Echinops_telfairi Locus SRD5A1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SRD5A1
Echinops_telfairi
SRD5A1
GeneScaffold_4683
SNORA33
17308..17441
19571
ACCTGGCCTCAAGACTCAGTCTTCCCCCCGATAGCCCGCCTCGGGATCCCCCAAGGGTC
AGCCCCAAAGGCCTTCGTCCCCGGACTCGCGGCCCGCCTTTTCCCCAGATGGACGCCCGC
CCTTTAGGGCCCTTCCCTTTACCCTTTAGGCCCGCCCCCCCAACATTTCGGCCGCATTTT
AGGGTCCACGACCGGTTCCCAAACCCCTCCCTCTAACACTCGGCCTCTACTCGAGACCGA
GTTTCCGCCCCTGAGCCCTTGGCCGCTTCGAGACTCCGAGGATGCAGCGCTATCCACTTA
GCCCCGCCCCCATGGAGCGACACCCGGGCCCCGCCCTCTATTCAATCAGCCCCGCCCCCT
CGCTCTTTGCTTTTCCGAACCCGCGATCCCGCTTTAGAAGGCCCTCACAGAGGTGGATTG
ACACGTGGCTGCAAAAATAGGCTGAAGCATAGGAACAATCGTGAAGATGGCGCAGGGCCC
GGTGGTGTTGCATTCTTTTTTTTTTTTGATGATTCCATCAATTTCTTTTTTTTTTTTTTA
ATCAATTTATTGGGGCTCATACAATTCATCACAATACATAGATCAATTGTGTAAAGCACA
TCTATACATTTGTTGGGTGTTGCATTCTTTACAGATTCGACGGTATCTAACAACAGCCTA
GACTCTGACCCCGAGCTGCTACTTGGGTTCCCAAGCCCCGCTCCGCCGCCGCCTCACCCC
GTCCGACCCCGAGGCCCCGCCTCGAAAGTTCCCCTCCCCACACCGTGGCTGCCTTTCTGA
GCCTGAGACCTCGCCCACCAGTCCTTCAGCCCCGCCCCCAGCACCTTCGCCGGCCCTGGC
TCGCACTTCCTGGTCCAACGGGTGGGGCCGGGCTCTGTGGGCGGGGCCTCAGGGGTGTGT
CCTCCAGCCCACGCGGAGGCCGGGCCGCGCCCCCGCCCGCCTGCACCTGCCTGGGGCTGG
CAGCGACAGCGTCGTTATATGAACCGTGGTAGGGCATGGAGTTGGTTCTCAGCTATGCAG
CTCGGCGAGCCGCAACTGCTGGACGCGCTGGGCGTCCTGCTGGGCGTCTCTGCCTGCTTT
ACCTTCGTGATACTGCAGAAGTTGGAAACATCTTATGGCCGCTACTGGTCACCGAGAATC
CGCTGGTGGCTGCCCGCGCGGCTAGCCTGGGGGCTGCAGGAGATGCCCTCGCTGCTGCTG
CCGCTGCTAGAGTGGGTCCGGTTCGGAGACCAGCTGCGCCCGCCCAACGCCCTGCTGATG
GCCATGTTCACCATCCACTACACGCAACGGTAAAGGCCGCCCGGACCCAACACCCAGCTC
CCTGCCCATCAGGGCTCCAGCTGGCCCCTGATCACCTGCCCACCTCTGCTCGGCAACCAG
CAGGCCCCAGATCACGGTCGCACAGACCCCCACACCCTAGTACTGCACTTGCGACCCAGC
ACTCCACGACTGCACTGGGTTCTGTGCCTTGAAGTGCANNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNACTCTGGTTTAATGCCCTGCACCACTTTTCATGCCTTACCAG
CCAAAGGCACCTGCACCCTTACCCACACCACCTTCACTGCCCTGCTCCATCCCCACAGCC
CCATAACCCCTTCCCTGTTTCTGAGACCCCCAGTTTCCCCTCCTGTCCCCTGTCCCTCTG
AAACCCTTCCCTGCAGTTTCCCTAGACTACTCCCATCCCATACCCTCTTCCAATGCATGT
CCTTCACCCGCCAGCCCCACCCTCTTGTCCTCTCTGAGCCTGTCTGTCCCCCTTTGAGGG
TCCCCTGTGGTCTCTCCTGTAGCCCCTGGCATACCAGAGCTAAGGGGTGGGGGGTGATAG
TTTGATGCTTCCAAAATGTCTGCCATTATTGCCTCCTGCACCCCAATCCTCCCCCTCCTC
ACGCGCTTGCCCCAGACTAGAACTCGCCCCTGGGGTCTCCTGAGGCTGTCATCCTCAGGT
GCATATGGGCCCCAGGCCCCTGGGTGGCAGTGAGTTTGGTGTTTGGGGTTCCATCTCTGG
GGAGCAGGTGGCCGGGTGTCTGCTCCCATGAGGGAGAAACCCTTGGGTCAGCAGCCCAGC
GCTGACCTGCCACAGCACTACGGCTCCTCTGGGTAGAACTGAATGACACACAAGTTATGT
TGCCTTTTCTTTAAATCCACGGTGGACAGAGTGTCCCTACAATGGGCCCGAGGTCGCTCC
GCTGTCCTGGGCTGTATCTTTACCTTAAAATCCAGTTATCTTACTTGGGTCTGTGGCGTC
TTTCCACATAACCTGATGATCCAGTTCTGACTGGCAGCTGCCCGCTGGACAGCTTTTTTT
GCATGTGTGCTTGGGGTGGAGGGTGGGGATGGTGTTTCTTCAGCGAAACCTGAAACCCTG
ATGTTGCTAAGCAGCCTTCCTGTGGTCTCCATGAAGGTCTTGAGAAATGGCTTTGGGGGC
TTCCACTGCCCGGAACCCCAGGTCAGGGCCCCCGCTCTGTCACAGGGACAACAGATGGCT
TGACAATGTGCCTGAGGACTGGAATCCTGAGCCCCTGGGCTGGGGAAGGCTACGGTCACA
GCGGGAGCCCCCAATCCTTCCTGAGTCTCCCACCTGGACATGGCCTCCATCAAGTTCCTG
CTGACCAATGCTGAGTGGGGTTGCTGGCACTCACCCTGCCAGCCAGCCCCTCAGGGAGCT
TGTGAGGTGTGCCCTTGATGAATTCAGGACACCGGCTGGCATGGTCATGAGGGATGCCAG
ATGGCCAGAGGGCTTCAGGACCAATCCTGTCACCCTTTCTAGTCTGCAGTCGTGCGCACA
CCCGGACTGCAGTCCCTTCCCGTTCCCATGGTGCCACCAATGCTTGCTGCCTTTCCTGAT
TCTCTGGCAGTTTTCTGAGGTAGCCGCAGGGCTGTGAGACCCTTGAACACCATTTTGGCC
TCAAGCTGATAGGCTCCCTCATCTGGATGGTTCTGTCTTGTCTTTGTCCTGTGAAGACTT
GGTGAAGGGCATCTCTGTAAGATGTTTGAATTTGGGTAGCATCATGAGTTACGTATGCAT
GGGGCTGCTAAGGCAACGTCAGCAGGTTAAAAGCACCAGCTGCCCCAGGGGGGACAAGCT
AGGTTTTCTGCTCCAGTGAAGAGTTGCCGTCTCAGAAACCCTCAAGGACAGTTCTACCCA
ATCCAACAGTCACTGTGAATCGGAATCAACTTGGTGGCAGTGAGTTTGGTTTAAGAACAA
AAGTCACCCATTAGAAGTTCAAGCCCTTTGATCAAGTTCCCAACAGCTAGCACGTAGGAG
AGGCATTTCTACACGTCCCAGGATCTAGGTGGGTTGCCTAACATGCTCAGTGATGCATGT
GTGTGTGTTACTTAACCTCTTTGATCATGCCCCTTCAAACACTTGCTTCACAGACAGGTG
GGAAGAATTGTGTGTGTTTGTGGTCTGATGGTCCAGTGGGGAGACGGCCCCTCAAGGACA
GGTTGTATCTCTGGTGTCCCGAGCACTGCCTGAGACAGGTAGCATTCTCTGTGCTGTGCT
GGGACCCCAGGCTGGACCGGGCTCTATCTGTAATCCACCCAACCCCACACATACACATAC
CGTACATAGATCACCACACACACCTTTACACGGGAGATTGATGGAGTGCCAAGTCTCACA
CTCCACAAACGTGCTCCCAGAGGAAGGAGTTGCCATCAGCCTCGCAGAACCCAGCTCAAG
GGCCTGCCTGGCACGTTGTGGTTGACTGACTAATCGATCAACGGACTATCAGTCCTGCGC
CCTCCCTATGCCAGAGCCCCTGTCTGTCAGTCTATTTGTGTATCTGTCTATCTCTCTAGC
TAGCTAAAAGCAAGCTCTGGAGATAGACCCTGAAGCTCTTCCAGCCCCAGCCCAAACCCT
CGTGCGGTGGGGTGGGGAGGGTCTGGGCTACTAAGCTGCCTCCCACCAAAGTTTTCACGC
TGGGAGAATTGGCAGAAGGCTGGAGCTGCCAATGGGGCCAGCGTGGGCATTGAATGAGCA
GAGTCCTAAGATGTTGGTGCCCTGCAGGGGCTCAGGCCCAACCCCTGGGAAGGTGCGGCC
CGCTGATGGACTTAGAACCCCAAACCAAGCCCATGCCCAGTGAGCTCCTCTGACTCATAG
CGAACCTCACCTAGTGGCCTTCATTCCTTGCTCCGAGAGAGTTGGCCGTTTGCACTGTTG
TGTTTGAGCCAGGGCACCGAGCCAGTGGCGTGACTGGGGAGCATGGGTGGGTGGGGGCAC
ATCCATCGCCCTGTCCAAGGATGATTCTGAGATAGCGCTGGCCATGCCCCATCCAGAAGG
CCCACCGTGGGTGGCACCAGCCCTAGGGACGCTGCTGCAGGAAAGAGAAACTGTTTCCAT
TCTACCCAAGCCACTGATTTATTAAAGAGTCATCCGACCCGCAGCAGTAAGTGCCTCTGT
GCTCCCCGTGGGTGGGCCAGCTGGCCAGCAGTACGGGCAGGGCTCCTGCAGCAGCACCAG
AGAGCGACTCCCCGAGGTGGCAGGTAGCCCCCAAGGTGGGAGCAGAGCATGCAGTTTGGG
CCAGGGAAGGCAGCCGTGCCTGCAGCTCTTGGAGCCTCCGGGGGCCACAGCCAGATGGAG
GGGGTGCCAGCAGGGTGGGATAAGGACGGAGCAAGAACACCGTGCTTGTTCTCCTGAAAG
TGTGGCAGGGATGGGAGCAATACGGGGTGGGTGTGGTGTCTGTGTGCCAGTCTGGCAAAA
GGTGTGTCTGTGTGCTCAGTAGGCGGCACTGAGGACATGCCCCATACTTTTTGGACTGTG
GGCAAGGAAGACGGGTGTGCAGGGGTGGAGGCAAGCCCTGGAGAGGTGCTGGGGCTGAGG
GGGTGGGAAGGGGGCAGACGGAGAGGCTTGGGTCCTCTTTAACTCAGGAAGAACTTCCAG
GGACTTGTTTGTTTGAGCAAGGGCGAGGGGCCTTCTCCATCCTTGACCCTGGCTGGGACC
CTGCACCTTCATCACTGCCTTCCACACCCCTCCACCGGTCCCCCCACCCACCCGAGTGTT
TACTGCTCTCCCACTCCACTGCCCTCCTGGACACCCAGGCTGGCACCGGTCACCAGGACT
CCCCTGTGTTTACCTTGGGGTGGCAGCTGCTCCCTGGGCACATTGTCAGCAGCTTAAAAC
CACCAGCCGCTCCAAGGGAGAAAGATGAGGCCCACTACCCCAGTCAAGAGTGACAGTCCC
TGACAGTGGCTGTGAGTCAACCAACTCCATGGCAGTGAGTGTTTTTTTGCAGCTAAACCC
ATGGCCTGCGAGTTGACCGCTGTTAAAAATGAAGCCATCTATTTTGTTGTTGTTGTAAGT
CTTCCTTGGGAACAAAGTGGGAGTTGGTACACATCCACACCACTCACATGCATGTGACTC
AGCTCCCCCTGCACTCCCTCCTGGGACCATCACAACCCGCTTCCTCCCTGTGCTTTCTGA
CACCCCCCCACCCCCCACCCCCACCTTCTCTCCAGGCTGGCCACTCTAGACTGGAGGGTG
ACAGAGGGCCCTGGTCTATAGGACCCACTTGTCTTATCGGACTTGTCCGCCTGGTCTCTT
GGATGACCCTGAGCTCTGTGCCCCCGTCTCCATTTCTGTCCCCATCTGGGACCTTCTGGG
CGGTCCTTTCTCGAGCAAGCGGTTAGTGGTGGTGGCTGGGCACCATCTGGTGCTTCTGCT
CTCGGGGTGTGGGGATGACGGTGGGGGGGGGGGCGGGCAATGGCCCATTGGCCTCGTTGT
TTCCCTGTGTCTTTTGATTCTGGTCACCCTTATGTCCCCTCAACAGGGCGAGTGGAGGCC
AGTGGTCGCCAAAGCAGCAGTTTTTATTGAAGGAAGATGAAGCACTAGAAGCCTGCGCCC
ACGCTCATTCGAGCGGCGTATTTTGTGAGGACTCTCGATAAAAGTACCCCAATGAGAGGG
AATTTCTCAGCAAGTAGTACAGGAATCCCAGGAATGGACAAGGGAAGGGTTACTGCGTGG
TTTACAAAATCGCGATTTCAACCGCTCCAGGAGCCTAGAAACGCTATTTTCTTGGTGGCT
ACGTCAATTCCAGCGCCATAAATCGGTGGCTGTTCCCGGGGCCAGTCTGAGTGGAGGCGA
TCCCTGGGGTCCCTGTGAGAGAGGGGTGTGTGTGGGGGAGCCCCCAGGCTTTCTGAGCTG
CACTGGCTCCGGACAAGCAGCAAACAGCCCAAACGGCGTCCAGCCTGAATTGGGGGCTGC
AGCCCTTCCCTCTGCCAGGTGCATTATATTTAAGGGCTAATTTTTTTCAGTCTTCAGTGT
TTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTTTGATAATAAGGTG
GACTGACCCATGTATTTCTCATACCTCCCATGTAAATCATGGTGCTGGAGAAGAACATGG
AAAGTACCGTGGACTACTAAACGTTCAGACCCATCTGTGTTGGAGGAAGTGCACTCAGAG
TGCTTGTTAAGAGGCCAAGAAGGTGAGGCTTTGTCTCACGTCCTTTGGACATGTTGACGG
GAGAGACCAGTCCCTGGAGGAGGACATCGTGCGTGGTAAAGTGGAAGGGCGGCGACAAAG
AGGAAGGTCCTGAAGGAGTGGAGAAGGACACAGTGGCTGCGACAGTAGGCTCAGCATTAG
AAAAACCGTGAGCCTGGCAAAGGCCGGGCAGTGTTTTCATCTGCTGTGCGTACAGTCAGT
ATGGCACCTATAGGGGTTACACAGATTCATGTCAACTTGATATATAGAAGTGGAAGGGTG
GAGTCTAGCCTGTCAATCAGGTCACAACCTGGTAGTGCCTCCTTGTGGGCATGGCCTTCT
CATAAGGAGGGCCCTGGGAACCTCCCTGCCCACTTTGCTGTCACCTTGTTAATGAGTCAC
GCAGGGACCTGCCAGAGCCCTGGAGATGCATCCACCTCCATTGGATCCACAAGACTTTGC
ACCCACTGGCCTGTGATTTTCCTGCATTCAGCATCACTTCTTGTGACTGCGTGAGTCTGA
AGTAGGACTTGTGGACTTGAGTTGGACTGGGCTGGGATGTTTTCTTGATATGCAATTACT
TCCTGATAGAAAGCTCTTTCTGACGCAGAGATGAATGTCGCTGGGTTTATTTCTCTCATC
ACCACAGCCTCACACAGCCCCCAACAGCAACAGCATGTGATTGGAAAAGCTGAACAGTGA
AAAAAGACCAGAGGATCAATGCATTTGTATGGCAGTGTTGACAATGTTCATTGAGCAGAC
TATGGACTTGCAGGAGGACCAAAAATTCAGTCTGAAGAAATAGATCCAGAATGCTCCTTA
GAGGCAAGGACAGAAAGATGTTGACTTTCTTCCTTTGAACATGTCATTTGGAAAAGACCA
ATCTCTAGAAAAGGACATCATGGCCGGGGGCCAGTGAAAACAAGGGAGACCCTCCCCCGT
GAGATGGACGGCACAGTCACCTCAACAGTGGTGAGCTCTTGGTCCGCGGAGCTCTCGGTC
CGCACCACTGCCCACTGCAGCGTCTGGGACTTGTTCTTCTTTCTCCAGCTTGGAAGCCCT
TCAGCTATCGGGCGTCTTGTCCTGCCTGCAGGTCATCGTCATCAGAGGCGCCCAGGGAGT
AAGATAGGCTGACTGTGTCCCCCAAGATCTTGTGGCCAAGGGGCCAATCCAAACCATTGG
AGATGTCCCCCTGGCCAGAGCACTTCTCCACAGGGTGGTCAGGAAGGAGGGAGGACAGGG
ACTCCTGGGGCTGTTTCCTCAGCCATGGTTCCTGGCAAGTACTGCAGTTGTTGGTCAACT
CTCTGTGTACCATGTTGTTGACTGTTAACTGCTCATCCCACTTCAAAGCTCAGAAGTCCA
TTCCAACAGGGGCAACGTCCTCAATAGAAGGTGTCGTCAGAGCCAGACTCTTGGTGACCG
GTGCAGGTGGGGGGGCCTCAGCACAAGGGGTCTTCTTTTACCTGGATCCACAAGCAACAT
CCGGGGTAATACTATCTTTCATAAGCATTCATACCAAACGAGCCCCAAGGAGTTGGAAAC
AGAGTCCAGAGTCCAACTCCTGAGTCCAGGAGTCCAGACGACAGCCAGCTCCCCTCTTCC
TGCAATCCCGTCCCTCACCTCTTGGGCTTCTGCGGCCACCTCGGCCGCCCACAGAACTCA
CGAAAGTTTGAGGGAAAGTCTCGCAAGGTGGTGGGCCCAGTTCAGTCCAAAGAAGGTCAG
GCAGGGGCAAACCAGATGCTCTGGCCAGAGGGTGCACTCTGCCCCTGGCTCTTCCTGCTT
CCCAGAGGGCTCCTAGCACACACAGCAGGATGGCAATGCAGGGATGCCTGTTTGCCACAA
TTCACAGGTGAGCCCTTATCGCTATCTTTCCTCCACCTTCTTGCCAGACCCTTCCAGGGA
AAGGCCTTGGTGGGAGCCAGATGAGGGAACTCACTGCTCCTNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGTGCCAGCAGGAAGGCTCCATCCATGTTGTGAAGCCCG
CCCCCATTTCCCCCGCGTCTCACCTCCCACAGGACCATGATTTTCCCCCTGCTGATCCGA
GGCGGCAAGCCCACGCCGCTGTCCACCTTCCTGATGGCTTTCCTGTTCTGCACCCACAAC
GGCTACCTGCAGAGCAGGTACCTGAGCCTCACCAAGTATCCTGACCACTGGACCACCCAG
CCCCACTTTCTGGCAGGTGAGTGGAGACACTGGGGATCCCGGGCACCCTCATCGTCTCTC
TGAGTTTGGGAAGAAAGCCCAGGTCCTGGCATCCAAAAGCTGCAGGGGTGAGGGAGGTGG
GGCGGCAGCAGCAGTACTTGTCACGGGCGGTCCAACTGTCCCCAGGGGGCCCAGACACAG
GGAGATCGGCCATGAGTTACTTGTTTGCCATCCCCTAAAACTCACTGCCATCAGAGTCAG
ACTCACCCCAGAGCCGGCCCGGAGCGTCTCAAACAAGGATGTGCACCTAGACAGGCTCAG
CCAGCCTCGCCTCTCTCTGGCAGGGCCGCTGAGCGCATCACCACGGTGCTGTTGTGACTC
CTGCCCGGTAACGTGATGAGCATAAGTGTGTACTTAACCACATAAAAAGTGTGTACCATG
TCACGTAAAAAGCATGTTTGCTGCATCCAGCTATGTGGACTCCTCATGACCCTCCAGGCT
GGAGCAGAGCCTGCCCAGCACGGTCACCACAGCTGGAAACCTGCAGAGGCAAGGATGGTG
AGACTTCTTGCATACCTGGGACCCGTGGCTTGGGTCAGGCGCACCTCAGTTCTCAAAAGG
ACATCCTTGCTTCCCAAACCCTTGAGAGAGGTCCTGTGTAGCACACGTACCAAGTGCCAT
GCGCATCACCTGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTCG
TTGCGTCTTCTGTTCCCACCCCACCCCCACCCCCACACGCACAGAGTCCCAATCCTCAGG
TATTAAGAGCTAGCCGTACAGAAGTGCAGCTCATTATACTGGAACCGGACACCTTGATAC
TCCAAAGAACTAAGCCACAAAAAAAAAAAAAGTAAAAATCTAACAGAAAGCTTCCCATAC
CAACTGAAATGATTCATCTTAAGGATTTTCTGCAAAGCTCTTAAGGGTCATACAAATGGA
ATTCATTCAGCATTTGACGGAGGGAAGCAGAAATACTTGTTTTTGTTTTTTTCTTACTGG
CTTAAACAACACAGGGACCGTGTCTCCCAGGAGGGAGAGAAGGTGAGTGTGGCATTCCGG
GGATGTGGTTGTCTCTCTGGCTGCACACACGGGAAGTCTTATAGACTGAGCTCACAGGCA
GATTCCACACCTAGCCCCCTGCAGGTACAGGGAGTGCATGGGAATTTGGGGGGAGGGGGG
CGTGGCGGGTTGGTAAGGTCTCTTGCAAAGCCTTGCTGAGGCTGTCCTGGCCCTAACAGC
TGCTTCCAACAGTGAAATCAGAAGGCAGAAACCTTCAAACCCTTCCTGTAGACCAGAAGG
CTCTCGGCGTCTGAGTTCTTCCCTAAGAAACATCACTTAATGCCTCCGAGATGGCTGGGG
AAGCATTAATAATGTCATCCAAGATGCACGTCTCTTTGACGTGAACTGACCATGCGGGTG
AACACACCTTCCTAAAGGAATAAAGGAAGATCTCTGACGAATCTAATCAGCCTCTTGGCA
TGAAACGGAGTTGCTCCTTTCGTGAAAAAATACTTTGGCAGTTTCCTGTTCCTGGTTGGC
GCTCCCTGGTGTGGCGAAAGGGGATGTGGGAGAAAGGGAGACGGTGTGTTCAGGGTGCCA
AGGGACAGCTAGGGAGGCCCACAGGTGAGCCGAGCCCCCCCCCCCGCCAGGTGAGCAGCT
GGGCTAGGCCGAGGGGAAGAACTGCTCTGGACTTGCTGGTGGAAGAATCGGCAGGAGACC
TAGGCTGAGCGCTCACTGAGCCTTTCTAAACACGTGTGCAAAGACAGATGAGCAGATGAC
CAGAGGAACTCGGGAGGAGGGCGCTGTCTACTCTACAAAGGGGTCTTTGGCTGCTCTTGT
TAGTTGCCTGCTCTCTATCGGCTCTCACTCATGGTGGCCATCCATCATGCAAGTGGACTG
GACACCACCTGGTCCTGCACCTCGTCCTCCTGGCTGTGTAAGCACATGTGAGGCCATTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGGGACAGAAGGCCTTGGCTCCTGAGGAGCCATGAGATGTA
TCCAGTCAATCAACCCTGTGAGCACCTTATCCCACTCACCCTGCTGAACCAGGCTTCCCA
TCTACCCAGCCACCCTCCCAACATTCACCTTAAATATGAGGTCGAGATTTCCAGTGGGTC
AGAGAACTTATCAGTACCCCCATGAGATAGTTAAGGTTTATTGTGCCAACCTGGCCAATA
AACACATGTGGGGTTAATTGAAGGGCAGAGAGATAAATGGTTCGGTGAGCCTCATCTTTC
CAGTTCTCGGGTCTCTTGCTTTCTGGTGGTCGGACCAGGGTGAAGCTGCCTTAGCCAGTT
CCCTGCTTCAGCTGGCAAGGCTCACTTCCTACAAGACATCCTTGAGGAGAAGCTACATGG
ACCTACCCCGATTCAGCCCTGGGTGCTGAAGCAGCCATGTGGAGACCCCTGCCAGCGCTG
AGATGCTTACACACTCACTGATTCAGCTTTCCTCCTGCAGTCGGCATCATAGTGTGTGCT
TTGTGAGATGGAGGAGGACTTTGTAGATTGATGTCGGACATATGGGCTAATGTTGGACTT
GTGGGCTTGGGCAGCACTGGGTTGGGATGTTTTCTGGATGTGCACTTAACCTTTATATAA
AACTCTCTCTTATACATGAGTTTCTGTGGATTTGTTTCTCTAATGTACACAGACTAACAC
ACCCCAAAGACACAAAGCTCGACTTGGCTTCATAACTGTCTCTCCAGAGACAGGGCAAGG
ACGCACCAGTGCTTTCAGTCAGCTCTACTGGCCCCAACTCTGGGCTCACCTTTGCCATCG
GGAATGGGGTGTGTGTCCTGTCCGGACAGGCCACTGACAGCCGGGCCATGTCTCCTTGCA
GGTTCCAGCCTGTGGCTAGTGGGCATGCTCATCAACATCCACTCGGACCACATCCTACGG
AGCCTCAGGGAACCCGGGGAGACTGGATACAAAGTACCCAGGGGTACGTACAGGCACAGT
CCTCTGTCTCCATGTGGTGTGGCACGGCATCTTGGGGTCTGAGGACCGCCGGGGGTGGGG
GTGGGGCGGGGACGTGGCCGGCATTTGTCAGCCGTGAGCTTCCCAGGAGAGTCACTGTGA
CTGTGGCCCTCACTACTGTTCCCGTTTTCCTAGACTTAGCAAAGGAGCCCACCTAGCCTG
GCCGAGCGACAGCCAGAAAGCCCACCATTCCAACTCACAGCCACTTGGTAGGGCAGAGCG
GGCTGCCCTGTGGGTGTCCAAGGCTTGGCACCTTTACAGAAGCCAACGGCCTTGTCTTTT
TCCCAAGGGGCGGCTGGTGGGTTCGAACCACCAACCTTGAGGTGAACAGCCCAACACTTC
ATCCACTGCACCACTGGGCCCCCAGGGGGTCATCAGGAAGAATAGGAAGCCCCATCCCAG
CTCTGCCTGCACAGAGAGCGAGAAGCAGAAAGGAGGGCGATGAAGCCGTCGCCTCCTTGT
CCGGCCCTCTGACCACAGCTGGAGCCCTGAATGACCTCTCCACGAAACTGTTTAGACTCT
CTTGCTGTGATGAGAGAAAAGGTCCCCAGGGGACAAGCTCTAGGCTCCTGGGACAAGTCC
AGGAGCCCCCGTGGGGACTTGGTGAAGGCCAGCTGTGCCCGCTGTGCCGTGTGGACGCAC
TTCACACCCTTACGTGGTGTGAGTAGTCCCAGCTACTCTCCCCGGCCCTGGAGAAGGCAG
GCCCTGGGGTCCCAGGGGAAGCTGCCTTCACCTGCTGGCTCAAGGAATCCTGGCAAAGCA
GGTTCCACGGAGAAGGCGGCCCCACTGAGCAGTCACAGAAGCCACGGGGAACTTGGGTGT
CCCCTCTCTCTCCCCCACAAGGAAGAGCCTGCTTAGACCTGAAGGGTCCCAGGGTGGATG
GGGCTAATTTAACACAGCATATAATATAATATAAAGACTGATCACAGAGCGAGGGCTGAA
AAGGTGCTGGAAAACAGAGCAGGGTTGACGTGCTACCAGCGGAGGAGCAAGGAGACCCTG
TGACCAAGCACCTGGGAGACAGAGCCCGGAGCTGAACCCCAACCTGCCACTGTCACCCCA
TCTGGACTGACTCATTGCTGCCCTGAAGGACGGTGGAGGAGGACATCTGTCCTGCCGAGG
GGTCCCAAGACAACATCATTACAGGAGCGCCAGCCTCTTCCTGTCCCCAGCAGAGCAGGT
GGTGGGTTTGAACCACCAGCCTTGAGTGGCAGCCCTGTGTTTAACCCACTGCTCCTACGG
GATCCTCCATGGAGCTGAGAGCTCCCGCAAGTGGGAAGTCCAGTCGGCGAAACTGAACAC
CGAGGGAGCTGGTGCTCACTGGGCAGCACCTGACTGGGGGGCCTCCCCCCACGGTCCTGG
GCAGCAGACAAGGAGAACAGTGGGAAGCCAAGCAGGGGAACTGAGCACCCACAAGCCCTC
CCGTCAGCGCAGACTGTGGCATGCAGAGCCCCCCTGCAGAATTCCTGGTGGTGCCGCTGC
TGCTGCTGCTGCCGCCTATGGTGGGGAGGATGAGAAAAAAACGGGAGCCTCAGATGACCA
CCTCCCACCCACCCCCACCCCCATATGCCAGGCAGGTCTGAGAGTGGGGTGGAAAGAGAG
CCTTCTCGGTGGACACTTAGTGAAAGGAGGGGTACAGCCCCACCTCAGGGGACCCAGCAG
ACTGTGGTCCCCACCTGCTTCCCAACCCGGCTCCCTCCTGTGGTGGAGAGAGAGGGCCCT
GGGTCTGGCCGAGAAGAGCAGGACACACGTCCTCAGAAGGCAGGGTGGCAGGACACGAGG
ACACCAGCAGGACACAGAGGAGGCGGCCGGCGCACAGTGACCGTGCCAAGAGCTGGGTCC
TTCTGGAGGTGGGACCCCAGGCCACCACAGCCGTGTGAGTGAGCAGAGAACTCAGGTGGA
TACCTCACCCATGAACTTGGGACTTCCCGAGTCCACCAGAAGCCTCCACCAATGTGTCAC
CCTGAGATCTGAGGTGCACCTGGCCCAACCATGGTGTTTTCAATCACCCCATCTGCCTGG
GAAAGCAGGATCATGGAGCCCCCCCACCCCCACTCCAACTGAAACTTATNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCCCA
CGGAGTGATGCCGACTCTTGGTCACCCAAACTGCCCCCACAAGTTTCCGAGACTGTAATA
CTTCAGGGGAGTAGAAAGCCCCATCTTTCACCCGTAGAGCCGCTGGTGGTTTCGAACTGT
GGACCTTGCCGTTGGCAGCCCAGCGCATAACCACCGTGCCACCAGAGTCCCAGGAACTGA
CAGGAAGCTCATGAAAATGTTTCAAGAAGCTGATGAAGTGCTGGAAAGCACTCGCTTGTC
CCTGCCAAGAAATTTGAAAGACAGCACCCTGGACTAGAATAGACTAGAAGGGATCCTTAC
TTGTACCCCTTCTCTAAAAAAGCGGCCCTACAGAATGTGGAAATCATCTAACAAGATGAT
TGATATCACAAGCAAGTAGAATTTTGCTGAAGATCATTCAACAACTCCTGTAGCAGTGCA
TTGACAAATAGCTGCCAGATTCAGACGAGGACATGGAACAGCGGATGCCATCGCTGATGT
CAGATGGCTCTTGGCTGAAAGCAGAGAACACCAGAAAGATGGTGACTTGTGTTTCACTGT
CTATGCCAAGGCATTCAGCTGTGTGGCACACAGAAAGCTATGCACAGCCTTGAGAAGAAC
GGGAATTCCAGAACACTTCGTCATGCTGATACAGAAACGGCAGTGGTCTGGACCAAATAT
GAGACTGTCGCATGGTTTAAAGTTCTATCCTCCGGCCATACTGGCAGGCTGAGCAAACAG
AGAAGCTGGACAATCTAAGAAAGCCCACAGCATCGGGATTGGAGGAAGGCTGATTCACAA
CCCGCCTTCTGCAGGGGACACAGCTGAGCCTGCTGAAAGCAAGGAGGTCTTGAAGCACTT
ACCGGTGAACACCAAAGATGGTGGCCTGCAGGATGGATTACAACTCACCGGAAACCAAAA
GCCCTTACAACTGGGTCCATCGGTGACACCCTGATCGATGGAGAAAAAGGCTGGAGTTGT
CAAGGATTTTTGTCTTGCTCAGATCTATACCCAATGCTCATGGAAGCAGCCATCAAGAAT
CAAATAACATGTTGCATTGGGTAAATCCACCACACAAGACTTCTTTATGGTGAAGAGCAA
GGATGTCGCTTCGAGGACCAAGCTGTGCCGGACGCAAGCCGTGGTGTTGTCAATGGCCCC
TGTGCATGTGACAGGTGTACACCGAGTAAGGAAGACTGAAGGGGGATCTCGGCATCTGAG
TCATGGTGCTGGCGAAGAATATTTAAAGTGTCATGGCCTTTGTGTCAGTCTGGGTGGACT
AGAGATACAAATTCATAGACGCTCATATGAGTATAAGAAAGAGCTTTCTACCAAAGATCA
GAGATTTCTACCGAAGATTAAGAAAACAAAGCCAGCCATTGATTCTGCTTACTTGAATGT
GTTTTTGCAGAAATTTAGAAAAAGCTGCCAATAACAGTAAAGCCATGTTACGAGCCTTAA
GGATAATTGAGATCATTAAGGTCCCTGAAAGTGGCTACATTAAAAAAAAAAAAAGAAAGA
AAGAAAACATCCCAGCCCAGTCCAGATCCAGTCCATAAGTCAGATATTACCCCATATGTC
CGATACTAGTCCATAAATTCCTCTTTAGCCTCACGCAGCCATGCAATGACTTCGAATGCA
GGAAGATCACAGGCCAGTGGGTGGAAAGTAGTGGATCCAGTGGCAGCAGAAGCCTCTCGG
CGCTGGCGTGGGTCTCCACGTGGCTCTTCCAGTTACAGGGCTCTGGCTCTCTCAGCGTAG
CACCGTCTGGCTTGTCAACAGGACTGTCTCTCACAGGGAAACGGTGCATCTGGCCTCCAG
TCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCAC
CAAGGGCCTTCCTCCCTGTACCAGGCACTTGTCCCTTGCCAGGGACTGGTCTCCGCTGGC
AACACGTCCAAAGGACGAGAGTGCCCCTGAAGAGCGCTCTGGCTGTACTTCTCCCAAGAC
AGATGACTCCGTAACGAGATGTATGTAATTGCTCTCCGAACAGAGACAATCACACCACGT
GTCTGCCACACCAAAAAGTCGTTGTCACGGCTTAGCAACACAGCAGCTTGGTTCTCTATT
GAGAACAGACCGGAGCTGCGCCCGGCGTCTAAGGAAGGGGGCAGAGCGAATGCACGCGGT
CTGTTTGATAAATCACAGGAATTGTCGCATTGACTACGGGATGAGGTCATTGCCCTTTGC
AAATGCCTTTCTCTCTTCATTTCAGGTGGTACCTCAAGAAGTTCAAAGATTACCCGAAGT
CCAGGAAGATCATATTTCCATATATCTATTAAGCGCCTTGCCGAGAACCTTCAGGGTCCT
TCAGCGAGCTGGAAGGACCCCTGTGTGGGAGCCGTGCTAAGTGAATGTAACCCCTGTGAT
TCCTCTCTTCCCAGATTTGTCTAGGGATCCCCTCTCCCATGGTGGCGGCCAGCCCTGGTG
ACTCATGCAGCTTATTTCTCAGATTGTGATCTCCTCCCCACCTCATGTGGCTGGGGTGGG
ATGGGGGTAGCTTAGGGTTCCCGAGAGCCACGTTCATGAGCCCTTTGGGCAGTCTCGTGA
TTTATAAGGTCGGCACCTGGACACCACCAGCCACTCCCCGGGAGAAGGCCGGGGCTGCCT
GTTCCAGTAAAGATGTGCAGCCTGGGGACCCATGGGGCAGTTCTACTCTGCCCTACAGGG
GTGCTGTGCATCGTAATCAGCTGTAAAGGCCAGCGTCATGGCTGTTCCCAGCAGCCCTCC
CCCCAGGGGTGTGGGTGACCACCACCACCACCTCTCAGGGCTCGGAGGGAGCTGTGCTGT
TCCGGGGCAGGCCCGCGGGGGACACAGCCCAGTGAGGGGCCTGATTCTAAGAAGCGCTGT
CCACGTGCACAGGACTTGACTGTGAACAGGCAGGCTGCCCCTGACGGCAGACTCGCATCT
GACCTCATCTCCCTGACCCGCTGGGTCATCTCCCTGACCCGCTGGGTCATCCCCCTCCAG
TCTGCATCCCATGAGGACTGACTGTGTGCTGCACCGTTGGTGTTTTCTGTGTCCCTTCCT
GGTGCAAAGAGGCCTGGAAACGCGCTTTCACGCCCTGGGCTCTCTTGAAGGACCCTGGCA
GGAACATAGGTCTGAGTGCTGCCAGCACATGGACATGGCATCCTGGCACGTCCCAGGGGC
CCACAGAAGAGATGCCTCCCCCAAGCCGACTGCACACGGGGCTCCCAGGTGGCAGCCCCT
GTTCCTCCTGCATCTCCTCTGCAGACGTCGGTGCTGGAGGGGACATGCAGGTGAGAGGCT
GCCTCTGCTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1007, 1009..1088, 1093..1107, 1110..1202, 1204..1206, 1210..1237, 1240..1288, 8732..8895, 13141..13242, 17863..18013, 18505..18571
1001..1007, 1009..1088, 1093..1107, 1110..1202, 1204..1206, 1210..1237, 1240..1288, 8732..8895, 13141..13242, 17863..18013, 18505..18568
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved