATCCATCCATCCATCCATTGTGTCAAGCATT
TGTACATTTGTTGCCATAATTTTTCTCAAAACGGTTTCCTGCTACTTGAGTCCTTGGTAT
CAGCTCCTCATTTTCCCCCTCCTTCATGAACCCTTGATAATTTATAAATTATTATTTTTT
CATGTCTTACACTGTTCGATGTCTCCCTTCACCCACTTTTCTGTTGTCCAGCCCCACTGG
AAGGGGGTTATATATAGATCATGGTGATCAGTTCTCCCTTTTCCCCCCACCTTCCCCTTC
CCCTCCTGGTATCGCTACTCTCATTATTGGTCCTGAGGGGTTTATCTGCCCTGGATTCCC
TGTTTCCAGCTCTTATCTATACCAGTTAAAATGTACATTTTAAGAACAAACTGATCATTT
TCCTTGTTCTCCCATTTTGAACAGTTGCTGTCTCTGCATCCACTCCTCTTGTGCTTCATA
AATTAGAAGCCTAACAGGAACAGTTAAAAACAAAATCAAAATAAAACAGAAAGAAAAAAA
TACTACTAATAAAATTAAGATTAAAAATAAATAAGTAAGTAGGAGAAAAGACCAACAATA
TTAAAATAAGCTAGAGAGAAAATTTCTGTCATGGAACATGCAAGAAATATTTAAACTTAG
ATCAAATTCAAGTTGACCAGGTGTCGTATTATACCATAGTTCCATCCACCATAATCATCT
TCAGAGTGATCTCTGTCTGATAGCAAAACTAGGTACTCCGTAGATAAATTTTGGGCTCCC
ACTAGCCTTCTACAAATTGGGTATTCACAGTTTAAGCTCTGATACATTTCCCTTCATTAT
ATTTGAATTTTGTTATTGTCGTCTTTGGATCACACAGGCTGGTGTACTTCTTCCATGTAG
ACTTAGTTGACACCTCACTCCAAGATGACTGCTTGCTTGACTAAAGGTCTTTAAGACCCT
ATACACTATTCCAGTTGATAGCCAGGCATCGTCTGCTTTCTTCACCACACTTGAACATGA
TCCTTTCAAGCAAGCATGCCTTTCAGTCTTAATTTTTAAATTTCTAAGATTTACGTTTTG
CAGCATTCCTTTTAAAAATCAAAGTCTTTTTTGTCACATTTATTAGCTATACCGAAGATG
TAAAGTTTGAGAACTTCAATCTTACTTTAAAAATTATGGAGGCTGCGAATATTCTCGCTG
TCCTGGTTTTGTGGTAGCCAGGGCAGGCTAACCGTTTGCTATATAAAAGACCATGCATGT
GTCCCCAGGCTGAGTTCTTTCCCTGAGCCTGGTTTTATAAATGCTGGTGATAAGTCTGCA
TTTCTGTAGATGGCTGGTACTCCAGGGATCTTTGTTCAAGTTCAAGATGACTGTTTAGTG
AAATAGGAAATAACAAATGTGGATTTGCAGAATTATGTCTAAAGTAGAGGGATTCTGCAA
CAATTTGTTGCCATTCATTAATGTAAAATTATTTTTAAAAAATTATGGAAGCATTCATAA
ATGAAAAACAAATTTACAATTTAAAAATCTACTTTTAGTATATTTACAATGTTGTATGTC
CATCACCACTACCCAGCTCCAGAATATTTCCATTACTCCAAAAAAGAAACCCCTGACCGA
TTAAGCCGTCACTCTCAATTGCTTCCTCCGTATACCACTGACAGCCAACTAACCTGCTTT
TCATTTATGCAGATGGCTACTCTGGGCACATAGCGTAAGTCCAATCATATCGTACATGGC
CTTTTGTGTCTGGCATCTTTCACTTGTCACAGTGCTTCCAAAGTTCGTCTAGGTTGCATC
ATATTTCTGTATGCCGTGCCTTTTTATGTCTGAATAATATTCCATTTTATGTATATACCC
TGCCATTTTTTTGTTTCCTTGATTCACAGAAATTTTGGTTGTTTCCACCTATTAAGTGCT
GTGAGTAGTGCCACTGCTATGAACATCCATATACAAGTTACTGTTTCAACGGAAGGGTTC
CCCTTTTAAGCCAAATATTTTATTTTTAGATTTATTACCTAATACTTTGACTTTTTTTGT
TGGAAGGTCATCTTTGTAAGAGCTAGTAAATTATGTTTCAGTGTTTAAAAGCATCTCTTT
TTAAATGAGGGAAACTATTCTTGTCTACTCCGTGGGTTTTTCCCCTTTTCATTTTTAAAT
GATCTTCCAGAAAAAAAGGTAAGGACAACTTAAGTTTGTTTTGTTGAAATAAATTAGCTG
TTCTTTATTAAATTGAAAACTGGCATCAGGAATTTGACCCACATTGCTTTACTTTTAGGA
ATTTATAGTTTAGGCTTACATTTCTTTAGACAGTTAGAAATAGCACTTAACCTGAATAAA
TAAAAACAAAATGTGAACATGAGTAACTACTCCATTTTTTTTTCTTCTAGTCACTACTTT
GATGAACCAAAGTTAGCTCCTTGGATTTCCTTATGTGTTCAAGGCTTTGCAGACAGTCCT
GTTTCGTGGAGAGAAAATGAACATGATTTTCTAAAAGGAGGAGAACATTTGTACAATTTT
GTGATTTTTAATAATCAGGATTATTGGCTTCAGATGGCTGTTGGGGCAAGGGATGATTGT
CCACCTTAAAAAATAAAATAAAAAAAAGATGTCTTTTGTTAGTATTTATTTTCAGATGTC
TTAATGATCAGACTGTTATGTTTACTGAGGGGATGATGATTTAGTATATATTATACTTAG
TATAATATATAAAGTATATTTAGTATATACTATATATTAGTATTTAGTACTATGTGTATT
ATGTTTAGTATAATCTCTCATTTAGTATAATCAGCATCAGTTACCATTTCTGCTCTGCAC
ATAGGGCTCATTTTGTGACTTGTCATTCAATGTGAATAACTCATAGTTGGTTTTTGCCTT
TCAGTAGGAGCCCAGGGATGGTTTACTACATGATAGGGTGGGTCAGGATGGCTAAAGGTC
CAGATGTCATTGGGTCAGGTGAATGATGTTGTGCAAAATGAAAAAATGAAACATTTTCAG
GTATTGAGAAACCCTTATGTGTTAGACAGGGTTCTCTAGAGAGATAAAACCAAATTGCTG
ATAATTTAATATATTTATTTATTTATAAAGATAATTAGATATATAACAAGAAATGAACTG
TTAAATCATATACAGATAAATATATAATACAAGAAATGAACAGTTAAATTATAAAGCACT
ACAAATGGCTCAGTGCAACTCACTCCCGTGAGAGAGTTGTGAGAGACTAGCAGTCCTTCA
AGTCTAGTCTGCTGCCAGATCTACCTCTATTTATAGAGAGCTAGGCTATGCCAGCACAGC
AGCCAGTCACAAGGCAGGTCACCAGCTGTCAGCCAGGTCACCAACCGCCAGTCCCCAGCT
CCAGAGATGTCTTAAAGGGACCTTAACTTACAATGACACAGTCCACAGGCTAGGCATCCC
ACAGGTAGTATAGCCTTTAAATTGAGGCACAGAACAAGCAAGGCAGCCGCACACTGGTCC
GATCAAAGAGTGAGAGACAAGAAAGGCAAGGCTCACCAAGCCATTTATCTCTCTGCCCTT
CAGTTAATCCCACTTGTGTTTATCAGCCAGCTGGCACAATGAACTATCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 3249..3252, 3254..3394, 26686..26754, 26855..26950, 27684..27809, 32828..32940, 32943..33025, 33151..33285, 35915..36113
1001..1123, 3249..3252, 3254..3394, 26686..26754, 26855..26950, 27684..27809, 32828..32940, 32943..33025, 33151..33285, 35915..36110
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved