Echinops_telfairi Locus DDX52
snOPY snoRNA Orthological Gene Database
Echinops_telfairi DDX52
Echinops_telfairi
DDX52
GeneScaffold_4355
SNORA2
4574..4709
20755
TTTCCGCCGGCTGGGCGCCGGGGCCAAGTTCGACGTGAGTCGCTTCTCGGCGGACGCGG
CGCGTTTTCAGGTACTGTTCGCCGGGGACGGAGGTGGCCAGAGGCCGAGGAATCTGGAAG
GAGCGCGAGCTCCAGAATGAACGGCCACTGGGGGAGCCTGTGGACCCCGAGTGCTGGCGG
CCTGACCCTGACCTGACGTGGAGCAAAAAGCTGCTCTCCTCAGGGTACCGGTGAACCTGC
CTCTTTAACGGGTTCAAGTCCCGTCTTAATGAATTCTGTCCTCGCTTCTTCTGTAGATGT
AGATGTAGCTGGGGTTGGCGCGAAAATGTAGCCCCCTCCCTCCCTAGCTTCGTTGATTCA
AGACAGTCCTTTCGAAAGAATCTCACCCCTGAAACTTGTAAAGAATTTTGAAAACAGCGA
AAAATGTAAAGGCCAGCTGCTTCTACTACAGTGTATCCACGTTTAGCTTAAGATGCAGTC
GTTTTCCGGACAGGATTCTTTCTGAGCCAACCCCGTGTACGTCAGCCAGAGAAGAGTGGC
CCAGGATACGGACTCTTAACATAGGGAAGGAACGAGTCGGTGGGAAAACCTTGAATATTA
ACTTTTACACTTGACACGAGGTACTGTCAGGCAGCCATCGAAAGGTTTTTAAATGACGTG
TGCTGCTGCTTTCTCTGACTGGCGGTATAAAAACCCCAAAACCTACTGCTCTTGAGTTGA
ATTCCAACCCATTTGGAACCCTTTGGGCCAATAACTGTTCCTGAGTTTCTGAGACTGTAC
ATTTTTATGGACTAGGTAGCTTTTCATCTTTCAAACTCCCTAGCTGCAAAGGTGGTGCTG
CAGTGCACAACCCACTAGGGCCTCTTCACTATACTGCCAACAACCACATCAACCATCATC
TAGTTGATTCCAGCTCAGAACCACGTTGTGTAGGGGTTTCACAGGGCTGTAAACTTTTTC
AGACTCTGGTGGGGTTTGAATCACCAACCCTTGCAGTTAACAGCTCAATGTTAATGGGGA
CAGCACCATCAGAGTTCATCCATTTACGGGGGTTCATANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTT
CTTACTGGCAATCTTGCCTGGGTGAAGCAATGCCATTCTATCAGATTTTATTTTATTTTT
TAGCTTGGAAAAAGGAAATATGACTTTAATTCTTCAGAGATGCTGCAGGGGCTGGACTTT
TTTGGAAACAAGAAGTCTGTCCCAGGCGAGTGTGGAGTATCTGGAACACATCAAGGGCTC
CAAGATGAAGAGAAAACGGAAGAAAGCCTTAAAAGGAGGAGGGAAAAGAAAAAGAGAAAG
ATGATGACTTCAGGTTAGTGCCTAATTTTAGTTATGTTTTTTTTTCTTTTTTCAGTTAAC
AAAAGTAATGTAGGCAAGGTCTGTCCTCCGAGAATTTCATTGAGAAACTTTCCTCCCTCC
AGTGCCCAACCCTGCCCTTTCCTCCTCAGACTCCTTTTTCTTCTCAAAACTGAAAAAGAA
TACAGTTTGAAGCCCTCCATGTTGCCAAAACTGCTGTTTCGACATGGTGTAAATCAAAGA
ATTGGAGAGGTGGAAGCACCGCCTTTGGCAGTGTACAGACCTACTCACAGGGGCTCCACA
TTTTGATGCTTCCGCTTAATTAAGGTTTCTGTGACTTCGTAGCAATACTTTTTTTTGCCC
TTACCCTTTTGTAGGTATTCAGTGGAATGCTACCTAGAACAACATGAACGTAAAGAACGA
CTAATACATGCAACCACATTGATGAATCTCAAAATAAATGCCAGGTGAAAGAAGCCAGAC
CAAAACTAATACATACTATATGGATCCATTTATATTAAATTCCAGAAAATGCAAGCTGAT
CTACAGTGAGAGAAGCAGACCCATCGTTGGTTAGGGGCAGTGTGATAAGTCACATGTGGG
GATGGTTTAATGGGTCACAGTTCATCATAGTACATGCTTGTGAAGTATATGGGATTTATT
ACAGATTAATTATACCTCACAAAAATTAATTCCAAAATTCCAGTAGACCAGTAAGTCTTA
ATTTAATTAGTTTCCCCCCCCCTTTTTTAATTCTCTTGGGTTGTTTTTTCCCCCATATAA
ACCTTAGAGTCAGAAATCCAGTTAGCAAAACAATCCTGTCATTTTATTGAACTAACTGGC
CTAATTTATTTATAAATCATTTTATTGGGGGCACGAACAGCGCTTATCACAATCCATACA
TAATCCATTGTGCCAAGCACATTTGTACATATGTTGCCATCATCATTTTCAAAACATTTT
CTTTCTACTTGAGCCCTTGGTATCAGCTCATTTCCCTCCTCCCCCACACTTCCTCCCTCA
TGAACCCTTGATAATTTATAATTTTTTTTCCCCATGTCTTAACACTGACTGATGTCTCCC
TTCACCCACTTTTTGGACTTGTTATTTATAGAGGAATTTCCATCTCTATAATATTGAGTA
TTCCTGAGTATTGCTATTTTCTCTTTTCTTATCTATAGTGTATCAGTTGATACTTTTTCT
TTTGTTTAATGTAAAGGGAGGTCATTAGCTGTAGCCATGAATGTCACACTTAAAACTTTT
TAATTTTAAATAATTTATTTAGAAATTACTTCTCCAGAAGAAGGAACTACAATACAGTGG
ATGTCATCAGTGGAAGCCAAGTTTGAAGATAAAAAAGTTAAAGAAGAAAAAAAGCTAACT
TCGGGAAAGTTGGAACATCTCAGAAAGGAAAAGGTTAGATAATGTCTTATGCCCCTCAAA
ATGTATGCTTTTCTGACCTAGTGCCGTTTTTGATGGACATGGAATATTTTGTTGGTGAAA
GTGAATGTAGTTTGCTGAGGTAGAATAATAATTATATTTGATTGGATGTTATTTTAGTGG
AAACTTAAAAGTGGACATGTGTGCTGTGGCTGAACGTTTAAAGTTTTAAATTCTGAAGTA
TAAATATTTCTTGACAAGCTGCTTAAGTTTCTGGATTAGAATTCAATTTTTAAAAATTAT
TATTAGCCCTTGTGGACTTACCAGATTTGGGTCTAGGGCCATGCTCCTCAATCCCCTTTT
GATCAACAGAAAATGTAGTCCCCTTTCTCTGCGTTGAGTTCCTTGGTTCAGCTGTATTTC
CTCTGATAGGTAATAGAAGTCTGAAGAATCCTGTTTTTTTGGCCCTGAATCAAGGCTAAC
AGTTTGATGGAGCTGTTGGCTTCAAGCAGGAGCCTAAAGAAATGTCTTCCTATGGTCTGT
TGGCCATTTCAGAACTTGGAAATGTAATGGTCAATTCATTAGAAAGAAACATCTGAAAAG
AAAAAAAAATCTTTTTTATAACTTGGGTAAAGGGCAAGTAGAATACACACAGAAGAAACA
AGTATGCTGTTGTCCTGTGCTCTGTCTTACCTGCGTGCTACTGATGGAAAGTGTGTTCAG
CTCCCTTGAGAGAATTCCGTGACGATGGTCAGTGACCAGAATCTGGTCATGTCTAGACTC
GGGACTGGAGAAACAAGCCAAACCAGCACCACTAGACTCCACTCCGGTACTTCCTTAATA
AACCACCACAAAGAAAAGGTTTTGTAGTTCGTGTTAAGTCCCAAATGAAGAAAACAGATG
GACTTAGTGTCTGTATTCTCAAGGTTTGTAGATCAGGATTATGAATATGACACATCAGTA
ACACATCACTCATGCGCAAAACAGTTGCCATCAAGTTGACGCCGACTCAGCAATCCATAG
GACAGAGCAGGACTGCCCGTCGGGTTGCAGTCTTTGTAGAAGCAGAGCCCCATCTTTCTC
CCATGCCTCCTTGACTGATGAATTCAAACCCAACCTTTGGGTAACCACTGCCCCAGCAGG
ACTCCCTTTTCTCTCATGACAGAGACCCTTGAATATACAGGAAGTGTGGATAAATAGGTT
TCATTGTTAGGACTGTCTTCTGCCTAAGAAAGGACATAGAATGTACCTCATGTCCATGAT
TTCTTAGGGCTTGGAATTAAACCAAAAAGTTCCATATGCTAAGAAATTAATCCTAGAAAG
AAACTGCTTTGGTAACAATTGACAACGTATTTGGCTGCTACCTATGATGACCCCTTTGCT
TCACTTTTCAGATAAATATCTCCGGAATAAACACAAAATCCATGTCCAAGGAACTGATCT
TCCTGACCAATTGCTAACTTTCAGCAGCTTGACGAAGAATATAAAAATCAGTTCTCGATT
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACGCAGGTCTGGGAGCC
TTCGGACAGCCCTTCCCCATGTGTGCTCTCCCTTCCCTGCCCTTGAAACTCCTTCCCTGC
ATAATCCCCCTGCTGAAATACTTCTCTGCTTTTTTTTTTTTAATCGTTTTATTAGGGCCT
CATACAACTGTTATCACAATCCATACATCCATCAACTTCTCTTGCTTTTAAGGTTCATCC
CAGATATCCATACCTCCATTAAAGTGCCTTGATTCCCACAGCTAGATGAGGTCTTTTCCC
TTTATGACACCTTTCTCGACACCCTTATTCTCCATGGTATTTAGTGAGGGTTTTTCCTTG
TGATGTTTATTGGAGACATTAAATGACCATGTATTTGTAATTGTATTTGCCTTTTCCATC
TTACAAGAGTGCAAATTCTGAGAGTGAGGACTATGTTCTGTTTGTTCACTTTCCAGTTAG
CTTATAATGCCTGGGAGTATTTCAGAGCTAGAGATACTTTCTAAACTGTGTTTACATACC
TGATTTAGATTTTTTCCCTACTGATTTTTATTATTGAAATATAATTTACATACCATAAAT
TGCATAGAATTTCAGTGTACAGTTCAGTGAGTTTCAACAATGTAATCACCACCCAATACC
GAATAAAGGTATAGACCATACCTGTACCAAACAATAAGCCTACTGTCATCGAGTTGATTT
TGACTCATAGACTCTTGAGTCAGTACAGCTAACTGCCCCATAGAGTGTCCAAGATTGTAA
GTCTTTAAGGAAGCACACACAGCCTCCTCTTGTTCCTACAGAATGGCTGCTGGGTTTAAA
CCACTGACCTTGTAGTTAACTGCCTAATGCTTAACCTATTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGTCCTTCAGGACTCATTAGCACATTCCTAGAGTCCCAG
AAAAATTGTCTTGCGTCCCCTTGCATTTAGTTCTCACTCCCTGGAGAAGTTGCCTAAAGA
CAACCATTGTTATAATGTCTATCACCAGACAGACACTACTTTTGCTTCTAGAATCTCATA
TAGATGAAATCATATTTATCTTTTTCTCTGCATGGTGTTTTTAAGGTTCATCCATATTGC
CTACATTGTAATTGGTTATTTTTTGTTGTTGCTGGAATTCTTCCATTGTATGATTATATC
ACAGTTTGTTTATCTATTAACCTATTGTTAGACATACGGGGATTTTAGAAAATGAAATTT
TTTTTAGTAGATTTGTAGAAATGAGAAGTTTCCCCCCACATAACCAAGATGATCTTAAGT
TCTGGTAGTAAAGGATATTAGTCACCTTTACATCCATTAGTCTTTTTCATTCTCCAGCTA
CTGAACTGAATACATTCGTGTATTGAATGATGCTGTCGACTCACACTGTGGTAGATTGGC
TTTAAATTTTCATTTAAGATTATTTCTATCCTGGCATTAGCTAAATTTTAAAAAATCTCA
GTGACTATTTGAAGAATGTCACTTATAGATGGCTTAGCCACTTTCATGTCTGGGTCTTTG
GCTGGGGAATATATATATATATTCAACAAAGTATTTCAACATACTTCATGCATAAAGTTC
ACTGACTAATAATGCTCATCATGTTCAGTCATCACTCATTTCCAGGTTTTCCATCACCCT
TCACAGAAGCTCTGTGTACCCTCTACAGTGGCTTCCTCTTCCCCTCTCCAAGTCTTTGTC
AGTAATGTTGGGCTTCATTTATCAATATTGTCTACCCCTCCAGTAGTTTAGCTGAACTAT
ATTACTTTTGGCACAGTGGTAGCAGGGATGGGAGATGTTAGAAAATCAGTATGGGATAAG
TTTTTTATTATTACTATTTTTAATGGGTTAAGTTTAAAAGTTTAATGGGGACATGAATGA
TTTGATTCATTAGGGTTTGGTTATTTCTGTGGCTGGTAACAATCATCTGACTGGGCTCTG
AAAATTTTAGGCATTTCCTTATATTTAATGTACTCTGTATTTTAGGGTCGGGAACTTCTG
GCCTCTGCACCTACTGGATCGGGAAAAACTTTGGCTTTTAGCATTCCCATTTTGATGCAG
CTGAAACAACCCACAAATAAAGGCTTCCGGGCTCTGATTATTTCACCAACAAGAGAACTT
GCCAGCCAGGTATGGTTGCAGTTTCTAAAGAGAATGTGTGTAGTGTTTAGTTGGTGTTCT
CCCTAATAATAAAAAGGTCTAAATATAACAAGGTCTGCATCTCTGTTATGGCCAAGTATG
CTGAACAGAGCAAATACTATAGTTCTGTATCTTACTCCATGTAAGAATGTCTCTCAAGCC
TATTCATAATTTTCTATAAGATGATATATTACCATTTATATTTCTAGGTAACTGCTTAAG
GTCCTTGAAGTCAAAAGGTCATTATTATATATATAGTCTTTCTAAAATTTATTTTTCTCA
CCTCTTCCTTCCCCAACCCCCATCTTGAGGTGAGAAAAGAAACGCATCTCAGTTTTTGAC
AGTGATCTGCTCCCCCCTCCCAGTGTGCTCGATTCCAACTCAGAGCCACCTGATAGCATG
GGGTACAACTGCCCGGGCAAATGTCTGAGACTGTAACTCTTTATGGGAGGAGAAAGTACC
AGCTTTGTCCCACGGACAAAGAGTTTCCAACTGCCGACATTGGAGTTAGCAGCCCAGTGT
ATTCCCCACTACACCACCAAGGCTCCTTCCAATGTGTTTGTATAGTATAAAATACTCACA
GGGGCTTCGCAAAGTTCATGGGAAATGGAGTGAAAAGATAATGGAATTTTTCCATGAACA
TTTTAAAGCCCGCTCATATGTCAAGAAGTATGATGTAGCCTGTAATTCTGCTGTATTTTA
AAATACGGAACTGACTGGTGAGCTATTGGTTTTGTCTTTTAGAACTAATTTACTAGGTTT
CAAGAAACTACTTAATTATTGTGGACATTAGAGTTATGAAAAGCCCAGATTCTGGTTAAT
TTGCATATTGTAGATTTAATTTCAGATATTCATGAGTCAGTAATGATGTTGTTAATAGTA
CAAAATGTTTTAAATCTTCTCCAAGTATCTTAGCAGCTACTGCTTTTTATTATCCTCTGC
TTTAGATTCACCGAGAATTATTAAAAATCTCTGAGGGAACGGGATTCAGGATACACATGA
TTCACAAAGCAGCAGTGGCCGCCAAAAAATTTGGACCTAAATCATCTAAGAAGTTTGGTA
AGGGACCTGTTCTTGTACAAGGGATTTGGAAATTGCAAGTAATTGAACAGCCAACTTGGT
TCATAGAAGACAGCTCAAATAGAATAAAAGGGAGTAGGGATATAGCTGTTTGTTGCATGA
TACGTTTGTATGTGTGTGTGTAGTGTACTATTAAGAGATTTTGGGTCTGACTAATGAGTA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTTTTCATTTTATGTATTTGTTTCCGTGCCTTGTTTTATTTGCCC
TGTGTACCTTGCTAACTACCAACTTTTAGGCAGGGGTTGGTGCTGAGAATAATGAGTTTC
ATTATTCCCCTAGTAAAAAGAACTATCTGGTCTGAAGAAAGTTGCATGTTTTGATGACCC
ATTTAGTGCAGAATTCCCTCAACCTTCCCACGTCTCAGTGATGCCAGTGAAGCTCACCAG
AGGTGTAAATGAGTTAATGCTGAATGGTACCTCTTGTCTTTTAAGTTTATCTTCTGCTTG
TTTTTCTTGTACTGCTTTCTGTTATGATAATAGATTTGAGAGCAACATCATGTGTCACCA
CATTTGATGATGTTTCTTGGATCTTCCAGTTCAGTATTCACAAGGTGTTTTGTTATTTCT
TAGTGTTGAGTGGCTCGTAGTGGACGAATCAGACAAACTGTTTGAAGATGGCAAAACTGG
GTTCAGAGACCAGCTGGCTTCCATTTTCCTGGCCTGCACATCCCACAAGGTCAGAAGAGC
TATGTTCAGTGCAACTTTTGCATATGATGTTGAACAATGGTGCAAACTCAATCTGGACAA
TGTCATTACTGTATCCATCGGAGCAAGGTACTTGTTCTTCCACATTATCCCACTGCTTTT
TTTCTTTAAATTCAATTCTGTTTGATTTGATTCAAGGTGATAGATTATTTGGCCTGAGAT
TAATAAAGGAGAGAATGTTACTGATAATCAAGATTGATGAGGGATTATTTGTTTTAAAAG
AATCTTACAGGACAGTCTCAAAGTATCATATTAGTGTTCCTATCATCATGCTTTTTAGAT
AATCTGGCCCATTCACAAAGTAGGGCATGTGGCGATCCAGAGGCGTTAACGTCATTAATG
GCTTAACCAGGACCACAGAGAAAAACTAACAACCCACTGACTTCCATTTGATTCTGACCT
GTGGTAACCCTACAGGACAGAGTAAAACTGCCCCGCAGGGTGTCCAAGGCTGTCAATCTT
TGCAGAACCAGACTGCCACATCTTTTCTTCCTCAGAGTGACCGGTGCGTTTGAGCTGCTG
ATCTTTTGGTTTAACAACAGTACCACCAGGGCTTGCTTAAATTAATGTTCAGTGATCGAG
AAATTGTTAAGGAAATTATGATATAGAGCAGGCGTCCTCAAACTACGGCCCATGGGCCAC
ATGCGGCCTGCAGAGGACATTAATCTGGCCCGCCGGGTGTTTTTGCCCCGTTTGTTTTTT
CACTTCAAAATAAGATATGTGCATAGGAATTTGTTCATAGTTTTTTTTAAAAACTATAGT
CCGGCCCTCCAACGGGTCTGAGGGACAGTGAACTGGCCCCTGTTTAAAAAGTTTGAGGAC
CCCTGATATAGAGCATTATGTAACTCGGGATGTGATCACTATGAAGGCTGTAGCTGAGTC
TCAAAGGAACCAATCGGTATGGTAAAGGATGCCCTTATTTATTTACAAATGCTTGTGTAT
GAAAGAAAGCAAAGCAGAGTCACCAAAAACATTATTTTTTTTTTATTAATCAATTTATTG
GGGCTCATACAATTCATCACAATACATAGATCAATTGTGTAAAGCACATCTATACATTTG
TTGCCTTCATCATTCCCAAAATTCTCTTGCCTCTTGGGTTCCCGGAATCCGCTCATTTTC
CTTTTTTTTTTTTCCCCCCCTCCCCTTCCCTTCCTCCTCCCCTTTCCCCCATGCACCCTT
AATAATTTATAAATTATTATTGTATCTTATATTACACTGTCCGGCGCCTCCCTTCACCCA
CCCCGCTGCTGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TCATTGCATTAGTCATTAATTTTAACTTTGGAAACTTTTTGGACATAAATAACTAGAAAC
ACGTGAATATTTATGACTAGAATATACCAGAATGTGAAAGTTTACTCTAAAATGGTAGGA
TTTGGGGCAAGTTATTATGTGATTTATATTTCTAAGGACTTTAAAGAAATGTTAGAGGTG
CCATATTAACTTTCATACTTTTGTGATTCAAATTAAAGTGTAATTACCTATGTATGTTAT
CATTGGACACATTGGATTCATTGAACTTTTACATACATTTTAAATTTATTTATATAGAGG
GGTGGGGTCAAAAAAATTGGCTCTGTAACCTAAGAGCTATTATGTTTTCTTTTCAGGAAT
TCTGCAGTAGAGACTGTAGAACAAGAACTCCTGTTTGTTGGGTCTGAGACTGGAAAACTT
CTGGCCATGAGGGAACTTGTTAAAAAGGTAAGTTTGAACAATCTTCTGGAACTTAGTAAG
TTCTGTGCTGGCCTGCTAACCACAAAGTTACATTTGAGCCAAGTTACGTGAGACGACTGG
ATGTTTTGGGAGAACACAGCCAGATTATTTTTAAGCAAAACGAATTAAGCAGTGGTGTGT
AAGATGAATTTTGATGAAAGAGACTGAAAGCAAGGGAACCAATTAATGGGCTGTTAAGTA
GACTGGGCAGAGCTGAAGAGAAGTAAACAAGGTGACAGCCTTGGTGGTGGTGGGATCAAC
AGTTGGAGAATGAAGGGGACAGGTGTTAGCAGGTATGTGGTGACTGCAGAAACCGTGAAC
TTTGGTGGTTTAAGGGCATGGATTCTGGAACCAGACCGTCTGGATTGGAACTCTAGCTCT
ACCACTTTGCTGTGGTGAATTTAGGTAGCTTATTTAACCTGTTCCGCAGTTCACTTGTAG
ATTGGATTACTCTGTCCCAGGATTGTTAGTAGTAATAATTGATTCTGTTCAAATACTGTC
CCAACAACAGTACCTGGCACACGGTAAATGCTGTGTAAATGTGTCTTATTCCTAAGGTTT
CCAAAAGGAATCAAGCTCGCCTGCAACCCTCGCAACCCCAGACTAGAACCGCCACTATGG
ATTTCCGAGGCGGTACATCTTAATTAATATTACGATCTTATTGAACGCAGTATAGTAAAG
ATTATAATTAAGAGAACTAAGAGCCAAATACTCAGCCCTGGGAAATAGCACAATTTGGAG
AAAGCATATTTTAAAATGACAATTGTTACTACATTTTAAGCAGAATCACAGAAGCTACGG
TATGATTCTTCAGGAAGTAGACATTCATTATTCAGATTAAAAATTAAAGAAGAGTTCACC
AAACAAGATTACTGGAATTAGCAAACTGGAGACGACCGTTCAAGTTCACTGGTAGAACAG
ATAGCCTTTGTAGAAAGCGGATAGTAAGAGAGCTGGTTTATGAAATTTGGCAGTGAAAAC
TGTGTCAAATTTGAATTGGTTCCTTCATGCATGAAACTGAAATACTGAGCGATTGTAGTC
TTGATTACGGGTTATGTGTGCTGATTTTTGCCTTCTTTTTTTCAGGGTTTCAATCCACCT
GTTCTTGTTTTTGTTCAGTCCATTGAAAGGGCTAAAGAACTTTTCCACGAGCTCATATAT
GAAGGTATTAATGTGGATGTTATTCATGCAGAGAGGACGCAGCAACAGGTGAGGCAAACA
TCCTTTCACCACTGTAGAGAACTTCTCCATTTACAAACATTGGCAATTAAATATATGAAA
GACTTTCTTCCCAGAGTGGTACTAAAGCATGTAATACATCTTCTGTTAATCAGAGAGATA
ACACCGTCCACAGCTTCAGAGCAGGAAAAATCTGGGTTCTTATTTGTACAGCCCTATTGG
CAAGAGGGATTGATTTTAAAGGTGTGAACTTGGTGATCAATTACGACTTTCCAACCAGCT
CAGTGGAATATATCCACAGGATAGGTAAGTTGGCTTTTATTTTCCCTCTGCCTCCATTAG
TATTTCTTCTGTCCCCTTCAACTTACTTTGAAAACCCAGTTGCTTTTATATGTGCTTATG
AGGGTCCTTTCCCACCCAGATATGTTTTTATGATCTGATATCTTTTAGGTCGAACTGGAA
GAGCAGGACATAAAGGAAAAGCTGTTACTTTTTTCACTGAAGATGATAAACCATTATTAA
GAAGGTAAATTGGGAAAAATAACTTGGAATTAAGTTGGCAAAATTGCTTTATTCTGTAAT
GTACATTCAGCTAACAAGTAATTTCATCAATTCCAAAATGACAGTGTCCACCCACTTCTC
CGCAGAGAGGAGGCTGTATGTAGATCCTTGTCATCAGTTCCCCATTTCTACCCCACCCTC
CCTCCAACCTCTGGGCCCACCACACCCTCCCTCCACCCTCCACGTATCACCACTTTGACG
CTGGTCCTAAAGGGATCCTGGATTCCCTGTGTTTCCAGTTCTTATCTGCACCAGTGTACA
TCCTCTGGCAACTTTCTCTTTTTTGCTGACCTTCTACTTTACCAAGTATGATGCCCTCCT
CCAGGGACTGATCCACCTGAAACCCATCCAAAGTGCATGGCAAAGTCTTGCCACCCTTGC
TTCTACGTAGCATTTGGTTGTACTTCTTCCAAGACAGATTAGTTTGTTCTTCTAGCAGCC
CATGGTCCTTTCAATACTCCATTCTTCAATCTTCCTTATTCATTGTCCATCTTTTGGATC
CATGGAAGCAGAATTAAAATACCGTGGTTTGGGTCAGGCACACCTTCATCCTCAAAGCGA
CACCTTTGCTCGCTCGGTCAATTCTAGCTTTGTTATATTATTTAGGAGTGATCTAGGGGA
ATCTGAGATCAGTAGCTTTGTTTGGCATCTAAGAGAGTAGAGACAGTAAGAGGAGAAAGA
GCTTATTCCTTTCCTCTGGCTCTGTTCTTTAACAGTTGGCTATAAAGAACACACAATCAC
TGGAAAGGTTTATGCACTTTCTGAAACGGATTTTTTTAAACACTAAAATATTTGTTTGCT
TTGTATATGTTATTGTGAGCTAGCAAATCCAGTTCTGCATATTGCTACCAATTTAAATAA
ATATTTGTTTTTAAAAAAATGACAGCGTCCCAGAATTCTTTTATAATACTGCCTGCTAAG
GAAAGGAAGACCGATGAGAAGGCCTTGTGTTTGCCTTTCTGTTATTAAAATGGGAAATAT
TCATAATGGACTATTAATAGTTTGTTTAACACACAGTTCTCCTAATAGCCATCATTTGAT
ATTCCTCATAATACTGTATCCAGGTTTTTGAATAAGTAAGTTTGATGTTGGCCACCTAGA
TCAGTTTACCTCAGTCAACTGTATCTTACGGTGTATGCGTCCCATTCTCTCAGTAATCCA
GTCTGAGCATGCCTGGTAAGAACTGGTAATATCACAGAGCACGCACCCTTCAGGTAGTTT
TCATTTTCTTAAACTGTGCAGAGGGTTTCAGTGCATACACATCAGTTTGACATGATAAAA
ATGTATGTTTGGTTTTTGTTTTGTGTCCTCAGTGTTGCCAATGTTATACAACAAGCTGGA
TGTCCTGTGCCGGAGTACATAATGAGTTTTAAAAAACTACTAAGGTACCACCTTGAATTG
ACCTGGAGCTGCTCTCTCTCTCATGCTCACTCTCTGCACACACCTTCTCGCTTCGCGTTC
CCTTACACATTGTAGTTCTAACAGTCATATTACGATTTGAGCATTTTAAGAAAAAAAAAT
TTGCTTTTAGGTGTTTGTGAATGCTGTATGCTTTGTTTTTTCCATCTTTGAAACTTAAGT
TGTTCTGATTTTTTTAAAGTTACTTAGTGTGAATAAGATAGGCTTAGAATTTGTTTTATA
ACTTCATGCATAAATATAATGGTAAAAAGCAGGTCCAGACTCAAACTGTAGTGCTTATTG
ATTGGCATGGGTGTATCTTAATCAGAATCTGTGGGGGGTTTGTTTTAATTTGAATTGATG
GTATTTATCCTCCCTTTTGCTTAGTTCTAATAGGTAGTCTCTTATATGAAAATGGACATG
TTCCCTAGTGAAAACATGTGCATTGTTTAAAAATGAGTTTTACAATTAAGAATTTTTAAA
AATTAACAATCAAGTAGTTTTAGTTTTAGCTCTTCTAAATTAAGTTGAACTTAATTTCTT
TTCTCTCATTCTGTTACTTTTAGCAAACAAAAGAAAAAGATGGTCAAGAAACCACTGGAG
AGGGAGAGCATTAGTACAACTCCAAAATATTTCTTAGAAAAAGCCAAGAGTAAACGGTAA
GCAGATGGGGCGGAACAGTTGCCGCTTGACTCCATCTTACGGTTATGGTAGGCATTGTTT
TCCTTCGGGTGACTTCACAAGTGGATGGAGAGCTCTGCAGTGCCTTCTAGAATGTGATAC
AAGGAGTATATCTGATTGCCTTTGGGGAATTCTTCTGTTTCTGTGTACTAATGATCTAGT
TCTTCCATCTTTGGAAAGATGGTGTAGAGTTGATAGTGCCCACCATCTTCACCCGCCTGC
ACCAGGGGTGCCTGAGGCCAGTACTTACAACGGTTGACTTGCATTGAGGAGCGCTCATGA
AGCTCCGTATTCTGGGCAGTTTCAGGATGATTTCAGCCTGATGCTGAAGCAGGTTGTAGC
CACCTCGAAAGAGTATTGCTTTGTAGTAGCTTAACTGAATTGTAGGAGAATGTTAAGACA
TTGATTTTTAGCATGCACAAAAGACTACCTTTTTACCCATTACTGCTAGGAAGTAGGTTA
ATAAGAGCAAGAGTAGGTTAAAATACCCCGAACAGCTGTCTGCTAGCCCAGTGGTTCTCA
ACCTTCCTCATGCCGCGACCCTTCAATACAGTTCCTCATGTTGTGGTGACCCCCGACCAT
AATATGATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGAGAGGGTG
GTCTAGGGGTTGGTCTCTGGGTCTGCATAGGAACCATTATCAGTAGGGTGAAAACTCCTC
CTACAGGAAGGAGCCTGTCCATTGTACCCAGAGGCAGGGAGCAGGCCCACCCCTGTGGTG
GGATGAGACAGCAGTCTGGCAACTGATTGCCCTCAGTGGAGGGAATGCCTTTGCATCTTA
CCTCCTCCCACATAGTAGTATCAGATAACACAAGCTCTGAATGAATTGCTTGGTTATAAT
GATTTCTATGTTGTATAGTGGGGTTCTTGAGAGTATCATCAATGACCTTTTACTGTATAT
AAAAGTTGATGCTTCTTTTTGCTACCTGAAATCTGTTCTGTGGGAATCATTAGAAAAACT
GTTCTCATCACCAAGTAGGCATTTACTGAATACCTATGATCTCGCCAGGTGCTTGGGAAT
ACAAGGAGGTTTAAAATGGGGCTCCTTCCCTAATATTACAAAAAGGAGATTAGTGTACTT
GAAATAGAATGATTTTAAAATAAAATACAAGTTAAGAGAAGGGCAAAGATAAATGTGAAT
CGGTGTAGTCCAGAGGGCTTCAAGGAGGCAGAACGTGAAACCAAGAAGTCAGGCATGCAG
TGGAACCCGAACAAACACAAGCAAGAAAACTCACATCAGCTTTTTTTTTAAAGTGGAACT
TGAGTCTTAACGACATTTTTTAAAGGCTGTGGGGAGTAAGGAGCCCTTGTGGCACTGTCT
GGTAGGTACTGTGCAGTTAACATTGGACTGCTCTCTGCAAGTTGGCAGTTCAAAACTACC
AGCTTATCTTCAAGAAAATAATGAAGCTGTCTGCTCCCCAAAAGATTTGTAGCTTCAAAT
ACCCAATAATATGTGTCACTCTGACTCAGAGTCAACTCAGTGGTAGTGGATATATTGATG
GGAAATAAAGTTCAGTTGGAAGTAGAGTGTCCCAAAGTAGTATAATTTTAAACTTTAATA
ACTTGGGAAAAGTAAATACAACAAATAAAAAGAAAGCCCTTATGAAATATAAAATTTATA
AGATAATCATTTTCATGTCAGTGGTACTCTTCTGTTCCCTCCACCTGACTGCCTTCCAGT
TGATTATGAGTCACAGGGACCCCTGGGACAGGGGAGAACTGCCCCTGTGGGGGTCCCAGA
CTCATTGTTGGCAGGAGGAAAAGTCCCATCTTTCTCCAGAGGGGCTGCTGGTGTTCCAGA
CTACTGACTTTGCCATTAGCAGCTCAACTTGCGACCACTCCGTCACTTTCCCTTTTCTGT
TTAGTGCCTCCTTAATAAATTTTTTATTCAAATATTTTGTGGCAATAATTTCTGGGTGTC
AGTGGATTGACAAAATAGGTTATCTTACTTGACCAGTTTGATCACCTAAACCATCTCAAT
AGACTTTTCTGTTGGGGAGTGGGGAATAGAGGGGGTCACCTGAGAAACCATTATGAATGA
ATCAGACCCTCCTACAGATGATCTCAAGTTTAGGCTTATAAATGCATTTCTTCCAAGTGT
GTTCAATGGGCTGGTAAACTTTTTTAGAGGCAATTAATAAGAGCATAAGATGATAGCTAT
ATTGATTTTTAATAAAACATGCCAATTTTCATATTTGAAAGAATAAAACTTTAAATATTG
CTTTTTCTAAGTTTATAGCACTTCTGTGGATGTTACAGCTGCACTGGCTTTAGGACGCTT
GTTTAAAATCCTGTCACATCAAGCCTTCTGTCTTTCCATTCGTATATTTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTCAGAAGGCCCTCCATGACCACCAGCTCAGCTCACTCCTGC
TGATCCTGTATTTTCTTAAACCTGTTTTTCCCTTTTCCCTGGGTTACCCCTTAGTTAATG
ACATTCACCATTACTGAATCTAGAAATCTCAGCAATCATATTTCGTTATTTGCCTGCTGT
GCAACCAGCTTTGACAACTTCTAATCATTTTACTCTGCAAATACTCCCATGTATTTCATA
TTCTGAAGACTGCATTGGCTGTAGAATCCAACTCCCAGCATTATCATCTGGGATCATTTG
GATAATAAGTTGTGAAGATTACTGAAGTTAATATATGTAAAGTGCTATAGCATGTCTAGC
ACTTAATAAGCACTCAATGTTAACTTGTATGATCAGAAGTTTGCTTTCATACCATCTAAT
AGTGTAGTTTGTTGAACTCTTTGTATCTCACTTAGGTGATTGTGTGTTCCTTAAAGGCAG
AGACCAGATCTTCGTGTCCCTAGTCTCATCTATTTGATATACAGTAGGTCTCAGTAAATG
TTAGACTTGTAAACTTTTTGGCAAGTACATATATCTAGAATTTCTGATTCGTCATTGCTT
ACATTCTTTTTTTTACAGGAAAAAAGCCTCTGGTCAAAACAGCAAGAAGAAAGTAGCTCT
TGAAGACAAAATTTAAAAACAGAATTTATAATAGACTGTCCCCAAGATACAATTTTATCA
TCCCAGTGTGAATGTTGTCATCACAGAGTAAAGTCATAAAATCACATGTATCAAACATTT
GAAATCAACTGCAAGTCCATAGGAGTGGTGGAAAATGATTTCTGATTCTACTATCAATGT
GACAAGTCAAGTTTCAGTTTATAGGTGACTTTTAAATAATTGTGCCATGGAAATAAGTCA
CTTGACTTTCTGGGGTTGAATCCAAAGAAATACTTCTTATAGAAGACCAAAAGTGTGTTA
TTAACACTCTATGTGTTGAACTCTTAAGGATCTTCCCCTTCAATTATGAAGGAAGGTGTG
AAGTGCTATGAAGAGGCATCTGGAACAGAATCTCAAAGGATTGCATTCAGCCTCCCTTTT
TTCTGATGCACAATAAGCAACGATTTGTCTGCCAAGAAAAAACCCACAGTTCTCTCTCTG
TTCTATTACTTGATTTGTGATGACTTTTTGTGGAATGAGCCACAGCAGAGAGATTCCTCA
TCTGTGACTGGTTATTCAAGTTCCATGGGATTTTTGATTCTTCGGTCCATTAAATAGCCT
TAAAAGCCACCTTGGTAAGGTAGATCATACTTTACCTAATATAATGTTGCAAGTACAAGA
TTATGGTCAGCCTGTCATTTTCCTACTTCATTTTCCATGATTTAACCAAGCTCTTTCCTG
TCTTTTTCCATGCAAGATCGTTTTGGTAGGAAACTGATAAACATTTTATCAAGATAAGAA
GACTGTTCCTGTTACTTGATGCCTCCGAGTTCATTTTCTCAAAGCTTATCTTTACTGAGG
CTTTATGGCCCTTCCCCATGTAGTAAACAGATCTCGGCCAGAGGCACGGATTCTGATTAT
CCTGTGATAGAAAAGATCCACTGCTAGTAGAAAGGCTTTTGCTATGGCTAATTTTGTATC
GTGGAACAAGAACATTAATTTTATACCTGTTCCATACTTAAAGTGGTGCTTGACAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1066, 2559..2748, 4018..4148, 5507..5515, 5518..5562, 5565..5601, 5603..5615, 5700..5716, 5719..5732, 5734..5739, 5745..5765, 7761..7904, 8861..8972, 9517..9589, 10359..10562, 13052..13142, 14241..14363, 14489..14639, 14784..14859, 16208..16279, 16859..16951, 20694..20751
1001..1066, 2559..2748, 4018..4148, 5507..5515, 5518..5562, 5565..5601, 5603..5615, 5700..5716, 5719..5732, 5734..5739, 5745..5765, 7761..7904, 8861..8972, 9517..9589, 10359..10562, 13052..13142, 14241..14363, 14489..14639, 14784..14859, 16208..16279, 16859..16951, 20694..20748
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved