Echinops_telfairi Locus ENSETEG00000018453
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000018453
Echinops_telfairi
ENSETEG00000018453
GeneScaffold_1112
SNORA55
5548..5681
12159
TCCAAGATTAGAGGTTCAAACTCACTAGCCACCCCTATAAGAGAGAGATAGCTCTAAAA
AAAAATCATGTTATTGGGCTGCTCTTGCAGGTAGCATAACTGTCCACCATTCAGTCACAT
TGAGCAGTTGCTACCACAGTCAGTTTCACATCTTGTTCTCTGAAGCTTGATACCAGCTCC
CCCTTTTCCCCTCCCTCCCCCATCTTCCCCTCCAGGAACCGTTAGTCATATTCATCTATG
CTGCATCTTGCACCATCCAGTATATCGAGCTACACACAGCTCTGTTGTTCGTTCCCGGTA
AGTGGAGTGATATAGCGGTCAGTCGTATCAGCTTCCGAGCCTCCGCCTGCCCGCGGTTTG
CGCAGTCTGCACGAACAATTATTCGGGTTCCTCCTTCCCAAGGTCCGCTGTAATTTTAAC
CCGCCAGGAGCCCGAGGCCTATATTTATAGAGACACGCGTGTCCCGGAGGCCGCTGTGGC
CAGCATCAAATGCCTCTGGGAGAATTTTTAGAATTTCAGAAGGGGATTCCCCATTTTAGG
TTCATAGTTTTTAATTTCTTAGAGGTTCAGCCCAGGAACAGCTGCAGACTACAAACTCCC
AGGGAAGGCCATATTGTTTCTGGATTTTTTTGGGAACGCCTTTTGTCTGAGCTGTCCCTG
AACTCCAGTTGTCCTGAGTATCTGAGCCAACTCCAGCTCCTCTCAGCCTCTTGCCACCTG
TGAGCCGCCGCGCGGCCCACGCCTCGGAGGGAACCTCTTTTGTCCTGTGGTGATCCCTAA
AAGAAGTCCTCCTGGCGGGGCTCGGGGTGGTGGGGGGCGGGGAGATGAACGCTGCGGCCA
GCAGCTACCCCATGGCCTCCCTCTATGTGGGTGACCTGCACTCGGACGTCACCGAGGCCA
TGCTGTATGAAAAGTTCAGTCCTGCCGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATA
TGATCACCCGCCGCTCCCTGGGCTATGCCTATGTCAACTTCCAGCAGCCTGCCGATGGTG
AGTTGAAACTGTGCACACAAAATTTGGGATCTTAGGCAGCCCTGGGAATCATAGGCAAGT
TCCCGGCCTGGGGCAGGGGGGTGTAGCTCCTAGGAGCCAGTAGTGGGGAGCCTAATGCTG
GTTAAGAAAGCTGCACCTGGCAGCAGATGGCTGCAATTCCTTGTCACTTGCTCTAACTGG
GTGACCTTGGGCAGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGCCCTTTTGACTCGCCAAGGTGGGCTTCCT
GCCAACGCCATGGCCTGCCTGCCTGCTGCCTCTCCCCTGAAATGGCCTGCGTCTGGGTTT
TGTGAGCATCCAGCACCTGGGGCTGGCTGGAAGGCAGCTCTAAGCCCACTCTGAGCGGGG
GTCTTGGCCAGCGGCAGAGTGGAGAGGGCCCTGGATTGACCAGGAGCTGTGGACTAGCCA
TGTGACCTTGGCCTTGCGATGCGTCGAGTCTGTCCCTGGGTCTCAAGTTGATCCCAATTG
CTCCTACCTATAGGACTCAACAGCTTCATACAGAGCTGGCTCCACAGTAACACTTAATGT
AGGTCCCGGAGGGCTACTGCTGTGGTGTGCTCATTGCTGTGGAGAGTGGGAAGGAGGGGC
AGCATGAAGTGGAGAAATGAGAGAACAGGAAGTCTTGGCATTAAATAAGTCTGTCCTTGG
TCCTCCTGGCCAAGTTGGTGATGGGTCACATTGGTAATTTGCCCAGCAGCCAGATTTTTC
ACTGGTATCAAAGAAGAGATGGAAACATTTGTGAAAATTTTCCTGTTTGATGTAAACAAT
ACCAAAAGTCACTAACAGGGTGGTTCCTAATACACTCCCAACAGGCTTGCTCCTCCCAGG
ATTAGCCACTGTTAAAACAGTTTGGTTTGTACCATTCCAGCCTCTTTCTGTGCATTTACC
TAGATGCACAGAAATGCACACTGAAAACCTGGTCAGCAGGTTCCTTCATGAGCAGTGTGA
TGTGGTAGGCGTAGCCCTGGTCTGAGCTACGAGCCCTGGAAGTGGTCCTTGTAGGAAAGT
CCTGCCTCACTTTCTGCTAGGGACTTGACATCTCTGAGCTTGCTCTTCTGGTGGTTGTGT
GGGGACTGATTTTAACTCCTGTGAGCCCTTAACAAACATTCCTTTGGGCCCCTGGAAATT
ATCTGTTTAGTCCTTCTGGGTGGTCACTGGTGTGTGCTATGTGGTTTCTTTGTAGGTTTG
TGGGCAGGTTTAAGTCTCGAAAAGAGCGGGAAGCTGAGCTTGGGGCCAAAGCCAAGGAAT
TCACCAACGTTTACATCAAGAACTTTGGAGAAGAGATGGATGATGAGGGTCTGAAAGAGC
TGTTCAGCCAATTTGGTAAGTCGGGGTCCTTTGTCCTGCTCTGTCCCCTTTTGTCCACCA
GATACCTGGGACCCCATCCTTTTGTTCGTTTTTCTTAAGAGATGAGGGCCCAGGCCCGAA
AGTAAAATACCTTGCATGACAAAGATCAAGGTAGCTAAGACTAGACTTCAACCTCATCTC
ATCCCTAAGGCCACCTCAGCTACTTGGAATTCATTAGAATCCAGACATGGGGCCTCTGCC
CTGCAGGCCATGGTGGGTTCAGCGAGAAGTTGGTTTCAAGTGGGTTCCTAGAAGCATTCT
CTCCTTAAGCTGTAGTAGAGATGGTGTTACTAATAGTTCTGTCCTTTGGCAAATAGGTAA
GACCTTAAGTGTCAAGGTGATGAGAGATCCCAATGGGAAATCCAAAGGCTTTGGCTTTGT
GAGTTACGAAAAACATGAAGATGCCAATAAGGTGAGAGTACCACCAGGGTTTGCAGGAGG
TAGTCCCCTTAGGGTGTGGGGCAGGGCCTTGGACACACAGCAGCATGGAGCTGGAATGGT
CTCACAGTTAACTGAACTGCTCTGGCATCACCTTGTCTGATGCCATACGTTAAGATCACT
GAGCTGGTTTTTTTTTTCCTCTTTTAGTTCATTTCTGTTAACTTTTTGTTATTTTGAAAA
ATCTTTTTATTGGGGTCTTTTACACTTATTATAATAAACCATACGGCCGTTAACTCAAGC
AGACATGTACAATTATTGGCATGAATCATTTGTGAACAATATCTTCTTGAGCTCTTTAAT
ATCAGCTCGTTTTTCTCCCTCCCTCTGCCACCCCCCAAACCCTTATTATGTATTGTTATT
ATTTACACTTAACTGTTTTCAAAGTGCATGGCACATACCTTGAGTTGTCAGTTGCCTGGC
CCTATTGGCTGCAAAGACGACACAACATTGTTCCCACTCAGAGGTGAGGGAGCTAAGGTC
CGAGGTGGAGGCTTGACGACAGTGGCGCATTCCCTTCCTATCAGAGTGGTGCGCACTAAG
CCCTTAGCACCTCCCTTAATACCAACAAAAGGAACTCAGACGTTCAGTAGAAGGCAAGTT
ATGTACATCTCCGCAATGGTCATGTTTATACAGAGGTGGTACCTTTGCTCTTGGTATGAA
CCAACAGCCCCACTTTTAAATGAGGAGGCTTGAATTTGCTCAGCAGACTTCAGAAGCAGA
GTGATTGAGTGGGTAGCCCTACAGGAGTGATTGCTTTCCTCAGAAATCAGTTGGGTCTCC
AGACCTCCGTACCTCCCTTGCATTTACATCCTGGGGTTTAAAGGCATGTGCTTCCTCTCT
AGGCTGTGGAGGAGATGGACGGAAAGGAAATCGGTGGGAAGGCCATCTTCGTGGGCCGCG
CACAGAAGAAAGTTGAGCGGCAGGCTGAGCTAAAACGGAAGTTTGAGCAGCTGAAGCAGG
AGAGAATTAGTCGTTATCAGGTGAGAGGTGGTCATGGCTCAGCCTGCCCCCAGGGGATTT
GTTTACTGTGACATCCTGCACTATGGGCTTCTGTTTAGTGGTCATTCTCTTTGGGGTTTT
TAGGTGAGCTCTTGCCTCTCCCCTCCCAAGAGTACTAAGCTTTTAAGGATTTCACTGCCA
CTAATCTTGACTCACAGCAACCCTATAGGACAGGGCAAAACTGCCCCGGGGGTTTCGAGT
GTAATTTGCTTGATGGGAACAGAAAGAATCATCTTTCTCCCACCTAGTAGCTGGTGGTTT
CACACTGCTGACCTTGGGGTTAGAAATCCAAAGCATAACCACTCTGCCAATAGGGCTTCT
GCAAGTGGCCGCAGAACAGGGCTAAAAGGGGACCCTCAGCCTGTTGCTCGTCATCATGTG
AGCCACTTGGACTCACATGGTCCTGTGGGGTCTGGTGCATTAGTGTTGGGGCAGTGGCTG
CAGAGCTTGGCTTCCAGGGCCCCAGCCCTAGCGTTTGGGACCTGGCCTGAGAATTTGAAT
TTCCTAACAAGTGCCCAGTGATGCTGGGCTAGGGGCCACCATTGTCTTGTCAGATAGGTA
GGGCAACAGGCGTGCCATTAACGATGCTGCTTCTTCCTCAGGGGGTGAACCTTTATATTA
AGAACTTGGATGACACCATCGACGATGAGAAGTTAAGGAAAGAGTTTTCTCCTTTTGGGT
CAATCACCAGCGCCAAGGTATTTGAATGAGAGGTTTGGGGCCAGAAGCAGAGAAGCCTTG
GCGGGGGTGGGGTTATTGGCACTTAGGGTTCCATTGATCTCATTTGTGGTTTCCTGGTGT
TCGAGAATAGCCTACCAGTTAGTTACTCTAGTCAATAAGCGTGTATCTGGTTAACATGCT
CGGGAGAATGGCGTTTCATCCAGTTAACGTTGCACTGCCTGCCTCCCCAAATACGGGATG
AACCTGACCACGCACTCCACGCGGGCCCTCAGCACCTGAATCTTTCCCATTCCGGACTGC
CTCGTGCTGGTGTGGGGACAGATGGTGCTACAGCATGAGCAGAGGGAATCCAGACGGGTG
GTTTCCATTTGTCTTGGGGCCTGTCTCTACAACTCTGCCACACTCCTTCCTGAGGAACTT
CCATTCTGGTCTTAGAGGACAAAACGGGGGTGTGATGCTTGTTTTTTCCATGTTCTCCAG
CGGTGCGTCATTGATTTTTATTTATTTTTTTTAATCCACTGAGCACGTAGGATAATTTTA
TTTGTTGTTGGTAACTTCCATTGTAAAGGTAAGGGGTTTGAGTCCTAGTTACATGGGGAT
ACATACGTGCTGTGTGTCCTTGGCAATTGGTATCGTGACAGAAATGGGTGGCATCTGCAA
GTCTGGGCAGAACCTGGTGCAGTATTGGTCCTGCTGCCTGTCAAAGAGAAGGGTCAGGGT
GGGCTGGCGAATGGAGGCTCTGCCAAGCTCTTGTCTGCATTACTCCCAACGTGGTGGTGG
GGTTGGGGTGTTAGGCAAAGAGGTTTTCAGGTGCAGTGGGGAGAGGTGACCAGAGACACA
AGCCAACCTAGGCCCGCCCCTCCCCTCTCCTACCACCACGTTGACTGGCCTTCCGTCAGG
TCAAGGGATGAGATGGTCTTTGCTTATCGGCATGGTGGTCTGGCTGGCATTTGCAAGCAG
AGAACAAAAGAGCTATTGTAGTCGTACCCCATGCTCAAGAACGAGGCACTGTATGGTTCC
CACCAATTTTACTGGCCTGTTCTGCCGCTCGGGACGGTGATGGGTCTTAGGTGTCCTCGG
CTTTACAAGACCCCAGAGGTAGCAAGAGGGGTGCCGTGGAAGCCGATGTGGGCCAGGCTA
ACCACTGCTACCGGGGTTCCAGTTCATCCAGGTGCAGGCTTATTCTGAGCACAGGACTGA
AGTAAGGGCACTTGTCTCATTAGAGTGCCTTCCAACCAAAGGTCCCGACAAGGGAGGCGT
CCAAGAGACTGCTGGGCCAGGCAGAGTGCTCTCAGAATGTTGGGATGACTTGGGGGTCCC
AAAGGGTGACTTACAGATTTTCTCAGAGGACATAGGATGATCACGGGATTATTGGGAAGG
AAGATCGAAAACTGCATCAGTGAGAAAGTTGTGTCCATGACTTTTCCTCTATCGCAACAA
TGCACCTGCTCGTTCCTGCAGGGTGGAACTGCCATCAGAAAACCTTAGTCCACCCAGCCT
ACAATCCTGATGCCGCCCCTTTCAGAGTCCTTTTGGTCCCCTAACTGGAACAATTACAAG
GAACTCCATTTGAGTGTGCGTGGGTGCTGGACCCTGGGTCGTTGAGGGGTAGGGTTAGAG
AAATGGGAAGAGGCCCTTCAGCTGTGTGGACCTAGGTGGAGGTAGCTATGCCGACAAGCA
TCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
GTGGTTCCTCGTGTTGCCGAGACTGGGAAACTTGCTCAAGGCCTCAGCAGGTGAGTTCTT
CCAGTCCTGACACTTGCCAGGCCTCTTAGGAATGTTGTGGGGATGGTTAACTTCTTAGGT
CTCAGGGACTTTTCTTCCTGGTAGGTCACTAACCATATGCATCCGGGAACTGGAACGAAT
CATCTGGAACTGCCTAGTTTTACCCTTGGGTCAGCCCTGGGGTGCCACCTGGGTTAAGGT
TGAGAATCTCCGACCCAGGACAGCCCACGTTTTGAGGCTGTTCATTCCAGCCCCTGAGTG
CAGAGCTTTGTCCAAGTGCATGCTCTTGTTTTCCAGGTGATGCTGGAGGATGGGAGAAGC
AAAGGCTTTGGCTTCGTCTGCTTTTCCTCTCCGGAAGAGGCTACCAAAGCTGTCACCGAG
ATGAATGGCCGCATTGTGGGCTCCAAGCCCCTGTACGTAGCCCTGGCCCAGAGGAAGGAG
GAGCGAAAGGCTCACCTGACCAACCAGTACATGCAGCGGGTGGCAGGCATGAGAGCACTC
CCTGCCAATGCCATCCTAAATCAGTTCCAGCCTGCAGCTGGTGGCTACTTTGTGCCAGCA
GTTCCCCAGGTGGGTCTGCTGGCTGCGTGGGGCCCTGGCAGCTGCTTTGGGGGTGTGTGC
GTTGGGGGGGGTTTGGTTTACAGCACAGGGGTTTTTCAGAAATCAAAGTAAAGATGCCTT
CAAGAGCTGATACCAAGGGCTCAAATAGAAAATGTTTTGAAAATGAAGGCAACAAATGTG
CTTAGCACAATGGACGGATGTCTGGATTGTGATTAGAGATCCCCCCCCTCAAGTAGGAAC
TTTTCCTGCGGTTGCTTTCTCATAAGCACTGATCCCCTCTAGCTGACCACCACAACCCCC
AAAGCTTTAGCAGAGAAAGCTCCTGAGCAGGCCTCTTCTGAAGAAGCATCCCAAGGCCTG
GTAGTGGTGAGGGAGAGGTACTGCTCACCTGTGGGGGCCAGTCCTTTAAAAGCTCATGGG
TGCTGTTCTCTTATTACAGGCTCAGGGAAGACCTCCTTATTACACGCCTAACCAGCTGGC
ACAGATGAGGCCTAATCCACGCTGGCAGCAAGGCGGGAGACCCCAAGGTAGGTCGCTTTG
TCCCTGTCCTGGTTTCCCTACGTGTACCCTCCCAGAGGGGCGTTTGTTAAGCCCTCTGCC
CCAATCCCCCTAGCCTTTGTTGATGTACAGGGTTTTTTTTCACCAGGCTTCCAAGGAATG
CCAAGTGCTTTACGCCAGTCTGGGCCTCGTCCAGCTCTTCGCCATCTGGCTCCAACTGGT
AATGCTCCGGCCTCTCGTGGCCTCTCTACTACTACTCAGAGAGTCGGTGAGCAAACTGGC
CTTGAGAGGCACTGCCCGGGGAGGCGGGAGTCACGACGACTACGCTCAACCCAGCTGTAG
TGTTTTCTGAGTCCTGGTTCTTAATTGAGTTGTGTGCTTAGGTAGGTACTTGAGGTGGCA
CAGACGCTCTGGGTGCGGGGCTTTGGCGCTTCTGACTGCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNACACTGATGTGCATTTGCTGGTCTGTTGTAG
GGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCGCCCAGCAAG
GGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGGTGCACACAGATGGGGAACGATG
GGGTTTCATGGGTCTGTACCCAAATTGATGGGCTTTAATGTTATTTTTCCACTCCACTCC
CCCCAAGGTGTGCCCACATCTGTGCAGAACTTAGCTCCTCGCGCTGCCGTAGCTGCTGCC
GCTGCCCCTCGGGCTGTGGTCCCTTACAAATACGCCTCCAGCGTCCGCAGCCCCCATCCC
GCCATACAGCCTTTGCAGGTGAGGTCCTGCTGTGCCCTGGATAGTGAACTCATCAAACAC
TGTCGCTGGCCTTGGAGGTGGCCCGGGAGGGCAGGAATTTGAAAAAGCAAAGCCAAAAAA
GGTTCACTCCGTCAAGTCCACTTTGATTCATGGTGACCTTGAAGGATGGGATGGAACTGC
CCCCTGTGGGTTTCCTAGACTTCACAGGAGAAAGCCTCATCTTTCTCCCATTGTGGTTTC
GAACCACTGGCTTTGTGGTTAACAGCCTAGCGTGTTACCCCCTATGCCCCTAAAAGGTAA
AATGGACATAATGCAAACTGTGCTGAGTGTTCTGGTTCTCCCTGCCTGCTTTTCACTCCA
TGTTTTTGCACGCCTGGGCCATGTCCACTGGCCTGCTTGATCCTTAGCTGCCCTGTCGGG
GACAGTTCACATCACCTCTTCTGGTTCGACCCCACCCACACTGCGACAGGATTGCCTTAG
CTGGGTGTGCACTGGCTGTGGGGAGCAGCTGCACTCAGCCTTTGGACCCATTAGCTGCTG
TGTAGAGCACTCTACCTTGAACCTTCCTGCTCCCGTGCATTCTACGTTTGCGACTCCGCA
GAACTTGATGGCACGTAACATAGCCTTCGTCTACGGGACCCTACTTTTAAGTCTGTGACT
AGCATTGGCCTTGCACAGTGATGAAACATCTGATAAAAGTTTACAATAAAGGGACGTGGG
TGATAAACCCCCAAACCAGCCATCCACTGCCATCAAGTCAATTCCAACACAGTGACCCCA
TTGGGCAGCACACAGCTGCCCCTGTGGGTTTCCGAGATGAAATTTTTACTGCAGTAAAAA
GCTTCACCTTTTTTCCCATGGGAGTGGCTGGGTGGTTTGAACTGCTGGCCTTGCATTAGC
TCGGTACATAACCCAGTATGCCACCAGGGGCTCCTATGTGGTTTATTATGGTAATTTTTA
AAAATCACACCCTGTTACTTAATATCTATTGGGAATTCGTTTTAAGAAATAGTCTCTTCA
AGAAAAAGCCTCACCTACACAAATGTTCACTGTAGCCTTATTTTAAAGGCTTCAGATGCC
TCATAACCTCAGTTAGGTACGATAGTGTCCTTGCTTAGGCTATAGGTCCATTTTAGTACA
TTCATTTCACCTTATAATTGCCTAACGCTTTCATTGTGTATGAATGATCCCTTCATACCA
CTTCTGTGTACCCTGCATCCCTCGGTCCCCAAGGACTGATGTATTAGCTCTTTGTGAACA
GAACCATGCCAGAGAGCAGCAGCCAGTCAGACGATGATTGGCTGGACTGCCCCAACCACC
ACTGCAAAGAGCCCTTTCTTTTGTTGCTAACCTGCTGCCCACCTCCTGGTTCCAGGCTCC
ACAGCCTGCAGTCCACGTGCAGGGGCAGGAGCCCCTGACTGCCTCCATGTTGGCCGCAGC
ACCCCCACAGGAGCAGAAGCAGATGCTGGGTGAGTGGCCCGCACACCACAGAGCCCAGGC
CTGAATACCGGCATCGGGTCTATACTGTGACTCCATCTGATTTGGGGGTAAATATTCCTC
CCTACAGGAGAGCGATTGTTCCCGCTCATCCAAACAATGCACGCTAACCTAGCCGGGAAG
ATCACGGGCATGCTGCTGGAGATAGACAACTCAGAGCTGCTGCACATGCTGGAGTCCCCG
GAATCTCTGCGCTCCAAGGTGAGCTGGCCCGGCACAGGGCCACAGAGAGGAGTCTGCTGC
TCTGTGGCCCTCCTCATCATGCCTTACGAGTTGTGGCCTCCTGGTGGTGTCTGGGAAGTG
GTTGGTAGACTTGTTCTGTCCTGGGCCTGGGCACCAGGGTGGCTTGGGGGCGCTCTTGGA
TGCCACTGATCCACTGGTGACTTCTGGCAGGTGGATGAAGCTGTTGCGGTTCTACAGGCT
CATCATGCCAAGAAGGAAGCTGCCCAGAAGGTGGGCGCTGTTGCTGCTGCTACCTCTTAG
ACAAGGAGTAAGCGTATGTTTGATCGTTTGACTTCTAGAATGGTTTCTGGTTTGTGACTG
TTCTTAAAAGAACGTGGGGGTGCTTTGTAGAGCCACTTACATAACTTAGTTAATACAGAG
AAAAGAGTCATTGGAGTTGTAGGGAATAAATGAACCATTTTCTCCATAAAGATCACCTGG
TCAAGTCCTTGTTGGTCTGGATAGCAATGGGTCAGAAAGGTTTCTCTTGCCCAGCTCCCA
GAGCCTCAGTCTGAGCATAGCCTTCCTGAGGCTTACCTGAGTGTGAGGAGGGCTGTTTAG
CTCTGGGAACACAAAGGGCCCGGTCTTGGCATCCAGGGTCTCAGTTGAGTGGTAAAGACA
AGCACCCTTGAGTATAATTACATTTTCCCCTCTAAGCTTCTGGTTTAGTGGTCAGGTGGC
CTCTACCTGCAGAGACTCAGGTGAGTGAGGTCTAACAAGAATTGGTGAAGGCCACCAGAT
GGAAGGAGGAAGCCAAGTAGCAAAGGCAGGGGGAGGAAAAGGAAAAGGCTTTGAAAGGTC
TGACCTGTTACAGGGTTGAGCCCTGTCCGTAGTCGTAGAAGACAGCAAGTAGGCACCGGC
GGGCCTGTTACATTTAGTGGACAGAGGACAGAGATGCTGTTAGGCTTCAGGCCCACAGTC
AGTCCTCAAGAATCACCCAGCCCAAAGTGTCAGCACGGAGACTGAGCCCCTGTTGTTGGT
GCCTCGTCAGCCAAAGATGTCATGGTTGGTTGTTTTATGTTGGTGCTTTTTGTTTCAGGA
TTCAGAAGCCAAATAACCCCTGCTGGATTTCAGCTCAAGTTTGAAGACTCCCTGACTTGT
CCTATGGACCTCAACATTAAGAACCACAAATTACGAATTAATAGGTCATTTTGTATCAAA
AGGTCAATTATGAAGCACCTAGAATTTTTTTCAGTTATACAAAGATGTTTTTTGGGTTTT
GCCATAGCCCAGATAATGTTAACATTTTGTTTTTCTATTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1193, 1494..1687, 1788..1903, 2992..3131, 3473..3567, 4439..4576, 5198..5293, 7593..7865, 8296..8383, 8503..8622, 9057..9143, 9244..9374, 10732..10825, 10924..11054, 11247..11336
1001..1193, 1494..1687, 1788..1903, 2992..3131, 3473..3567, 4439..4576, 5198..5293, 7593..7865, 8296..8383, 8503..8622, 9057..9143, 9244..9374, 10732..10825, 10924..11054, 11247..11333
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved