Echinops_telfairi Locus SMC1A
snOPY snoRNA Orthological Gene Database
Echinops_telfairi SMC1A
Echinops_telfairi
SMC1A
GeneScaffold_670
SNORA18
105478..105611
117481
TAGGGAGCAGAGGAGAAGGAACAGAGGGGCACAGGATAGGGAAAAGAGGGTAGAGTAAG
ATGAGAAGCAAGAGATTGGGCAGAAGAGGATGGACTAATAGGAATGAGATGGAGGGAAGG
CAATGAAAAGAGATGGGGGTAGGGAGGAAATATGGTGGGGAGCATTGACTTAAGTACCCT
GACTCCTGGGGTACACAAAATACCTTTCTCATCAAGGAGTCCAGGTTTTGGAGCTCTCAG
GGTTGGGTCTGGGATCAAGTGCCCAACTGGTTTAGGTCCAAATCGGTTCTTGAACTATAG
TGGCAGTCTCGAAACTCTGGAGAGGAGAGGAGAGGAGACAGGATATAACAGCAGTGTCTC
AGGCCATAGCGTCCCCCAGTCTATACCCTTGTCACTTGTAACCTCCCCTTTACATTCCAT
CCTCTTCAAATCGCCCCTCACCCGCGCATGACAAGCTCTGAGTTTATGTGACAACAAATC
ATCTTGCCTGTCCCTCGTTCCCATCAACCCTCCGGTCCCAATGTCCTTATAATTCCCAAC
CTTGGTCCGAGCCTTCCAAGTGACCAGGCTAAAGCCAACGCCTAGTTCCCAGTTTCTTCT
CGCAGGTCCTAACCCTGCTGCTACTTGTGAATTTCAGAAAGCTTGAATTTTAGTCCTGCC
AAAAAGCCTATGGTATCCCCGAACGCTGCGAGGAGTCCTCCCAGCAAGGTCGTCAGTGGT
TTGTGTGCCCAAGTAACAAGAAAGGAGGGTGGGGCTTAAAACCTGTCGTAATCCTGCCCC
TTGGCAACGGATCAACAAAACTTCCACACCAACCAAAGGCCCCGCCTCTGGTTCCCACCG
TTACGGAAACCGGAAATTTCATCAGCCTTGACTCATTCTCGCGAGGCTTGCCATGCGCCC
GGCCTGCACTGCGGTGTTTCCCGCGCGGGCTTCCCGGTTCCTGGGCGGAAAACGCAGCTC
CTCTTATTTCTTTTGGCTTTGCCGCCGCCGCCGCTTCTGCCATGGGTTTCCTGAAATTGA
TTGAGATCGAGAATTTTAAGTCGTACAAAGGGCGACAGATCATCGGACCATTTCAGAGGT
TCACGGCCATTATTGGACCTAATGGCTCTGGTGAGATAAACCTGGCCGCGGCCCTGCACG
CGTCCCGGCCTGGACCCCCTATCCGACTCCAGAGTAGTGCAACCCAGCCCACGTCACTTG
AAACGTAGTGAACCTTAAAGTGCTTTTGCCCTATCTGAAGAAGTTTGTCCAAATCTACTG
TCTATATTCCGGTGAGCTTTCTCGAATCTTTCCCCCAGGTTGCTTCCGCCCACCACCCCC
TTCTGTCAAAAGTGGCATGCTCTAGTAGGCTGCTAGTTTTACGTCTTGCCAAATCTTGAT
CTTCCGGCTTCCCTGCCCCTACTGTTTGACCTTTCTGAAAGATGTGGGATGACTGGATGA
CTGAATGACTGATATCCTACCCTTAGCCCCTGGTCCCAAAGGGTACGCCTCAATCCTCTC
TCTGGCCTCCCATTGGTACTCTCCAATTTCCCTCTTTTTACACTTCCTCTCTTGAATTTC
TGATTCAGCATTGTACTCTCCAGTATTCTTGGGGATCTTAATACCTCTCCTCCGTCTCCC
CTGTCCACACGTCAGACTAAGGTGCCTCAACTCTCTTTCCTGACACTATAAAACCTGGGA
CATGCCCACCAAATGTTCATTGAATGCTTACTGTTAGCAGGAGCTGTTAGAGATGCTGTG
GAATAGAATAAGCCAAGCCTATATTTTCAGGGAACTTTAATTTCAGTGGAAAAGACATTA
ATAAAGAGAAAATAATTTAGTAAAGAAGAAAATGCTATGAGGGAAATAGAACACCATAAA
TTCCTTCCACCATTTGGAATTCTGTTTTCCACCCCAGAGATATTTCAGCTGCAACATTTC
CTAACCTGAAAGGTTGCCCTTGCTGCATATCTTACACCATCCGACGTCTCCCTTTTGACG
CCTTGTGTTCTCACAGGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGTTTCTCAGTTAG
ATAGATGGCTACTTGTTTATCTTCCAGCCCATAGGACCCCACATTCTATATCTTTTGATA
GCTGGGCACCATCAGCTTTCTTCACCGCATTTACTTTTGCATCTGCTTTGTCTTAAGCGA
TCCTGTCGGGGTAGGCTGGTGTGCTTCTTCTATGTGGGCTTTGTTGTTTCTCAGCTAGAT
GGCTGCCTGTTTATTTTCAAGCCTTTAAGACCCCAGATGCTATATCTTTTGATAGCTGGG
CACCATCAGCTTTCTTCACCACTTTTGCTTATGCACTTGCTTTGTCCTCAGCGATTGAGT
TGGGATAGGCTGGTGTGCTTCTTCCATGTGGGTTTTGTTGTTTCTCAGCTAGATGGCCAC
TTGTTTATATTCAGGCCTTTAAAACCTCAGATGCTATATCTTTTNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNTCTTTTGATAGCTGGGCACCATCAGCTTTCTTTACC
ACATATGCTTATGCACCCGTGTCTTCAGCGATCATGCCAGGAAGGTGAGCATCTCAGACT
GACGATTGTTAGAACAAAGTGTTCTTGTGTTGAGGGAGTACTTGAGTAGGGGCCCACTGT
CCATTTGTTTCCTTAATACTAAACCTATAAATATATGTACATAGATCTATTTCTCCCTCG
TCATATATAAATATATTTACATATGTATATGCCTGTATTTAGATCTCTATAACTGCCCTT
CGCCTCCTAGTTTTTTCCTCTATTTCTTTGTCATAGTATATGTTTTTGAATCTTCATCAC
AGGTCTGTGAATGTCTGTAAGATGACATTCTTTGAAATATTTCATCTTTGTTATCTTTGT
AATCCTACAGCCTATGTCAAATTTATAATTAGGAATTTTTTTACAATATTGAATGATTGT
TGAGTACAAATGCATTTAGTTGTGGATGTTTTATCATCTCTGGAAAGTAATAGGGAAGCA
CAAAGATTGGAAATTGATGCCTAAATGTCTGTTTCCTGATCTGTGCTCTGACAAAGGAGA
TAGAGCTAAGAGACCAGAACCATGTGAGGCTAGTGCTGCCATTTATTGAGTGTGTTATGT
AGGGTCACTATGAGTCAGAATTGACTTGATGCCATCGAGTTTAGGTTTGAAGCCCTGGTG
GTAGAGTGGCCTATGCATTGAGCTGCTAGCCACAAGGTCACCAGTTCAAACCCACTACAG
TTGTACTGTGAGAGAAAGATTACCATAAGTTGTCTACTCCTGTAAATATTTAAAAGCCTC
AGAAACCCAAGAGGGCAGTTCTACTTAGTTTGTAGAGTCACTGAGTTGGTACCAACTTGA
TGGCAGTGAGTTTTGAGACCCCGTGTCAAGTACTTTATTTATTGGGACTGTGCACATTAA
AAAACGACAACAAAAAACGTGGTGTTTGGCTATAAAGTGAAAAGTTCAAAACCAGCCAAC
CTCTCCGCAGGGGAAAGATGTGGCAGTCTAGTTCTATAAAGATTGGTATCGGAAACCACA
TTGGGCAGTTTTACTGGGTTGCTATGAAACAAGAATTGATAGTTGGAAATGACTTTTTTA
CAGTTAAATTCTCACAATGAAATACCATTTTCCTTATAGATGAAATGGTGGCACAAAGAG
GTGTGATAACTTGCCCTTGAGTCTCAGAACCAGGATCAGAATCCTTCCATTTCAACAGAG
AATTATGTGCCAACCTGCGTTTTAGATGTTTTGTCTATGAGTCATGTTTTTTTTCATATT
TTCCAGGTGGGAGAATAGAAAACAATTTGTCCAGGGTAACACAGCTAAGACATACTGAAA
GCTAAGATTATAACTGTTGTACTTAAGACCAAAGTCTTTTAAAAAATATTCTATTTTGTT
TTCAATTGAAATTTATATAGTAAATTAGTTTCTCAATATCTGCATAAATTGTTCTGTGAA
ATTGGTTATTCTCATACAATGTGTCAAAATTCTCATTATTTCTCTTGTGTTGGTTCTGTT
TCCAGAATTCTGCTTTTCCAGCCCCCATTTTCTTTCTTTCTTTTTTTACCAAAACACACA
ATTGCATTTATTGTGCCCTCCCAGAAGTCCCTGGGGACAAAATAAAAAGAACGGCAGGGA
AGGGCTGTACAGGAGCGCTCTTCTTTGAGGTCCTTGCGTTTTTGGTTTTTTTTAGAAAAT
GAAAAGTCCGGGTGGGCCAGGGCCTGCCAAGCTCGCTCGGCCTGGGGGGTCCAGGAGCCA
GAGATGTTGCCTTAAGCAAGGAGCCTGAGACCCAGGTGGAGACCCCTCACACGCTCACGG
TCATGGGGTGGGGGGGGGAATAGCTTTCGCTCGAGAATGGGTGCAAGAAGGTCCAGGCAG
CCGCCATCTCGCCGTCGCCCCGTGGGGTGCCTGGGGCATTGCTCAGGTCGGCGCCTGGGG
AGCTCTTCTGCAACCTGTCCCATGTCGCCAGAGCCCAGGGATCCGTTCATGTGATGGGGT
TCCATTGCGCTCATGGCAGTCATGGGGCCCTCCCGGCCGGGGCCGAGCGGGAAGTTAGCC
TGGCCTGGAGGCCAGATGGGGTTCACAATGGTGCACATGCTCTCACTGGAGTTGGAGTCT
CCAGGGCTGGCCAAGATGGGTGTTCTGGGGTGGCCCACCTCCAGGGGGTCCTGTGTAGCT
GCTGGGAGCGCCGAGAAGTAGGAGACCGAGTTGCCACTAGGACTGGCCCATGGGCCTCGG
ACTGTTGGGCCCATGTTCAAGGTAGGCAGTCCAGGGCCAGTGAGGGGGTTGGGCAGGGGC
CGGATGCTGCCTCCATAGCTCTGAGGCTCAACGCCAGCCATGCCCCGGGGAGGCGTTACC
CGCTACATTGGCCCACCCATGCTGGGATGCCCTGGGAGGGGGAACAGGAGGAGGGGCATG
CAGACTGGGGAGGTGGTGGAGTTGGGGTGCTGAGGGGCGGGGGCGGTGACACCAGCTAGT
ACTCCTTACTCACGCCAGCTCCCATTTTCATCTTTACAGTAAATGTTGATATTTTAATTT
TTGCAGCCAACCAGTTTAACTGAAAGGTGGCCTCTGGGAGTAGTTTTGATTAAAAGTTTA
AATCACCTTAGGGTGATCATCTCTGGAGTTGGGTGGGGGAATCCTGTAGTGTGATTCTGG
ACTTTTTAAGAATATGAGTTCTGTTCTGTTTTCCTCTCTTTTTATTGGGATCCATCTATT
GTGTCCTTGATTAGAATAGTTGGTAGTGGTAGTTGGGCACCATCTAATTCTGGTGCCAGT
GTAGATGAGCCATGATTCATAGACTTGGTCCTGTAGACTAGTTTCTTCTCTGATTTTTTG
GTTTTCTTCTTTCTCTTTTGTTCCAGATAACCCCAGACACTACTCACCAAATTAGAATGT
AGAACATGAACTTTATTGTTGACCAAATTGCCTCACCAGAGTATGGTCCACATCCTTTAA
ACCAATAAACCAATCCCCTGAGATGTTTGATTGTGTCTTGAAGTATCCATAATTGTGTAT
ATATTACTATATATATTACTACAAATGCAGCACACACATACTAAAAAAATAAAACTCACT
GCCATTGAGTTGATTCCAACTTATAGGACCCTGTAGGTCTGACAAGAACTGTTCTCCCAG
GCTGTAAATTTTTAAAACGTTTTATTGGCACTTAATCCACATATCACACAATTCAATTGC
TCAATCATATCAGGAAGAGTTAAACAGTCATTACCACAATCAATTTTAGAACATTTTCTT
TTTCCCCTCCTATGATTAAATCACTTTAAAAATGAGTTGTGTAATCACCATGAATTCTAG
GCTCCCTTGCCCCTCCCACATACATTGTTTGCGTCCCCAACACCTTTATCCTCCTTGCCT
CCCACCCCCACCTCCACCTCCCTATATAAACCTTTGCATCAGTTCTTATTTCTACGCATC
TACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTCAAGAACCAATGGGTGACTGTTCAGCAGTCTTTGGAAATTTAAAGTTAG
CTTCTGTTTCTCTAAATCAGTAATAATCAAAACGGCGTGCAAATTAAAAAATAAAAATAA
TGGAAACTTTACTTTAAGGGGGTGAGTAAAAATTAATAGGTATAGGCAAAGTACATTTCA
TGAAGTAAAGGAGAGGCAGAATAGTCAGAGAAGGCTGAGATGGGGAAAGGTGGGAATAGT
CAGAAATGGGTGAGAGATGGGGCAAAAGATGTAAGCAAACACTCAAACAAGAAAACAATT
GACATGCTTCCACAAGCTGATGAAGCACTGCAAGTACTTACTCATCTATGCCAGGACATT
TAGAAGACACCTACTTGGCCAACTGACTGGAAGAGACTCACATTTGTACCCATTCCAAAG
AAATGTGACCCAACAGAACGCTCACATTGTAGAATAATATCATTGATATCGCATGCAAGT
AAAATTTTGTTGAAAATCATCCAGTAATGGTAACTGTAGTACATTGACAGAGAATTGCCA
GATTCAGAAGAGGACATGGAACAAGGTATATCATTGCTGATGTCAGAAGGATCTGGGTTG
AAAGCCCAGACTAGCAGAAAGAGGTTTACTTGTGTTTTATTGACTATGCCAACACATTCA
ACTGTGTGGGTCATAGCAAACCATGGATAGCCCTAAGAAGAATGGGAATTCCAGAACACC
CCATTGTGCTCCCGAGGAGCAAACAGAACAAGAGAATGCTGTATGGTTTAAAATCAGGAA
ATGTCTATGTCACCATATTTGTTTTCTCACCATATTTATTCAATCCATATGCTGAGCAAA
TCATCAGAGAAGCTGGATTATATGAAGAAGAATGTGGCATCAGGATTGGAAGAGGGCTTA
TTAACACCCTGCAATATACAGACGACACAACCTTGCTTGCTGAAAGTGAGGAGGACTTGA
AACATTTGCTGATGAAGATCAAACATTGTAGCCTTCAGTATGGATTACACATTCAATGTG
AGAACACCAAAATCTTCACAACTGGACCAATAGGTAACATTATGATAAAAAATAAAAGGA
TTTTGTTTTACTCGGATCCACAATCAATGCTTAATCAAAGCAGCAATCAAGAGATCAAAC
AACCCATTGCATTGGTTAAATCTGCTACACAGAATCCTCAGGAGAAGGCCATGCACACAC
AGAGGCCTCATTGGCTATGACCTGATTGACAGTCTAGACTCCAGCCCTTCGCAAGTTGAC
AGATTATATAACTACCACATTGATTTTTGTTTGTATTTTTCTTGATTTTTTTTTCTGTAT
ATGAACTCCAGGATCGGAACTTCTACAGAGACAGTAATTAGAGAGGAGCCCTGGTGGAGT
AGTGGTTATGCATTGGGCTGCAATCCACATTGTCAGCAGTTTGGAACCACCAGCAGCTCC
TCTGGAAAAAAAACTGGGCTTTCTATTCCTGTAAAGAGTTACAGTCTCAGAAACCCACAA
AGGGGTTACTATGAGTCAACAATGACTTGATGGCAGTGAGTTTGTTTGTTTTTTTAATAG
AAGGACATAGCAGGGGAGGTTATGGTGAAAGGGAGAGTTAACAACAATAAATAACTATAA
GAAAAAAAAGAATGTTCTAAAATTGATTGTGGTGATGATTGCACACTTTCTCTTAATTGA
TGTGAATTATATGCCAAGAAAAAAAAGTAGTAGTGAAAAAAAAGGAAAAGAGAAAGACCC
TCAATGAGAGGGATTGACACAGTGGCTCTAACAACAGGCTCAAACATAGCAGCAATTGTG
AGGATGCCACAGGACTGGACAATGTCTTTTTCCCTCCTTTTTCTGTTGTGATGTTGCTGA
GTTTGAGCCCACTAGGAGACACCTAACAACACATCAGCACCCCATCTAAATCCCCTTATG
TTGGATCAGGATTGATCACATTAGATCAGTGGTTCTCAACCTTCCTAATGCCGAGACCCT
TTAATACAGTTCCTCATGTTGTGGTAACCCCCAACCATAAAATTATTTTCGTTGCTACTT
CATAACTGTAATTTTGCTACTGTTATGAATCGTCATGTAAATATCTGATATGCAAGATGT
ATTATCATTGTTACAAATTGAACATAATTAAACATAACTAAAGCATAGTGATTAATCACA
AAACAATATGTAATTATATATTGTGAAATATTTATGTTTTCCAATAGTCTTATGCAACCC
CTGTGAGGGGGTTGTTTGACCCCCAAAGGGGTCGAGACCCACAGGTTGAGAACTGCTGCA
TTAGGTCATATCATGGGTGTGATTGCTTCATGACTCAACTGCCACATTATATCATTATAT
AACTGTCCAGTCAAGTGGAAACATATCTTAGGGAGCACAATTCAACAATCCAATATGTGC
ACCCTCCATTTTGGCATAATACCAATTTTCACATAATGACCTGGTCTTTGGAAACAATAT
CTATAAAGGAGGAATGGGTATATTGAATTTCAGTTTACAGTAATAGAAAATTCACATTGA
TTAAGGATAGGGTTGCACAGCCAACTATTTTAGCTGCTGTTAATAAGTTGTACACCTGTA
AAATGTTGAATTGGCAAAAGTATGATAGATATATTTATAGCACTGAAAAAAACAAAAAAG
AGTATCTGCCGAGACACCAAAAACTCAATCAATTTGATGGAAGTGAGTTTGGTTTAGGTT
TACGGAATAGTCATTACAACAATCCTGTAAAGTAGGTGCTTAGATTACATCCATTTTATA
GGAGAGAAAATTGATGCACATCAGTTAAGTACTTTGTCCAAGGACATCAGCTAGTAAATG
ATGATGTTGAGAGCCAAACCCAGGTCTTCTGGCTTCCATGTTTGCCAAGGGGCAAAAGGG
TTAAGGATACTAGTGAGAATAAAGAATAGAGAGAAAAGATGGGAGAGGGTCTATGCTGGT
CAGAGAAAAAAGTTAAGAATATTAGACAGAAGCTGCTAGCCTAGAAGAAAACGAAAAGGC
CAACAAAAAATTAGGTTTCAAAGATATGATGGGTGCAAAAGCAAATGTGGTGAAGAAAGC
TGATGGTGCCCGGCTATCAAAAGGTATAGCGTCTGGGGTCTTAAAGGTTTGAAGGTAAAC
AAGCGGTCATCTAGCTCAGAAGTAACAAAGCCCATATGGAAGAAACACACCAGCCTGTGC
GATCACAAGGTGTTGAAGGGATCAGGTATAAGGCATCATCAGAACAAAAAATCTTACCAT
AGTGAACGAGGGGGGGAGTGCAGAGTGGAGACCCAAAGCCCATTAGTAGGCCACTGGAGA
TCCCCTTGCAGAGGGGTCTCATAGCAATGATGAAAAATACAACTTTCTTCTAGTTCCTAA
ATGTTTCCTCCCCCCACCCCCCCTGACTATCATGATCCGAATTCTACCTTGCAACTCTGG
CTAGACTAGAAGATGTACACTGGTACAGATAGGAACTGGAAACACAAGGAATCCAGGGCA
GATGATCCCTTCAGGACCAGTGGTTTGAGTGGTGATACTGGGAGAGTAGAGCTAGAATGG
GTTGGAAAGGGGGAATCGATTACAAGGATCTACATGTGACCTCCTCCCTGGGGGACAGAC
AACAGAAAAGTGGGTGAAGGGAGATGTCGGACAGGGCAAGATATGACAAAATAATAATTT
ATAAATTATCAAGGACTCATGAGGGAGGGGGGAGCAGGGAGGGACGGGAAAAAATGAGGA
TCTGATACCAGGGGCTTAAGTGGAGAGCAAATGTTTTGAGAATGATAAGGGCAATGAATG
TACAAATGTGCTTTACACAATTGATATATGTATGATTGTGATAAGAGTTGTATGAACCCC
TAATAAAACAATTTTAAAAAGTAAAAAAAAACAACCAACAACAAAGATATGAAAAAAGAG
GTGGAGACCCACTGGCCTAGTCCCAGAACAGAGGGAGGGCTGTGAGGTGCCCCCCTTCTG
GCCAGGCACCCCAGTAACTTGAGAAGTGGGAGATAATAGGGACAATCAAGTGTGGAGATT
ACAGGATGCTTGTCTGTCTACATGTACTATTTGAGCATACTCTTTCATATTAAGACATGT
CTCAATAGTAGAAAGACAACAAACTACACGTTGAAGTGTAACTAATGATGCTGCTATGTA
CTACCAGCTGTGGAATTAGTTTGGGGAAAGGCATTTCAATTTTAAGGATAAAATGAAAGT
AAAAATCTCTGAAGATTTTGTTGTTAAAAAAAAAAAAAGAGGTGGAGGGGAGGAAGACTG
GGAAGACTTATAAGAACAAACTCAGAGTAAGATATGGTGTTATGTGGATGCTGGGTGTGT
ATGTGTGTTGGGGTATTCCAGGAGATAACAAAGACAATGATGTGACCTTGACCAAATAAA
AACCAAATTCACTTCCATTGAGCCAATTCTGACTCATAGTGACCCTATAGGGCAGGTTAG
ATCTGCTTCTGTGGGTTTCTGAGACTACAAGTGTTCATAGGAGCAGAAAACCTCATGCTT
TGCCCTCTCGCCAATCCTCATTGTAAGCATATATAGTGTCCAGTCACCTATGTTGTTAAT
CTGTACAAATAAACAATCTAAAAATCTGTCTTATCCTTGATCGTGTTTTACATTCTTTAC
CAGTGGCCAAATTAATGATAATATCAACAGAACTACCATATGCCCCATGGAAATTATTTA
TAAAGCCCTTCAACATAATAATAACGATGGTTTTAAAGTGAATCAAGGATATATATATAA
ACTATAGCTATATGAATGGGATTTCGAGCTCACACTTAATCATAGCCCCAATCCATGAAC
AATTAGATCTTATGACATGGACCTGCTCAATATCTATCCATATGAAATGTTCACTGAAGA
TATGGGTGCTACAGCAAAGTGTCGGAAGGAAGCAGGTGGTGCCTGACCATCAGAAAGAAT
AGCATCTAGGGTCTTAAAAGCTTGTCTTCAAACAAGGAGCAGGGTTGGGGAGGGAGGGGG
AAAAACGAGCTGATATCAAGGGCTAATTAGAAAGAAAATGTTTTGGAAATGTTGATGGCA
ACATATGTACAAATGTGCTTAATACAATTGAATGATGGATTGTCATAAGATTCGTACGAG
CCCCCCAATAAAGTGATATTTAAAAAACAAATGAACAACAACAAAAAAACAAGTGGCAAT
CTAAATGAGGTGTCAGCTAAGTCCACATAAAGGAAGCACATCAGCATGTGTGATCCAAGA
ATTACAAACAGTAAAAATACAAACCCAGAGGACGGAATGGTATTAGAATTTCAATTCTGA
ACACCCAGTTTACATAAGGATGTGGTTAACAGTAAGAGCCCAAAACCCATCTGCAGGGTC
CTCCCATGCAGATTAAGTCATTGATGACACCCACTGACTATGGACCAGAGATGGGAAAGG
CCTTGGTACCAGACATTGCAGTGTGGCTGACTGCAATTTGATTTAGGTCAAAATCTAACA
CCTTGTCAGTGAGCTCCCACTTGACCCAATATATAATTGCTGTAGCTTTTAATATTTTCT
GCTTTGTTATTTATAAAATGTTTTTAAAGTTTCACTGTAATTAGGTTATCTGTTTGTATT
CAGTCTTGATTTTTGTGCCATTTTCTGTATATGAAACCCAGATTAGGTAAACCTAGAGAC
AGAAACTGGATCAATAGATTCAAAGGGCCATGACAGGGAGGCTGGCAGGAAATGTGGAGC
TACCAACAATGAATACAAAGTAGAAGACATGTCTTGGAATTGATGCAGTCATGGTTGCAC
AACTCTTATGATTATGATTCAACTATTGAAATGTATGACATGTGAATTGTATGTTGATGA
ACTTGTTAAAAGTAAACGAATTATTAAATTAAAAAATTTGAAATAACGAGGATTAGAACA
GCTTCAACCTCTTTGAGTGGCACAAAAATGGCTAAGTCCTGGACTAGTTCAGGCTAGGTC
AAACACCCCCAGAATTGTCACTGAAGTAAGTAAGGCCCAGTGATCTGCTTTCTAAAGATT
TTAATCTTGAAAAACCCCTGGAGAAGCTGTTTTCTGCATAGATAGGATTTCTATGCGTCA
GAATTGACTCATGGTAACATTCGTATTGGAATAAGTTTGTTGCTGTTGTTAGCTGCTGGG
TTATGCACAAGGTTAGCTGCAAGTGGATAAGGCTGTTGTAGATGCATACAGTTTTCACTG
ACTGATTTTTAGAAGTAGATCATCAAACATTTTGTAGACAAATAAATGCATGTATATAAA
TTATATTTTAATGGAGGCTTTTTTATTCCTCCAGAACACCACAGGCATTTTATTATTTAA
TTCCTCTAGCTATTCTAAGTGCCCAGCACAGAGTCTGGAAAATAGGAGTCTCGGATATGT
CTGGACAGGTATGCCGGCTTTTTCTAGAGAGAAAAGGCCTCATCATAGCCTGCCCAAACG
CGGTGGGTGTAGTGGTGTCATGCGATCACCACTGGCTTCTTTTCTCGGGTGAAACAATTC
TTCAAGGACATCCTGTCTGTGATTGACACTGCAGAGGAGAAACCCAACAGGGCCTGCCCA
TGACCTCTCGCGCACGTCTGTCCGCCCGCCTTCTCGGCCCTGCCTTGCGACTCCACCTCG
GCCAATCAGCGAGCCCGGAGCAGATCTGCTGGTGAGGAGGAGGCTTGGAGCAAAATGGCT
GCTGCGTGTCGGAGTGTGAAGGTACAGTCACTTCTCTCCTGCTTGTTGCGTGGCTGGCAC
GGCGCAGCCGTGTATCTGGGTCGGGAGTCGGGGAGGTTTGGGGAGGGATCGGTGCTGTGA
AAGCATCATGAGTCATGCTTCGCTTAGGTCGGATTTTGGCGGTGGTTGGCGGTGAAGGTC
AACACTTTAAGGCACACGTATCAGGGGTGACTGGGGGGGTTGCCTGCCGGTGCATTCCTC
CGAGGTCCCGTCCGCCGAGGGGAGGGAGCCTACCCGGTCGCGCTGTAGGAGTAACTAGAA
GCCGCCTTGCACCCCCTCCCACCTGCTCGGAAGCCGGGAGAAAGGACAGCTGTGTGCGTG
GCGGTGGTCTGGACTGGGCAGCAGCTGACTGTGCCGCTCCTCACAGGGCCTGGTTTCAGT
GATAACCGGAGGAGCCTCGGGGCTAGGCTTAGCCACGGCGATGCGACTCGTGGGGCAGGG
AGCCTCTGCTGTGCTTCTGGACCTGCCCAACTCGGATGGAGAGGCCCAGGCCAAGAAATT
AGGGAAGAACTGTGCCTTCGCCCCTGTCGACGTAAGTGGGGACACCCCTCCTCTCCAGGA
TGTGCAGGAGCTCAACAACACCAGCTTGCGAACCTGTGATTTCCCTCCCTTTAAGAGTAC
CGTCTATGTGTGCAATGAGCCCATGCCCTTGTCCCTTTGGGCCTGAGCCTTCAAGCACTG
TGAAATATAGAAATCTCAAATTCACAAGAATGGGGATGAGGATTGGATCTGGCAGAATTT
CCTGAAGGGCGTATGTGTTTGAAATGCATATTGAGCCCTGTAATTTTACATTAGGATGTG
GTTAAATTTTGGGGGAAGCTATGGAAAGTAAAGGGTGCTTAAGTCATCTCAGCAGGTAGG
CATATGGGAAAGCTATCTTCATATCAGTAATTTTCAAAGCAAGGATTTATTAGCGCTCCA
GTCTATAGCAATTGAGAATCCCCAGTGGTATCTGAATTTATCGATAATGTAGATTTGAAC
CGTTTTTTTTGAACACTGCCCTGAGGACCTAAAATTTTCACCTTAATCCTCTTCTTCCTC
TCTCAAGTTCCACTGTAACTTCCTCTTGGTTTTTCCCCAGTTTATACAACTCTGGGACTC
CATTCTCCTAGGTTTAGTAGTGTGCAGATATAGGCAATACCATTTCCACTTCTCCCTTTC
AAGGTGACCTCAGAGAAGGACGTGCAAGCAGCCCTGACTGTAGCAAAAGCAAAGTTTGGC
CGTGTGGATGTCGCAGTCAACTGTGCAGGCATTGCCGTGGCCATCAAGACATACAACTTA
AAGAGGGGCCAGGTCCATAGCTTGGAGGACTTCCAACAAGTTCTCAATGTAAGACCTTAA
AGCTCACCTTGGATAGGAAGAGGTATCTGGCTGTGGTTATCCCCAAAGCTTTCAGGGTAC
AGAAGAATGCGTCTGCCTCGGGTCTTACATCATGTATGTCTTCCAGGTGAATCTCATAGG
TACCTTCAATATGATCCGCCTCGTGGCCCAAGAAATGGGCCAGAATGAACCAGACCAAGG
AGGCCAACGTGGCGTCATCATCAATACTGCTAGTGTTGCAGCCTTTGATGGCCAGGTATG
TAAGCAAGAACAAGGTTTGTGCCTCCTCAGTGATGTGTTGGGGTCCTCCCACCTTTTACC
TCCACTCCTCCTTCTCCAGGTTGGACAGGCTGCATACTCTGCTTCTAAGGGGGGCATAGT
AGGCATGACACTGCCTATTGCTCGGGATCTGGCTCCCATTGGCATACGGGTGATGACCAT
TGCTCCAGGTAGATATACCCTTTCCATGCCACACCTGAGATTTTGGGGCAGGAGGATCCT
GTGGGCAGAGGTGGTGGAGTGGGGGGTGGGGGGTTAGGTGGGAAAGCCCTACCGAAATAG
CAGTAGCCTTCCATCTCTGGACCCTAGGGATGCACCAAGAAGTATGGCTGAGATAAGGAA
GGAAGGGCAAGAGAATATGAAAACAAGTGTGGGTCTCTGACTTTGGCTGTTTTATCTAGG
TCTGTTTGGCACTCTATTGCTGACTAGCCTCTCAGACAAGGTACGCAACTTCTTGGCCAG
CCAGGTGCTCTTCTCCAGCTCGACTGGGCGACCCTACTGAGTATGCTCATCTGGTACAGG
CTCATAATTGAGAATCTCATTTCTCAAATGGAGAAGTCATTCGACTAGATGGTGCCATCC
GAATGCAGCCCTGAAAGGAGATGGCAGAGAACACCCCCCCCACCTTTGCCTTTCCTTTGG
AATGCTAGAGTCCACTTTGAGAGGAATCCCAGAGGCTCTTTTGTAACTTTGCCTACATGT
CACTCTCTGTGCCTAATAAAGTTTGTATTTCTCAGCACTATGTGCTGGGGGGACTGATAT
GGGGAAACAAGGTGAATGTGTGAAGGCTCTGACAACGTTGATTGCTCAGAGCCCTGGGGT
GGGATGGGAAAAGCAGTATTTCATATTTTTTTGTATCCTAAAACAACACTCTTGATTTCA
GCGAATAACTTTATTATGGGGGGAAGAAGGTAGTAGTATTGGTTCAGTTACTTCCTATTG
GGGAATGGATTGAGGGTGGGTGTAAACAGTATTTTCCTCTTTTCCTCATAGCCTTCTATG
AGCTTGATGGAGACGGGGAAGAAGACCATTCTGAGCTCAGCGACTGCTGGTATTGAACTG
TAGATGATACTGGGATGTAGGTTGATTGGTGTAGATTCTTGAATTCAGGTAATTCTGCCT
GTAAAAGAAGTCCAGTGTGCGTTCAGTTGATGTCCTTTCCCTTTCTCCTTCTCAACATCC
GTCCTCACCTTCCCTGACTTTCAACATCCCTCCCCACCACCATCCCCTAGTACTCACTCT
TTTTTTTGCTCCTTAGCCAGTTGGTGGTTGAAGGAGCCCAGCCCCCTCCGAAATTCAGTA
CACAGTTCCCTCTCTTGCTGTTCCAGCTCTAGCATTGCCTGGGCCAAGTATGTGGTCTGG
CTTTTCCATTCCTCATCCCGTGCTTTCTTGGCCTGGCGCTGTGCCTTCTTTTCACAGCGC
TGCACTTCTTGGACTTTCCTGATGGCAGCTCGCTGCTCTGGAGTCATTCCCTTCCAGCAA
TAGGGCAGGACTCGATGGGGAGCGTTAGGGTTTTGGGCAACTTGGGGGTTCTCGGTCAGC
AGGTCGCTTGTAATCTGGTTTTGGATATCCATAAAGTTGGCTGCCTGCTGACGCTGATAT
TCACAGTGCTTCCTCTCAGCCAGCTCAGTTACCTGGTGGGGTCCCCATAAATGTTAGCAT
TTGAGTGGCCAACTTCACAAAACTTTCAGGTGTGGGGACGGGGCGGTTATATGATCTTGC
TCTCCATCTCAGAGAAGGAGCAGATACCACAGGGCCTCTTAATGACCCTTGAGGTGGCAG
AAGGGTGAATAGGCAGGGAGAACTTCTCTGTCCTTAGGAATCCCTTAGACTAAGAGGCTG
GGGTGGGAAGGTAAGTACTTTGTTCTCAAGTCATCCTGAGTCTGGAGGTAGGGAGAGGTA
TCGTCTGACTTAAGGGAGCCTTGAGGTGAAGGAAGGAGTCCTTAGGTAGAGAGGTAAGGA
AAAATATGGTTAAGCTTCCCCAGGACATTGTTCAGGGGACTGAGGGGAACATAGTGCACT
TGATGGCTCAGGCCATACCTGGGCTCTGTTGACGTTGGCTATGGCAGACTTCGTAGCCAT
GTGACAGGACTTCTCCAAGTTGGCCAGGTGAGTGGCCCGCATGTCCATGCCAAGGCACAG
CTTGTCATTAAGCATATCTACAAAGAAATGTGGTCTGAGTACAACACTGGCCTGCTCCAT
TTCTGGTCCCTCATTTAGTCATTTGTTCAACAAGTTTTGTGTATATGTAAGTTTAGAGAG
GTAGGTAATATTTTGAGTTAGGATATGGAAGAAGCTACATTGGGGGACTAAGGATAGCCA
AAGTGGTAGCAACAAATTTTCAAAAGACTAGCTGAAAGATGTACCCCAAAGATGGGTCCC
AATGCCAGTCCCAGTCATGTATCTTAGAAGGTACATGACCTTAGGTAAAACAATTTCATC
TCTCTAAGTCGGTAGCTAGTAAAAACAGCCCTGGTTTCATAGTGGGTTATGCATTGAGTT
GCTAACTACAGTATCAACAATTTGAAATCAGCTACTCAGGAGAAAGAGGAGGCTTTCTAT
TTCTGTAAGATTGATAGTGTCGGAAATCCACAGAGGCAGTTCTACTCTGTCCTATAGGTT
TGCTATGAGTCAGAATCTACTTGATGGCACTGAGAAGCCTCTATCTACATGTATTGGTCT
CCAAGGACACCACTAAATCAGATTCTTTCCTCAGCTCTGTTTAGTGAAGAAGATAATAAT
GTGGTAAGAACAATGACAGAGATATGTAAAAGGAATTTTCAGTGCTTTGGGTGGTGGGTA
GGAGGAAGGCTTGCAGAAAGAGTTGGTTATTGGATTATGTTTTTGTATATAGGCAAAAAG
CATAGGGCATTCCAAGCATGAGCCAAAGTATTGAAATGTTTTCATTCCAGCCTCTGGTCT
CTGCTGGCCCTAGAACATGCTTTGGATGAGTAATAGATGTTATTCTTGGCTCTTTTTCTC
TTTCTTTCTTTTCTTTTTTTCCTTCTTACTTTCTTAACTTACTTTCTCATTGAGGCCTTT
CTCTTGTTGCCTAACCTAAATTTTGCAACCTGCCTACTCCAAAACAGTTATCCTCAGGGG
ATTTTTCTCCTTCGCACTTATCACTATCTAATATACTGTTTTACTAAAATATTTTATCTA
CTGTTTGTCTCATTAGAAGGCAATCTTTTGTAAGGACAGAGTTTTTTTTTGCTCGTTGCT
GCTATGCCCCAGTATTTAAACCAGAGCCTGGCACATAGTAAGTAGGTTCGCAATAAATAC
TTGTTAAATGAATGGAAAGAAATGAAGAAACAGTGTTGTGTATATCTTAAAGTACGAATA
GTCTGCTGTTTTATTTTTAATCATTTTATTGGGGGCTCTTACAGCTCGCTCTATCTATCT
ATATTTCATCTATCTATTTGCTTTATCACATTCCATACATCAATTGTCTGAAACATATTT
GTACCTATGTTGCCATCATCATTTTCTAAACATTTTTGTCTGCTGTTTCTGAAGCCAAAA
ATAGGAGTGACTGGAGAGCTTTGCAGGGAAGCCCTGGGGGCACAGTGGTTACACCTGGGA
CTGGTTTTAAACCACCAGCCACTCCCCGGGAGAAAAATGCAGCTTTCTACTCCCATAAAG
AGTTTATAGTCTCAGAAACCCTGTCCTATATGGTTGCTATGAGTGGAATTAACTCGATGG
CAGTGAGTTTGGTTTCAGAGCTTTGCAGGGCCCATATTAAGGGTCAGAGACATGACCCTG
AAGCTAGTAGGGAACATGGAAGGAGTTAAGGGGGTGGGAGGGGAGGGTGACATGATAAGA
TTTATATTCTAGAAAGCTCCTTGCTGTGGGGAAACCTGGAGGCAGAGAATCCACCGTGAA
GACTACTGTAGTAAGTCTGTTGGGAGGATTCAGTGATAGAAAAATTGGAGGGGAAATGTA
TAGGAATTTATATCAACAATACTTGATGGGTTGGGTGAGGTAGTAGAGGAAAGATTTAGG
GATGTGTCCCAGTTTTCTAGCTTCAATGATATGGTCACCACCAGAAGAATACAAAATGAA
AAGCAGGTTTGGGGACACTGATGATTTGTTTAGAGCATGTTGAGTTGGTGGTAGTCAGCA
GGAATCTAGATATGCGAATCTGCAGGTAGAGAATCCTTAGCACAGAAGGGGTAAGTGACA
TGGTGGTTAAGTCCAGAATGAAGGCTGAGGGCAACTGAAGTGAATTGGCAGGGTAGGGAG
AACAGTGTGGCAGCTTGTACTTTACCTGCATACATCTCATTTCATTCTCACAAAACCTCT
ATGTAATATGGATTATCCTTGTCTTAAAGATGAGGAAACTGAAGTCCAGAGAAGAAAATA
AATTTGCTCAAATCAACCAGTAAATGGCAGAGTCATTAATTAGGTCTGTACATTGTATTG
CCTCTAAGTAATGACTAATCAGAACCATGGCTATACTGTCAGACAGAAGGAAGTCAGTCT
GCCTAGTCTAACCTTTCAACATCAATTCCATGGAGAATTGGACTTCCCCAATGTACCTCT
GGTCTGGATACTATACCTGGCTTAGGACAGCTTTCCACCAAGCCCCAGGTCTCCGAGTCT
AGAGGGCCTGGCTGCTTACCTGTATGTATCTTATTAAATCTGGCTTGTTGTTGCTCCTGC
AGCTGCCTTTCCAGGCTGTATCTGAACTGTTCCTGCTGCAATCTCAGGTATGTAGCCCTG
TCCAGATTCTTCCCAGAGAAGCACTGGAGGCTGGCTGGGCCACAGAGGGGATCACTGTCA
CAAAGGTGGTTGGGAAGCACCTTCTTAAGTCCATTTGGATCCCAAAGGTCAAATTCACAT
CTGTTCTTGAGCTGCTGTTTCTGTTCACGAAAGTCCTGGATTTTCTTGGCCAACCGACGT
GTCCTTTCTGCCTGTTCCTTCTCTAGCATTTGGGCTACTAGATCATAATGTACCTGGTTG
GTACCTGGAGGCGGGGAAGATCATTGTGAAGGCACCACAGGAGGGACAGAGCCCACCTAC
TATGGCCTGTGCTCCCAAGGCCTATTTGATTACCCAACTACCCCTACCCCTTAGGCCCTA
CTCAGAGCCAGAGCTGCCCTACTTCAGCCTACTGAGTCCCTTGTCTCATCTTTCTGGCCC
TACTCTGGCCCCTGGCCTCTTCTTTTTTAAGAAAACATTTTGTTGGGGGCTTACACAGCT
CATATTACCATCCATCTATTCATCCATTGTGTCAAGCACATTTGTACATATGTTCTGGCC
TCTTTCTTTACCATAAGCTGCATCCCTGTTCCGCTCTGTTGTCTCTCGAAGCTTTCGTTC
TGCAACTTGGCTATTTAGGGCTTTGACATCCACCTGGTTCCAAAGAAATGAACTAAGTAA
GCATAGGGGTCCATCAGGTGCCTTGGATTTACTAACATAAACCGCTTATAATTAATCCCC
AAATGCTATAGATTTCCAGTACATACTGGATAAAGTTTCAGTGACTGAGCATAGCTTTCT
AAGTCCCCCACTCCTCCTGTCTCATCTCTTAGTACTCTTTTCTCATGTACCAGTATAACA
CTAGCCTTAGTAGCTTTGCTTACGATTCTCTGCATATCTTAGGCTGTTTAAACTTTTTAA
AAAAAATCGTTTTATTATCACAATCCAAACATACATCAATTGTGTAAAGCACATTTGCAC
ATTCATTGCCCTCATCATTCTCAAAACATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTATTGAACACTTAGCAGATCAAT
GGATCAACCCTATCTTTAATCAATGTGATTTTACCATCACTTTTATTTTGCTGTAAAATT
TTAATTTATTTATTACCATTACTTTTAATTGCCCTTCATCCCCCTCCCTCCTGCCTCTGG
TAACTACTAATAAATTGTGGTCCCTGTACATCTGCCTTTTCTTGTCTGTTTGAATGAGAA
GTCACATGAAGGAACTTCAAAAAATTGGTGGAACAGTGGAATTAAAAGATAATGGAATTT
TCCCATGAACTTTAAAATGCGCCCTCATATATTATTTGTCTTTTTATGATTGTTTTATTT
TGCTTTGCATAATGTCTTCAGTTTTCATTCTGTGGCATGTATCAAGAATTCATTTCTGTT
ATTGGCAGAATAATATTCCATTTTATATATCTACCAAAGCCCCACTGCCATTAAGTGACT
TTATATAGTGATTCTAAGGCTGAAAGATAGTCTTACCTTTCTTTCTTGGAGTGACTGGAG
GTGTTGAACCTCTGATCTTATGATTAACAGTGCAGTGCTACCAGGGCCCTCACATTTTAT
TTATTCATCTGTTGATGTCATTTAAGTTGTTTGGCTATTGTAAATAGGGCCCTGGTCCAA
ACTCTGACACAGGCCGCAGCCTGCTCTGCCTACATTGTCTTTGAAGATGACCTGTCTTCC
CACAACGAAAGCACTTTCTTCTTTGTTTGGTGTAATTTGCCAAGGCAGCCGCCATAAGGT
TGGCCTTGTATTCCTCTGTCTCTACATTCTTGCATATCCTGAGATAATCTAGCAGGGTGC
CTTGTTCCCTGTAGGGACGCAAGGCATTTTTACAGTGTTTGTTAGAGAAATCATAAGATA
GCTTATGCAGTAGGTCTTACTGCCTGGGCATTTTTTATACATTTGGAAATAGAACTTTCC
AAACGGGACACAAAGTCAGCATAGATTCATTATTGTGCTGTCTTATAGTAGTGTAACTCG
GCTTTCTCTCTTCTGATGGAATTATCTTTTCCGAGGCATTTAGGCAAACCGCACGTATCT
GTCCTATTGTCTGTTCCTAAACTGTAGTTGAGACTCAACTGTGATATAATTCTCATCCTC
TCGCAATTGATGAATTCCTATATCTATCCCATCCTCAGCATTCTTCCGAGCTTGTGAACG
GGCTGTAAAATTCCACCACATATGATACTGTCAAAACTCTGAAGGGTGAATACAAATTTT
CGCTAGAGCTTCCCAGTCAATAGGGGTCCAGCTCTTGGACTGTGTTAAATCCCTTACCAT
GCTAAGTACAAAATGTGAGTCTGGGCCATAATCATTTGCCTGCCTGCTTGAGATCTTTTA
GCAACTTTAAGGGAAGGACATTGTAGAATTCCTTGTGGGTGTTTCTCGCAACGCTGTCTA
TCAAATTCTAACAGGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGC
TTTCCTATACTTAGCCTCTTTGCTTCGGTTCTCTGAGCTGGTCTCCTTAACCTGTATATC
TTAAAGCTCCACTTCCTGAACTTCATCTCTGTGTTAACTCTCTCAGTTTGTATTTCTTTG
GAGTTAATCTCTCTACCTCCAGCACTGGCTTGCTTGCTTGTTTGTTTTACAATCTTTGGT
CTCTCTTACACTAAATTCCAGCAGGGGAGCAGATGCTTTTACTATGATGTCCCCTTAGTT
TTTTCAGCCCTGCCTAAAATCTTGTCTGCCTGATACCCATTCTGCCTGCCACTCACCTGA
TTTAAATTTGCATAGCTTAGATGTTTCTTACTACTTTGCTGGTCTTGTTTCTTTGCTTTC
CCTGCCTTTGAAAGCAAGGGAGCTTCTTGGGATTGTTTAATAGCCTTGCTTTGGGTCTTG
GAATTCACGTTCTCTAGTGCTTTATCACCTTTAGACCTTTGGAGGCTGCAGTCCCCCGAG
GGCATATGAGGTTTCCATTAGAATGGAAGACCTTAAATAACAAATCAATCCCTGCTTCTT
CAGTTTTTCCTAAAGTTTCCTCTCCTAAATTATACTCATTCACAGACACATTAGCTTGCT
TTTCTAAATTAAGATAGACACAAGACTTCTCACTACAGTGATAATCCTCATTCTTTTCCT
CCTGCAAAAGTACTAAGACCGTCTTAACTTGAACCCACAGAGACCATGTCTCAATAGGGA
TATTCTCCCCATCTCTGTGTGCTTTCTTTAAGTTTACAGTGACTTCCTCCCAAGTCTCTA
GATCAAAAGTTCCTTCCTCTGGGAACCATGGATTATACCTTTTTACTACTTTTAGAAAAC
ATTTCATCTTTTTCTTCGTTACTTTTACACCCTGTTTTTTCAGTAAGTGGATGAACTTGG
TACCGTAAGTTTCAGGTTTACTTTTACCTTGCCCCATTGTTCTCTTTAAAATACTCAATC
ACTATTTCCACTATTTATCTGCTAATCCCCACACTGGATCCTTACTAAACACAATTTACC
GATTTAGTCTACATTCCGGTGGGGCTGTACAATTGTTACAAGAGGTATAACTCGTATCAC
CAAGCGATGGGCGCCATTTGGGGTTGGAAGGGGTGGGGCAACAAATCACAGATCCGGTAG
GCGCAACTGTACAGCGATTATAAGTAAAGATACAGTAAAGATTATAAGTAAAGATTACAG
TAAAGTCGCAACCATACCCAACTACATGGACACCTCCCCACAGAAGAATTTATTTCAGAG
GACAGCACTGAAACTGCAGCTCAGGGAGAGGGACATATCTGATCAGAGCACAAGGGAGCA
AATGAAGGGGGAGGAAGAGAGAGTGGAGCACATCCTTGCCCACCAAGCCTTGACGACGAT
ATTCCCACTCAGATCATCCAATCCACAGAGAAGACCATATGGCCGGCCCCACTATGAGGC
ATGCACATCCCTCACTGACCCATAGCCCTACAGGGGACAACACTGGAGACACAGTGTGGG
AATTGCACCTGATCTGATCCCACCACACTGAGGCAAAACCCTAAGGGCGTGCAACAAAAC
AGCAAGGAGAACAGAGCAATGAAGTCCACAGGGAATACCAAAAATAGACTTTGGTGCCAG
GGCTTGGCACCCCATCAGACTCAACCGGAAAATACTCCTAAAGGCCAACAAACAGTACTT
GAACTAACTATAAGCTTTTCTTTGTTACTTGTTGTTGTGGGTTGTTTTGTTTTGTTTTGT
TTTGATTTGCTTTTTGTTGTTTCGTTTTGATTTGCTTTTTGTTGTTGTTTCGTTTTCTTT
TGTTGCTTGGTTTTGCTCTGTCTTGTTTTTGTGCATGTTATTATCTCTGCAGGTCTGTTT
AAATAAGAGGCTGGATGAACAATCTGGAGGAGTAAACAACGGGACTGACAGTTCCTGGGA
GAAGTGGGGGGAAAGGAAGTGGTGTTAACAAACCTAGGGACAGGGAACAACAAGTGATCC
AAATCGGTGGTCAGGAGGGTGTAGGAGGCCTGGTAGGGCGTGATCAAGGGTAATATAACT
GAGAGGAATTACTGTTACCCAAATGAAGGCTGAGATGATAGTGGGACAAGAGGAAAGTCA
AAGGAAATAGAGGAAAGAGCTAGGAGGCAAAGGACATTTATAGAGGTCTAAATAAAGGCA
TGTACATACGTAAATATGTTTATATATGAGGATGGGGAAATAGATTTATGTGCATATATT
TATAGGTATAGTATTAAGGTAGCAGATGGACATTGGGCATCCATTCAAGTACTCCCTCAA
TGCAAGAACACTTTGTTCTATTAACCTGGCATTCCATGATGCTCACCTTCCCGACACGAT
CGCAGAAGACAAAGCGGGTGCATAAGCTAATGTGGTGAAGAAAGCTGATGGTGCCCGGCA
AACAAAAAAACATAGTGTCTGGGGTCTTAAAGGCTTGAAGGTAAACAAGCGGTCATCTGG
CTCAGAAGCAACAAAGCCCACATAGAAGAAGCACACTAGCCTGTGTGATCATGAGGTGCC
AAAGCGATGAGGTATCAGGCTTCAAAGACCAAAAAAATCATATCATTGTGAATGAGGGGG
AGTGTGGAGTGGGAACCTAAATCCCATGTGTAAGCAAGTGGACATCCCCTTATGGAAGGG
TCGATGCGTAGGAGATGAGCCACTCAAGGTGCAGTGTAGCAACAGTGAAACATACTACAA
CTCTCTTCTAGTTCCTAAATAGGCTCCCGCCCACTATCATGATCCCATTTCTGCATTACA
AATCTGGCTAGACCAGAGGATGTACACTGGTACAGATAGGAACTGGAAATACAGAGAATC
CAGGGCGGATGATTCCTTCAGGACCAGTGGTGAGAGTGGTGATACTGGGATGGTGGAGGG
AGGGTAGGGTAGAGAGGGGGAACTGATAACAAGGATCTATATATATCCTCCTCCCTGGGG
GATAGACACAGAAATGTGTGTGAAGGGAGATGTCGGACAGTGTAAGATATGATAAAATAA
TAACTTATAAAATTTTAAAAATCGTTTTATTAGGGGCTCATACAGCTCTTATCATAATCC
ATACATACATCTATTGTGTAAAGCACATTTGTACATTCATTGCCCTCATCATTCTCAAAA
CATTTGCTCTCCACTTAAGCCCCTGGCATCAGCTCATCATTTTTCCCCCTTCCCCCATAA
CTTATAAATTATCAAGGGTTCATGAGGGGGATAGTTCTACTCTCACTTGGGGTCACTATG
AGGCAGAATCGGCTTGATCGCACCCAGCAACAACAATCTTTATAGAAGCAGATTGTCAGG
CCTTTCTTTGGTCAAGAACATTGAGTGAATTTGAATTGATAGCCAGTCTTTTTTGTTTCT
TTGTTTCACCAGTTTTATGGGCATATAATTCACATATCCTACAATTCAGCAGTCCAGTCA
CATCAAGACGAGTTGTACAATCATTACCATACTTTTAGAGTATTTTATTCATTCTTTAAA
AAAAAATCATTTTATTGGGGGCTCATACAACTCTTAATCACAATCCATACATACATCAAT
TGTATAAAGCACATGTGTACATTGGTTACCCCTCATCAATTTTATTCATTCTTGAACGTG
ACTTTTATTAGCCCTGGCATATCCCCAAGGAACCATTAATTCAGTTGCTATCTCCATATA
GATTTACCTATCCTGGATTTCTAATACAGAAAAACATTAAAAAACAAACAAAACTAACAA
GAATAACAAAATAAAACAAAGCCTGAATTGAAAAGAAAGCAGAAAATATTAAAAGTAGAA
CAAATTTAAATGGATCATAAGGGAAATCGAATAATAGAGTGGTAAATTTTAACCTAATTG
CGTTTGCAACAATCTACATTCCAGTACATTTTGCATGTTAGCAAGGCCATTCACATCCCT
GGTCAATGGTCAGAGGGATTCACCAGGGGCTAAATGCACATGCATGTGCCCATCACCTTT
AAAAAAAACAACTGAGACCGCTTTAAAAATGGGTCAAAAGGGAGATCAGACTATAAGATA
GTGTATTAGCGTCTCCTAAGCATTGATTTATTCTCCCTCTTTTACCCACCAAAGAGGGTT
TTTTCGAATTCTTTGACCCAGAGCTTTGTTTGGGCCACGACTTCGTGGGGAGAAAAGGGA
TATTCTAGCCTCCCATTAGTCTGAATGCTTAAGAGACATTCCTATTACTCTTGCCTTCTG
CTTTTCTTCTTATGTTCCATTCTCCCTGACTTGCCTTTTTCTGCTTTGTCTCCTCTTCCC
TTAGGTAAGTCAAATCTCATGGATGCCATCAGCTTTGTGCTGGGTGAAAAGACCAGCAAT
CTGCGAGTAAAGACTCTGCGAGATCTGATCCATGGAGCTCCTGTAGGCAAGCCAGCTGCT
AACCGGGCTTTTGTCAGCATGGTCTATTCTGAGGAAGGTGCTGAGGACCGCACCTTTGCC
CGCGTCATTGTTGGTGAGTGAGGCTAGTGGGAAGGCTCTCCTTGGGCCCTGGAATGAGGC
CTGACCCTCAGTTGGTTTATGTATTGTTTTGCAGGGGGTTCTTCTGAATACAAAATCAAC
AACAAAGTGGTCCAGCTACATGAGTACAGTGAGGAATTGGAGAAGTTGGGCATTCTCATC
AAGGCTCGTAACTTCCTCGTCTTTCAGGTAGGCACTTTGTTGTTGAGAATGAATATACAT
AACAAAACATAACACCTGAATCCAGGACAGATGATCCCTTCAGGACCAGTGCTGAGAGTG
GCGATTTCCAGAAGGTGGAGGGAAGGTGGGTTAGAAAGGGGGAACCAGTTACAAGGATCT
ACCTATAACCCCTTCCCTGGGGGATGGACAACAGAAAAGTGGGTGAAGGGAACGTCGGAG
AGTGTAAGATATGAAAAAATAATAATTATAAATTATCAAGGATTCATGAGGGCGGTGGGG
AACGGGGAGGGAGGGGGAAAATGAGGAGCTGATATTAAGGGCTCAAGTAGAAAGCAAATG
TTTTGAGAATGATTAGGGCAACCAATGTACAAATGTGCTTGACACAATGGATGTATGTAT
GGATTGTGATAAGAGTTGTACGAGCCCCCAATAAAATGATTTCCTCATCTATTAACATAT
ACTCACTGCCCCCAGTAAGACCCCTATTTGTTCCTATCTAATCTTTCCAGTTGTCTGTTT
GATCCCCACTTACCAACCAGACTTACTGCCAGCAACCCTATAGGACAGGGTATAACTGCC
TCTGAGTTTCTGAGACTGTAACTCTCTTCTTTCTCCCTCAGAGCTGTTGGTGGTTTTAAA
CTGCTGACCTTGCACTTAGCAGCCCGACCCATAACCATTATGCCACCAGAGTTCTATTTG
ATCCTACATAGATAGATCATGAAAGAACACCATGCTCAAGGCAAATGTTCTTTACTAGTT
AAGCTAAACTATAGTCTGGTTTTAAGAATTGAGGGGATATTTTTAGTTTAAATCTTAAAT
ATGATCTCAGGGTAATAGTTATGGAGCCAAGTGGACATTTTGAACACTTATAGGATATCT
TTTTTTTTAGCCAGCCCCTGCCTTATTCCCAAAGCAGCACTGCTGGTGCTGTGGGCAAAG
CATCAGACTGCTACCCTTAAGGCTGACATTTCAAACCCAGCAACCACTTTGTGGTAGAAA
GATGAGGCTGTCTGCTCTTCAGAAGATTTAGTCTCAGAAGCACTATATAGGGTCACTAGT
AGTTGAAATTGATTTGATGACAGTGGGCTTGGAAGGTTGGTCCTGTTCCTAAGGAGCCCT
GATTGTATAATGGTTAAAGTACTCAACTATGGTTTGAAACCACAACCACTCTATGGGAGA
AACATGTGGCAATTTGCTTCCATAAAGATTAATAGGAATGGAAACCCTGTTGGACAGTTC
TACTCCACCTTATGGATCACTATAAATCAGTTTTGACTTGATGGCAATGAGTTTGGGTTG
ATTTAGTTTGGTCCTATTTCTTCTGGGTCTGTTCCCACTTACGCTGTATCATTTCTCTCT
TCAACTAATGTACCAGCTTTGCTTCCTTGCTGTGTTCCTGACTCCTCTCTACCCTTTTCA
AATTTAGTCTGTAGGCCAGATTCATATTATGAAGACCAAATTTGTCTTCTCTCAATTCTC
TTTAAAGGCATTTTGATGATTCTTTGTTACTTTATTTAAAAAAAATCATTTTATTAGGGG
CTCATACAATTCTTATCACAATCAATACATACATCAATTGTGTAAAGCATATTTGTACAT
TCATTGCCCTCATCATTCTCAAAACATTTGCTCTCCACTTAAGCCCCTGGCATCAGCTCT
TCATTTTTCCCCCTCCTTCCCCGCTCCCCTCTTCCTCATGAGCCCTTGATAATTTATAAA
TTATTTTGTCATAGCTTACACTGTCCAGCGTCTCCCTTCACCCACATTTCTGTACCCATC
CCCCAGGGAGGAGGTTATATGTAGATCCCTGTAATTGGTTCCCCCTTTTCACCCCACGCT
CCCTCCACCCTCCCGGTATCACCACTCATCACTGGTCCCGAAGGGATCATCTGTCCTGGA
TTCCCTGTGTTTCCAGTTCCTACCTGTACCAGTGTACATCCTCTGGCCTAACCAGATTTT
TAAGGTAGAATTGGGATCATGATGGTTGGGTGGAGGAAGCATTTAGGAACTAGAGGAAAG
TTGTATGTTTCATCATTGCTACACTGCACCCTGACTGGCTTATCTCCTCCCCCAGATCCT
TCTGTAAGAGGATGTCCAATTGCCTACAGATGGGATTTGAATCTCCACTCCCACTCCCCC
TCATTCACATTGATATGTTTTTTGGTTCTTTGATGCCTGGTACCTGATCCCTTCGACACA
TCATGATTGCACAGGCTGGTGTGTTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTTGAT
GGCCGCTTGTGATTACCTTCAGCTTTTAAGATCCGAGACACTATATCTTTTGATAGCTGG
GCACCATCAGCTTTCTTCACCACATTTGCTTATGCACCCATTTGTCTTCAGCGATTGTAT
CAGCGAGGTGAGCACAAAATGATATGATTTTTTTTTTTTTTTGATGCCTGGTAACTGATC
CCTTCGGCACCTCGTGATCACACAGAATGGTGTGCTTCTTCCATGTGGGCTTTGTTGCTT
CTGAGCTAGATGGCCACTTGTTTACCTTCAAGCCTTTAAGACCCCAGACACTTTATCTTT
TGATAGCCGGGCACCATCAGCTTTCTTCACCACATTTGCTTATTCACCTGCTTTGTCTTC
AGCGGTTGTGTCGGGAAGGTGAGCATCATAGAATGCCAATTTAATAGAAGAAAGTATTCT
TGCTTTGAGGGAGTACTTGAGTGGAGGCCCAATGTCCTTCTGCTACCTTAATACTAAACC
TATAAATATATGCACATAGATCTATTTCCCCATCTTCATATATAAATATTTTGCATATGT
ACAGGTCTTTATCTAGACCTCTATAAATGCCCTTTGCCTCCCAGCTCTTTCCTCTATTTC
CTTTGACTTTCCTCCTGTCCCACTATCATGCTCAGTCCCCACCTTGGTTCAGCAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
ATGAAGGATGAAGTCAACTGATCAAGTATCAAGTTCCATTCAGTATAATCAGGATTACAA
CGATTTCTATCTGACAGTAAAATGATTCGAGACCTTTGCCTCTTGCTACTGGGAATCTGC
CAGCTTCTTAGTCTGACTTGATACTCTGCTGGTGGGTTTTGGCTCCTACTGTCCTCTATA
GCCTTCTACGAATTGGGTGTTTGCAATTTAGGCTCTCATACTTTTCCCTTTGTCATATTT
GAAATACCGGTATGTTATTGTAATCTTCGGATCACACAAGCTGGTGTGCTTCTTCCATGT
GGACTTAGTTGACTCTTCACTTAGATGGCTGCTTGTTTGAATACAAGCCTTTAAGACCCC
AGACACTATTCTGATAGCCAGGCACCATTGACTTTCTTCACCACACTTTGCTGTAGCACC
TTTATCTTCAGTGATTATTTCATGAAAGTCAGTATTGAGCCGGGCCACGTTATCATAACT
AACTTCTTGGATTGGGGATAGAGTTCAGTGGGGACCCAGAATCCATCTGCTTGTTCCTGA
GATGTGCATGACTCAGGTTTACTTTGGCGGTCGTATTTTGACAAATTCAAAAACCCATAA
AACCAACTACTCCGACTGCCACAAACCAACTAGCAGACAACAAAAGACAAACAAAAACAA
GTAAACTAAGGGCAGGAAAACCAAAACCCATAGAAACAGAAAAGTAAAACATTGTCAATC
ATCCCTCTGGGGCAGGGGTCCTCAAATTACGGCCCGTGGGCCACATGCGGCCCACCGGGT
GTTTTTGCCCCGTTTTGTTTTTTACTTCAAAATAAGATATGTGCAGTGTGCATAGGAATT
TGTTCATAGTTTTTTTAAAACGATAGTCTGGCCCTCCAACGGGTCTGAGGGACAATGAAC
TGGCCCACTGTTTAAAAAGTTTGAGGACCCCTGCTCTGGGGTATAACATCATCTCCCTGG
GGTGAAATATCAGCAATTTTTCCGATGGCATGTCACTCTGGACTCTAGGTATGAGGAGTC
TATGCAAGTACAATTCCACTGTGAGCTGCAACCCATGAGTTGTTGCCCCTGTAGTTTGAT
CTCCCATTTGACTGAGTTCTGCTTACCCTGAGAATGGGGATTGGTGCCAGGGGGAAACAT
CCTGGATCAGTTCTTCCAAGTTCAAATCCCTACCCAACAGATCAAAACCTGTCATGTCAC
TGTGAGGGGAGGAGGCATCGAGGTACTAAACATGGTGATTCTGGGTCCCTTTCCATTGGA
CACCCACCCAACCAGGGGTTACCACAAAGGTCCAATGACCACAGGTCCTAAGGTGGCCAC
TCTGCTTCCTTGCTCATCAAAGTACCCCAGGCCTCATTCCAAGGGTGCAGGCACCTTTGA
AGAAGGGTTAAGTTCATTCTAATGGGCCTCTACGGCCGTACCTCTATGTGCAGTCCTTCT
GGTGTATCAGGCTGTAAATCTTTACAGAAGCAAAAGTCTAATCTTTATTCCATGAAGCAC
TAACATCTTGTGGTTAGCAGCTCAACATGTAACCCACTATACCACCATGGCCCTGGNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTCTTTTCTTCTTGGTTTGCTTCTGT
ATGGGCATGGGAGGCCAGTCCCTCTCCCCAACCTGTAAGTTTAGTGTTGTCCTCTGTAGC
ACATACATCTAGGGAGGGGATCAGTTTGCCTCTGATTGGGGCCAGCCCTGTAGACCTCCT
TGTTCATGAGTTGCTCCATGTGGTTAGGTTGTCCTCAAGGTTTGGTGTCCTGCGGTGGGG
TCTGCACTCACACTTCCATTTCTGTGGAGACAGAAACAATACCTTTCCCTAGGGTGGATT
AGTGCCCTTCTCTCCCAGTGCCGCCATCTTCCTCTCCCCACCCCCCTTCCCCATCTTTGT
GTTGGAATGACATGCACATCCTTGAGTTTAGTCTGTCCGCCACCCAACTGCCTGTATCTT
TTATGTTAATTTTTAAAGATGCACATCACTTTGTGTTTTACCATGCTCTCCAAGTCACTA
TGATGCATACTAAAGTCATTGTGATTTGTGCAATATTAGCCACAGGATTAAACCTGAACT
CCCAAGCATGGGAAACATAATAGGTTCTTGCCCACTTCATTAGCCAGGCTATGACAAGGA
ACAACTGGCTATAGTCTTAGATGGCTGTGTTTTGATCTTTACTAGGGTGCTGTGGAGTCT
ATTGCCATGAAGAACCCTAAAGAGAGGACAGCTCTATTTGAAGAGATCAGTCGCTCTGGA
GAATTGGCCCAGGAGTATGACAAGCGAAAGAAGGAAATGGTGAAAGCTGAAGAGGATACT
CAGTTTAATTACCATCGTAAGAAAAATATTGCAGCAGAACGGAAGGAGGCCAAACAGGAA
AAGGAAGAGGTAAGTGGCCAGGCTACTTCTGGGCTCTGATGGGCCAGGATGGAACCAGCT
TACTTATGGACCCCTGCCTCTTATTTGCACAGGCCGACCGTTACCAGCGCCTTAAGGATG
AGGTGGTGCGAGCCCAGGTCCAGCTGCAGCTCTTTAAGCTTTACCACAATGAAGTAGAAA
TTGAGAAGCTCAACAAAGAACTGGCCTCTAAGAATAAGGAAATCGAGAAGGACAAGAAAC
GTATGGACAAGGTAGAAGATGAGCTGAAGGAGAAGAAGAAGGAACTGGGCAAAATGATGC
GGGAGCAGCAGCAGATTGAGAAGGAGATCAAGTAAGAAGTAGGCTTGAGCCTGTAATTTG
CGAGGAACCAAGAGGCTATGCTAAGCCCTAGGTCTCTTCTGAGACTTGAGTCCAGTGCCC
ATACTAGTTTCTTTATCTTTCCTTTGACTTGCCTTGCCCAGAATCGGGGATACTTCTTGC
TTTGCATTTTTGTTAGGTAGTAATTATGTACACAGACTTGGTAAGATAGGTACTCAGGAG
GAGACTTTTTTTTTTTTGAGTCAGGAAGTTCAGTTTTTATTTGGTGGGCACAGGTGAGGC
AGGGCACAGAGCTACTAAGGCCTTCATGAATGCAGGGCCCGCCACTTGTCCAAGGGGCCA
TGATTAGGGATGTGTTTGACTCCATAGCTATCTGGGATAAGGCGCTTCTCAGCCACCATG
TCCTCTAACTTATCCACATTAAACTGGGTGAAGCCCCACTTCTTGGAGATGTGGATCTTC
TGGCACCCAGGGAACTTGAAGTTGGCACTGCGTAAGGCCTCAATCACATGCCCCTTGTTT
TGAAGCTTGGTGTGAATGGACATGATGACCTGGCCAATGTGGGCTTAGCCACTCTGCCTT
GGGATTTCCCAAAAGCTCCTTGCATCCCAGCTTGGAGCCTAGCTTAGGGAGAACAGAAAT
TAGCCAGGCCAGAGCCATTGAAAAGCAGCAAAGGTAGTCTCCAAGGTCCCTTAGGGCAGC
CCATACATAGCAACATGCTGCATACACTACCAAGGAACCTTGCTGTTTGCAGCTATTGCA
CTTTGGCCCCCACAAGGAGGAGGATGGTCTGCTGAATTGGCTGCAAAGAGGGAGAGTTTG
AAAGAGGTTGTGACCTTGCTGAATGAGAGCCAGGGTAGAGGAGACGCGTGCCAATCGCAA
TGCGCCACGCAGACCTTCCTAGAAGAGTTGGAAAATTTAAAGGATCAGGATTTGAAAAGA
TTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACATGGATGAGCTAGAGAAGC
AGATGCTGTCAGTAGAGAAAAGCCTGGCAAGAATTCGTATGATCGGATGAGAAGCGTAGA
GTCAGAGTCAGAGCTGAGATTTCGACCTTGGAAGAGAACCAGGTAAGTCATGAGACAGGC
TATAGGGAGTAGATTGCTAGCTGATAAGGACTGGCTTGTTCATCCTTCCTCGTCCTTAAC
ACAGGTGAAGAAGTACCATCGGTTGAAAGAGGAAGCCAGCAAGAGAGCAGCTACCCTGGC
CCAGGAGCTCGAGAAGTTCAATCGAGATCAGAAAGCTGATCAGGACCGACTAGATCTGGA
AGAACGGAAAAAAGTTGAGACAGAGGTGGGTATAAGATTAGGAATGACATTCGAGGGGAG
TTAACTTGCTCAGTTCCTGGTGATAGAGTAGATGTCTCTCTCTTTCAGGCCAAAATCAAG
CAAAAGCTTCGAGAGATTGAAGAGAATCAGAAGCGGATTGAGAAACTAGAGGAATACATT
ACTACAAGCAAGTATGTGACTCTGTCACCTTCCCCCACATTTCCAAGCTTTATTCTGTGT
TTTTCCCAAGCTTATTCTTTTGACCATACCTGTCTCTCCCAGACCATACCAGAGTCTCTC
CTAGCCAAGAACAACTTCTGACCAGTCAGGGTAACCTCTGTTGTTTCCATTCTTTGTAGG
CAATCCCTAGAGGAGCAAAAGAAGCTAGAAGGGGAACTGACAGAGGAAGTGGAAATGGCC
AAACGACGAATTGATGAGATCAATAAGGAGCTAAACCAGGTGATGGAACAGCTAGGGGAT
GCCCGCATTGACCGCCAGGAGAGTAGCCGCCAACAGCGAAAGGCAGAGATTATGGAAAGC
ATCAAGCGCCTTTACCCTGGCTCTGTGGTAAGAATTGAAAGGGAACTCATTTGCTGAGCA
CATGTGCTTACAATTACTGTTAAATATTTTGCTGAACAATCCTGTGAGGGTAGGGTTGCT
AACCCATTTTTTACATGGAGGGTGAGAAAGATTAAATTACTTAACTCAAAGCAACACAAT
TTGCAAGTGGAAGAGCTTCATTTAAAACCCATTTTGTTTAAATTCTAAAGCACATGTTCT
TTTCCTCACATCAGTTTTGTCTTCCTAAAGATTTGTCTTGCTGTGCCTACTTCTCCATAG
GAGTTGCAAAAGACTTTGAAAGGAAGAGGGGTCAAGGGACCACAGGGCCAGGATTATTCT
CCCAGGAAGTAGGTGTGGGACCTTTATATTCAGAGAGTACTGTGTATGGAGTCTTCTATA
TGTTCTCTATTGGCATGTATCAGCCAGGCCATTTTCTTTTTTTCTTTTTTTAAGTCGTGT
AAATAACAAGCATTTATTATCTCATCGTTTCTGAAGGCCAGCAGTCTGAGACTGACAGAG
CTCTTTGATTCTGGCTCAGGGCTTTTCACGAGGTTGTAATCATCTTTAAGTTTGATTCTG
GCTTGAAGACTTCCAAGATCACTCACATGGCTACTGGTAGGAGGCCCCAATACTGCACCA
TGGATGCCTTTTTGTAGAATCGCTTGAGTGTCCTCATCGACTTGGTGGTGGTTTTCTAGC
ACAAGTGATCTCAGAGGAAATTTTGTTTCCCACAGTGGTTGCACCATTTTATAGCAATGG
ATGATATTTCCCAACTCTCCTTACCATTGGTTTTTCCTGTTTAATTGAACTTTGGTATTG
TTGTGGTGAAATGATAATTTCATTGTTTTGATGCATCTCTCTAATGGCTAATGATTGCTG
CCATATCTTCATTTGTTTACTGCCTAAATGTCTTCTTTAGTGAAGTGTCTGTTTTTAATT
GGATTGTTAAGAGATTTTTGGTTAAGGTGTCAAGAATTTCCCATACAATTTTGAAAATAG
TCCCTTGGAGGATGTGTCATTGCCAAATATTTTCCCCAATATGTAGGTTTTCTTACTCTT
GAAGAAGTCTTTTGATACACATAGGTATTTAAGTTTTAAAAGATCCCAGTTATTTAGTTT
AGTCTCTGTTTCTTGTGCTTTTCTTTTTTTATGTTCTTTTTTTTAATCGTTTTATTAGGG
GCTCATACGACTCTTATCACGATCCATACATACATCAATTGTGTAAAGCACATTTGTACA
TTCATTGCTCTCGTCATTCTCAAAACATTTGCTCTCCACTTAAGCCCCCGGCATCAGGTC
CTCATTTTCCCCCTCCCTCCCTGCTCCCCCCTCCCTCATGAGCCCTTGATAATTTATAAA
TTATTATTTTGTCATATCTTGCCCTGTCCGACGTCTCCCTTCACCCACTTTTCGGTTGTC
CGTCCCCCAGGGAGGAGGTCACATATAGTTCCTTGTAATTGGTTCCCTCTTTCCAACCCA
CTCTCCCTCTACCCTCCCAGTATCGCCACTCACACCACTGGTTGTGAACGGATCATCCGC
CCTGGATTCCCTGTGTTTCCAGTTCCTATCTCTACCAGTGTCCATCCTCTGGTCTAGCCA
GACTTGCAAGGTAGAATTCAGATCATGATAGTGGGGGTTGTAGGGGGAGGAAGCATTTAG
GAACTAGAGGAAAGTTGTATTTTTCATCGTTGCTACATCGCACCCTGTCTGGCTCGTCTC
CTCCCCGATACCCCTCTGCAAGGGGATCTCCAGTGACCTACAAATGGGCTTTGGGTCTCC
ACTCCGCACTCCCTCCATCATTCACTATGGTAACATTTTTTTGTTCTGATGATGCCTTAT
ACCTGATCCCTTTGACACCTTGTGATTGCACAGGCTGGTGTGCTTCTTCCATGTGGGCTT
TGTTGCTTCTGAGCTAGATGGCCGCTTATTTACCTCTTGTGTTTTTCTTACTTAGGTTTG
ATAGTCTCTTAATACCATAAGTTACAGCTCCTAACTCCGTCTCTATTCTTTGATGCCTTA
CTGTTTTGTTTTTTAATATTTAGGCGATTGTTTCATCTTGAACTGGTGTTTATTTTATTT
TTATTTTTAAAAAATCATTTTATTGGGGGCTCTTACAGTTCTTATAACATTCCATACATC
GATTGTATCAAGCATATTTGTATGTATGTTGTCATCATTATTTCCAAAACATTTTCTACT
CGAGCCCTTGGTATAAGCTCATTTTTTTTACTCTCCTTCCCCGACTCTTGTGAATCCGTG
ATCAATTATATATTGTTATTAACTGGTTTTTATATATGGTATATCTTACTTCATTTTTTG
AAAAAGGATATGTGATAGATTTGTCTCAGAGGACACAGGATGATCATGAGGGCTTATTTT
GAAGTTCTTATTTTATTATTTTTTTAATTTTGAAGTTCTATGGTAATTGAAAAAAAAAAC
TTTTAGTGAAGCAAAGGCCAGGAAAGTTGTGTGTCAGGGTTCCCCCCCCCCACATTATGA
CAATGCACCTGCTTATTCTTTGAGGGTAGCAAGGACTTTGCATTGTAATATTTTTGTTTA
ATAAAGGGTTCAATCATTTTGTAGCAGTACTTTTTGACTTAACCTTGTATGTAGAAAGTC
TGAAGGTAGTGTAAGTGTTTGGTAAATGGGAGCTTTTGCTGATAAACTATTACCTTTCAT
GGATGTTTTAGGACTCAGAGGCAGGTTTATTGGAGGCTGTGATTTTTACTGCGAGGGAGA
ATGTAGAGTAAAATAAGGCTCTAGGGACATCCTAGATTTCATCAGACTTTTTGAGCTTTC
CAACTCTGGAGATTGCAGGTTCCCTGAATATTATCCTTTGGTTGCTATAATTCTATTCCT
GGCTTCATTTCAACTTGATTCCAAAGAATATTTATTGATCAGCCTGTATAGGTAATTTAG
GATAAATTATTCTCAGTCCCTGCTCTTAATCTGATGATAGTCCTTAGGGAACCATAGTTG
GTTTGTAGAGGTGAGAGTAGTGAAATGATAAAAGATATATTTTGTGAGAATTTGATAGAA
GGTTTTTAAGATGTCTAATATAGTTACTGGGGTGGCAGTGGTCTATAACATGGGAAAAGA
TTTGGAAAGATGATTTTGGATTTAGACATAACTGTAGACCATTTTCAGTTGTTTATCCTT
TGGAGCTCTAGCAGGCTTTTCTTTCTTTTTTTTTTTCTCAAACCAACAGCCTTTACATTA
TTTATTGTTAGACTTGACGAGGAAGCAAAAAACCAAGGAATAAACCAGATTTGTCAACAG
AAGTTCAAGTGATCAGATGGGGACAAAAGTCTTAATGCAACACAACATGACTTGAGACTG
GGAAAATGTGGTCATGTGTGCCATCCCTCAGGGGGCTCCTTACAGACCCAGCTTGGTTCT
TCTCCAATGTACTGAATAGTGGTTGTACCTGATTTTATTACTGATTTCCATTCTAATCCA
CTGGGGAATGGGGCCATTCTGCTTCTGTTTCTTGGCCAGGAATCTCTTGATCCTGAAAGT
CTTAATTAGACGACGTGGTGAAATCGGAGCAACACCACGCTCGGGCTGGCAGAGAAACTG
AGAGCGGGAGAAGAGCTCTAGCAGGCTTTTCATCCATTGCGATTTTGGTACAGATTATAT
AGCCAGTATCTCTTACGGAGTTGTCATTTCTGAATCAGCTTCTAAAAGCCTCATGCCTCA
ATTTCCCCTTCTTACTTTATTCAGTATGGCCGCCTCATTGACCTCTGTCAGCCTACACAA
AAGAAGTATCAGATTGCTGTCACCAAGGTTTTGGGCAAGAATATGGATGCCATTATTGTG
GACTCAGAGAAGACAGGCCGGGACTGCATTCAGTATATTAAGGAGCAGCGTGGAGAGCCC
GAGACCTTCTTGCCTCTTGACTACCTGGAGGTAATGCTTGTGGAGATGGAGTCAGGGGAG
TGTGAGAGGGCCCTTCCTTTAATCTTTCTATATTCTGTCACTTACTGAACTTCTTATCAC
AGGTGAAACCTACAGATGAGAAACTCAGGGAACTCAAGGGGGCCAAGCTAGTGATTGATG
TGATCCGCTATGAGCCACCTCACATTAAAAAGGCCTTGCAGTATGCTTGTGGTAATGCCC
TTGTCTGTGACAATGTGGAGGATGCCCGCCGCATTGCGTTTGGAGGCCACCAGCGCCACA
AGGTATGGATTCCCTTGCTAGACAGGAGTTGGATAGACTCAGTATGTCAACTCAACTCTT
TTCTCTTCTCTATATTGTATGTAGACAGTGGCATTAGATGGGACCCTGTTCCAGAAGTCT
GGAGTAATATCTGGTGGGGCCAGTGACCTGAAGGCCAAGGCAAGACGCTGGGATGAGAAA
GCAGTAGACAAGTTGAAAGAGAAGAAGGAGCGATTGACAGAGGAGCTGAAAGTAAGCCAT
AGTCAGTGCTCTCTCTATGAGTGGAGGTTTCTAAGCCCAGGTTTGCCTACTGCTTACAGC
TCATCTCTTCTTTTGTGTTCCCATCAGGAGCAGATGAAAGCAAAGCGGAAAGAGGCCGAA
CTGCGTCAGGTGCAGTCTCAGGCTCATGGACTACAGATGCGGCTCAAGTACTCACAGAGT
GACCTAGAACAGACCAAGACAAGACATCTAGCCCTGAATCTACAGGTGCAGTCTGGTTCC
CATCCCTATCTTCCAAGGTCATCCTCGTTCCCTCACGAGTGGAGAACTTTTCCTACTCCT
TCCTCTCTTCTAGTCTGCTCCAGCGAACTGTGTCATGTGTATTGCATTAGAATACCTGCT
TCACTGGACTGTTGTCAAACATATACAGTGTTTAGACTGGTTTCTGACACAGTAATTTTT
CAGTAAATATTAGGTGCTATTATTAGCATTATACCCCAAATACTAGTGTTTCTTCTGGAA
GTGAATTACAGGCATTTAAATCCAATTAGATGAGGGGACTATTGTATGTATGAGGGATAT
CACAGTGAATACAGTAGACAAAAAAATCTTAACTCTCATAGCGTCTATATTTACATGGAA
GGAAATTAAATAAATGACATCATATATCAGAAGATAGTATTTTGGAGAAAAACAAAATAG
GCAAGGGAAATAGGTAAGAGTATTGTTGGGGTTGGCATAAACATTATCAACTGTCTACTC
ATAGAACAGCTACCAAAAGTCAAAGATACTGATGTTGAGTTGATTTCTACTCAAGGCACT
AGAACTGCCCAGAGTTTCCAAGGCTATAAATCTTTTTTTTTTTTTGATCTTTGGCAGGCC
GTGTGGACTTTATTTTTTTCTTTTTTAACATTTTATTAGGGGCTCATACAACTGTTATCC
CAATCCATACACACATCAATTGTGTAAAGCGCATTTGTACATCGTTTCTCAAAACATTTT
CTCTCCATTTAAACCCCCGACATTAGGTCCTCATTTTTCCCGTCCCTCCCCGCTCCCCCC
TCCCGCATGAGCCCTTGATAGTTTATAAATGGGTATTTTGTCATATCTTGCCCTGTCCAA
GGCTATAAATCTTTACAGAAGCAGACTGTCATGTCTTTCTCTCACAGAACAGCTGGTGGG
TTTGAATAGTAGCCATCCTTTCAGTTGGCAGCTGAGTGCTTAACCACTGCACCAGGGCTC
CTTAGCTCATTAAATATAGGTCAATAATCCCTTGTCCAACATTCAATGTTCAGAAAGCTC
TCAGAACAAAAGTGGTTTTTGTGGTTTGTGTGTAAATGGGCAAAAATCTAAACTGAATAG
ATGTGAAGCTATTTGTTAGCTTAATCCACTTAATGATTATGGGAGTGCTTCCCAAGACCA
ATCTGGAGGTATTATATCATATCTATTGTTTTACCCTTTGCTAAAATTTGAAAGTCTGAA
TTTTAAAACATCTCACCCCAGGGTTATAGATAAGGGATTGTGAAACTGTAAGGGTATTCA
CTGTGTTCTCAGCTCTGTGGATTAGATCTAACCAAACTCGAGGCCAGGGAGGAAGTTAGG
TGATTGTTCCAGTGAGAGATGATGGCTGATTTACTAGGGCAGCAGTGCTAAATTCCGATT
CTCTTCCTTACTTATGAGACCAGGGCAGTCCTTTTCCTCCAAGGAACTTGGTATATATTT
TCCTTTTCAACTCCATTTCTCGCAGGAAAAGTCCAAGCTGGAGAGTGAACTAGCCAACTT
TGGGCCTCGCATCAATGATATCAAAAGGATCATCCAGAGTCGAGAAAGAGAAATGAAAGA
CTTGAAAGAGAAGATGAATCAGGTTGGTAGTTGGGTAAGCCATGGGCATCAGGTAGGACT
GGACCTGGAAGCAGGACCCTGACCAAAAAGGCCTCTATCCTCTCGCTTCTCCTTTCAGGT
AGAAGATGAAGTATTTGAAGAGTTTTGTCGGGAGATTGGTGTGCGTAACATCCGGGAGTT
TGAGGAAGAGAAAGTGAAGCGACAGAATGAGATTGCCAAGAAGCGGTAGGTGGAAATATG
GGTAGAAGAGAAGACAAAGATGCTTTGAACCTCTCTCTAGCTTGATACCCTTGTAAAGTC
AGATGTCATCATAAAGCTGGGCCTGGCTCTGTGGGAGTTTAATGGAAGTAGGCTTTAAAT
AACAGAGATCCCAGGGAGGCATTGTGGTAGTACACAAGCGTCCCAGTAGTACCTGTGTTA
AAATCTTGACCTCCACAACTCATTAGCCTTGTCATCTTTAAGCGTCGGTTTCTATATCTG
TAAAATAGGATAATGTATCTGTAACATGGCATTGTTGCAAGGATCAGATGAAATAATCGT
TATAAAGTATTTGGCATAATACTTAGCACATACTAAAGAACAATAATTGTTAGCTGTTAT
TATTGTTAGTATCCTGACGAAAAATGCTGGGGTGGAAAGACCTTGTTTGAAAAATAGCAA
GAGCAAAGCAGTTTCTTCATTCTTCCCAGTTTTAGTTTATTCATTCATTCAACAAACCTT
GAGTACCTACTTTGTGCCAGGTTGTCCTGCGGTAGGTATTGACAGGGCTGGGGAAAGGTA
GAAAGAGATGAAACATGACACAGCCTCTACTCTCAAAGAGGTCACTCTCTGGACCCTATG
CCTTACACAGTAAATCGTTCATCTAGCCCTTTACCAATACAGTAAAAAAATCATTTCTCT
TCTGTCCCTCAGCCAGTTTCAAGGAATAAAGAATTGAATTAGAGACTATTCCTGTCTTCA
GAAAGGTTATAGAATACTGGGGGAGACTAGTAAGTCAACAATTTCAGAACAGTGTGATTG
ATGTTATTGAGGTAGATAACAAAATACAGAGATAAAAAAATTTAATAAATCATTTTATTG
GAAACTTATACAGCTCTTATCACAATCCATACATCAATTGTGTCGAGCTCATTTGTACAT
AATGTTGCCATCATCATTTCTAAAACATTTTCTTTCTACTTGAACCCTTGGTGTCAACTC
CTCTTTTTCCTCTCCCCCCCATTCTCCCACCCTCATGAACCCTTGATAATTTATAAATTA
TTATTTTGATATTTTATACCAGCGATTCTCAACCGGTGGGTCACGACCCCTTTGGGGGTC
GAATGACCCTTTCACAGGGGTTGCCCGATTCATAACAGTAGCAAAATTACAGTTATGAAG
TAGCAACGAAAATAATTTTATGGTTAGGGGTCACCACAATATCAGGGACTATATTAAAGG
ATTGTGGCATTAGGAAGGTTGAGAACCACTGTTTTACACTATCTGCTGCCTCCCTTCACC
AATGTTTCTGTTATTCATCACCCTAGACAGGTGGACAGTTGTATGTCGATCATTACAATT
GGTTCCCCCTTTCTCCCCCCACTTTCCCCCTACCCTCATGGTATTGTTACTCTCCTTATT
GGTCCTGAGGGGTCTATCTGTCCTGGAGTCTGTGTGTCGAGAGCTCTTATCTGTACCAGT
GTACATGCCCTGGTCAGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCCAGGTTATTAGAGCAAAGTG
TTCTTGTATTGAGGGGAGTACTTGAGTGGAGGCCCAATGTCCGTCTGCTACCTTAATACT
TAACCTATCAGTATATGTACATAGACCTATATCCCTAGTGTTGTACATGAATATATTTAC
ATATGTACATGCCTGTTTATATCTCTATAAATGTCTTTTGCCTCCCTTGTTCTTTCCTCT
ATTTCCTTTTACTTTCCTCCTGACCCACTATCATGTTCAACCTTCATTCAGCTCTCAATA
CAAGAGATGTTTTTTTAATTTAATAAATAATTTTATTGGGGGCTTTCACCACTCTTATAA
CAATCCATACATCAATTGTAACAAGCGCATTTGTACGTAAATTGCTGAGTTAGTTAATTG
TGCCAACCTGGCCGATAATCACATGTGGGGCTAATTGAAGGGCCCGAAGATGAGACCCTA
AGGTCAAAAGGCAGTCAAAATACGACTGAGGAAGAGCTATCTTCTCAAAGTAGACCATAA
AGACATAAATAAAGTATTGCCTTTTAAAAAAAGATATGAAAAATCATAATTTATAGTTTA
TCAAGGGTCCACGAGGGTGGGAGGGCCAGGGAGGGAGGGAAAAAAGAGGAGCTGATAGCA
AGGGCCCAAGTAGAAAGACAATGTTTTGAAAATGATGATGGCAACATCCTTAACACAATG
GATGGATGGTTTGTTATAAGATCTATAAGAGCCCCCAATAAAATGATTTTTTTTTAAAAA
GAGAGAAAATGATGATGGCAACTGAGTTAGTTAATTGTGCCAACCTGGCAGATAATCACA
TGTGGGGCTAAATGAAAGGCGGAGGGATAAATGGGTGGTGAGCCTTGCCTTTCTAGTTCT
CCGGTCTCTTGCTTTGTGATCGATGGTGGCACCAGGGTGCAGCTGCCTTAGCAGTTCCCT
GCTTCAGCTTGCAAGATTGACTTCCTACAAGACATCCCCAAGGAGAAGCCACATGGACCT
ATCCCGATGCAGCCCTGGGTGCTGGCGCAGGTGTGTGGAAGACCCCTGCTAGTGCTGAGA
TGCTTATTCGTGGACTTACAGAATGCCTCATCCACCGGTATGGCATCCCACATAGCATTG
CTTCAGATCAAGGAACTCACTTCACAACAAGTGCAGTGTGGCCATGGGCCCATTCCCATG
GAATCCAATGGACATATGTCCGCGTGGGTTCGTACCCCACTCCTGGAGGCTCACCAAGCT
ATTTATCCCTCCGCCTTTCAATTAGCCCCACATGTGATTATAAGCCTGATCTCTAACAGT
ATTTTGCTGCTATTCATGAAGTTTTCAGTAGCTAATTCCTCCGAAGGGGATAATCTATTT
CTTCTTTGTAGTCCGTTCTTAGTCAGGAAGTTCTGCTGAAACCTGTTCGTTTTGGGTGAC
CCTGCTAGCATTTGAAATACCAGTGACACAGCTTCTAGCATCACAGCAACATGTAAGCCA
CCACAGTAGACAATCTGACAGACAGGTGGTAAAGGGAAAGGGTTAAAGATATGGAAATAC
TGCCTTTAGAAGTGAATAGATTCACTAACCTGCTTTTGAAGGCTATGATTTTCAATGGGA
GACCTAACTCTGTTTTGAGTCTCTTAGCAAAAGTTAAGACTCCACTGTAGTACTGACCAC
TAATGAGTAATTTGGCAGCTTTGCTCTCAGGCAAAGTGTGTAATTAAAAGTATATTACAA
CCCCATAGGCCAGACTATGAAAGGGGACCTTGCCCTCAGGGAAGGAACTTGGATTATACT
TTATAACTAACAGAGGCATCTTATCTAAAGGTTGGAAAGGGGGTGGGTGTTATTCAAGCT
CGGATATGACTCAAGGTGCCATAGGATAGGCCCCAGAAGTAATCCTCTAAATCTTGTTAA
TCTGCAGTTGTGAACACATCAATTTTTTTTCCCGTTTCTATAGTCTTGCCAGCAAAGTGT
CGGATCGATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGTATTTTG
TCATATCTTGCCCTGTCCGACGTCTCCCTTCACCCACTTTTCGGTTGTCTGTCCCCCAGG
AGGAGTCACATATAGTCCTTGTAATCAGTTCCTTCTTTCCTACCCATTCTCCCTTTACCC
TCCCTGTTTCGTCACTCACACTACTGGTTCTGTAGGGCTCATCCACCCTGGATTTTCAGT
TCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAGACTTGCAAGGTCGAATTCCAGT
CATGGTAGTGGGAACAGGGAGGAAACATTTAGGAATTAGGAAAGTTGTATTTCTCATCGT
TGTTACATCGCACCCCGACTGGCTCATCTCTTCCCCGAGACCCATCTGCAAGGGCTGGAT
CTCCAGTGAGGGCCTTTAAGTTTGTCCTTAGTTTTCATTAATGATCCTTATAACTCTAAG
TTTTATATTTAGGTCTTTTTCTTAATATTTAGGTGTCTAATACATTTTGAGTTCTGTATA
GATAGTTTTTAAAAGAGTGTAATGTTGAAGCAGACATTAAAAAATATTTAATTAGTTGAG
GAAAACTATTGTTTTATGTTAAGGAAATTTCAGGGGATAATTTTGGTTTATGATTTAAAA
AATTATTTGCAGAGCAATCATTTCACCCATATGCCTCCAGAAAGTTTGGAGTTCTTGAGA
ATATAAATTTTTGTCCTGAATGTTTGCTCTTTTGGTCAGGATTCTTATATAGAATCTTTG
ATCAAAATGAGGAACTCAATGTTTTGTGTATGATTTTGTACTTCCCAAGGCTACCCATTT
CTTAAAAAGGTTTGGGAATCTTGGGAGAAAAGTAGTCTAAACCCTTGGGCAGAGATTGAA
TACAGCCAGTGTGCCCAACCATGATGTTGCTAACTAAAATTATTTTTTTCTTACTGTGTG
CCAGGCTCTATTCTAAAGACTTTATACATAATAACTAATTTTAAAATGGAAAAAGAAACC
TCCCAATAATTCTGAGGGTCATTTATAAAATAAATAGGCTATAATCTTTCATCATTTATA
AAATGACATCATTTATTTTATAAATGACTAAACTGAGGCATGAACAATATAATTTTAACT
TGCTGGAGATTACAGTATTCAGTGGCAGAACTGGGATACCAATCCTTCTTAACTCTACAT
TATATTGCAATGATAGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
CTTCTTAACCTCCTACATTATATTGCAATGATAGTATAGGAAAAAAGAGCCCAAATTCTG
TTAGACCTGATTTTCAGTGTCACATGGACAATTTACTAGCTTGTGGCCTTGGGCAAGGTC
CCTTACTTCATGACCCTAAGTTTTCTCGTTTAAAAATTAGTGCAAAAATTCACATGTACT
GTTGTGAGGATTAGAGATACTGTATGCCAGGTTCATGGAAGCTCAGTAAATAGGAATAGC
TGGTGGATTCATTTTGTGCCTCCTCCTAGGAACTTGGGTGGGCTCTGGCATTCAAGGGGA
ATGAATGAGATTTAGTCTACTCTCCTTAGCCTTGCACCAGAACTATAGGGCTATGCTAGG
GAACTTAATTTCTTAACTTCAGGGGAGGGTTTTATGGGGCCATTGGGGTATATGAGTTGA
GCAGTGACCGACATTTATTAGTAACCGTGGGTCCTTGGTGGGGCAATGGGTTAATTGCTC
AGCATTCAAACTGCTTGGGGTAGGGGTGCTAATCCTCACAATTTCTTCCTGTAAAGATTA
TACCTAAAAAAAACATTGGGGCAGTTTGGCTCCAGAGTATACGTTTGCTATGAGTTTGAA
TTAACTGTACATAACTACAGCAAATATGAGTGGATGAACTGAGTGGTACTTAACATTAAG
CTGTAATTTGGGTCCTTGAGCCTGAGAAAGCAGACAGTAAATTTTAGTTATCAACTTCCC
TTTTTTCTCTGCAGTCTGGAATTTGAGAATCAGAAGACTCGTTTAGGTATCCAGTTGGAT
TTTGAAAAGAATCAACTGAAGGAAGACCAAGATAAAGTGCACATGTGGGAGCAGACAGTG
AAAAAGGATGAAAATGAGATAGAAAAGCTCAAGAAGGTAAGGAAGGAGAAGATAAAAAGG
TTAAAGATTGGGAGGAAATATTGGAAGAAGAATGATGGATAGACAGCTGATATCAATAAT
TTAGGAATGTAATTTTGTAAGAAATATATTAAGACCCAAATAAGGGGAAAAATGATTTAA
TGCCATAATAGTTTAAGAAAATATTCAAATGGCCTATAAACACGTATAAATAATTTATTA
AAATCAAAGAAATTCAAATTAAGGCAACAATCCATTGTAATTTGTTTCCTATCATAGCAG
TTTAACTAAGATTAAAACATTCTCAGTATTGGTCCCAGTGTGTGACACCCGTACTCTTAT
GCATTATAGCACCATCTGTCTGGAGTACAGTGATACCTCAGTTGTCCAACGGCTCCAAGC
TTGAACTTTCCATTACTTGAACAGCGAAGTTCAAAAAAATCTGCTAGGTGTTCAAACTGC
TGTATAGTTGAACTGAAAATCTAACTTGAAAAACTTGTATGGGCTGAAAGTGAGTCACGT
TGCATCCAGCCTCAGACACAAAGGGGTCAAGCTTCAGTCTAAGCACCACTCAATATGTAG
TGCTTGTGTTAGTGCATTTGTCATTGTGCCTTTTTTGTACTTTATTTGCATAAAATAGCG
CATTAAAAAACATGGCTCCAAAGAAAAGTTAGTGACACCAGCAGTAAAGCTAAGAGGATA
GTTAAAAAAAGAAATCATTGATAAATTTGAATCAGGTCACTTCTTTTGTGATTTGGTGGC
TGAATACAACATGGCTAAGTTGACATCAACATTTTTAAGGGAAATAAAGGTGATTAAGCA
GCGAATGCAGCAAAAGGTATGAATTGTTAACCAAGAAACAAAGAACCCAAACTATAGGCC
AGGATGAAAACTTACAGTTAAAAAAAAGAAAAGAAAACTTATAGTTAATTTGGATAAATC
AGAAATAACTTGATGGTGATAATGTATCTGAGGCAGTGATGTGTGAGAAGGCTAAAAGCC
TCCATAGTGATTAAAAGTCCTGGAAAAATTAATTTATAAGTATAATTTTGGGGCATCAGA
ACAAATTATTTGGTTTTCCATTGTTTTTCATGGGAAAAGTATGTTCAATTCTTGAACTTT
TCAGTGTTTGAACATGAATTTGGAATGAATTGAGCTCGACAACCAAGATACTACTGTTTT
CAGAATGCATATCTACCTTCTAACTCGGTTATACCTTATGAAATAATCCAGAATAATGGC
AAAGCTTTGTGCACAGAAATGGATGCTTATTGCAAGCATTATTTTGTTCTAAAGTGGAAA
AATACCAATACCCTTTTGGAATTAAGGCTTTAGTAAATTCTGCTAAATTCATATGTGTAT
TTGTGTAATTTAGTGATCTTAAAACTTTAGATATACCGTCCCCTTTTAAAGAAAAAGTAT
TCCCTAAGATTCCCAGTGTTGGCTCAAAAACAATTTAATATTACTTAAACATATACAAAT
ATATATACTCTACACAACCAGAAGGGCAACAGCTTCCTAATTCGATATTAGCGAGATTAA
TGAAATTCAAATTACCCTACACTGTGAAATCACTTCAACAAATGACAGTGTTTTGCTGAA
ACCACATCACTCTCCTCAGTGTCTATGCTACTTACTGTTACATATCCATTCCTTTTAGTT
TAGTGAACCTATAGCACTGTGTTATTTGTTTTTATTAATGTCACATTTCCATTTTTATTC
AAAAATATCTAAAAAGTACATTGTTGGAATAGGAAAGTAATGAAATGTTTTTTTTTTAAA
TAAAAAAACAGTATCAGAACATATTTTCATTTTATATCACCAGGACGTAGGATAAATAAA
TCCTTGTAGGGGGAAAGGTGCTTTTTTATATACTTCGGATGATGTTTACAACATAAGACT
TTCAAGATGAACCTAAGAACAGTATTCACACATAACTCATACCACCCCTACATACCAGCC
AAATATCAGTGTGTTTGTGGAAACTGACAGGGGAAATGCTTTGGAATTTGTTGTTGCTGT
TGTTTTGCCAAGTTACCTCGGTTCTCATTCTATGTGTTTTTAACCATGACTTTTATTTTT
TTAAATTTTATTGGGGGCTCATACAACTCTTACCACAATCCATATGTCCATCCATAGCAT
CAAGCACATTTGTACATTAGTTACCATCATCATTCTCAAAGCATTTTCTTTCTACTTGAG
CCCTTGGTATCAGCTCCTTATTTTTCCCCTCGCTCCCCCCGCCCTTACTTCCTCCCTCAC
TCACCCTTGATAATTTATAAATTATTATTTTTTTTCATGTCTTACACTGACCATTGTCTC
CCTTCACCCACTTTTCTGTTGTCCGTCTGCCAGGGAGGGGATTGCATCCTCTGGTCTGGT
CTAGCCGGATTTGTAAGGTAGAATTGGGGTCATGATAGTGGGGGAAGGAAGCATTAAAGA
ACTAGAGGAAAGTTGTATGTTTCATAGGTGCTATACTGCACCCTGACTGGCTTGTCTCCT
CCCCACGACCCTTCTGTAAGGGGATGTCCAGTTGCCTACAGATGGCCTTTGGGTCTCCAC
TCCACACTCCCCCTCATTTACAATGATAGGATTTTTTGTTCTTTGATGCCTGATAACTGA
TCCTATTGACACCTCATGATCATACAGACTGGTGTGCTTCTTCATGTGGGCTTTGTTGCT
TCTCAGATACATGGCCGCTTGTTTATCTCCAAGCCTTTAAGGCCCCAGACGCTATATCAT
TTTAAAAAATTAAATCATTTTATTGGGGGCTCGTACAACTCTTATCACAATCCACACATA
CATCCATTGTGTTAAGCACTTTTGTACATTTGTTTCCCTCATCATTCTCAAAATATTTGC
TTTCCAAATGTGGTGAAGAAAGCTGATGGTGCCTGGCTATCAAAAGATATAGCGTCTGGG
ATCATCAGAACAAAAAAAATCTTACCATAGTGAATGTTGGGGGGAGTGCGGAGTGGAGAC
CCAAAGCCCATTAGTAGGCCATTGGAGATCCCCTTGCAGAGTGGTCTCGGGGAGGAGATG
AGCCAGTTAGGGTGCGATGTAACAATGATGAAAAATACAACTTTCCTCTAGTTCCTAAAT
GTTACCTCCCCACTCCCACTACCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGCAGCCTTTGCACCCACAAGGTGTCGAAGGGATCAGATATAAGGCATCATCTGA
ACAAACAATCTTACCATAGTGAATGTCGGGGGGAGTGCGGAGTGGAGATCTACAGCACAT
TAGTGGGCCACTGGAGATCCCCTTGCAGAGGGGTCTCGGGCAGGAGATGACCCAGTCCGG
GTGCGATGTCACAACGATGAGAAATACAACTTTCCTCTAGTTCCTAAAAGTTTCCTCCCT
GCTCCCACTACCATGACTTGAATTCGACCCTGCAAGTGTGGCTAGACCAGAGGATGTACA
TTGGTACAAATAGGAACTGTAAATTCAGGGAATCCAGGGCGGTTGAGCCTCACAGGACGA
GTGGCGAAACAGGGAGGGTAAAGGGAGAATGGGTAGGAAAGAGGGAACCGATTACAAGGA
ACTGTGTGTGACCTCCTCCCTGGGGGACAGACAACCGAAAAGTGGGTGAAGGGAGACGTC
GGGCAGGGCAAGATATGACAAAATACCAATTTATAAACTCTCAAGGGCTCATGAGGGAGG
AGCGGGGAGGGAGAGGAAAAATGAGGACCTAATGTCGGGGGTTTAAGTGGAGAGAAAATG
TTTTGAGAATGATGTACAAATGTGCTTTACACATTGATGTGTGTATGGATTGCGATAACA
GTTGTATGAGCCCCTAATAAGATGTTTAAAAAAAAAAAGAAAGAAAGAAAACAGTGCTGT
TGGGGTCTATCCCAATGAGGCCTTGTCTGTAGACCCAAATCGTTGGAAACGCCTCACAGA
GTAACTATGCGGTTTGCTTTACTCGCAGAACTGCTGTTGGTTGGAGCTGTGAGGAAGAAC
TACAAGACAAATTTGAAAGAAAAAAAAAAAGAAAACAGTGATTACGGGTGAACTAGGCAA
TACCGTACACACCATTCCCTCCTTAACCCCTTTAACTACTGAAGACAAGTAGACAAGTGG
CCAGTGCCTTTCCTGGGGGCCTGTGGGCATGTATAAATGCTGACTCAGTTCTGGCGACAT
TTGGAAGCGATATGTCTGCCACTCTCAGTGTCATGTAATGTAAACAGAACCCAATAGCTA
AAAGGTTAAAAAGAGCACTCTGGGTTGTGGTGTTGTGAATCATACCTAGTGGCAGTACTA
GTTAACATTTTTAGAGGGGAACCATTACGATTGTGTATCACGTTTGTCAGCTGTCAAACA
TTTTGTGGGTTTTTTTATTAGTTACTTTGTTATATTTTCCATTCACAACATAAGAAGTGC
TAAGTGAAAACTCGTAGGAGGAAAGAGCTGGCAAGTTTCGGGTAAAAAAGAATAATTTTA
GTTTCATAAATACAAAATAGAATAAATGTTTAAATAAAAGCAATTATATAGTGTTTTAAT
TATCCAATCCATATTCCTGAATCCTCACTTCAAAATATAAATTTAACAAAATTTGTAAAT
GTGATGTGGCCCGCGTGAATCTTGCCTGTTGCACTGAATGACCCGCGTTTAATTGAGTAT
GACACCCCTAATCTAGATGATCCAGAATAAGATGTTTGTTTGACTTTTCAAAGAACTCCC
ATATATATCCATCATTAAGGTTCATCAATATTCATTTAGCCATATTTGCATTTTCATTCT
CTAGGTATGTTAATACTTTTGATGAACCATTTTAGAGTAACTTGCACATATATCCCATGT
ATGTGACTTCTTAGGATTAAAATGAGAACAAAAAGTCTTCTTTGAAAAATCAGAATGTTA
TAAGGCACTCCCATTGAGCACTCACTTGTAGTCTCTTACTTTCTTTGCCGAAGGAATCCT
AGTTTTGTTTGTATCTTTCTTTAAAACAGTTTCGTTATTACTTCATCCACATGTCATACA
ATTCAATAATTTAATTATATCATGAAGAGTTATAAAGTTATCAATACATTAAATTCTAGA
ACATTTTGTTCTTTGTACTCATTGTTATTCATGTAATTATTTTTCTTGCTAATTGTGGCA
AAAATATACACAGTAAAACATTCTCCAATTCCACAACCTCTACATGTATGATTCACTGCC
AAGTCTTCGGGTTGTACAACCATTATTGATATCTTTCTACAAATTATTCCACCATCATTG
ACTCAATGTTCCCTAAGCAACAACTCTTTCTCCTTCACCCATGGTAACTATTGGTCAAAA
TTGGGTGCTTTTTTAAAAGTAGTTTTCTTGCTATAGTATTCACATATCATACACTTCCAT
GGTTAAATCACTGTTAAAATGAGTTGATATACATTATCACAATCAGTTCTACTGCTCCCT
CCCCCCTCTTGCATTTATTGTTTGCTCCCTAAGTCCTCACCCCCCCCCCCACTTCCCACC
CTGTGTCCACATCCCTGATAAACCATTGCATCAGTTATTGTTTTTATGTATCTGCTCTTT
CTGTGTTTCACAAACTGGGGAACCCAACAGAAACAACAACAAACAAAACAGCAAGAAGAA
AATAATAAAAATATAAAGATAAAAAATATAAATAAAGAATAAGAAAAGACCACCATCAAT
ATTTAAAATGTCAGATAAGAAATTTCTGTTGTGGAACAAGTGAGAAATACTTGAGCTTAG
AGCAGATTCAGGTTGGGTCAAGAGGAAGGTCAGTTCAATAATCTTAGTCAAATAGTAAAG
TCTTGCCTTGCCTGTGGCTAGAGGGGCTCTGCCAGAGGCTTGATCTGACTAGCTAGTCTG
CAGATAGATTTTGGGCTCCCACTGTCCTTCATAGCCTGCTGCTAATTGGGTGATCACAAT
TTTCACTCTGATATTTTTCCCTTCGTCATATTTGGGATTTCTCTTAATTGTCCATCTTTG
GATCACCAGGGTTGGTGTGTTCTTAACAATGTTTCTCATAGAGAATATATGGTATTATTT
ATGTGTGCTTGTTTAAGAACATAAATGTTATATGGCTCATGATAGGCAGTATGTGGAAAT
ATGTTCAAAAATAATATTGTCAGAATATAGATTTTGTTACAATCTAGTCTTAATTATGTA
AAATGGTCTATAAATAACATGGGGAAGAACTATGTTAAAATGTCCATTGGTCATTAACTG
GTGGGATCTTGAGTGATTCCTGCTCCTGCCCTCCGCACGCGCTTTATATATTTTATATAC
TTTGAATAGCAGGTATTTTTTATAAATGGAATGGGTGTTGGGGAGGCAACCGAATAGTTT
GGAAAAGATAAGCATCTTGAATGGTAATTGGGAAGTTGGGAAGCAGAGTTCATTGAAGAG
TGGCTCCAACAAACTGCTTGTTATGAAGGGTAGTAGCAGGAGAGAAGATCCTAAGGTAAA
TTGGGAAATGTTTCACCTCTTGTTCTGTTTCCTTGCTGGGACCAGGAGGAGCAGAGACAC
ATGAAGATCATAGATGAGACTATGGCCCAGCTACAAGACCTGAAGAACCAGCACCTGGCC
AAGAAATCAGAGGTGAATGACAAGAATCATGAGATGGAGGAGATTCGCAAGAAACTGGGC
GGAGCCAACAAGTGAGTGAGTTCAGATTCAGAGCATGGGAAGTAAGTAGAACAGGCAACT
TGCCGGATTTGGGTCTTACTTAGCTCCCTGAACCTTCTTAGGGAAATGACTCACTTACAG
AAGGAGGTGACAGCTATTGAGACCAAGCTTGAACAGAAGCGCAGTGACCGCCACAACCTG
CTACAGGCCTGTAAGATGCAGGATATCAAGTTGCCACTGTCTAAGGGGACCATGGATGAT
ATTAGTCAGGAAGAGGTAAGAGTTATTGCTGATGGTGGGTGTGGGCTGCAAAAAAATATT
AACCAGGGATGGAAAAATGACAGTGGCCTGGAGGGACAGTTAAGTGATGGAATGGTTATA
GGCAGGAGATGGTGAGGGATATAGGAGAGATGCAGGGCAAAGAAGGTGAGGTGGTAGAGG
CAGATGGTATGAAAAGGAATAGGTCTGGTGTAAAGTGGGAAGTTGACTTGAGGGTAGGGT
ATGCCAGCAGGTGGTGAAGGATGTAAGCCAGACGATGAAGTCATCCATTAATTGTGGAGA
CTTGAACTATGCTAACTCTACTGGGTGATAGATAATAGTAGTGGGTGTCAGATTGAGAAC
TGAGAGACATTAGCCAAGAGTAAGAGCAAAGGAAGCCAGGAAGCTTTGGGGACCAGAGAG
AGAATAGTTGCAGGGAGGGAAGTTGGCCAGAAGAGGGTGGGGTAGGGGACATCAGAAGTG
CAGAGTAAAGAAAGCTTAGCTTTCTGAAAGAGAGGAACACTAATAGGGGAGCTGAGACAT
TGAATCCATTGGAAGTAAAGATTGGTAGTGAGGGCCCAGGGAATGTTAACTGAGGGGAGG
ATTATATATATCCATCTTAGACCTGGTCATATATCTTGGTATCCCTGGTCTTCCTCCTTC
CCTTCCTCCCAAATAACATTTCATTTCAATTCAATAAAACATTTTAAACACCAGAAATGT
GCCAGACATCACAATAGCACGTGACATAATTAGTCTAATCTGAACTATAACCGTGTCAAA
CAGGCAAAGACACTTGGGATCAGAGAGTGTGGCTTCCCCGATCATACTGTCAATGCCAGA
ACCCAGTGATGAATCTTCAAAGCTGTTGTTCCATTTGCCATACTGCTTTCTTACAAGGTG
CTTTCTCAGAGACATAGAAGGTTACAAAGGAAATCTCAGGCTCCCTCCCACAGAGGGTCA
CTCTCATGGCAGTCTGTTTCATTAGAATCTCCCTCTCACCATTGCAGGGTAGCTCCCAGG
GGGAGGATTCAGTGAGTGGCTCCCAGAGAACTTCCAGTATCTACGCACGAGAGGCCCTCA
TCGAGATTGACTATGGTGATCTGTGTGAGGATCTGAAGGTGAGGATCAGTCATGGGGGTG
GGAAGTTGGGGGAGGTGAGAGGAGTGGGGGTTGGATAGTCATGGTCCAAGCTGTACAGTT
AGAGAGGGTCAGCCCCTCTGGACCCTACAGAGACCAAGAATGTAAAATGGGGAGAGCTGG
TAAGGGAGGATTGACTTGTGACCTAGGGTGCTCTCCATTATATACACAAAGACATAAGCA
CATCTTCCACCTTCACTACAATTTGCTTGTGTCTCTGTCCCTTTTCTCTCTCTAAGTATG
TACTTGTCTCAGCCTGGATGCACACATACAGAGAGAACACGTGTCTATAAAATGAAAAAA
TAGACTTCAAACTTTCCGCAGGGCTCTGTCCTAGGAACGCTTTCATTTTTGGAATTCTCT
CATCCTGATATCTCTCTCAGCTCTTGGCTTGCACTACCATCTATGTTGTGCTCGGTCCCA
TAGGTACTTCCAGTCCTAATCTTCTTCCCCAAATCTGCCTCTCAGTACNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTGTTTCCACCAGTTCTTTGTTTGG
GCCCACTTTCATCCTCACGTAGGGGTATACTGCAGGAAAAAACCTCTTCACTGCCATCGA
GTTGGTGCCGACTCATAGTGACCCAATAGAGTAGGGTAGAACGGCTCCTGTGAGTTTCTA
AGACTAACTCTTTACTGTAGTGGAAAGGCCTGTCTTCCTCCTGAGGAGTTGCTGTTGGTT
TTGAACTGCTGAACTTGTGGTTAACAGCCCAATGCGTAACTACGATGCCACCAGGGTTCC
TTTTATACTGTAGAAGCTTTCTAAACTCCAGCGCGTTATAATTCATGCTTCACCATTATA
GTCATGAGGAGGTAATATTTTTAAACTTTTGAATTATGGAAGCTTCAAATGGTAGAGAGA
ATGATATGAACCCAACCCCAGCTACCCATCACTTAAATTTAATAATTAGCTGCAGATGGT
GAATTTTGGTTCTTAAGACTCGTTTTATCCCCAGTGGACCCTTTTAGAGTAACTCCAGAT
ATTATTTATAATTACCTCAGCATCTAGAACAGTGTTTCCCAAAGTGGATGGTACTACTAC
CTATCTGGTGTGTGTGGGGGGTCTGCAACAGCAAACACCTACAGTTTATCTTGGACTATG
GGCTATAGCACAGACGTTTTTTCATTGACAGGGGGTAGGTACTGAATTTTTTTGGTGGTG
GTTTTTTTCCTGAAAAGAGGGCCAAATGAGTTTGGGTGCCTATGAGCTAGATTATAAGGA
CTTGAAAACAAAACAGCACTACCACAATATCACATCTTGTAATAAACCTCCATAATGTCC
TATAATCAGCAAATGCTTAGGTTTCCATGAGAGTCCTATAAATACTTAAAGGCTTTCTAT
GTTTAAATCGGGAGTCAATTTAGGCTCATGTGTTACAATGGGTTGATATATCTCTACTGG
TCTGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTGTTTACCTTC
AAGCCTTTCAGACCCCAGACACTATATCTTTTGGTAGCTGAGCACCATCAGCTTTCTTCA
CCACATTTGCTTATGCACCCATTTGTCTTCAGTGATTGTATCAGGGAGGTGAGCACACAA
TGATATAATTTTTTGTTCTTTGATGCCTGATAACTGATCCCTTCGGCACCTCATGATCAC
ACAGGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCGCTTGT
TTACCTTCAAGCCTTTAAGACCCCAGACGCTGTATCTTTTGATAGCCAGGCACCATCAGC
TTTCTTCACCACATTTGCTTATACACCTTCTTGTCTTCAGCGGTTGTGTCGGCAAGGTGA
ACATCATGAAATGCCAGTTTAATAGAACAAAGTATTCTTGCATTGAGGGAGTACTTGAGT
GGAGGCCCAGTGTCCATCTGCTACCTTAATACTAAACCTATACATATGTACACATAGATC
TATTTCCACATCCTCATATATAAATATGTTTACATATGTACATGCCTTTATTTAGACCTC
TATATATGCCCTTTGCCTCCTAGTTCTTTCCTCTATTTCCTTTTACTTTCCTCTTGTCCC
ACTATCATATTCAGCCTTCATTTGTGTTTCAGTAATTCCTCTTGGTTACATTACCCTTGG
GTCATGCCCTACCAGGTCTACATCCTCCTTGCCACTGATTTGGGTCACTTGTTCCCTTGT
CCCTGGGTTTGTTAACACCACTTCCTTCCATCACTCCCTTTCCATGCCCCCCAGGAACTG
TCGGTCCGTTGCTTTCTCCTCCAGATTGTTCATCCAGCCTATCTTATTTAGACAGACCTG
CGGAGATAATGACATGCACAAAAACAAGACAGTGCAAAACTAAGCAACAAAAGAAAACAA
AACAACAACAAGCCAATGACGACAAACAAAACAAAACGCAGCAAGAAAGAAAAGCTTGTA
GTTAGTTCAAGGACTGTTTGTTGACCTTTAGGAGTGTTTTCTGGTTGAGTCTGATGGGGT
GCCAAGCCCTGGTCCCAAGGTCTATTTTTGGTATTCCCTGGGGACTTTGTTGCTCTGTTC
CCCTTGCTGTTCTGTTCCACCCCCGTTAAGTGTTTTGCCTCGGTGTGGTGGGATCAGATC
GGGTGCAATTCCTACACTGTATTTCCAATGTTGTCCCCTGTAGGGCTATGGGTCAGTGAG
GGATGTCCCGTCAGTGAAGGATGTCCCATCTCATANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTCTTCTGACCCTCTCATACCTCCCTCTGCCTCTGTCTGATAAGATCACTTG
TCCCGGATGGCTTGCACCGCCCCGTGCCCCCCAGTCCCCACCCCTACCCCCGCCCAAGTC
TGTGGAGTAAGTTGATTTCCTCCAGTTCTTCCCACTAAATTCCTTGATTCAAACAAAACC
CTCTAATCTTTGACTGCAATATTTCCTTCTGCCCAGAACCCGGTTTCTTCTCTCCTGTGG
GCTTTAGCACAGACATGTTTCTGGAAGCTGTCTGTGGCACCAGAGTCTAGTTCAGTATCT
TTCTTGTGTGCTGACCCAACTTTTTCTGCTTTTTAAAATGTTAGCGTTAATTCTGACTCT
TTATAAACATTCCTCTGCTAGATTCGCGAGCTCTCATAACATATGAGGAGCCCCAGTGAT
TAGCTCTTAGTAGGCATGCAATAAATATTTATTTATAACAGAAGGCACAGAGTCAGACAT
GCATATAAAGTATTCATAGGTCTCAAGCCAAACTCAAGAAAAATTTTTTCATCTGTAGTG
TTCTGAACTAAAAACGTAAGTTGTCTTTGCCAGTGTAATGCTTAAGTGGAGTGAAGAGCA
GCTTGTGTGGGGGCTTCTAGGTCACACCTTGGGGTGGTGTTGGCTCATGGGTTGGACCAC
TAGCCAGAAAGGGGCACCACCTCCCGAGAGACATGTTGGCAGGGCTTAGAGCAAGGGCAC
CACTAGCATGTAATTTCCAGGGATATTGGAAATGGTTCCTGTACGCAGGGCCTGGTGGGT
GGGGGAGGAGCTGAACTGGAAAGGAAGAAACTACTTTCTGCATGGGAGCATGTATTCAGG
GCCAAATCAGACCCTTCTTGATTCTGCTGGGACTGGGCCTTATAGGATGCCCAGGCTGAG
GAAGAGATCAAGCAGGAGATGAACACACTGCAGCAGAAGCTAAATGAGCAGCAGAGCGTG
CTCCAGCGTATTGCTGCCCCCAACATGAAGGCCATGGAAAAGCTGGAAAGTGTCCGAGAC
AAGTTCCAGGAGACCTCGGATGGTAAGATTCTCCCTTTGGGCCCTGAAATGAAGGCAAGA
GTCTCTCCTAAAAGGTATCTATATGGTTTTTTAAAGTTCATAGAAAAATTCCATTATTTT
TATGTCATTTTTCCATGAACTCTTGAAGCCCCCTTGTATATTACAGCAACTGCTATTTTT
ATATGCTTTCTTTATAAAAACTTTAAAGAGCTTTGAACAGTAGGGCCATCACACCTATTT
TACAAAGTTCAAAGAGGGAAAATGAAGTTTATCCAAGGTGGCACAGCTGGTTGTTGGTAG
AGTCCAGAGAGGAACCCATGTTTTTGTTGCTTTAAGCAGGTTTCTTCCTCTAGTGAGGTG
GTTCTCAACCTGTGGGTCGCGGCCCATTTGGGGGGTCAAATGACCCTTTCACAGGGGTCA
CCCGAGTCATAACAGTAGCAAAATGACGGTGATGAAGTAGCAAGGAAAATAATGTTATGG
TTGGGGGTCCCCACCACATGAGGACCTGTATGAAAGGGTCGCGGCATTACGAAGGTGGAG
AACCACTGCTCTATGGGGTCCCGTCCCACTGGTTGCAAAGTCTGGAGGCATTTCTGTCTC
GGTGAAAAGCACCTAGTCTGTAAATTGTCACTGATAATTGCCCAGCTGTTCCCCAGCCCT
GTCAGATCCAGGGCACTGAAGGCATCTCCTGTCTTTTACATGTGGCAGAGTTTGAGGCAG
CCCGAAAGCGAGCCAAGAAGGCCAAGCAGGCATTTGAACAAATCAAGAAGGAACGCTTTG
ACCGTTTCAATGCTTGTTTTGAATCTGTGGCGACCAACATCGATGAGATTTATAAGGCAC
TGTCCCGCAACAGCAGTGCCCAGGTAGGTTGGAACCCTTTAATCAATTCCTACTATCGGT
CCTTCCTCTGTACTTCCTATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGTTCTTCTACAGGATCCTTGAGCACAGAGCTGGGTTTAGAGGAGGGC
TCAGTTGATTCATTGGCCTTTAGGGACTTGGGCAACATTGGAACTTGCGTTTTTTAGTCT
TTAAAGAAGTAGAGGGGGGACGCTGGCCTTATTCATGAGACATGGGGCTGTTCCACCCCT
CTTTGCCATGGATTCCGTGTCCGCTCACTTACTGGTTCCCTCCCAGCTACAAACCAGCTC
CCTTCTTCGTACTGGATGAAATCGATGCTGCCCTGGATAACACCAACATTGGCAAGGTAG
GTGTAAGAAAAGTGGGAGCCAAGGAGGGAGGCCTCTAGGTTGGGGCTGGGTTTCAAGAAG
CAAACTCCTGAGTGTACCCTAATCACTTTTGCTGTTTGCCCTCTGTGCCTGGGATGGTAG
GCCCAGGGTCATCCATATTGTGACCTTGTCTCAACCTCTCTTTACCTGCCTTGCAACCTT
TACCCTACCTCTTCTGCCTACTGGTTTTCACTGGAAGACTGGGGAAGGTTAGGGCTTCCC
TGCTAATTACTTGGTGGCCTCTCCCACAGGTAGCAAATTATATAAAGGAACAGTCGACTT
GCAACTTCCAAGCCATTGTCATCTCTCTCAAGGAGGAGTTCTACACCAAGGCTGAGAGCC
TCATTGGAGTCTATCCCGAGGTATGTAAAGTAGGCTTAGCTTAGGAGCCAGTCCCACTCC
CAGCTGACTCCCCAAGGCAGGAAAGGAAGACTAAAGTGGAGGGGTAAGGGAAGTGGGGAG
CATCTGGGCTTGTTGGAACTCAGCCCGGGAGGCTTAGCTAGCCCACCTGGGTAGGGCTGT
CACATGTGGAAAGGGTAGATAGGACAGGCATCCAGACAGGAGAGAAAAGGTGAGTGTGAA
GGTAGGCAGGCAAAGAAGGCATATAGGACCAAGCACATCCTCTCTAATCCAGGAAGACTC
ATTTACTGGGCTTTGGGCATGCATGCAGTGGAGTGGGTTTGAAGTCCCCAATCCTAAAGT
GCTAGACCCCTCTTAATTCTCTCCTTTTCTTTTTTTCTTTTTCTCCTTTCTCCTGCAGCA
AGGGGACTGTGTGATCAGCAAAGTCCTGACCTTCGACCTCACCAAGTACCCGGATGCCAA
CCCCAATCCCAATGAGCAATAGTCTGCTCTCTTGCTCTGTGTGGATCCCTCAGCTGCACC
TCTCCCAATTTCTGTCTCTCTGGTTTCCTGCCTTCCCCTACCTCCCAGCCCTGTTTGGCA
TAGTCATGGGAATTTTAGGCTATATCAAGCATGAAGAGGGAGAACAGAGGTGATGTTAGG
CCTGAGTTAGCTCAGAGTTCCTGAGCTATATAGGAAAGGGGGTGCTGACCATTTGTCTGT
ACCTTGCTTCTCATCCCCCGCCCCTATCAACCATAATAATCATGGTCCCTTTGCCCATTG
TATGTGTGTGTGTTTGAAAAATAATAAAATATATTGGAGACCTGTTTTATAAGAAGCCTA
TGCTGAATTTGCTTCTAAGCATTTAGGATGACAGTACCTCAGACTATGCAGTTACACAGA
ACCTCACTAGATTCTTAAGCAGTCACCCAAAACTGCCCTCATTCATTCATATATTCATTT
GCTTATTTGTCATACCTATGTGGAACACCCAGATTTGTCAAGCTGTCTTTTAGTGATATA
GAGCTGAACCAGATGCAGTCTCTACCTTTCTAGTTAGGAGATGATACAGGCTTATGAATG
AATGAGTGTCATAGGCAAGGGTACTCTGTTTCAGAAGAGGAAGATTACCTTCAAGCTTCC
TAGAGAAGCTCACATTTGAGTAGGACCCTGACATATTGGTGAAATTTTATCAGGCACTTG
GTGCTGAGCAGAGAGCCCAGTGGTCTGAACAACCCAGTGGCTGCAAACCAACCCACCAGC
CGCTCCTCAGGAGGAAGATGAGGCTGGCTACTCCCACAACGATCTACATCTCAGAAACCT
TAAGGAGCAGTTCAGTGTTGTCCTATAGGTACTCTATGAGTTTGAATAGACTCAGTGGCA
GTAGATTTGATGAGTAGAGCATAGGACAGATCATTTTTAAATCATTGACTGGTTTAACTG
AAAAAGTCATTTGATTTTTGTTTGTCGTTTGTCAGATAAGTCTAACAATATTACCTACCT
CC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 51304..51492, 51574..51686, 86325..86528, 86612..86850, 87979..88159, 88161..88178, 88180..88188, 88190..88195, 88199..88213, 88217..88221, 88223..88241, 88324..88464, 88548..88630, 88799..89006, 92724..92909, 93002..93181, 93264..93410, 93507..93644, 95125..95241, 95338..95444, 101414..101555, 108105..108250, 108341..108494, 109487..109597, 113925..114081, 114768..114922, 115081..115232, 115546..115615, 115889..115999, 116398..116481
1001..1109, 51304..51492, 51574..51686, 86325..86528, 86612..86850, 87979..88159, 88161..88178, 88180..88188, 88190..88195, 88199..88213, 88217..88221, 88223..88241, 88324..88464, 88548..88630, 88799..89006, 92724..92909, 93002..93181, 93264..93410, 93507..93644, 95125..95241, 95338..95444, 101414..101555, 108105..108250, 108341..108494, 109487..109597, 113925..114081, 114768..114922, 115081..115232, 115546..115615, 115889..115999, 116398..116478
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved