Echinops_telfairi Locus CCAR1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi CCAR1
Echinops_telfairi
CCAR1
GeneScaffold_465
SNORD98
20904..20967
63597
AGGCCCGCGCGGCCGGCCCCTCCCCCACCGCGGCGCTCCGCGCGCGGCCCTGGGGCTCG
CCCGGCCCCTGAGCCTCGGCCCGCGGCCCGGGGAGCCGCCTGCGGGGCCGCCGAGTCTTC
CGCCGTTCCGCCTTCGCGCCCGAGCCGCCCGGGCCCCTCGCCGGGTGCGGGTTGTGGAGG
ATGGGAGCTTTCTTCCCCGGGGGGTGGGAGGCCCCGGGCTGTTGGTAACCCCGCTTTTGA
CGGTTTCCTCGGCGTGTGGGGCGGAGGGTCCACCGCCCGTGGTCTGAGGCCCGCGGGGAG
CTCGGAGTGGAGGGAGCCGGACGGCCTCACTCGGGCTTCACCCCCCCCCCCCCGCCCCAG
TCGTGGAGGGTTGGGGGCGTGGGCGCACACCTTCTCTCCTGGTTTTTTTGGGGGCTAAGC
AAGGGGAAGAAATCTTCACAGTTGTTTTCCGAAGCACGACTGTTACCTGTTCCACTTTAA
CTTCCTAGGGTAGGGTAGAGAAAAGGAGCCCTTTCTTGAGATAGTAAGATGTTCGTTCGT
AAAATGATCATTGTAAATGCTTTTATTCGGAATCTCGTGGCCCTGATTTTCGTTATTGAT
CTGACTACGGCTCTAGCCCGAATGACCAACTTACTACCAAAAGAAACTCGGAAGGTAGAC
TGCTTTTTATCCCAACGTTGTGAACTTATTGATAAGAATAGGCCCTCTAGACCCCTTTAA
AGGTGACAGTGTGTGGTTGCTGACTGAAGTGCTTTTCTTTTAAGTCAACTCTTAATTTAT
GTCATCCTTTAAAATTAGGTACCTTTGATACAAAATGTTTCTGTTGCCCTTTTTCTACTT
TACAGTTATTTACATAAAGATCTACAAAAATGCCCCTGACAGTTCCTTAAACTAGTTTTT
TGTGATGTTTGTGGGGTGGCTGAATTTTAAGATGTGGATTCTTTCTTATTAGGTCGTTGC
ATTAGAAGAAAAACCAGCGAAGGTTTTTTGCCCCTTGCATCATGGCTCAGTTTGGAGGAC
AGAAGAATCCGCCATGGGCTACTCAGTTTACAGCCACTGCGGTATCCCAGCCAGGTCAGG
CTTCTGAACACATCGCATGTAAATGGAGGGGGAAAGGGGAAAGAGTATTGTGCTATGTTC
ACTGGGCTATGCATAATATCGTAAAATGTGCATAGATTATTATCTTTTGTTCACCTGTAA
AAGTCTTCTGGGGAAAAAAGAGGTGGCTCAACTAACTAAAAGAAATGTGCTTTATATAAG
TTTGGCTAAAGTTTTTAAGTAGCTCAGATTGATTAATTAATAATGTTAGACATTAACATC
CACTTGCTCATTAAGGAGGGTATACCTTATTAGGGCATGCTGAGATGTCAGATTTTGTAA
GTTACGTTTAAAACTAAATATATTTGAAATGGACTAAATTTTGGCTGTGCTTTTCGACTG
TCAATATAAAATACGAAAAGAAACTAAGGAACTTAATTATTAAAATCAGTATAAAAGAAT
CAAATGAATATTTTAAATTTCAAAAATGGTCTTTGGGGTAGAGCTGTTTGTTTAAAAATT
TTTCGTTGGCAAAAAAAAAAATTTTTTTTATTAGCACTTAGGAAGAATTCTATACCCATT
TTTTTACGTTGATTGAATCTTTAAAAGTAAACTCTACAATAATTTCTTGTTGAAATGTTC
AAATCCTAAACATACCACCCCAGTAAGTTGCATTAGTTTATCCAGGATCCTACTAAATGA
AGCTTTGAGTTTATTTCATTAGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCTATGAGTCAGCAGCAACTTGATG
GCAGTGATTGTGTTTTGTTTTAACTCCTTTTTCAAAGAGATGAGGAAATTGAGGCCCAGA
AATGTGAAGAAATTTGTTTCAGGTTGTGGTAGAGTCAGGATCACAACCCTAGACTTGAGC
TTCGTTATATTCTATTATCCCATTTTCTTAGTCAACTGCAAAAATACCTCCATAGGTTTT
TAACTATCTCCATAGTTAAAACTCCTTAAGATGGTATTTAAGGTCTTCTTTGTTTCTAAT
ACCACTTCAGCAGTAGTCTTTCTAAGGATCAGAGTGTTTAAGTTTGAGATTTAGGTTTGA
AATTTTCTTGTGTGTAAAGAGATTAGAGGAGAGACTGAGAGATTTGACAAATCATTAATT
CAGTCTTTCGATCAAGTTCATTGGCCAGTAGTATTTTTTTTAATGCTCTTTTTTGGTCCG
TAGTACTACTTTTTAACTTGCAAACTTAGATTTCTTCTTAGTTTCAAAATAAATGTATTT
TTGTACTTGTTAGTCCCATGTTTGCAGAGTCAAAACTGCTCCAAAGAGTTTTTAGGGCTC
TGACCTTTATGGAGCAGATTGCCAGCCTGGCTCTTCCAAGACACTCTGGGGCAGTTAGAA
CAAGCAACTTTTGTTTCAGCTCGTAGTAGAGGGCTTAACCATTTGTGCCACCCAAAGGTA
CCTTTTTTTTTTTTTTTTGTAACTATTGTGATTTGGGTGAAAGTTTACACAGCAAATTAG
ACTTCCATTTTTTCTTTCATAAACAGTTCAGTTCCTCTACTTAACTGCAGTCTCCATAAT
CATACTATTCCCACTTCTTCCCTGTTTTTACCATTTTTATTTGTCCTTTCTTAATCCTTT
GCTGCCTTGTGAGTTTTCTCCTTGGATACAAATAGTGCCCTTAGGATCTTATATGACTGA
TCCTCAGGTATGCATACCTCCCGTGTGTTGTTATTCCCCTCAAAGACCCATCTATTGTTT
GGCTGAAAGTTGAGTCAAGGGAGTGAGTTCCATTCAAGGCTTGGCGTGTGACTAGGGTCC
ATAGACCTGAGCTTTTACCAGTCAATACAGCCCAATCTTTTTTTATGATAACAAGTTTTT
GTTCCACATTTTCATACTCTATCCAGGATCTTCTACGGTCATCCTTTCAGGGTGATTGGT
TGTGCTAGCCAGGCACCTGTACTTCAGTGTTTTCTAAAGTGGGCAGTACCATTCCCTGCA
GAATGCAGGAAAGATCCAGGGTGGCTGCAGAATTAGATACCTGTATGTTATCCTAGATTA
TGGGTTCCAGTACAAAAATGTATAATTTTCATAGGGGCACTGTGTAATTCCTGCCCCTCT
AACTTCCCTACAAAGGGGATGGAGGCCAAATAATTATAGTAACCCATGATTTAGTTCCTC
TGATCTCAGGGTTGTGGAGGCCAAGGTTTGCATGGTCCATTAGGTTAATTATGTCTCTCT
TATTTTGGTTATTTATTTTTTAATTATGTCTAAGTTTTTCTTTACTATTCCTTACTCTAG
ACAGGGAGACCAATAGTTGTCCCTTATGTGGCAGATCATAAGCTTTTAGGACCAGAGATG
CTACTCATCGAAACAAAGGTTGTAGAATATTGTCTTTGTGTGCTGTGCTATGCCAATTAA
CCTTGATGCCCTCTGAGACTATCATCCTGAGTTCCTAGGCTATCAACTCATTACCTTAAG
GTGTTTGGTTATGGCTAAGAAGTTTTCATAACTTTTCCCAGTGTATGCTGTACTATATTT
GAATATACATCTGCAGCACATTAAAATATGTAGAGATCGTTTTCTAGGTACTTAGAGCCA
TGCTTTATAAACTTAAATTATTAGAACCTTAAAAATGAAAACATTTTCATATTATGTGGA
ATTTTGAGATTTTACTGTATTTCTCATGTTTTGGTAAACGTTGCAACCAGGTGTTACTTT
GACTAAAAATAGAATATATATATATATATATTTCTCAAAATATTAAAATGTGGCAATGTA
TTTAGCAGATCGGGCATGTTCTCATGCATTTATTTTGAACATTTGTAAGATTTATTATAG
CTATAAAGAAAAATGAACTAATTCAGGGATTAAAGATCAAATGATAGTTAGTGCTTTAAC
ACAGGTGATTGCAGCCAGTATTCGTTTCAAATGTGAATTCCCTTTTCTTGCCACATTTTG
GCCTGATGAGCTTTTTAAATCCCCATTCCCTTGAATCAGCAGCTCAAATCCCAAGATTCC
TGATCTTTTTCTCACTCATAATAGCTGGCATATTCCTTGATAGAATTGCATGTTTCCAAC
CCATAATTTGATAGAACAGGAAGATTGTTACTGCTCTGAGCTGTTTCAATACTGCTAGTG
TACTGTATAGTAACAAATGGCCTCTGAAACATTATCCTGATAGTAAAAGTGCTCATTGCT
AATCATCCGTTCTTATTATCCTCTGAGTTTACGTTACTTGTGCTCTTATCTAGTGAGAAT
TGATAGGTGACTGTCTTGTGTATTTTAACTAGTAACTTATTAACATAGTGCCAGGACCAG
ACCTGTTGCCATCCAGCTGATTCTGGCCATTAGCGAACCTATGGGGTAGAGTAGAACTGC
AATTTAGGATTCCTGGAGTGTTGTACATTTTTGCAGAGGCAAACTGTCTCAGCTTTCTAT
CATGGAATGGCTGGTGGTTTGACCTCGAGCCAGGTTCTTAACTACTTTGACATCAGGACT
CTTTTCATACTGTAAAGATTGGTTTGTAGCCTTGGAAACCCTACAGAGTGTTCTTGCTGT
AATACTGGCTGCAATCACCTGTGTTAAAGCACTAACTATCATTTGCTAATGAGTTAGGAT
CAACTCAGCAGCTACAGGTATGATTTGGGTTTCGATTGAAAATACTTCTTGAAGGTACTT
TGTCTAGGTAAGTTTGGTTGGATTTATTCTGAAATAGAATTTTGTAAAATACTGTGTTCA
TATATTTACCACAATAAGCATCTGGCATGGATTATGAATCCGTTAGTTTGAATCAACATT
ACTAACATCGTTCTTTATGTTTGTTTTGATTAACCAGTGGATAGACTTTGACTAAGCACC
CCCAGAAAATTGCTAAAAGGGACCCAAATAATCTTGAACTATCTTTTCCCTTTTAATCTC
ATTTTAGCTGCATTGGGTGTTCAGCAGCCATCGCTCCTTGGAGCGTCTCCTACCATTTAT
ACACAGCAAACGGCGTTGGCAGCAGCAGGCCTTACCACACAAACTCCAGCGAACTACCAG
TTAACTCAGACAGCAGCATTGCAGCAACAGGCTGCAGCTGCAGCAGCTGCGTTGCAACAG
GTGAATCTTCAGGACCATATGTGACATAAGGACAATAAAATTAGCTTGAGTAGCTATGGT
CACTACCATCCATCACTTTTTAATGAATGTGGGGTTTTAAAAAAATTAAAGAATCATTTT
TTAGGGGCTCATACAATTCATCACAATCTGTACATACGTCATTTGTGTCCAGCACATTAG
TACATATGTTGACTTCATCATTCTTACAACACCCGCTTTCCACTTGAGCCCTTGGTGTCA
GCTAATTTTTCCCCCTCCCTCCCATGAATGTGGATTTTAATGAAGGCAGAGTTTTGGGCC
TTTATTCTTTTTTGTTTTATTTTGTTTTCCTGTTGATGGAAATTATACATTTAAGCCTAG
CAAATACAGAAAAAAGTATAGTTGCATATTCAAAATTCTTCAGTTTTTAAATTGGGCAGT
TTTATACCTTGAGAAATAATTCCGTTCTTGGTGGGCCCCAGAGTAGAGTATAAGTAAGTT
ATCATTCATTTTGTTTGTTTTAGAAGAGGTTAGCTAGTCTAGAACTTTTTTTTCTTCAAG
TGTAATTTTGAAGAAATATATTGGTATGTAAGTGGTTCATTATTTGAGAATGACTAAAAC
TAAAAACCATGCTTTTCTTTGTAAAATCTGTTGGTTTTTGTTTTTTCCAGCAATACTCAC
AACCTCAACAGGCCTTGTATAGTGTGCAACAGCAGGTTAGTTTATGTTTTCCAACTTATA
AAGTGGTTTGGAAATAACCAATTGTTTTAAAATTAATTTGATAATAAAGTTTAATTCCTA
TTAGCTACCTTCTATGATTTCGATTCTTTGGAGGTAGAGGAAATGAAGTTTCAAAAGGGA
ATGTGTCTAAGACAGAAATAGATAGAGGGGAGGTGTTAATCATTGTGCTTAAGTCATAGG
GTAATCTGGGAAAAATCATTCTACAGAGCTTTTGGCCCTGTACTCCTGTCTCAAACCTTT
AGCTCTACTTTGCTGAACTAAATCATATGTGCAAATGAAGTTTCTGTGTTTTCAATCAGA
ATATTGGACTCGAAGCCATTTTTTTTCTTTTCAAAGCAGTAGCTCCTACTTTTTTTCCTA
AATGAAATCCTATGTAGAAACTCAAGGTATAGAATATTAAAATAGAGCTGTTAAAAATGG
GACCTACCTTTATTTACTATCCCCACTCCTAATCACAAAGAACATTTGAACAATTATTTT
TAAACATTTTTATTTAATTCCTACATTTGAACAATTCAAAGCAAGTTTATTTGGTCGGCA
TTCCCTAGGCTCATAATCTACTCAAAGTTTTCCTTAAGGTTTAAAATTTATAGGATGAAG
TAAGGAAAACGGCCCAAGGAGAAGCATGTCCAGGAAATAACATTTACCCTTAAAGGTAAC
TGGCTCTAGCCTAAGCGAGAAAACATTACTCATTCTAGGCTTCTCTAGGGCTAGGAGATA
GTTTGTGGTCTTTCTTCATACCTGAGTCATTGAGAAATTTCAGGAAAAGTCAGATACAAG
AGAAAGTGATTAAAAGCTGGATCCAAAGACACGAGAAGCATGAGGCAGGCACTTTCAGCG
AGAAGCTCCTGTCCTGAGAGCCATAGCCCAATTTCATTCTTGGCTTAAGCTTGAGGTTTG
AGAAACTTATTTTCCTGAAAATAGCAGTATTCTACTAATAGTTTTTAAAAACCCCTAAAA
AAACTGATGAAATAGATTTCAGAATTGGGTATCTTGCTTTCAAAATATGCTCTAGACTTA
TTTTAGTATGAAATGCATTTAAGTTTGAAATGCATTATTAGATATAATCAACTGAATCAT
CTAGAAATGGCATTAAGACCAGAGTCAAACTCATTGCCATCAGTCAGTGCCGATTCTCTA
GGACAAGGCAGAACTAACTGCCCCTGGGAGCTTCTGAGACTGTAACTCTACAGTAGAAGC
CCTGTCTTCTTCCCTGGAGTGGCTGGTGGTTTCAAAGTGCTGGCCTTGAGGATAACCCCT
GTGCCACCAAGGCTCCCTAAAATGGCAATGAACTATTAAGTAGTATTCACTTAACAGAAT
TATTATTTGATATTTAACATCTGATAAAAGGCCCTCAGTAAACTGAGTGTTTTTGTCAGA
ACCTCATGGAGCCCACTTTTTCTTAGCTTAAGTAATTTGTTTCTGAGTGTTTGAACTTCT
GTGTTCCCACCAGTTCTTTTGGCTTTCCTGTATTTTTTATGTTAGCTATTGCCAGAAAAT
CAAAATTTGATCTTTCATAGTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTGATTAGTATTTTTTATGAGTAGTAGCATAATCTTCATTCTGAACCATTTTTTT
ACATGATAATTAACATGTTGACTAGAAGTCTTCCTCTTGGGTTTTGTGGACTTTTGACTC
GTGTTTTTCGTCAAATAGCAACAAAAAAAGGCATTGAATGCTTTGAGTCCGTTATTACAT
AAGATTTATATATATATATATATATCAGGTCCATAGATATTAGAAGGAGGAAACCTTATA
TGATCACTGACTTCTGTTTAATTTTTCTTAGAGATAAAGTATTTAATAGTAATAGTTTCC
TTTTGCAAAACCTTTTGTAAGCAATTTTTTTCTTTTGTTACTCTGTTTTCAGTTGCAGCA
ACCCCAACAGACCCTTTTAACCCAGGTTAGTTTGGTGTTACTTTAAGTTTTTTGGCTATC
TGAATAAATAGTAGACCATAGTTTTATTCATACTCAAGATTTTCTCTCAATATTTAAAGA
TGAATATTTGTTGAATTCACATAACAGCTTGGTAGTTTCATATTTTAAATAACGATTAAA
GATGTGTGGGGTTTCTTGTTTTCTCTGGATTTTGATTGTGGATCCAGCTGTGATCTACTT
TTTGTGTGTGTGTGACCTGCTTTTTGTTTAACTTACGGATTAAGTGATCTACAGCGTAGA
TCAGTTTTCCATTGAAGTCATACATTTTTTGTTTAATGTCATTGATTGTTATCCCCACAA
GGTAACATCGTTGACTGCTTTCTCCCTGTGTTTCCCCTTTCCAATCCTCCTCTTTCATCT
TCCTGCTCTCTGAGCTTTGTCCTTAGGTAAATGCTGTTGTTTTGGTGGTAGAGGGTTTAT
TTTTCTAAGGACGGTGTACTCCCATAATGTTGTTCACTTTATAGACCTCTATATCCTTTG
GGTAAACATTGAGTCATGGGGATAAGTTTACTTCTAGGCCTGGAGGGTGATTAAGGACCA
CATCTTGGATCTTTATTAAACTGTGGATTATGAATTTAAATGAAGATGTGTTTTGAAACT
CATTGGACCACGGGACCTTTTCCCACTGGTTACCTAAACACTTATTAAAGTGAAGGTAAT
GATGAAATAAATCTCAAAAGAACAAAATATTTAAGACTTGATTTTTACTTTCAAATTATA
CTTGAATGTTTTCTAATTTTAAATTTATGGTTGGTTTTAAGCCATTTAAATTGTTTTCCC
TTAAATTAAACCTTTTTATGTATATCTGAATATACATATATATTTTTATTAAAAGATCAT
TTTATTGGGGCTTTTACACCTCTTATAACAATCCATACATCAGTTGTATAAAGCATATTT
GCACATATGTTGCCATCATTATTTTCTAGACACTTACTTTCTATTGAGCTCTTGGTTAAA
ATTTTTGTATAAATCCAAATTATTTTCTTAATTTGATATTGGTTATGTTTTTGAGTGTGT
GTGTGGGGTGGGGATGTTTACCTTTTTCTCCAAGCTTATGCACTTTTATTTTTTCCTGAT
TATTTTTATGTGGGTATAGTTTAATGATAATTGATTTTATTCTTTAAGTTACACAGTTAT
TCTTGCTGTGATTGTTTTATAGCCAGCTGTTGCATTGCCTACAAGCCTTAGCCTGTCTAC
TCCTCAGCCTGCAGCACAGATAACTGTTTCGTATCCAACACCAAGGTCAAGTCAGCAACA
AACTCAACCTCAGAAACAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
AACAACGTGTTTTCACTGGAGTGGTTACAAAGCTATCACGACACGTTTGGATTTGTGGAT
GAGGATGTATTCTTTCAACTTAGGTAAACTTCATTCAACAGATTCTTTCTTGTATTTAGC
ATTAAGTATATAAAGCATCATCTTAATGATGGCATAGCATTGTGCTCTAACAAAAATTTA
TCTTTTTAATTATTCAGGTTTTATTTGTACCTGTGACCTTTTTTGCTTGTTTCATTACTT
TGTTTATATTTGTTTTGAGGTTTGATTTTCAAATCACTGGTTTGGTTCTTTTTCCTTTTT
ACTGGAGAATCAGATAAGAGGCAGCTTTTGATTATTGCATGAACTAAGTATGGTGAGAGG
ATTCCTGGTGGTGCAAGTCCTTAAACACTTGCCTCCTCACTGATAGGCTGTTTCCGTAAA
GATTAGAGCCACAAAAATTTTGGTAGGCACTTGTTGCTTGGTGTTCCTATGAGTCAAAAA
TGACTAACAATTATAGGTGAATTCTTTATATGTCTGAAAGAAGCTAGATTTATTTATTAA
CTAATAATACTCATAAGCAGACTTACAATGAGACTTGTTTTTTCTAAGTGAGATTAGAAG
ATAAAGTCAAAGTACGCCTTTATATGGTGCTGTAGTAGTGTAATGGTTATGCATCAGGCT
GTGATCCACATGGTGCTGTATAGTGTAATGGTTATGCATCAGGCTGTGATCCACATGGTC
GGCAGTTTGAAACCACCAGCAGCTCCAATGGAGAAAGACTGGGCTTTCTACTCCCATAAA
CAGTTACAGTCTCAGAAACCAACAAGAGGTCTCTGAATCAGCATTGACTCAATGACAGTA
AGTTTGGTTTTTTGATATGCTATTATATGTTATATTTATTATCAATAGCATTTAGATGGG
AAAATTAACAAATGAGAATTAAAATAATTTCCTTCAATAATTCAAATATGTATAGGAGGT
ACTTTCTAATAATTAGGAATTATTTTGTAAGAATTTTCTGGAAGTAGTGCTGCTTACTCT
GAAATTGTAAAAGTTAGGAAGGGACACGATGTTAGAATATGCGGCAGTAAATTGATTCTT
CTACTTCAGACCTTGTGTTTATCCATAGAGGATAAAATGTGATCAGTTCTTAAAAGAAGT
ATGTCTAAAAGATGTGTCTACTTCATTAAGTGTCTTTACAGGCTTCTCTTTCAGATATAC
ACCCTCCAGCCCCCACCCCCCTCAAAGCAGTTGTCGATTTGATGCTGACTATAATGACAA
CTCGTGTGCTCCAATAGAGTTTTGAGATGCTGATTTCTCAGAAGTAGATATTCTTCAAAG
AGGGGACTGAACCTCCAAACTTTTGGTTAGCAGCTGAGTGTGTTAATCTTTTACACCACT
CAGGAACTCCTATTTCAGATAGTCTATTTAAAATATTAACTACTACATAAAAGTTTTACT
TGCAGGGGAGGGAGTCTCTTTTTAATTATATTGGTATTTAACTTTTTTATTATTACTTTT
GCAGTGCTGTCAAAGGGAAAACACCTCAAGTAGGTGACAGAGTATTGGTTGAAGCTACTT
ATAACCCTAACATGCCTTTTAAATGGAATGCACAAAGAATTCAAACCCTACCGAATCAGG
TATGTAAAATAATGAGTTAGGTATTATAGAAATAGGATCATTTGGGTCTTACATTCATTT
TGTTTGTTTGTTTTTTAATTTAATTTTATGAAGAATCAATCTCAAACTCAACCTTTACTG
AAGACTCCTCCTGCTGTACTTCAGCCAATTGCACCACAGACCACATTTGGTGTTCAGACT
CAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCTTTCCCAAATTTGCATTATAAGGACTTTCAATTAGAGACCATCCTAAAGAG
TTAATTTCCAGATCACAATAAAGTAAGCCACATCAATTATTTGGTTACCAGTGCATATTA
TAAAGTTATGTTTGGGGGGAGTGGGGAAGGAGAGGGAAAATGAGGACCAAATGCCGGGGG
CTTTAGTGGAGAGGAAATGCTTTGAGAACGATGAGGGCAATGAATGTACAAATGCGCTTT
ACACAATTGATGTATGTGTGGATTGCAATAAGAGTTGTATGAGCCCCTAATAAAATGATT
AGAAAAATAAATAAAATTTTAAAAAATAAAGTTATGTTTGTACTATACAGGAGCTTTAGT
GGCACTATTGGATAGGTGTTAGACTGGTAACTGCAAGGTTGGTAGTTCAAACCTATTCGC
CACTATGCAGGACAAAGATGAAGCTATTTGGTCCCATCAAGATTTAAAGCTTAGGAAACC
TTATATAGGGTTGTTGGATGGCAATAAAGTTGGGGTTTTTTATTTCTTCTTCCAATAGTC
TCGTAAATGTACAATAACATAAGAAAATTTGAAATATTGTAAGAATTGTCAGAATATTAC
ATATAGACATGAAGTGACAAAATTTATTGGGAAAATGATACTCATAGACTTACTTGATAA
AGAATTGTCACACAAGTTCAATTTGTAAAAAAAACAGTGAAGTACAATAAATCGATATAT
GTATATTCAGAGAAGTTGCAAGAACAATGTAATAAGTTTCACCATATTTTTTTCTTTTCA
TATACGTGTGTATACAATATACGCATACTTCTTTAATCTTTTGAAGTAATGAGCTGGCAG
TGTGACCTTTTCCTTTAAATATTTAAGCTTGTCCCTCCTTAAACATCTTTTTCTGTTATT
ACAACCCATTGTCATATCTAAGCAAAAACGGTTCTTATAGTCAAATCATAAGTAAAAACG
TGTTACAGTGAACCCTCGTTTATCGGGGTTAATCGGTTCTAGACCCTACCGTGATAAATG
AAATTCCATGAAGTAGGATTCCTTATTTGTAAATCAAATATTTTCGTAGTTAGAGCATAG
AGGACATGAAAAAACACCCTTTAGTCACCATTACACTCGTATTACCCAATTTATTAAACG
AAAAAGGGAAAATACAGTAAAACATTTTGGACGTTACAATTATCATTTATTATTATATTA
TTTATGGCATCTGGTTTACAGTATTACATATTTCACATACAGTATTATACATAGTTCTTA
CAAATACTGTAATCAATAGCCTATGAAATGACTTAAGGGATGTACTCTACATGTGGGTCG
CCGTCTTTTTCCTCTGAAGGAGCGGGTGTAGGCAGTGGGTTTCTGGGTACACGTTTAAGA
AACATTGTGATTGGCAGTTGCCGACGTTGTCTCTTCATTTCAGTGAAAAGGTTTTTGTAG
GGTTCCATTGCCCCATCGAGTGCATTCCGGAACCGTAATGCACGATTCATTTCTGGATCC
CATTCTTCAATCGTGTCCTGAACTTCTTTGATTGTTCTTACGATATGCGAGAGACGCTCC
ATTGTGAGGCCAACTAACTCCTCATGATCCTCAGGAACCTCTGACTGCTCTTCCGTCTCC
TCCTCACTTTCAGACTTAGCTAGTTCCACCAAATTCTCATCATTTAAATGATCTGAAGAC
TCCAGCACCTCAAATACGTCATCGCGGTTCATATCCTTGAAACTTTCTCCTTCCAGTATC
TGGGCTAGTCTCACTGTGTTATCCACTGCCGGGTTTCTGACTTCTTCTAGGGTGAATTCT
TCAGATTCCTGGACAATTCCAGGCCACAACTTCTTCCAGCTGGCCTTTGTCGTCTCTACC
TTCATGTCTTTTAAAGTGGCCTGGATGTTCTTCAGACAGGTCGCGATGGTATACAGCTGC
CAGTACTCCTTCAGTGAGAAGTTTTCCTTAAGGTCCATGCCTTCGATGAGGTGTTTTAGA
GTGTTTCGCATGTAGAGAGCCTTGAACGCGCGAATAACGCCTTGATCCATGGGTTGGATC
AGCGAAGTGGTGTTGGGAGGAAGGAACTTGATCCTCACACCATTATAAGATAGATCTTGC
GCATGACCTCCAGCATTGTCCATGAGGAGAGTACTTTAAATTCGAGTCCTTCTTCTCGAG
ATATAACCTGACTTGGGGATGAAGCACTCGTGGGACCATTCAAAGTCAGCTGCTTCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAGGGCTCTAGGATTC
TTGGCCTGTAGATAAGGGCCGGCTTGAGCAAAAATCCCTCAGTATTTCCACAAATAACGA
GAGTGACTCGATCCTTAAAAGCCTTGAATCCACGGACCTTGGTTTCATCCTTAAAAATAA
ATGTTCTGGAAGGCATTCTTTTCCAGAACAGTCCTGTTTCGTCCATATTGAACACCTGCT
CAGGATGATACTTGCCCTCCTCAAGGATCTTCTGGAAAGTATTGTTCATGTAGTCCTCTG
CTGCAGGCTGGTCAGCTGAGGCAGCTACTCCGTGAAGAACGACACTCTGCAGTTGATACC
TCTTCTGGAACTGTTCGAACCAACCCTTGCTCGCTGTAAAATCCACGAACGTTGCAGAAG
AGGATTCTGGTTGAGGTTTGTCTGCTGTAAAACGCTGATAGAGCTGCCTTGCCTTCTCCC
GGATGACTATCGAATCCAACGGAATGTTTTTCTTGCGCCTGTCATTGATCCAAACGGCTA
GGACAGACTCCGTTTTTACTGTGAACTTATTACGACTTGTCACGATGCGCTTTGCTTCCT
TGTTGAAAGTGAAAGTAGCCTTAGCACGGATGTTTTTTTCCTCTTTACGGATGAAGCGAA
CAGAAGACTCATTCAAGTCGAAATGGCGTGCAACCTCCACGATTTTCTTGCCATCTTTGA
TCATATCCAAAAATTTTACCTTTTCCTGGATGGTGAGCATCTTCCTCTGGCACTTATTTT
TATTGTCAGAAGGCTTAGAAGCAGCAGCTCGTTTAGGAGCCATCATAGGGCTTAGATAAA
ATTTCTTAAAAATCGCAAACAATTACAGTACACTGTACAAAAGCAAAAATGCATCTGATA
CGTAGCTCCGATACGTAGCGATGCAGACAGAAGCGTGTACAGTATGAGCCAATCAGTGGC
AGTAATGACAGAGCATGCGCTGTTAACGCAAAAACTGCGATAGAGTGAAGCCGCTGAAGT
CGAAGCGCGAAGTGGCGAGGGTTCACTGTATAGTCCTCTTTCCCAGGGGTCCGTAAAATA
TTTAAAGTCTCCCAACATCCTCCTTAAAGAGTAGCCAGGTAGACTTCATTAAGAAACATT
GTGATTGGCGGTTGCCAAGTAATCTTTTACTTACAGATTCTTGTGGACTCTTTATTGGTA
TGGATTTGTTTTGATTTCTTGTGGTGTTTTACTTAATTCTTCTCTTTCTCTTGGGGCTAG
GCACTAATTAGAAGGTATGCCAAAGCCTTTTGACAAAAATACATTATGGATAGTTTTATA
GAAGGCTGTGTTAGGTTCTTTCATTGTTATTGATGCCAATTTAATAACTTGGTCAAAGAT
AAATGTTACACCTCTTCTGTGGAAGATGTTCTTTTTTCCTTTGCAGATAATTAATATGTG
AATGATTCTGTAAATACTTTGTTATGCATCCTTTGAATATACCCTGTGAATAGCTTGGTC
TTTTTTTTTTTTTTTAATCATTTTATTGGGGACTCATATAACTCATCACAATCCATACAT
CCATCCATTGTGTGTCAAGCACATTTGTACATTTGTTGCCCTCATCATTCTCAAAACATT
TGCTTTCCACTTGAGCCCTTGGTATCAACTCATTTTTCCCCCTCCCTCCCCACTCCTCCT
GAATACTTAGTATTTATAGAACTGGCGCCAGTCATCTACAGCTGTTGATTAGGCCCTAGC
TAAGACTAAGGTTGTTATTTACATTTTTAAAGGGTTGTAATAAAGGAAATCATGGCTCAA
GACCATATGCAGATCACAAAAATTAAGATATTTACTCCCTAACCCTTTAGAGAAAATGGT
TCCTAAGTCCAACGTTAGGTGATTGTTTTCCTGAGTCAATTTTTCATTGTAAGATTCAGA
ATGGGTATTTTTCTAATTCTATCATCTTGTTTCCGTCTATCAGCTGTCACAAACAGAGAT
GAGCATTTTTTTCTCCTTTGCCAGGAGTTCTGTTTCTTAAAAGTATTTTTATGATCTTGT
GGCCTTTCATTTTTCAACTTGTTTATCTTTAATCATTTTTGTTTTGATCCTTTAGTTACT
CAGATGTGGGCAGTGGGAATTCTTTCAAGCTGACTATATTCCCCATTAGATTTTTAGCAC
TTTTTTCCTTTCTCATATAAGATGTCCCATTTTGCCAAGTTGTAAACTTGCCTGTGTTTT
CTGAAGTGGCTCTAATGCCTGGAAGGGGGAAGTAAGCATCAAAAAAGCANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGC
CCCTGTGCAGGGATGTCAGGCAAATTTGTGAATGTTTTGTGTGTGTGTGTGTGTGTGTCC
TAAGGCAATACCTATGTTGTTTTGAAAGATAAATTATGATTTTCAATTATTTGGCAGTGC
TCCATAATGTTATCTATGAAATATAACCTGATACTTTAGAACTTGTTTAAATAAGCTTTT
TTTTTTGTTCCTGTGTCTTTTGAAAGCTGGATTATTGCAGCCCCCTGTCCGTATAGTTTC
ACAGCCACAACCAGCACGAAGGTTAGACCCCCCATCCAGATTTTCTGGAAGGAATGACAG
GGGGGATCAAGTACCTAACAGAAAAGATGACCGAAGGTATGTTAAAGTCTCTATTGTGGC
CATTTGTTTTTGTTACCATTACACTTTATTTATTAAAGAACTCTTCCATGTTGCCAAGAA
ATGTTAGTAATTTAAATTTTTTTTCTTTTAAGTCGTGAAAGAGAGAGAGAAAGACGGAGA
TCCAGAGAAAGATCTCCTCAGAGAAAGCGTTCGAGGGAGAGATCACCCCGGAGAGAGAGA
GAGAGATCACCTCGGAGAGTTCGACGTGTTGTTCCACGTTACACAGTTCAGTTTTCTAAG
TTCTCTTTAGATTGGTAGGTTCTTTTTCTTCCTTTTGTTTTTATTGATTACTGATTTCAT
AGTTTGTAATACAAATACAGCCTTTGCCATTAGAAATCATGTTCATGTTATTAAGAATTA
GCCTCATCCACAAAGTAGAGATACTTTTGAACCAGCACAATTATTGTAAGGATAAATTGA
GTTGCTGTCTATTGTTAAAATTTTAAGCACTTGATGGCATCAGGTTGTGGTGATTCACTT
CTGATGCATAAATTGGGCAAACTGGTAAATAGTTTACTCTAAGGGAAAGTTAGAAGAACC
TATTATCGCTGGGACTGTATAAAATAAATCAGCAGGTGGAAAAACCAAGAATAGCTTTAA
ACCAAAAATACCACCTGAAGTTGTCTTAAAATCAATCAATAGCTAACTATTTAAAAACTG
CGCTTGAGTGTTGTGTTCGTTTAAGAACTGTATCTGCTCACAGTCAAAACGGCAGCTAGA
AAAGTGACAGTGGAGTGGTAGGGTGGATTGGAGGGGATTATGTTAATGGGGGAAGAGTGA
CTCAAGTGAAGGAGCTACAACTTGAAAGTTATTACAGGAAAAGTTGAATTTGTGTTTATT
TTGTTATGTGCATTCTCAACAGAAAATATGTTTTTTAAATCAAGCAGGAATAATTAATAG
TAAAATAAGAAAAGTGACACACCAAAAGGAGCTTAGAGTAGAAGCAAGTGCTACATATAC
TTCATTGAACTTGAGAATTAGCTTTAGTATTTTGACCAAATTTAATAATTCAGTTCCTAT
CTACCAAAAATTAAAATTTATCTGTAGTCAATTATAGTGTTATTCCAGGACAGAAACTCA
AAATCAAACTCATTGCTGTTGAGTCAATTCCTGCTCCTAGAGACTGGATAGGTCAGAGTA
GAGCTGCTCTTAGGGTTTGCAACAGTGTTAACCTCTCCAAGAGTAGAAAATTTAATCTTT
CTCCTTTGAGTATCTGTTGGTTTTGAACTGCTGACCTTGTGGTTAGCAGTCTACTCCTAG
AACACAGTGTATTTTATTTTAGTCTTAAGAGAAGGAGGATGCTTCAGTGGTAGAACTTCT
GGGTTCTTTCTCAGGCAGTGTCACTCAGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTATCACTATCTTTTAACAGATGTTTAATCTGAAAGTAGCTAGTAGACTA
CTTTTAATTGTGTTTTTAAATGAAGTCTCTTGACTTCATCAGATTGATTTACCTTGAGTT
AGTCTCCTTTAAAATTTCTCCTCAAGAAAAAGATAAATCATCTTTTAAAAATATTGATAT
GCCAGATGTAAAAGGCAAGAGACTTGTCTCCATTATAATAATCAGATTTGGCTCTCTGTT
AATCACCTAAAAGGGTTTGGAAGTGTGGATAATCTTTAAAGCACTAGGGTTTTGCTTTCC
TAAGGATTTTTATATTTAATTTTGAATGTGGCAGTTGGGGAAGTTTAGTAGAGAATAAAA
GTTGTATTTTTTTCTACATCATTTAGGCCTGATTGAGCAGTACGCAAAAGATAATTTGCT
ACCACTCTCATCCCTCCTTTGTACTACCTATATGAACCATACTTGCTTAGATAGAGTTCC
AGCTGGTGTAGAACTCCTTTGGTTCAGATCTTTTCTGGAGTCAGGGTTGAAGTTTATTTC
ATTTGAGAGGGTCTTTACTAATTGTTTGCCACACACAAAAAGTCCTGGGAACTATTGGTA
AACAAATCTCAAACTAAGGCTTTGGTTCATCTTTGCAAATGTCTGGCTCATTTATAACTG
TCCATTTTCAGCTGACTTGTGTTCTGTTATTTTTAGCTTTATCACTAAATATGTTTGCAT
AAACGTTGGTATCAGGCTGTCATTTAGTCACTATTCCTGTCTGTTTTTCAGTCCTAGTTG
TGACATGATGGAACTGAGGCGCCGTTATCAGAATTTATATATACCTAGTGACTTTTTTGA
TGCTCAGTTTACGTGGGTGGATGCTTTTCCTTTGTCAAGACCATTTCAGCTGGGAAATTA
CTGCAATTTTTATGTAATGCACAGAGAAGTAGAGTCCTTGGAAAAAAATGTGGCCATTCT
TGATCCACCAGATGCTGACCACTTATACAGTGCAAAGGTTTGTATTCCACTGTGAAATAC
AGCATACATTTCTTAGCATTTATTCAGAATGGGACAATTCTTCAGAAAAAATGTTAGATG
TAGGACCTAATTCTTTCTCTCTCTCTTTTTTTTTCCTCTAAATTTACTTTGGGTACTTGG
AGCCTAGTAACACAGTAGTTAAAGTGCTAGGCTGCCAACTGAGTGGTTTAAACCCACCAG
CTGCTCCACAGAGGGTGATGTGGCATTTGCCGTCCATAAAAACTTAACAGCCTTGGAAAC
CCTGTGGGGCAGTTCTACTCTGTCCTTTATTATGGGGTCGCTAGGAGTTGGAATAGACTT
GATGGCAGTGGATTTTTTTATATACTTTGGTTATTTAAGTAATAGAACCTTTCTTTGCTT
TAGCTCTTAAATTGTAAAACTAGTGCAGATTGAACCTCATAAAAATGTTAATATTTGTAA
ACTTTGGAAATTTTTGTGATCTTGTATACTCTGGACAAATATATTCAATACAGTTTCTGC
TAAAGCACTTTACCTTCCATTTTAATAAAAGATTTCAAATATGTACTATGTAAGGATAAT
TAGTAGTGCTTCTCATTTTTTTACATTGCTTTAGACTTTTGACAGGATTGAATTATTTGA
CTATAATAGGTAATGCTGATGGCTAGCCCTAGTATGGAAGATCTGTATCATAAGTCATGT
GCACTTGCTGAAGATCCTCAAGAACTTCGAGATGGGTTTCAACATCCCGCTAGACTTGTT
AAGGTAAAATGAAACATTCATTTTTAACTTAATATTCTCTTTGCTTATTTGTAATTGCAT
ATAAATAAAATGAAAAATATTATGTGTATAATCTTGTTTTATTAGTTGAATTTCTTTTAA
GGCACTCTGAATGAAAAAGTTACTGGTTTATTGCAGATTATGGCTATTTATGTGTTGATG
ATTAAGGTGTCATTTGGTATGGGTAGCATGCTGAAATTTTAGTGCTTAGAGGATTTAGTA
TATCTTAAGGTGCTATTGCAGTTTGAATTATAGCTTGTTTCCTTCGAAAGAATTCTTAAT
CTGAAGAAATGCTTTTAGAAGGATGAGTTGTGATGTGTAAATCCTATTCCATTGCTGAAC
TGCAGTGTGGAAATGATGAACTGAACTCTTCCTTGACTGATACCAGAGGTAGTAAAAATA
ATAATGGGAATGCCTTTTCCGTCTCCAAATATTTTCTTTATAAATTGAAAGGTTGCATTG
TACATATAATAGCTATTTATTTTGAATTAGTTTTAGTGGGCATGAAAGGCAAAGATGAAG
CCATGGCCATTGAAGGCCCTTGGTCTCTTTTCGTTGGATGGACCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNATTGCCGAAAATACAAGGAAGAAGAATAAATAAAAT
CAAATTCTTCACTTGAATGTGTCCCAGAGGATGTAAAAATTAAATAAGGGAAATGCCATT
CCGTCTCCAGAATAATTTCTTTATAAATTTGAAAGGTTGCACTGTACCAATAAATAAGTA
TTTATTTGGAATTAGTTTTTTAGTGTGCTGAAAAGCAAAAGATGGAAGCCCATGACAATT
GAAAGCCCACTGGTCTCCTTCCGTTGGATGGACCCAGACCCCAGAAAAAGACCCTCGGTG
TTGATTAAGACTGCTATTCGTTGTTGTAAGGCTCTGACAGGCATTGATCTAAGTGTATGC
ACACAGTGGTAAGTACCAATTCATTTCCTTACTAGAAATGTTTTCCTAGTAGTTTACATA
GATGTTTCTGCCAATCAGCCTTCCCCTTGGCCACCTACCCCTATTATTTTAGCAACCTTG
GTCCTGCAGGTAATCTCAAAGGAAAATCCCTAATTGTAGCAACAGTTTATTTGGTGCCAA
AAGTGTTTTGGGGGGGGAAACAGTTAAGCACTAATCAAAATAAACTGGAAATTAAAATGT
TTTGTTATGCTGTATTGCAGAAGTTGGATGTATATTGAAAATATTTTTTATTTCGTGCAT
AGCTGGAGAAGATCGTCAAGAGACAACTTCATTTCGTTTTTTCTTTTGTTATAAAATAAT
GTAGTTGCTGATTATTTTTGTTCAGCCATATTTTCTCTTGAGGCTTATTTGTCCTTTGTA
TTTTAGTATATTTCTTGTGACTTAATTGAGATTATTCCTTTTTTAGCATATGAAATCTGA
ACAGCTATCCAGCTTCTTCAGGTATTCTCTAAAATATGGGTAGCTCTATAATCAAACTTG
AACATGCCTTGGAGGACATACGTTTCTTTTAACCAATGAAATGTACAAATGTACCAAAAG
AGGAACTATGGCTTCTATAATTTTTTTTTCTTTAGACCAACCTCAAGTTCTTGCAGCAAA
ATATCTTTACTTGATGTGCTACAAGTGATCTAGGGACTTTAAAATGTATTTTAGAATTTT
TTTTCCAACATGCTTCTTCCCTTGCAACAGGTACCGTTTTGCAGAGATTCGCTACCATCG
CCCTGAGGAGACCCACAAGGGGCGTACAGTTCCAGCTCATGTGGAGACAGTGGTTTTATT
TTTCCCGGATGTTTGGCATTGCCTTCCCACCCGCTCAGAGTGGGAAACCCTCTCCCGAGG
ATACAAGCAGCAGCTGGTCGAGAAGCTTCAGGGTGAACGCAAGGAGGCTGATGGAGAACA
GGCACTGAACGCTAATCCCTTTTTCTATTTCCGCTTCTCACAGGCACAGGAACACAGGCA
CAAATGCACACCACACACTACATAACAAACACACATGGAGGAACATAACTGGTAACAGCG
ACTGGTACTCCAGCTTTCAGCAGTATAGTTGTATGCTCTTTTCTCTGAAAAATTCTGTCT
ATTATACTAACTTAAGAGTGCTGAGACCTCAAAGGAAATAAGTTGTGCTTAAATTGCACA
GAATTTTGTTTTCATCATAGGTCTAGTTGCTGGAATCTGGGACCAGTTGTTGAGCAAGAT
TCAGTATTAAGCCATTTTAAGCACTTTGCCATTTTCTGAAATTTAAAAAATTTTCTCTTT
CACTGTCATCAGTTCTAGTCATGGATATTTGAAATTGGACCACCCACAAGTCTGAGAGAT
TTGAAATTTCAGGCTATGTGGCAACGTCATTGGTACATTTGAAAGGTCTGACTAAAACAG
TCTTAACTTTGGGTGGCTTGAAAATTGGGGCAAGATCACACACTGTGTGGTTAGTGGAGA
CCAGCAGTGTTTGTGCATCCCTGATATCTTTTGTGTTGTAATTTATCACCCTTTTGTGTT
TCACAGATCTGGCTTTGATTGGCTGATGAGTGTCTTTGTTATCAGTTAAAGTGATAGAAT
GTATGTATGTGGACTTGCCTAAATAATAACTTTAGGAGAAGACAATCTGAAACATTTGTG
ACCTTGCACAGATCAGCAACAGACTTTTAAAAATAAATTACTTTTATTTTAAGGCTTCAG
AATAGTAATTACGGTCTTAATTTTGCATGTCAGGATGAGGAAGAGAAGGATGACGGTGAA
GCTAAGGAAATTTCCACACCTACCCATTGGTCTAAACTTGATCCAAAGACAATGAAGGTA
ACTTTGAAAGTGCTTGCTTTTACTTTGAAATCTCTGAAAAGGAATAGCATAACATTGGAG
AGAATGAGGACAGTGTTTTCTTCCTGGTTGGCGGTTGATTTCCCACATTGTAGCCATTCA
AGATGAAGCCCAGTCTATTTAATCTATTTTTAAAGGACTGGTTTGCAAAGTCATCCTTGG
TTTACATATTGGTGTGACTGCAGCCAATAGCTTTTAAATGCCAGCCTCATGCAAGTGCTT
TTTAGTGTGAGCAGTGTTGTCTTCTTGTTAATAATTTCTGCTCTTGAGTAACTTAAGTTC
CAGAAGTTGTAAGCAGAAAAAGGTTATCTAGATTTAAAAATGAAATTTAACACAATGTAG
ATTGGTGTACACCTAAATTGGGAAAGAGATAATAATTTTAAGAGCCTGTTTTTGAAAGTC
TGGCTTACTTTGTACTCCTAAGCCTCTGGACCTGTTTTTTACCGTATAAGCTTCGGCACT
CTGGGCCCATGAAGTGAACGTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGCTACAGCTGTGAGTCTCAACATGACAGTGATGTGAGATGCACAGACTGC
AGTGTTCATCTTGTACATAGTCACTATGTGTGAAACAACTGCTGCACTTAGTAACAATGT
CTATAATGGGAGACTGACACACTTAGTTTGGATGAAACCGGAAAAGCAAATTCTGTATAT
GCAGGAGCAAATGCTATATATTGGCACTTTCATAAACTTAGGAAGTTTTAAGCTGATTTT
TCCTGACAAAATTTTAGACATATCTGTATTTAAATAAAATAGGTGCTGCTATTAGAATTC
TATTGTGCATAGCTCTTAGCACCTATTATATTTGGACAGATACTTGTTTCTAAATCTGAG
AAGATACCAAATGTTTATTGAACTGGTAAAAGACAGTAGTGAATATAGATGTTCCCATTT
CATATTTGGATCTTCAAATTGGACAGTATAGATTTTAAATGTAAATCTGGGATTTGTGTA
AACAACTTATGTTTGTACTGAATGTTTATTATTTATGGGCTTTTTTGGATTTTTGATAAG
TAAAATAATTTCAGTCTGAATTTGCTGACACATTACGACATTAAGGCAGTGTTTTATGAA
TACCTAGCCTTAGGAGGAGCCCTGGTGGCATAGTGGATTACACCGCAAGGTCAGCAGTTC
AGATGCACCAGCAGCCCTGTGGGGTAAAAGACAAGACTTTTTCTACTTGCTTAAACTGTT
AGGTCTTAGAAACCCACAGGGGCAGACTTACCCTGTCCTATAGGGGCAGTATTTGTCTGA
ATCCCCTCGGTGGCAGTGAGCTTGAGCCTTAGCTTTGTTATAAAAATCTAAATGAAGCAC
AACTCCAAATGGATGTAAAAACTACAAACTGAATTTGCTCCATCAAGGCAGTGCTAACAC
ATAGTGACCCCCTGTGGGTTTTTGAGACTGTAACTGGTGAAGGCAGTTCAAAGCCCAATC
TTTTTTTTAAACAATTTTGTTAGCATTCTATATGTAATACAATTATTACCACATTCAATT
CCAGAATATTTTCTTTTTTCTTTATAATTTTTTTCCTAGAACATTTTCTTCCTTGTACTC
AGTTATTTTTGTAATTATTTTTTTTGCAAATTGTGGCAAAAATATACATGCCAAAACATC
CCCCAATTCCACAACTACTACATGTATAATTCAGTGCCATTGATTATACTCTTTGTGTTG
TACAACCATTATTGATATCCTTTTCCTAATTATTTCACCACTGTTAACATTAGTCAATGT
CCCCTAAGCAACAACTATGTGTCCTTCACCCATGCTGTTGGTCAAATTTGAGTTTTTTTA
AGTAGATTTCTTGATAGAGTATTCTCATATCATATACTTCTATGGTTAAGTTGCTTTTAA
AATGAGTTGTATATACATGACTGCCATCAATTCCAGCGCTCATTATTTCATTCATTATTT
CCTCCCCAAGTCTCCTTACCCTCCCACCTCCCACCACATCCCAGATAAACCATTGCATCA
GTTATTGTCTATATTCATCTATTTCTGTGCTTCACAAAATGGGAAACCCAACAGAAACAA
TAAAAAACAAAACATCGAGAAGAAAATAATAGTATACAGATAAAGTAAAAATAAAGAATT
AGAGAATACCATATTTAAAAAGCCACGGAAGAAATTTCTGTCGTGGAACAAGGCAAGAAG
TACTTGAATCTAAAGCAAATGCAGGTTGGGAGTAAAAGGGAGGTCACCTGACCAATTACC
ATATTATAACATGGTTCTATCCATCATGATCAAGTTTACAATAATATCTGATAGTACAAC
CATTTGAGTCCCTTGCCTGTTGTTAGAGGGGATCTGTCAGAAGCTTAATCCAAGTACTCT
GCAGATTGATTGGGTTCTCCCTGTCCTCCATAGTTTTCTACGAATAGGGTGTTCACAGTA
AGCTCTGATAACGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAACTTTTTTTTACTATTGAGCACAATCCA
GAATAAAGTGTGGTTATATGCTTTTGTAGCCCTCCTGGACAGTTCCAGTGCTCCTCTGGG
GGCACTATTACCTACTTGAGGAAACACTATTATATGTGGTCACTGCTGTGGGTCAGAATT
GACTCAGTTGCAGTGGGCTCAGGGTTTTGTTTTTTGTTTGTTAGCCAAAGCCATACTAAA
CACAGTATATCAGTTTTAGAAGATTTTTTGATGATTTTGAATGTCTTCAGCGTATATACT
TACTGTAACTGTATTGTAAGTGCACACAATTGTTTTAAAGGAACTATTGAATGCAGTTTT
GAATATGTTGTATTTATTAAATCAGTGTTTATTAAAATTGACTGTTAATCTTGGTATCTT
TTTATAGGTTTCATTGTTTGCAGAACTTTTCAATGAAATGCTTCAGAGAGATTTTGGCGT
AAGAATATACAAGTCATTAGTATGTCTTCCTGAGAAAGAGGATAAAAAAGAAAAGGATAA
GAAGAGCAAAAAAGATGAAAGAAAAGATAAAAAAGAAGAACGAGATGATGAAACTGATGA
ACCAAAACCAAAACGGAGAAAATCTGGTGATGATAAAGATAAGAAAGAGGATAGAGATGA
AAGAAAGGTCTGTCATTATTTTTATAAGCAGCACTCTGGTTTAGAAGTTTTAATCATCTC
TAGATTGTAACAAAAATGACAGTGGATTCTATCAGTAAAATTAAAGGCCAACTAAAAAAT
GGTAATGTAATATTGGGAATTTTTTAATCTACGTAGACATGTTTAATTTTGTGGTGACTT
ATTAAAATTATACTTAGTGTTCTAAGATATTTGTAATTTCATACTATTTCAAGTAAACTT
ACTGAATTTTGTTTTGTTTTTTCCCATTTCAAAATATTTAATGTTTGATGAGGTAACTTT
TACCTAATATTAAAGCATTTTAAATTACAGAAAGAAGATAAACGAAAAGATGATTCTAAA
GATGATGATGAAACTGAAGAAGATAATAATCAAGATGAATATGATCCGCTAGAAGCAGAA
GAGGCTGAGGATGAAGAAGATGGTATGAACACTCAGTTTTGTTTTTTTAATGATTAAGTT
ATTTTTGTTTAATATTTTTATTTATTGTACCATTAAAGTCTAATTTTTAACTTTTAAAAA
ACTTTGTGAATTAAGTGAAAATTTACAGAGGTCATCAGTTTTACATTCAACTACTCTTTC
ACATTTTGTTTCAATCCTTTCATTTCTCCCACATTTTCTGTTTCCAGTTTCTGTACCTCC
TCTTTTCTTAATCTTTTGATCTTTAATGGTTGATTATTTTTCATTGCTATTTAGAGTAGA
AACAGTAAAAAAAATTTTTCTAGTGAAAATCTTGTTATATTAAGTAATTCAGTATTTAAT
GTGAGAAGATTTTAAAGACATACATGATTAGATACCATATACTTCACACCTATTTGATTT
ATATCCATTGCTTGGACATGGTCTTTAAACTGTTACAATGGCATACTCTAGTTCCAAAAG
TTTAATAGAATATTAGTCCCAATTTTAAGACAATGTGAGCCTTGCATTCCATTTTCATTA
TGAAAACTACCATATATGCAAAAAAAATCCAACAAATCCTGACCTTTACTAATGTGCATA
TTTAGGATGTTTTACAACAGATGTTATAACTATTTTAGCAAACATTAGCCATAAAGTACC
TGTAAAGTAATGTCGAATGCCTGTCAGGCTCCAGGCAGATAGTAGCTTTCCAATTTTTAA
TAGCTTGTTCTGAAATTGGAAGATCACAAGAGATTTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAAACACAGTACAGTCATGAGTTTACTAGTCTCTGTATGTTGCCACTAAGGAAATCT
CAATCGTTTTAGTATTTCTCTCTGTGCCAAGTGACCAGTGTGTCTGATTTCTTCCTCCCA
GAGACTGCTCCAAATCAGCATGTTTTAGCTGAAGTGAGGCAACGATTATTTTCATATCAT
TGCTATTATATGGACATAGTCTTAATGTTTCCCTTTACATGGGTTAAATATATTTATATA
TGAAATCTATTTCTGCATTTTCTTTAGGAAAAAGAAAAGAGTCAGATGATCACAATTAAT
AGGGATCTGTTAATGGCTTTTGTTTATTTTGATCAAAGCCATTGTGGTTACCTGCTTGAA
AAGGATTTAGAAGAAATACTTTATACTCTTGGACTGCATCTCTCTCGGGCGCAGGTAATG
TATTTTATAAATAATTTAAGAGTAAAAAAAAAATTTTTGTCACTATTAAAAGGAAAAGAA
AACAGGATGTATTTGTTTCCACACGTCATCTTTCTGATCTCTGTTGACTTACGTTGAATT
AAAAAAAGAATTACAGAATAATTTTTTTACAGGATAATTTTAAATCACTGCAGTAATATC
AGAATATATAACTTTACGAAGCCAGAGTTATTCCTTCTCTTTCCTTTAGTTCCTGTACTC
AAACTAAATCACTGTGTAAACCTCTACATCAGTGGTTCTCAACCTCCCTAATGCCACGCG
ACCCTTTAATACCACTTCCTCATGTGGTGAACCCAACCATGAAATTATTTTCGTTGCTAC
TTCATAACTGTAATTTTGCCAGTTATGAATTGTAAGTATCTGATTATGTAATTATATATT
GTGAAATGTTTGTGCTTCCCAATGGTTTTAGGCGACCCCTGTGAAAGGGTCATTCGGCCC
CCAAACAGGTCACGACCCACAGGTTGAGAACCACTGCTCTGCATTGTTTTTATAGTAATT
CACCTTATTTTAACAGAACATAAAATTACTTTTTAGATACATATTGGTAACTCTTCTTTG
GATTCTTAATACATATATTTTAATGCATATGTACTTGTTATCTTTGCTGTTATACTTTCT
ACCCATGAAACTTTTTCCCAAAATGCTACTTTGGATTTAATGAAAAGAAAGAAAAGGTGA
AAACACTAATCTGCTGTAAATGAATGGAAAGTATACTCTTCCTTTACGATCTCTTAGGTC
AACTTTAGAAAACCCAAGACATTAGGCAACATAATTTAAAAACAGTTGCTATGAATGTTC
ATGTGTGAATAGTAGGAGAAAATAACATTAGGAGAGCCAAATTTTTTTCATCTTTTTAAT
TTTTATATTTTTAGTTTTCAACTTTTATTTTGTTTTTTGTTTGTTTGTTTGTATAACAGG
TAAAGAAACTGCTTAATAAGGTAGTACTTCGGGAATCTTGTTTTTACCGGAAGTTAACAG
ACACCTCGAAAGATGAAGAAAACCATGAAGAATCTGAAGCATCACAAGAAGATATGCTAG
GTTTGGATGTATTGTTTAACATCATGCTTTGTTTAACTATATTACTTAATAAAGAAGAAA
ACAATAAAATACAATACCTTTTACATATTACAGGAAATAGGTTGTTACTTCCAACACCAA
CGGTAAAACAGGAATCAAAGGATGTGGAAGAAAATGTTGGCCTCATTGTATATAATGGTG
CCATGGTGGATGTAGGAAGCCTCCTTCAGAAATTAGAAAAGAGTGAAAAAGTAAGAGCTG
AAGTGGAGCAGAAACTGCAGTTACTAGAAGAGAAAACAGGTAAGGAACAGCAGTGGATAT
GTTAGCACCTTATAGGATCTACAAGGGGCCTCCAAACAGTTAATTAGACCATTCTGTTGT
CTTTTAATTCCATTTGCTATGACATATGCCTTAGTTTTTAGTCCAGGCACCTAGGTAATT
TTTGACCATTTTTGTTTTAGTTGTAAAATTGCTTACCTTGAGGAGGATGAATCTTAGGCC
CTCTTGTGTATTTTGAGGTTCCTGGGTGGTTCTATTCCATCCTTTTGAAGTCTCTTTTAG
TTTCACTGTTTTACCAGTACTTTTTATACCAGGGGTCTCCAAACTTATTTGGTCTATTGC
CATATTTTCAGGGTGGGGGGTTGGGGTGTTTACCTAGCACCACCCAGGCAGTTACAGATT
TTGTACTTTAATCCAGGATAAAATGTAGGTATCTGCTTTTCCAACGTCCCTGCATAGTTC
CAGCTCTGCCCATCCCACCCCACCCAACTCGACCCTCTATAAAAATCATCTTAAAATGTA
ACTGGAGTGGAAATGTTTAGTTGAAACTTAAATGAGTAGTGTTAGTATGCTTTACATAGC
CAGTAAAATAACCATTTAAAGTGCTTTTACTAGCAAAGATATTTTTTACTTCAGAATTAA
ATTGGAATTTTATGTAGGCAAATGTCAATTTTAGAGTTTATTTTTATTTTGTTAATAGAT
GAAGATGAAAAAACCATATTAAACCTGGAGAATTCCAACAAAAGTCTTACCGGTGAACTC
AGAGACGTTAAAAAGGACCTTAGTCAGTTACAAGAAAATTTAAAGATTTCAGAAAACATG
AATTTGCAATTCGAAAACCAACTGAATAAGACAATCAGAAACTTATCTACAGTCATGGGT
GAAATCCACACTGTCCTGAAGAAGGTTAGGAATTTTGTACTTTATCTGTATTTTTATAGG
TTTAGTCCTTAATTTAATTTGTGGCATTTTATTGTGTTTTAATATTATGAAAGGCTAGTT
TTCTTAGGCATTTTATCCTTCATAAGGTTAATCTTAAATGATTCGCAAAAGATGGTGTTT
TCCTCTGAGTGGCAGTGTCAACCTGGTTTGTATGTTGCAGAGAATTCCTTTAGTGGCTAG
CTATCAGAATTAACTTTTTTAATATTCTGTCATTGGGAAAAAAACAGTGGCTCAGTGTCA
TTTAATTTAGGATCTTGTACATTGTAGGTTGCACTTGGAACAGAAAGAGGAAATCTAACC
ACAGTGCATGTACTATACTACGTTTACTTTTAAGAACTAGTGATTTTTTGCATTAATGGC
TTTCTAGAATAAACAAAGCTGAGTGATATAAAACTGCAAAATTTCTTTTATATTTTACTC
TGGGTCCATATTTTCATAGACAGATTTAAGTTAGATTGCAGACTTTCTAATAAAATGTCA
CTTTTTTTTATTTTTTAGGATAATGTGAAGAATGAAGATAAAGATCAGAAATCCAAAGAG
AATGGTGCAAGTGTATGATAAACTAGGTTCAGTCACGAGGAATGGTGTTTAAATATGTAA
TATATAAAATCATGATACAAGAATGTTTGAAAGTGATGCATGTTCAATTTTAGTAGTATA
AATATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAAGAAAGCAATAGACGACTACCAT
TATTATATATATTAAGCTTTACAAAAGTCAGTCCTGGTGTTATTAATGTTATTGCTTTAA
ATTGTTATACTTTCCCAGAGTAGCCCCTGTAGTACTGAAACTTGGAAGGTTTTAATTTTC
AAAGTAGTTTCAATTGTACAGTTAATTATCAAGCCAGTAGGTGTCAGTATGATGCCTTAA
ATCAGTGATTCTCAACCTTCCTAATGTTGCGACCCTTTAATACAGTCCCTCATAAAATTA
TTTTTGTTGCTACATCATAAGTGTAATTTTGCTACTGTTACGAATCGGGCAACCCCTGTG
AAATGGTTGTTCAGCACGCACACCCCCCGCACCCCACCCCCGTCTCCACCCACAGGTTGA
GAACCGCTGCCTTAAATTAAGCCTTCCTAATTAAAAGTAAGCTTTTTTATTAGTCTTCAG
AATTTTTGTGAATGCTGAGAAACTTGGTTGACTGCTCAGTGAAAAAGAGTAGAGTAGGTG
ATCTATTCTAAACTGCTTTTCAACCAAGGAAGAATTGACCACTGGGTGACATTTGGCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1073, 5167..5339, 5990..6034, 8032..8064, 9262..9377, 9480..9557, 11164..11278, 11373..11462, 11565..11667, 17246..17375, 17492..17653, 19611..19836, 20469..20582, 21435..21439, 21441..21447, 21451..21466, 21469..21486, 21488..21500, 21502..21513, 21515..21607, 22350..22560, 23373..23456, 24064..24249, 24350..24541, 56167..56406, 56730..56841, 58419..58501, 59607..59753, 60719..60839, 60933..61118, 61798..62003, 62538..62597
1001..1073, 5167..5339, 5990..6034, 8032..8064, 9262..9377, 9480..9557, 11164..11278, 11373..11462, 11565..11667, 17246..17375, 17492..17653, 19611..19836, 20469..20582, 21435..21439, 21441..21447, 21451..21466, 21469..21486, 21488..21500, 21502..21513, 21515..21607, 22350..22560, 23373..23456, 24064..24249, 24350..24541, 56167..56406, 56730..56841, 58419..58501, 59607..59753, 60719..60839, 60933..61118, 61798..62003, 62538..62594
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved