Echinops_telfairi Locus METTL3
snOPY snoRNA Orthological Gene Database
Echinops_telfairi METTL3
Echinops_telfairi
METTL3
GeneScaffold_1149
SNORA70
3082..3212
28227
GAAAAATGAAGTGTTGGTGAGACAAACGTCAGGGAAGTTGCCCTGGGGATTTGATTTTT
TCTTCCCTTATCACAGTAATGCATTCTGCAAGGGTAACAGTGACTGTCCTAAGAGAATTT
CATTGGGAAGCCTTCCACCATCTATCCTACAACCCTGACCTTGCATCTTCATACTACTTT
TCTCTGATCTGAGTCCCTGAAGGATGCCAAAACTGTCATTTTGAAGTGGTGCCAACTGGC
AAGCAAATCATTCTCCAGGGAAGGATTGGGAAGATGGAAACACCACCTTCAGGAGTGTAT
AGACCTGCTTGGCAGGTATGTGCGGTACCAATAGCTCACTCAATAGTATTATAGAGACAA
AAGTTTAATGAAAGTTTCTGTGACCTTGTAGCAGTAAGTTTAAGCTATTTGTAGACACCC
CATCCCCCACAGTACCTTTGGTTTAAAACCTTTCCCCTCCAACACCTCTCAAAAGTGGGT
AGAGACACAAAGATCAGGAAACATTTTAACAGGTATTTCTTTATAAATGGATGCATATAT
TAAAAATAAATAAATAAACGGATGCATATAACCAAATACCTACACGTTGTTTGGAAAGAC
ATGTGATACCAAACTACGAAAGGGGTCGTGATCCTTCAAGTTCACAAGCTGGGCCGTACG
TGCAATTCCAGCAGAAGCGTCCTTCCGCGAGTCAAGCCGCAGAACTCGGCTCCTAAAGTT
CAACATGGCCGCCCTGCCCGCCACCAAGATGGGGACCGCGGCGTCGCCGTGCCAGGAAGC
CCGCGCCCCGCGTCCACCACGCGGCCGACGCGCAGGGCGGGCGGCTCGACTTCCAGCCTC
CGGGCGAGCGTGAGACCGGAAGTGGCTTTTCCTCTGGCACAGCGCCCGGGGTCTCCTTCC
GGTTGCGCGGGCAGCGCCGTTCCCGGGAGGGGCCGGGGGCGCGCGCGGCCGGCGCCGGCT
CCAGAGGCGTCCGCGCGCGGGCGGGCGAGCGGGCGAGCGGCATGTCGGACACGTGGAGCT
CCATCCAGGCGCACAAGAAGCAGCTGGACTCGCTGCGTGAGAGGCTGCAGCGGCGGCGGA
AGCAGGACTCGGGCCACTTGGGTGAGGCGCGGGGCCGGTGCCCCGTCGGGGGCGGGGCGG
GGGGGGTCCCTCCCGATGACGCCTCTCGTATCGCCAGGAGAAGGGGAAGGTGGGGGGAGA
AAGATGAAACTGATCACAATGATTGACATATAACCCCTCCCAGGGGGATGAAGAACAAAA
AAGTGGGTGAAGAGACAGTGGTTTGGTGTAAGACATGAAAAAAAAAAAGATAAATTATCA
CAGGTTCATGAGGGAGGAAAAGTGGGGGACAGGGCAAAAGGAGCTGATACCAAGAGCTCA
AGTAGAAAGAAAATGTTTTGAAAATGCTGATGGCAACATATGTACAAACGTGCTTGACAC
AATGTGTGGATATATGGATTGTGATACGAGCTGTAAGAGCCCCCAATAAAATGACTTAAA
ATAATAATAATAAATTAACAAAAAAAAACCACCCAAGGACAACAGCACATACAGGTTGTC
CACTCAAACCCACCCAGAGGTGCCTTAGCAGAAAGGCCTGGCGATCTGGCTTCCGAAAGT
TCCCAGCCATTGAAAACCTTAAGGAGCCCAGTTCTACTCTGATTCACATGGGACTGCCAT
GAGTTGGATTAGACTTGACAACCCTGATTTGGGGTTCTTTACCGATGCATGCTTAGCTGA
AGTCCGTACTTTACACCAATTGTGGGATACCAGCCCCCACAATCGAACGGGTCCAAGGGG
CGGTTGTGTAATTGAGGGGTAAAGAGACATCACACAAGATAAGGCATGCAATTGCTCACC
TCCCGGATGGCCATGATCTCAGTGCCCAGGTCCGCACAGAGTGAGGGAGGAGTGAGTCTA
TTTCCAATCACGGCATACAAACAGTTTCAGGATGTGCAAGCCCCCCTGATNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTGAGCTGCACGATA
TGTGAGTTATATGTCAGTACAACTGTTCAAAATTGTTTTGAAAAGAATGCTTATAGAAAG
TTAAATACGATATATGTATAGGTCTGGAATATTCAGTTGCCTCATGTGCATGTGAAAGTT
GGACATTGAATAAGAAAGACCGAAGAAGAATCAATGCACTTAAACTATAGTATTGGCAAA
AAAAGGTTGAAAGTACCATGGACTACCAGAAAAACAATGCTTGGAAATGAGGGTAGCGAG
ACTTCATTACCTGTACTTTGGTCATGTTATCAGGAGCGACCAGATCCTGGAAAAGAACAT
CGTGCTTAAAAAAGTAGAAGAGCAGCAAAAAAGACCCTTGACAGATAGATTGGCATAGTG
GCTACAGAAATGGGCAAAAACTCTGCAGCCAATTAAGCCGACCGTCCTCCTTGTGGGGGC
CGGTGTGCAATGGCTGCAAACAGTAACCCTCCTCGGTAGTGTATGCAGCCTATTGGTATG
TATAGGTTGCCCTAAGGGACCTTGGAGACAACCTTTTGTTGCTTTTCAATGCCTCTGGCC
TGGCTAATTTCTGCTCTCCCTAAATTAGGCTCCAAACTGGGATGCAAGGTGCTTTTGGGA
AACCTCAAGGCACGTGGCTAGAGTCCACATTGGCCAGGTTATCATCCCCATCCACACCAA
GCTTCAAAACAAGGAGCATGTGATTGAGGCCTTACGCAGGGCCAAGTTCAAGTTCCCTGG
GCGCCAGAAGATCCACATCTCCAACAAGTGGGGCTTCACCAAGTTTAATGCTGATGAGTT
TGAGGTTATGGTGGCTGAGAAGCGCCTCATCCAGGATGGCCGTAGAGTCAGATACATCCC
TCACCGTGGCCCCTTGGACAAGTGGCGGGCCCTGCATTCATGAAGGCCTGGGTAGCCCTG
CGCTGCCCCACTTGTACCCACCAAATAAAAATTGAACTTTCTGATAAAAAAAAAGAACAA
AAACATAACCACAATTGTGAAGATGGCACAGAGCCTGACGGTGTTCCATTGTTACACGTG
GAGTTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGACGCCTCTCGTCCCCGCCCCGGGCGCCGCCGGCCCCC
GCCCTCCGCTTCCCCGACTCTCCCCGCGGCCACGGAGCTCGGTCCCGTCCCGGCGGCGGC
TCCTCTGCCGGCCGCGGCTGCCTTCACCTCGGGGACACCAGGCCCCGACCCCGGGCATCA
CGCGCGCGAGCCCCCCCTCCCGGTGTTTCCGTGGCGCCTCGCTGTGCCTCGCTGACTGGA
CACGGAGCAAGAACGGCATTTTGGGTTGCTCAAGCCGTCGGTCGGCGGTTCGAACCCACC
CGCCGCTGGGAGGGAGGGAGGGAGATGTGACAACTTTCTGGGAAGATTAGCCCTCCCCCC
GCTCCCCCCGAAACCGACCATTGCCATCAAGTTGATTGCGTTTCCAATAGGGGCCCGGTC
GTCCAGATCAGAAGTGCTACATCTTTCCCCCGCAGAGCCGCTGGCCAGTGTGAACGGCCG
TCCCGTTGGGTTCGCAGCGGAGCGCTTTAACCATCGCGCCACCAAGGCTCCATTCTTTCT
CGGTCACAGCCTTAGAAACCCAACGGGGCAGCTCTACTCTGCCCTGCGAGTCGGAATCCA
ATGTTTTGGGCTTTCTGGTTGCTTAGTAAGTGGGGATAATTTTGTTCTTGCTACCCGAGT
GGAGGAACTGGCTTAGTCTTGGACATTCATGTACCTTCAAGAACCCGAAAGCATAAGCAT
TTGTTTGGAGTTTTTAAACGTTCTCCCCTGTCCAGTCGTCACCTCTGTGTCGCAGTCATA
AAACTCGAAGGGAACATCACAATATTGCAAATATTACTCGATTCCCCACGGCAGCACTAT
GTAAGGTAAATCCCTATTTCAGGTAAAGTTGCTCTGGACATAGAATTTGTACCGTTTCTG
GCGGTTTGTGCCAGTGTTTCTTAGTATGCTAGAGTCGGCCTGAAAACACTGGCCCCTGGA
AGTAGAAAATGCGCCGGCAGGATTTTCACACCATAATTGATAACATCAAATGAATGACTA
CAATCTGCACAAACTTGGTTAGACAAAGATAGCTAAGACATTGTCCTGGCCTTCAAGGAG
TTAGGAAAATGTAGTTGAGGATAAAAGATGGATGCTTAGTGGAAAGTGGATCTATGCAGA
TGTAGTTAGGTTAAAATTTACCGCCTTGTCTTTTTTTCTCCCCTTGGACCCATTTTTAAG
TTGTTCTAATTTTAATTATTTTCTGTTGTCTTTGCAGCTGAGGTTATTTGTATTATTTTG
TTATCATTACACCTGAGACTTTGCTACGTTTTATTTTGTTGTGTATTTTTCTTTATATGA
AATTCAGGATACATAAATCTATAGAGGCAATAAACTGGGATTAAGAGTTTTTGAGTTGTG
GCAGGGGAGGTTGTCGGGGGAAAGGGAGCTAATAACAAGCCCACGACAAGAATAAAATGT
TCTAAAAACTGATATTTGATGGTGATTGCACAACTCTTTTAGTATGGTTTGCACTTATTG
AGCTGGCACGATATTGTGAAGTTATATTGTCAGTACAACTGGTTCAAAATTTGTTTTTGA
AAAGAAATGCTTAATAAAAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGGCACGTGGCTAGAGTCCAC
ATCGGCCAGGTCTCATCCCCATCCGCAGCTAAGCTTCAAAACAAGGAGCATGTGATTGAG
GCCTTACGCAGGGCCAAGTTCAAGTTCCCTGGGCGCCAGAAGATCCACATCTCCAACAAG
TGGGACTTCACCAAGTTTAATGCTGATGAGTTTGAGGCTATGGTGGCTGAGAAGCGCCTC
ATCCCAGATGGCTGTGGGGTCACATACATCCCTCACCGTGGCTCCTTGGACAAGTGGCGG
GCCCTGCATTCATGAAGGCCTGGGTAGCCCTGCGCTGCCCCACTTGTACCCACCAAATAA
AAATTGAACTTTCTGATTAAAAAAAAAAGAGCAAAAACATAACCACAATTGTGAAGATGG
CACAGAGCCAGACAGTGTTCCATTGTTACACGTGGAGTTGCGTTGAGTCAGAACTGACAG
ACTGGCACCTAACAACATAAGTAAAGCATTAGTGGATCAGCGTAGTAAGGGGAGAAGAAA
CGAGCTGGCTCAGATGGCAAGGGGCAGCAGTGGGGAGTTGACATTTGCATTTCCAGTTTT
GCAGGCTATATACCAAGTACCTATGGGCCTATTCTGACTCACAGGTACCCTATAGGCAGA
GTAGAATTGCTCCTTAAGGGTTTCAGGGCCATAGATCTCGGCGGGATCAGATAGCCTCAT
CCTTCTGCAGAGTGGCCACAGTTGGTTTGAATCGCCAACCTGGCAGTTAGCAGCCCAAGT
GACCTACCTAGGGCTCCTTTTTTTAAAAAAAATCATTTTATTAGGGGCTCATACAACTCT
TATCACAATCCATACACACATCAATTGTGTAAAGCGCATTTGTACATCATTGCCCTCATC
ATTCTCAAAACATTTCCTCTCCACTTAAGCCCCCGGTATTAGGTCCTCATTTTTCCCCTC
CCTCCCCCTCCCCCCTCATGAGCCCTTGATAATTTATAAATTATTATTTTGTTATATCTT
GCCCTATCTGACGTCTCCCCTCACCCACTTTTTTCTGTTTTCCGTGTCCCAGGGAGGAAG
TCACATATAGTTCCTTGTAATCGGTTCCCTCTTTCCAACCCACTCCCTCTACCCTCCCAG
TATCGCCACTCACACCACTGGTCCTATAGGGATCATCCGCCCTGGGTTCCCTGTATTTCC
AGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTAGCCAGACTTGCAAGGTAGAATTCG
GATCATGATAGTGGGAGCGGGGAGGAAACATTTAGGAACTAGAGGAAAGTTGTATTCTTT
GTCATTGCTACATCGCACCCTGACTGGCTTGCCTCCTCGCGGAGACCCCTCTGCAATGGT
ATCTCCAGTGGCCTACTAAAGGGCTTTGGGTCTGCACTCCATACTCCCCCCAACATTCAC
TATGGTAAGATTTTTTGTTCTGATGATGCCTTATACCTGATCCCTTTGACACCTCGTGGT
CGCACATGCTGCTGTGCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTTGATGGCCCCT
TGATTACCTTCAAGCCTTTAAGACCCCAGACACTATACTTTTTGATAGCTGGGCACCATC
AGCTTTCTTCGCTACATTTGCTTATGCACCCATTTGTCTTCAATGATCCGTTCGACACCT
CGTGATCACACAGGTTGATATGTTGTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGG
CTGCTTGTTTACCTTCAAGCTTTTAAGACCCCAGACGCTGTATCTTTTGATAGTCAGTCA
CCATCAGCTTTCTTTTTTTTTTTTATCCTAACCTTGCCTTTTTTTTTTTTTTTATAAACA
TTTTATTGGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAATTGTGTAAGGC
GTATTTGTACATCATTTCTCAAAACATTTTCTCTCCATTTAAACCCCCGACATTAGGTCC
TCATTTTTCCCCTCCCTCCCCGCTCCCCCCTCCCACATGAGCCCTTGATAGTTTATAAAT
GGGTATTTTGTCATATCTTGCCCTGTCCGACTTCTCCCTTCATCCACTTTTCGGTTGTCT
GTCCCCCAGGGAGGAGGTCACACACAGTTCCATGTAATCGGTTCCCTCTTCCCTACCCAT
TCTCCCTTTACCCTCCCTGTTTTGCCACTCACACCACTGGTCCTATAGGGCTCATCCATC
CTGGATTCCCTGTATTTTCAGTTCCTATCTGTACCAGTGTACCTCCTCTGGTCTAGCCAG
TCTTGCAAGATAGAATTCGAGTCATGGTAGTGGGAGCGGGGAGGAAACCTTTAGGAACTA
GAGGAAGGTTGTATTTCTCATCATTGTTACATCGCACCCTGACTGGCTCATCTCCTCCCC
GAGGCCCCTCTGCAAGGGGATCTCCAGTGGCCTACTAATGGGCTTTGGATCTCCACTCCA
CACTGCCCCCATCATTCACTATGGTGAGATTTTTTGTTCTGATGATGCCTTACACCTGAT
CCCTTCGACACCTCGTGGTTGCATAGGCTGGTGTGCTTCTTCCATGTGGGCTTTGTTGCT
TCTGAGCTTGATGGCCCCTTGATTACCTTCAAGCCTTTAAGACCCCAGACACTATACTTT
TTGATATCTGGGCACCATCAGCTTTCTTCGCTACATTTGCTTATGCACCCATTTGTCTTC
AGTGATCCGTTCGACACCCCGTGATCACACAGGTTGATATGTTGTTCCATGTGGGCTTTG
TTGCTTCTGAGCTAGATGGCCGCTTGTTTACCTTCAAGCTTTTAAGACCCCAGACGCTAT
ATCTTTTGATAGCCGGGCACCATCAGCTTTCTTCACCACATTTGTTTATTCACCCGCTTT
GTCTTCAGCGGTTGTGTCGGGAAGGTGAGCATCGTAGAATGCCAATTTAATAGAAAAGTG
TTATTGCATTGATAGAAAAGTGTTCTTGCATTGAGGGGCTAGGGCTCCTTTTGAAGGCGA
TACTTAAAAAAAAACACAACAGACATCTCACTGCCATTGAGCTGATTCCAATTCTTAGTG
ACCCTGTAGGACAGAAGAACTGCCTTGGTGGGTTTCTGAGGCTGTAATTCTTTACAGGAG
CAGAAAGCTTCATCTTCCTCCTGCGAATGGTTGGTGGTTTCAAACTGTTGACCTTGTGGT
TAGCAGCCTGACTCAATCTGTGCTACCAGGGCTCCTCTTGAAGACTAGAGGACTGTGAGG
ACTGAGCTAATTAAAGAGACTGTAAGAGGGAGGAGGGGGTCGGGAGAGGCAGGCGTGCAG
TCATATGATCAAGAGAAGGTACTAGTCAAGAGCAGGATTTATTTTCTTGATCTGTACATT
TAACTCCTTTGACTTGTAGGTCTAGTTTTCCTTGCATCAGTGGCACGTGCACTAAAACCT
TTTGTTCTTGTTCCTGGTTTGGGTGTGAGGTGTATGTGTGTAAATATATAGATAACAAAA
CATTTGCCATTTCAGCAGTCTTCATAGGTAATTTTTCACTGACATTGTAAAAGTTTCTGG
GGGAAAAATGGAATTAAAAGACAATGGAATTTTTCTGTGAATTCTTCGAAGCACCCCCCT
ACACACACACACACCCCCTGTATATTATGTTGTTTAAGTGTTACCATTTCAGAATTTTCC
CATCACCCTTAACAGCAGCTCAGTGCTGTTTGTTTTACGCACTTCAATTTTAGATATGAA
ATATGACTCTCCCTCTCATCTGTATAATAGAAGATTCAATCACCTTACTTTTTTTTTTTT
TCCTTTTACAGCAACTTACTCTTTCACAGTTCTGGAGGTCCAAGTTGTGAGTGAAAGTGC
CGCAGTGGTGTGCTTTGTCTGCAGACCCTAGGAAAGGGTCCTTCCCGGCTTCCGTCAGTA
TCTGGCGCCCATTGGCTCTGGGCATTCGTTCTTAGTTTCGGCTGCTTAACTCCAGTCTCT
GCCTCAGCCTTCCCATCACCTCCTCCTTTGTGCGTTTCCAGTTTTATGATTTGTATTGTT
GTTGGGAATATATCCAGCAGAACATGTGCAATTCGGCAACATCGATTACACAACTCTTGG
TGTGGCGCATCCACTCTCACCCGTTTCCCGAGTGTCCCTCCTCCCTGTCCTCTCCGTTTC
CCATCTAGTCTTTGAGCTGCCCTGCCGATCCAACCCTGTAAAGAAAGACAGGCCATGGCT
CTAAGATGGCTTGAGTGAGCTTTATGGTTGCTCAGTGTAGAGGTGTTCTCCGGGCAGTGG
TTTCCAGAGTTCATCCAGCTTCATTGGTTCCTGGAAATCTAAATTCCATAAGAACTTAAA
ATTGTGTTCTGCATTCCCCTCCCCCCTTTTGATCAGGATTCTTCCATAGAGGGGCAGAAG
ATTAATGCCATATGAAAATCCCCTTGGAGCCAAGGAATTTCTCTGAGGAGACAAAAACCT
TCCCTAGAGCTGACAGAAAACTTTCCCCAGGGCAACCTTCCTATTTCGCGACCCTTTCAT
ACAGGTCCTCATGTGGTAACCCCCAACCATGACATTATTTTTGTTGCTACTTCATAACTG
TCATTTTGCTACTGTTATGAATCAGACAACCCCTGTGAAAGGGTTGTTTGACTCCCAAAG
GGGTCGTGACCCACAGTTTGAGAACTGCTGCCCTAGAGCCTATACCCTGACTTCTCATCT
CCTAAACAGTGAGAAAATAGATTTTTGCTCATGAGAGGTACACGCCTGTGGTGTTTGTGA
TAGCAGCACTAAACCACTGGGACATCACCTGTACTGGAAATCACCCATGCTCACACTCTT
TATGCCCTGGTACTCCCGCTGCATGGTCCCCACCTGTGCTGTGTTCGGTGTGGGCGTGTT
TTGCTTGCATGTTGGTGTGCTTAACTAAGGGAAATGTCTTTGAAATCCCTTCAGCTAAAC
TTGCAGCTCCAGAGAGTGTGTACCATAGTTCAGTCACACAGCGGAAGAGAAGGACCCATG
GTTTCCTTCTTTCAGAACTAGTAACCACCAATTACTGCATTTCGACATTTTGTAGGTGAT
TGAGTTTTCAATGGATCCCTTTCAGTTAGAAATAATGTAGTCTTTTTCTGTTACTCTCCT
TCAGCTTCCAGATGAGAACACATCACTGTTTTTTAGTCCCCTGAATCTGTTTTGCAGTGT
ATTGAAATGTGACAGCCTAAATAAGTGCATTTCTAGGAATATTTAATTTTAGCATGGAAT
AATTTGTTTTTCCTGTTCCTAGTGACAACTGAAAGGGCAGGGGGTGGGGGGCACTGAGGA
TTCAAGTTATTATTTGCATCAACAAAGTAATCAAAGTGTTTATTTTAGAAAACCATATTA
TCAGTGCACTGCATCATTTACGACTTGGTGTTCAGCTTAGTCTCTTTTCTTTGGGAACAA
TCTATCTTTAGTCTGTAGTTTCTGGTTATTATTATTCCTTGTAGTACGTTTTCTGTTTGT
CTGCTTCTAAATTCATACACTTTAGGTGGATGATGCTAATTGCTCTTGGTCACTTAAGTC
CCATGAACTTTCCCATGGCGCTCATCACACTTTGGAATTAGCCGCCTCTGAGCTGTATAT
AGAGTGCTGGTGGAGTGGTGGGTTATGCCTTGGGCTGCTCACTGCAATCCACTTTGGGAG
AATTGCAGCTCTACCCTGCCCTGGATGGTCGCTGAGTCAGAATTAACTCAGTGGCAGTAA
CGTTTTGTTGTTAGTGAGCCAGTGAGCCGTATGCCCATCGAACTACTAGATTCTCGATAC
TCTCAGGTTAGATAAAAAATAGTACCAATATAGGTGCTTGCATAAGAGAACACTTGGTCA
ATATGCTGTGGATACTTTCTGAAAGAATGGCACCAGTGATTCTTAATCCTTTTCTGAGGA
GTAACCCATTTTAGGGATGATACAATGTTGAGTCTTTCTTCCAGGTGTGTAAGTATATTT
AGTAATGTTGACCAGACTCTACTCTCCCTTGGATGTAAATATTTCTCGAATATAGTATCT
GTTGCCTGCACATCTACCTAATAATGGTTATGACTCCTGTAAAAATATTTTTAAGGTTGC
CATTATAGATACAGTGTCTTCTGACCTAGAGCTTTGGAACCGTCATTCAGTACTGTGGAA
GTGGGCAGAGAGGAGGCACCTGCAGACAGCCTGTGACTGTCCTTTTCGTTCGTTATTTTG
ATTATTCCAAATGTTATACTTCTTTGAGCTTTAGGGTTTTTAAGAAAATATTGTGAAACT
GGCTTACGTGCCACAAAAGAATTTAAATAATTACTTTCAATTTTATAAGGAGCCCTGGTG
GCCTAGTGGTTATGAGTTGGGCTGCAATCTGACAGGTCTTCAGTTCGAAACCACCAGCCG
TCTTCATTGGAGAATAGACAAGACTTTCTACTCCCAGAAACAGTTTCAAACTTTGGGAAA
CTTAAGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATTATTAAAATCTCAAAAGCTGCCCAACAAGCTAATTGGACTCCACTTACT
GAATGCTGATTTAAAATGCAGACACATCATCCTTTCCTCCCATTCCATGTTCTATTGTCA
GAATCCTAGTTCTAGAACGTAAATAAATGATCTGTTACGCCTTTTGACAGGTTTAGTTAA
TGTCTGAAATGCACCATTTAAAAATGTACATGGGTTTCCAGTTAATGTTAACCGAACTAA
GAAGTCTATTTTCCTAAAAGGGTGCTTTAACTTATTTTCATAAAATATACCAGTATTTGG
TGTATTTTGGGACCTTCCAGTCAAATTTAATAGATTCAGTGCCATTGGATTAGAAATTTC
TAACTATTCAAAACATTTATAAGTGTAAACTACTGACCTACTATGTAATACTTGGTTTAA
CAGAATTCCAAGTCCTATGAATTTATCTTCATATTTCATCTATATTTAACTAGCCACGCA
GAGATATTAGGCTTTCCCAAAGGTAATACCTTCATTTGACTCTTGAGATTGTCTACCTAG
CTTGTGACCCAAGAGAGTAGGTGAGAAACTTCGCTTGGTGCTGGGGGCCTCAGCAATGCG
CGCTAAGATTTTTGTGAGTGTTAAAGGTCACACAGCACTGTCATTTTACATATCCCCTGA
AGGTCAGTGGTCTTAAATCGCTAACATTTGAACCTCATAGCAGAAGTTGTTGTTGAAAAT
ATTTCTGGTTTTTATTGAAACGCAGGTTGATTATATCCATTGTCCTATCAGAGTAAATGA
AAGGTGCTACTGGGGGGATTTAAATCTCCCGTGTTATTACTTTATTTCCTTTAAAACACA
GCAAAGACATGGAATTAGGAAGACATCTCTTAACCAGTAGAGAAAGAATGGGTACTTCCT
AGAACGTCCGGGGTTCTTTTGGCAAAGCAACAAATGCTAGAGTATGACTGAGTAAAGATA
ATGTAGTGCTGACATTGGTCAGAGCATTTCCTTGCATGCTACGATGTGCTAACAAGGGTT
AAAATTTTGGTTCCTGGGGAATATATTGACATGGATTGCCTTTGTCATTTTCTCTTGTTC
CCCTCATTCCTAGATCTACGGAATCCGGAGTCAGCACTGTCCCCAACCTTTCGTAGTGAC
AGCCCAGTGCCTACTATAGCTACCTCTGGTGGCCCTAAGCCCAGCACAGTTTCAGCTGTT
CCTGAACTAGCTACAGATCCTGAGTTAGAGACGAAGTTGTTACACCACCTCTCTGATCTG
ACCCTAACATTACCCACTGATGCTGTGTCCATCTGTCTTGCCATCTCCACGGTAATGACT
TTGTACAGAAGGTTGGTGTCTACCATTTCTTCAGTTCATGGTCAGTGTCTTATTTCCATC
CCCTCCTTCCCCAGCCAGATGCCCCTGCCACTCAAGCTGGGGTGGAAAGCCTTCTCCAGA
AGTTTGCCGCTCAGGAGTTGATTGAGGTAAAGCGGGGCCTCCTACAAGATGACGCGCACC
CTACTCTTGTGACCTACGCTGACCACTCCAAGCTCTCTGCCATGATGGTTGCTGTGGCAG
AGAAGAAGGGTTCCGGGGAGGTAGCAGGAACCATTTCAGGACAGAAGCGGCGTGCAGAGC
AGGACTCGACCGCTGTAGCTGCTTTTGCCAGCTCATTGGCTTCTGGTCTGGCCTCTTCAG
CATCAGAACCAGCCAAGGAGCCGGGCCAAGAAATCAAGAAAACATGCAGCCTCTGATGTT
GATCTGGAGATAGAAAGCCTTCTGAACCAACAGTCAACTAAGGAACAACAGAGCAAAAAG
GTAGGTGTCAGAATGAAAAGTACCCCAAGGTTCATGCATATGCTCTGAACGATAGCTTCC
AAAGGGGTTACCTCTAAGCAAAGAGCAGTCCTTAACTTGAAGGCATAGAGCAGTCGGTGG
GGTGACTTAACACCCCAAGGACATTTGCTGTTGTCTGGAGATTTGGTTATCAACTTGGGG
TGGCTCCTGTTAACTAGTGGATAGAGACGGGAATGCTCCTAAACTTCCTATAAGACACAG
GACTCCTGCCCACCACCAACAAAAGAACTTTCTAGCCCAGAATGCCATTAATGCCAAATT
TGAGAAACCCAGGTTTAGAGAATCTTTGCCATTGAATCTGTTCAGAAGAGTCCATATTCA
AGGTAAGCCAAATATAGAAATATAAAGGAGATTTTAAAATTCATGGAGAATTTGAATGAA
TTTTTTGCATGAACGTTTTAAAAGACCTTTCATAGAGGGAGATAAATACTGGAAGATAGT
GCTGGATCAATAATTATAGAAACTGTTGATTAAACAAAGTGATTTAGCAGGATAGTTATT
CTGAGTATAGACAGGGGAACAACATCCTTCTGCTACTTAGGTGAATTTAACTTCTCGATT
CTCATGTCTTGTTTATAAAATGAGGATAACCAGCGTACTTTCCCTTATAGATGCAGGCTC
AGTCAGACAATAAAATCTTTAGCACCCGGAATCAAGACCCAATCGTTTAGATTCTTAATG
GAAGGACTGCTGTCCTGGGAAGTTGGGGGTTAATGCTTAACAGTAGGAACATCTGGAATC
CAATGTGGTTGAGTCATTTCCAATTCCTAGCAGCTCTCTGGGACAGTAAGACTCCAGACG
GTCTCATCCTTCTCCCCTGGAGCAGCTGTGGGCGCAGACCTGTAACCTTCCTGCTAGCAG
CCTAGCCCCTCACTCCCTGCACCACCAGGGCTCCAGAGTGGGAGGCAAGGCCTCGTGTGT
TTTACTTCTCTCCCAAATGAGGAAGGACTGACCCTGTGATGAGTCTTTTTTTCCGGGGCT
CGTTTCCCATATTGTTAGTTTATCGGCCCCTTTGAGGAGCCTTGGTGGTACAGTGGGTGC
ACGGTTGACTGCGAGTATTCCCAGGGTTGGCAGTCTGAAACCACCAGCAGCTCCACTGGC
GGGAGAAAGATGGGGCTTTCTACTCCCACAAACAGTTACGATCTCAGAAATGCACAGGGG
CTGAGAGTCAGCATTCAGTGAGTTTGGGGTGGTTTTTTGTTAGTTTGTGTTTTTCTGGTC
GTGGGGGGCGGGGGGAGTTGAATTTTATAGGACATTAGTGTCGTGTATGAACTAATTAGA
CCTACAAGCACCTTCAAGGCCAAAGCTGCTTCTGTTACAGGTCAGCCAGGAGATCCTAGA
ACTGTTAAATACTACTACAGCCAAGGAACAATCTATTGTTGAAAAGTTCCGCTCTCGAGG
TCGGGCCCAAGTGCAAGAGTTCTGCGACTACGGCACCAAGGAGGAATGCATGAAAGCCAG
TGACGCCGACCGGCCGTGCCGCAAGCTGCACTTCAGGTCTCTTGGGAGGGAAAGAGGTGT
GATCAGCCTCCTACAAGCAGTCCTTCCATTTCAGCACACTCCTTCCAGTCTTTTGGGTGT
CTGTCTTGAATCCCTTATTTCGTTTTTTGGATATGTAAGCCCTCTAGACTCAGAAGGTAT
ATACTGTCAGAAGTGGTGTGGTGTTTTGTGGGAAATATAGACTGCCTGCCAGATGTGAGC
TTTTAAGGTATACCACCAGAATGTCTTGCAGCAGCAAAGCATCACCAGCTCTGAGCCCCA
CTGCAAGGGTTCTCTGAAAAGAATATGGTCTTAGAACTAGACCCCACCCAGAGATTTACT
CTGCTCTAGACAGTAAATCTACTACTGCTTTCAAGGAAGCTAAGTCTCTGCTCAGTAATT
AGTCTTTTCTAATAATTGGAAGCTAAGTCTCTGCTCAGTAATTAGTCTTTTCTAATAATT
ACGGATTTCTGTGTCACCCGCCTCTCAACATTCTTGCAGGAAACTCTAATAGAAAGAAAT
AGGATGAGGGGGGAAGTGGGAGAGGAAAATTTGGAACTTGAGTGACTGTGTTCTAAATCC
AGAATGTGATCCCCCCCCCCCCTATTCTTGCTCTGTATCCCCCCAGACGGATCATCAATA
AACACACGGATGAGTCCTTAGGTGACTGCTCTTTCCTGAACACGTGTTTCCACATGGACA
CCTGCAAGTATGTTCACTATGAAATTGATGCCTGCATGGACTCTGAGGCCCCTGGCAGCA
GAGACCATCCACCGAGCCAGGAGCTTGCTCTTACACAGAGTGTTGGAGGCGACGCCAGTG
TAGATCGGCTCTTCCCGCCTCAGGTACCTATATATCTGCTTCTAGACTTAGGACCCAGTG
GGGCAGCCAAATGTGTGGGAAAGCAACCCATCCTGCTGACTGGAAATGGAGTGGGAAATG
TTTCTAAGGGTCTGGGGTCATGAACCTGACAATGAGAGGGAAGATGACCAATCCCCACCT
CCTGCAGTGGATCTGTTGTGACATCCGCTACCTGGACGTCAGCATCCTGGGCAAGTTCGC
TGTTGTCATGGCTGACCCCCCCTGGGATATTCACATGGAGCTCCCCTATGGAACCCTGAC
GGACGATGAGATGCGCAGGCTCAACATTCCAGTACTGCAGGATGATGGCTTTCTCTTCCT
CTGGGTCACAGGCAGGTAATGCACTTAAAAATATGTAGGTTTGAGTGCGGAGTGGAGACC
CAAAGCCCATTAGCCCACTGGAGATCCCCTTGCAGAGGGGTCTCGGGGAAGAGACGAGCC
AGTCAGGGTGCGATGTAGCAACAATGAGAAATACAACTTTCCTCTAGTTCCTAAACGCCC
CCACTGTCATATGAATTCTACTTTGCAAGTCTGGCTAGACCAGAGGAGGTACACTGGTAC
AGACAGGAACTGGAAACACAGGGAATCCAGGGCGGATGATCCCTACAGGACCAGTGGTGT
GAGTGGCGATACTGGGAGGATAGAGGGAGAGTGGGTTGGAAAGAGGGAACTGATTACAAG
GAACTATATGTGACCTCCTCCCTGAAAAAAGTGGGTGAAGGGAGACGTCGGATAGGGCAA
GATACGACAAAATAATATATTATAAATTATCAAGGGCTCATGAGGGAAGGGGGAGCAGGG
AGGGAGGGGAAAAATGAGGAAATGTTTTGAGAATGATGAGGGCAATGAATGTACAAATGC
ACTTTACACAATTGATGTATGTATGGATTGTGATAAGAGTTGTATGAGCCCCTAATAAAA
CGATTAAAAAAAATATGTAGGTTTGGGCAGATGTAGTAGTACAGAATGAGTATTGGGTGG
GAGATAAAATGCTGTGTTTTCCTGGTCTTGCTATTAAATGTATGGCTGATTCAGGTTTGT
TTGTTTTTTTTCCTTTGAGACTTAACTTCTGTTTATAAGATTATTTAACTCTATGCGAAA
GATGAGGTAAATGACAATGGGTACTATGTCTTATTCTTTTCGTACTTAGATGTACCGTTT
CCCTAACGATATGTTGCATGTAAAAGTTGTGACTATCTACTGACAAAATGTTTCTAATTA
TTACATTGATCACATATTTTAGAGGGAGGAAAACATGGGTATGGAAGTAATTATTAACCC
TTATCTCTTTCTAGGGCTATGGAGCTAGGCAGAGAATGTTTGAACCTCTGGGGGTAAGTA
GTAATCATTTGGGTTTTGGGGAAACACACCCTGCTGTAGTTATTGGATGTATTATTCCCT
TCTGGTGTGTTGGTCCCTATGATTCTTTGCCTCTGTAGCTGGTACTACCCCCAAACTGGG
AAGACCTAGGGAAAGCTCTAAGTTCCCTTCCTTCCACCTCAGTTATGAACGGGTAGATGA
AATTATCTGGGTGAAGACAAACCAACTGCAGCGCATCATTCGGACTGGCCGTACAGGTCA
CTGGCTGAACCACGGGAAGGAACATTGCTTGGTAAGCAGCATCGGGGTCCAGCTCAAGAT
GGTGGAGCAGAGAGAGGAATTGGATTATTTCTCATTAAGGAAAAGTTCAAAGCTGGGTTT
CGTAAAATAACCTGTTCTTTGTGGTGAGCAGGTTGGTGTCAAAGGAAATCCCCAAGGCTT
CAACCAGGGTCTGGACTGTGATGTGATTGTGGCTGAGGTACGTGCTTCCCCAGACACCCA
AAGCTTCCGCATAGTATGTTATCAGTTATTGATGTCAGCTATGTATTCTTCATCGGGGTT
CCTAACGTAACAAGTCTGGAATTGTAACTGTGGTTGGCTGTGTCTTAGGTTCGTTCTACC
AGTCATAAGCCAGATGAAATCTATGGCATGATTGAGAGACTATCCCCCGGTACTCGCAAG
ATTGAGTTATTTGGACGACCACACAATGTGCAACCCAACTGGTAAGGGTACTACCAGTCA
CATTCTATCTTACACAGTGTGGTGATACCACCCCCTGGGGTGCTGGAATGATCAGGGGGC
TATAAAAGCAGATACCGTTTACTTTATCCTGGATTATGGGCTACACTATTAAACGTTTTT
AATTGCTAGGGGTGGGGAGCAGTGGCGACTGGTTTTCCTCCTCTGAAAAGGGGGCAGTAG
TCTAAGCTTTAGGGACCTATGCTGGGCTCAGGATCTTTAAAACATCTAAAACATGTATTT
AAAGCTGTTAGGCCACTTCCTACCATTCATTGGAAACTCAAAAGGCATTGAGTTTCCCAT
ACTCCATTGGCTGAAGTCCTTTGTGATTCTATAGGATAAAACTTATGACTCACTAATCTG
CCCCCTGGTGGTTACTAAGAATCTGTCCGATCCATCCAGAACTGCAACACCTTTGACATG
CAGGCTAGCTAGCATTTCACTTGTTCAAAGAACACCAAACTGGCAGCTACAGCAATAGCT
TTGTGACATAAACCTTGCTAATCAACAGTTACTAACCCCCAGTTAGTATAGATCAGCTTA
TTGTAGAAACAGGTCCTGCTCAATTCCTAACTGGCATTTATGTTAAAGTCTTTAACAATA
TTAAGGTCTTTTAATTCTAGGATTTCTGGTTTCCCTCTTCTCCCCTCTTGTTTCAGGATC
ACCCTTGGGAACCAACTAGATGGAATCCATTTGCTAGACCCAGATGTAGTTGCCCGGTTC
AAGCAACGATATCCAGATGGCATCATTTCTAAGCCTAAGAATTTATAGAAGCACTTCCAC
AGCCATGGCTTTACAGGCTACATCTGGAATGTAATATTACTGTACTATAGCGCTTTTTCC
TTATTTAAATAAAAGTTGATAATGTAGTCGGGACTTCAGGATCAGATCTGGCTGTCACTT
AAGTGTTTGAGCTTGTGCAATTCATCTCTCAGTATGTATGTCTCCTCCTTACGTGTAACA
TGGGAATATTAGCGATCTCAACCTTGGGTCCTTTTCAGGTTTCCAGATGAATGTTAGTAA
TTAAGGTAGGACTATACGGAATCAAAACTAAGAACTACTAGTACTATGTGACACTGATAC
TAAGAAAGGGTTCTCTACATAGCATTTCTCAAGGTAAAACTTGAGTTCCACTTATAGGGT
GGTTACCACTGGCATTGTAATAACTCTAGGACTATAGTGCTCTAAATCACTTGCTTATTT
TGTTACACCTGTGTAACTTTTGTTAAGTCTCTTAATGTTTATTTCTCAGAAAAAAATGAA
ATAATCACTTTTAGTCAGATTACCTAAGGTGTGCAGAGTTAGTTCATAGTAGGTGAAGAG
ACCTCTGGCCTATCTTTATGAGATATTTCAGCAAATATAAGTGAACACAACTTCTTTAGA
CTTTGGTAAAACCTCTTATATTAATTTAAGGATGTAGGGTTCTGCCTCTTACACACAGAA
GCTGTGATAACTCAGATAAGGAAAACTACAGAAACAACATTTGTAAAAAGAAATAAATAA
GAAAACTTCTGGGTGATGTTATCTCCCTTACAGCCTAGTGTGTTTGGTGTTTTGGAAGTT
AATGTGTACGTATGACAGAAGTGGTTCCATTTTTAACACTGGAACGCAGCCTTTCACTCC
CTTTACGTTGTATGCACACCATGGCGTTCTTTCCTAGGCTCAAGGCTGAGTATACTTCCA
TTTTAATAATCTTTTAGGTAAGTCCTATGACAATTATACCAATAAATTTCCTCAAACACC
ACCCACCACCACCCCTACCAACTAGTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1100, 21313..21530, 21614..21921, 21923..22019, 23380..23555, 24166..24382, 24547..24734, 25694..25732, 25902..26010, 26131..26196, 26328..26440, 27116..27227
1001..1100, 21313..21530, 21614..21921, 21923..22019, 23380..23555, 24166..24382, 24547..24734, 25694..25732, 25902..26010, 26131..26196, 26328..26440, 27116..27224
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved