Echinops_telfairi Locus SLC25A3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SLC25A3
Echinops_telfairi
SLC25A3
GeneScaffold_736
SNORA53
3248..3445
5582
CTTATTTTGTTTTTGTGCTTATGTAAATAGTCTGTCATAATTTCAGATCCAAATTGCTC
ATGGCTAGTATGGAGGAAAGCAATTGACTGTCACATATGGTATCCTACAACCCTGCCATA
TTGACTTACTCAATTTTCAGTGTTTCTAATGGTAACACCTAAACAGTGTGTCTAGCATTA
CCCTTTTTTCCCATAATTAATTACTATATATATATGATGCAGACCGTCAGAGGATCAATG
AAAAAGAGGAAGACTCTCAACTGGATGGATTGGCATAGTATCCCTTAATGACCTCAAGAC
CAGTGCGGTGTTTTCTTGTTGTACACAGGGTCTTGAGGGCACCTAACAACAATAACTATA
TACTAGCCCTCACTTATACGAAAAGAACAAAAGGACTGGCGTCAAGGAGAAATGCCTGAA
GGTGAAGGGACAATGAGGACGGGCCACAGTCACAAGTCAGCGCTCAAGAGCCCAGTCTGG
AATGCGCGCCTGCGCAGGACGATTCTTCCTGCGCACAAGCCGGGCCGGAAATGCTGGGGC
GAACGGGGGCGGGGCAAGGGTTGCTAGGAGAACGCACTGGCGTAGAGGTCCCGGAGCTCC
TCTCCACCAATGGGCGTCGCGTGCCTGTAGTCGACGCGCGGCGTGCGTCACGCTGACGCC
GCGCGAAGGGCACGGATCTGAGGGCTGAGAGGACGTCCTGCCTCTGTGAGCCGCAGCCTT
GCCTAGGGAGCGGACGCGGGTTCGCCATCTTAGGCCGTGAGTGTGACCCGGCCTTTTCCC
GGTGGGTGCGGGGAGCGGAGCGCGCAGTCCCTGTGGGCCCCAGCCTTGGCCGTAGGCCCG
CTCGGGCGCCGCCTGCTTTGGGGAGGCGCCGTGACCTCCTCAAGGACGCGGAGGCGGGAA
GGAGAAGGCCCCGGTCGGGGTCCCCGGGCGCCGCTGACATTGCGCAGCGTGCCGACCCCT
CGCCTTTTCCTCTGCCCGCCCCTCCGCCTTCCCTTAGGGAGATGTTCTCGTCCGTGGCGC
ACCTGGCGCGGGCTAACCCCTTCCACGCGCCGCACCTGCAGCTGGTGCACGATGGCCCCG
CGGAGCCCCGCAGCAGCCCCGCCGGGCCCCCCGGCCCGCCCCGCCGCACCCGCACCAATG
GCAGCCGCCGCTGTAGAAGGTGAGCTCCGAGGCCGCCGCAGGCAGCCTCTCCGCCGCGCG
GAGCCCTGGAGGGGGGGGGAGCACGCGTCCGGGCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
GCTAGACCTTAGTGTACAAAAAGTTACCCTCTTCAGGGATGGTCACAGGTATTACGCTGA
TGTAATTCGGTAAACTTGCATTTACATTCTGTAGTTACTGAAGTTTATGTTTAACATAAA
AGGAAAAATAATCGATTCCTGGAAAATTAAGTATTTATGGGAAGTGTTAGCTTTCTTATA
TATTAATAATGATTTTTTTTTCTTTTAAATAAAGGTGGACCCCCAAAAATACAAGGGCAT
ATTTAATGGATTCTCAGTTACACTTAAAGAGGATGGTGTTCGAGGCTTGGCTAAAGGATG
GGCTCCGACTTTCATTGGCTACTCCATGCAGGGACTTTGCAAATTTGGCTTTTATGAAGT
TTTCAAAGTACTGTATAGCAATATGCTTGGAGAGGTATGTAATTTAATTTGAAGTGGGAA
GTTTTGAGCAGTAAACAAATTTTTAAGTGCCCCAAAATTATCAAAATGTTGTCTGATCCA
CCTTAAGAACTCAGTGAATGATCTTATCCAGGGTGAACAAAATGCCTCAACTCATGAGGT
TGTTTATTATCAGAGGCAAAATGAAAACATTTTTCATTTGGTCTGTTCAGTTTTAAATTT
TTGCAAATAAGTTAAATTTTAAGCTTTTAAAGAGGGGACTATGTATGGGATTCCATTATG
TGGTTCTGTGCTAAGTATACTTAGATTAAAAATAAAGGCCCCAAAGGCGCACATTGTAGT
TACGTGAACATAGCATATATTCCATTCCATCTGTGTTATCTATGGACCCAGTAATAAATA
TACTTGTAAAATTTGTTTGAATCGTGTCCCTTAAAGTCAACTTGAAAACGGCCTCTGCAA
AAGCAAACGGCGTTTCTCTTACTGTTTTTCGTTTTAGGAGAACAGCTATCTGTGGCGCAC
ATCACTGTATTTGGCTTCCTCTGCCAGTGCCGAGTTCTTTGCTGACATAGCTCTGGCTCC
CATGGAAGCTGCTAAGGTTCGAATTCAGACCCAACCTGGTTATGCCAACACTTTGAGGGA
TGCGGCTCCCAAAATGTTTAAAGAAGAAGGCCTATATGCGTAAGTAAATTGCTTGCCTGA
AATTGCAATATAACAATCTGTTATTGCAGGAACATAATTTTTTTCAGTAGCAGTAAGTTC
ACCAGATTTTCCATCATTGTTTCTTGTCTGTTTTCCCCTGCATAGAATGTAAGTTCCCTA
AGAACAAGAATCTTTGTTATATTTACTACTATATTTCAAGCTACATTGGGCCTGGCTCAC
AGTGTTTAATAGGTTGTTTTATATATGAGGCACATTCCAAGTCGTGACATGAGTATGTAA
AGGGGCTACAAAAAAAAGTTGGTGGAAAATAGTTAAAAAAATAATGAGCTTTTTGGTGTG
ACACCGCCTGCCCCGCCCCGCCCCGCCGCCCCCCCCCAGTAGATCTAGAGGTGGCTATAA
AAATCCTATTTAGATACAATTACAAATAAATTGTAATGCATTAAGTAAATTCATTGAGCC
CCCAAATAAGCGGGGTTTTAGTTTCCTTTTTAAAATTAAAGAGCCATTTAGCAATCTACA
AATGACTTATTTGTAGCCTGTGCTTCACAAACTATTTGACCTAATCATTTACTGTTAACT
TTTTGGAGGAGTGGTTAAAATGCATTTGATCCGTATAATATGTTAAGAATTTACACTTAT
CAGGACACAACATGCTTCCTTAGATCCACCTTTGTGGATGTTAATTTTGAACTGAGTTCT
ACTTGTAAACTTTGTGTTTCTTGTAGTTCCAGTCAAAGAAACATCCGGCACCTTTTGTGG
TTGTACCCTCTTAAGGTGCTTGAGTCATTGGCATGTGAGAGAACTATACCTTCTACTGTT
CTTTGGTTCTGATGGAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGAAGTTTGCCTGCTTTGAGCGGACTGTTGACCCTTTATACAAGTTTGTGGT
TCCCAAGCCCCGAAGTGAATGTTCGAAGGGAGAACAGCTTGTTGTAACATTTGTGGCTGG
TTATATAGGTATGAGAACACACTTATCTCCGAAATAAGGACAAAGAATTATTTCTATTAT
TGACTTCTTGGAGGAAGGAGGTTTCATTGCAGTATTTATCTTAACATAACATTGCATATG
CCATTTGAATTTCATACTTGCTAAAAGGATAGTTTTATAGTTTGCTTTTCCTGCTTAGTT
TGGGGACTATATTTATCTCCACAACCACCAAATCTTTTACATTTTTTTTCTGACTTTGGA
AATCGGTTCACTGCTGCACCATCTGGATTTGTTTTTTTTTTCTCTCACTCGCTTAGACCG
CTTGGCCATCCTGACACGTTTTTCTCTCACTCTCTTCATGACTTTAGTAGTTTTTCTAGA
ACAAATTTAATGTAAGAAGAAGGAAGTCATGAGTAATTTGAATATGGATACCTTTTTTTG
GAATATGAATACTTTTAAGGGATCTTCTATGGCTTTTTAAAAGAGAATTTTATTACATAA
AAACTGGGAAAGGTAGGCTGCAGTTTGGATAATGGGTATCTTTGGACTTCACCTGAGTTC
ATACTGGATCCTGTTTGGCTCTTTCAGCTGGCGTCTTTTGTGCAATTGTTTCCCACCCTG
CGGATTCTGTGGTGTCTGTGTTGAATAAGGAGAAAGGTAGCACTGCTTCTCAGGTCCTCC
TGAGACTTGGATTTAAAGGTAGGATGTCTTTTTTCTTTAAAGAAAAACACTTAAATAGGT
ATGTTGTGTGTGTGTTTCACTCCTGTTTCATATTTCAACCAGGTGTATGGAAGGGACTGT
TTGCCCGTATCATCATGATTGGAACTCTGACTGCTCTGCAGTGGTTCATCTATGACTCCG
TTAAGGTCTACTTCAGACTCCCTCGTCCTCCTCCACCTGAGATGCCAGAGTCTCTGAAGA
AGAAGCTTGGGTTAACTCAGTAGTTAATCAAACATAAGTGGACTGAATCTGTTGGCTGAT
CAGTGTTGAGGAAAGTCAAAAGGAACTTTTATATATTTGACAGTGTAGGAAATGTCTATT
CCTGATACAATCACTGGTAGTTTGCTTGTCTAAGGCAAGAGTTTCAAATTTACTGTTGAA
ATAAACCCAACTGTTAATGATATGTTGTCGCTTGACAATTATTTGAAAATGTAGTTAAGG
ACTCTTATCACAATCCATACATACATCAATTGTGTAAAGCACATTTGTACATTCATTGCC
CTCATCATTCTCAAAACATTTGTTCTCCACTTAAGCTCCTGGCATGAGCTCCTCATTTGT
CCCCCCTACTCCCCCTCCCTCATGAGCCCTTGATAATTTATAAATTATTTTGTCATAGCT
TGCCCTGTCCGACATCTCCCTTCACCCACTTTTCTGTTGTCCGTCCCCCAGGGAGGAGGT
CACATGTAGATCTTTGTAATTGGTTCCCCCTTTCCAACCCACTCTTCCGCTACACTCTCA
GTATCGCCAGTCACAACACTAGTCCTAAAGGGATTATGCGTCCTGGATTCCCTGTGTTTC
TGGTTCTTATCTGTACCAGTGTACATCCTCTGGTCTAGACAGGTAGAATTGGGATCATGA
TCGTGGGGGTGTGAGGAAGCATTTAGGATTAGAGGAAAGTTGTATGTTTCATTGTTGCTA
CACTGTACCCTGACTGGCTCGTCTCCTCCCTGAGACCCTTCCATAATGGCATGTCCAATT
GCCTATGGATGGGCTTTTGGTCTCCGTACTCCCTTTCATTCACAATGGTATGATTTTTTT
TTTCTGATGATGCCTGATACTTGGTGGCTTTTGACACCTTGTGATCACATAGGCTGGTGT
GCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCGCTAGTTTACCTTCAAGC
CTTTAAGACCCCAGATGCTATTATCTTTTGATAACCTGGCTTTCTTCACCATACTTGCTT
AAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 1137..1158, 1334..1458, 1774..1953, 2437..2618, 3495..3667, 4227..4337, 4422..4582
1001..1135, 1137..1158, 1334..1458, 1774..1953, 2437..2618, 3495..3667, 4227..4337, 4422..4579
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved