Echinops_telfairi Locus MRPL9
snOPY snoRNA Orthological Gene Database
Echinops_telfairi MRPL9
Echinops_telfairi
MRPL9
GeneScaffold_4511
SNORA70
6299..6432
9055
TCTGCCAAAGACTCCACACTGCATCTTTATCTACAACTGACACTTCTAGCACAATCGGG
TCAGCTGGATCATATGGTCCCAGTGGCAAAGCAGCTTGCACGGCAGCCTGAACCTGTTGC
AGAGCCTTTTCTTGTTCTGGGCCCCTCTCAAAATTGGAGGCTTTTCATGTCACTTGATAA
ATAGGTCGAAGTAGAACACCCAAGTGAGGGATATGTTGCCTCCAAAATCTGAAGAGGCCC
ACTAGACGTTGAGCCTCTTTTTTAGTCATTGGGGGCACTAAATGCAATAGCTTATCCTTC
ACTTTAGTAGGAATATCCCGACATGCCCCACATCACTGGACCCCTAGAAATTTTACTGAG
GTGGAGGGTGTCTGAATCTTCATTGGGTTAATTTCCCAACCTCTTGTACGCAGATATTTT
ACCAATGAATCTAGAGTCTTTGATACATCCTCCTTAGTGGGTCCAATCAGCATGTCATCA
ATATAATGGACCAGTGTGACATTTTGTGGAATAGACAGGCAATCAAGGTCCCTTCAGACT
AAATTATGGCACAGGGCAGAAGAGTTGATGTACCCCTGGGGGAGAGTTGTGAAAGTATAT
TGTTGCCCCTGCCAGGTGAAGGCAAACTGCTTCTGGTGTTCCTTCGAGACTGGTATAGAG
AAGGAGGCATTAGCCAGATCAATAGCTGCATACCAAGTACCAAGAGAAGTATTAACTTGC
TCAAGCAATGAAATCACATCTGGAACGGCAGCTGCAATTGGAGTCACCACCTGGTTAAGT
TTACGATAATCCACTGTCATTCTCCAGGATCCATCTGTCTTTTCTACAGGCCAAATAGGC
GAGTTAAATGGGGATGTGGTAGGAATCACCACCCCTGCATCTTTCAAGTCTTTGATGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCGGCCACCTTGGCGGCCCCGG
GCCGGGCTCTGTTCCGGGCGGGAGTCCGCGAGCTGATCCGGCCGCGCCTGGGAGCGGGTC
CCCGCGGCCCAGAGCGCGAGTTCAGCCTCTCGCTCGGTCGGGTGAGGGCCGGCGCCGGGC
TGTGGGGTCCTTTGACCCAGCATGGGTCTTAAGCCCGCGTGGTGTTTCTCGGGGCGAGTC
GAGGCCGGGGTGGCGGGGGGCCGACGAGGGGGAGTCCCGGCAGACGCGCGCTCACCGTGG
TCTCCCCGCGCTCCAGGGCACAGTCATCGTGGAGCGCTGCTGGAAGGTGCCGCTGGCCGG
GGAGGGCAGGAAGCCGCGCCTGCACCGGCGACACCGCGTCTACCAACTGGTGGAAGACAC
CAAGCACCGGCCCAAAGAGAACCTGGAGCTCTTCCTCACGCAGTCTGTGGAGGGTAAGGC
CCGGGGCCAGCCCGCCGGGATTCACGCCGCTCCCTGCGCTTCGCTCTGCCTTTGCCTCGC
TTGCTCCCGCTCTGGGAACAAGCAGCTCTGTATTTGAGAAATGTGATACCAGATTTTAGC
ATTGGTAAAGCGGGACACCCTTGATAAAACTCATATCCTGGCGAAATAGCCACATGGCAG
CGGAAAGCCGTATACCCCTAGCTTGTCGTGCATTCTTTCCAAAAATCGGGGACTTTTTTA
AAACACCGCGGGACTGTCTGGTCGCCCTTATTTTACACGGAAACACGGGCCAGGAACCCA
CTGCACAGTTCACAGTATGTGGGGAGAACGAACTGGACGTTCCTATGACCTCGACCAGCA
TAACGAATATTCAGTTTCAAAATCAAGTTGGGCAATAAATTAGAGATCCTTTAAATGTTT
TTCTACTGGACGTGATACATTTTCCTCTTTTTTCCATCATTTGATGGGGGCTCANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTGTTTTTCCCGGTAGAGTTC
TGATTAGGGTGCCCAAGCCCTATTTTTTGGCATTCCCTGGGACTTCATTGGCTCTGGTTC
ACCTTGCTGTTCTGTTGCATGCCCTTAGTGTTTGCCTCTGTGTGGTGGGATCAGATCAGG
CACAATTCTCACACTGTGTCTCCAGTGTTGTCCCCTGTAGAGCTATGGGTCAGTGAGAGA
TGTCGTGTCTCATAGTGCAGCCGGCCATATGGACCTCTCTGTGGATTGGCTGCTCTTAGC
CAGGAATATTGTCCTCAAGGCTTGGTGGGCCACATTTTCTTTCTTCTAAGAAACTCGTTC
TTGGCAGACTCTGTTGGCCCCGAAGGAGTTAACAGAGACAGGGCAGTGGACTGTTTCCAT
GGACACCAGATATCCCTTGCTCAAGAGGGAAGATCTGGGCGCCTGGGCTGCAAACAGCTT
GGATGCAGTTCTGGGAGCAGGACCTGACCGAGGGTGCTGTGCTGCTTCCCAAGGACAAAA
ACCTTGAGGCAGTTTGTTATGAGAGCCTAGTGCTTAGTCTGCTCCCTTGTTCTTTGTTTA
CTTTGAGAACGTGCATATGTGCTTACTAACACTTGCCCTAGCTAGCAGAAAATAAAAGAC
CTTGCAGGGCAGCCATCTGGGCTACACCCAGCACAGAGGTGTCAGCCCTTCGCTGGTACT
AAACCACATTTCCCATGTTTTTATTTCTCCCCGCACTGTCACGGAATGGTACAGGACTAC
AGGACTCCTGGATAGTTTTCCTTATCCAGTTCCTCTCTTGTTCTCTTTGGCAGAACTTGG
AGTGCGGGGTGACCTGGTGTCCGTCAAGAAATCCGTGGCCCGTAATCAACTCTTTCCTCA
AGGACTGGCTGTCTATGCATCCCCTGAAAACAGGAAGCTTTTTGAGGAAGAGAAATTGGT
ACGCTCAAAGGAAGGCAAGAGGAACTTGGAAGACTAAGAAAAGATCGTTTGAATTTTATG
TTTAATTTGAAAATGAATTAGAGACTGGAAGACCAGAATTCCAAAGCCCAGCCATGCCTA
GTGTACTAAGAGGGTGATATTAATTACCATGAGCTCGTTTCCTTCTGCTTGTTTCTAACC
TTCACCTTCTTTTGCAGCTGAGACAAGAAGGAAAATTGGAGAAGCTGCAGACCAGGGCAG
GTGAGGCGGTGAGTATAGAAAGAGAACATCTTTACTCCTCACAGACAGGGGTCACCAGTG
TCTTCCTCACAGGAGAAGATGAAGTGTTGGGGGGCTGCTGTGAGAGTGTGGGGACTTCCT
AGCAGACCCTGACCTGGGAATAGGCCCTGTCCTGAGCATAAGGAACCCATGAAAAAAGGA
GATGAGGATTCTGCCCTCCAAGAGATTTACATATAAGATGGAGATGGCAGGTGGATATGA
TGATCAGTAAACTCAAGGCAGTAAATTATTAAAATAATGGGGACCATAGTAGACTCGGGT
GATTGGAGAGGGCTCTGTATAACAGAAGACATTGAATTAAGCTTTAAATCAGGAAACTTT
TAATAAGAAAGAGTGAAAAGATGTAACTTAAAACTTTAAGTCCTATTTTGGCATAGAAAG
TATATTAGTCTGTGGTAGAAAACCCGCCCCCCCTCTGCCTTCCCCCAGACTGTAACTCGT
AGACACCCTTCAAACCTGGGACTGACCCCACTCCTGGAGCAAGATTACCTTTTCAGTCAA
ATATAAACAGGCATACAAAGTAAACATTGCAGCTGAGAGGAATGTGCTCTTTAGAATAAC
CAACCACACGAGACCAAGAGCAGCAGTGGTCCCAAAACAAAGTTCAGAGGGTAGAAAGGA
TGGGCACCGGCGAGGAAGTGGGAAGAGTGCTGCTAGACCGACGGCATTGCAACTGTCATC
ACAAAGCAATAAAATGGGTATCAGTTGTGAATGGGAAACCAACGTGCTTTGTAAACTTGT
AAGCTTTTCCCAAAACCATGATAAAATGTTTAAAAAGATGGACCTATCTAGTTAACACAG
ACAACTTAAACAGTATATTTGGAAACCTGGGTGGGGCCAACAACTAGGTTTCTAAAACAT
CTCAAATGCTTGGTTAATATGTTTTTATATCCTGTAAGCAAGAAGAGCCCCTGATAATGT
TGGGGAAGCATTGTAGGGCCAGAAGGAGTGGTTTAAAACAACCTATAAATGTACGTTTTC
TGCAGCCAATTAAGCCGACTGTCCTCATTCCTGTGGGGGCCAGTGTGCAATGGCTGCGAA
CAGCATCCCTCCTCGGTAGTGTACACAGCCTATTGGCATGTACAGGCTGCCCTAAGGGAC
TTTGGGGACAACCCTTTGCTGCTCTTTGATGGCTCTGATCTGGCTGATTTCTGCTGTCCC
TAACCTAGCCTCCAGACTGGGATGCCAGGTGTTTTGGGAAACCCCAAGGCATGGTGGCTG
AAGTCTGCATCGGCCAGGTTATCATGTCCATCCGCACCAAGCGTAAAAACAGGAGCATCT
GATTGAGGCCTTACACAGGGCCAACTGCTCGTGTGATGACCGCCAGAAGACCCACCTCTC
CAAGAATGGGGCTTCACCAGGTTTAATGCGGATGAATTTGAGGACATGGTGGTCGAGAAG
TGCCTCATCCCAGATGGTTGTGGGGTCTATTATATCCCCAGTTTATCTGGGGCCTCCACT
GACTAGACTCTTTCCCTTGCTTAAGATCAGCCCAAGTTTGTAAGTGCATTTCCTCATGAA
GGTTTTGCTAAAATATTTTCCCCATGATAATCAGCCTTGAGATAAGAATGTTGTAGCCAA
AAAAAAAAGAATTGTTGAAGCCTCCCTGATCATTTCTCACCTGTTCGAGATGTTTAGGCA
AAAGTGAATGCCCCTTTTCTCCAAACTCTTAAACTTTGTGCCCTTTTTGCTANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCTTTGATTCCGCCTCTAACCCAGCCC
CGACTTGTCATTTCTCCTCAGACAGTGAAATTTCTGAAAACCTGTCGCTTGGAAGTGGGG
ATGAAGAACAATGTGAAATGGGAGCTGAACCCTGAAATTGTGGCCCGCCAATTCAACAGG
AATGTGAGTGCTCCACCCAACTGCCACTATTCAGAGGGGCACTCGGAGAACTTGAGTCTC
TAACTATCCTGCTGGAGTTAGCCATCTCAGTTGGTTTGTAAGGGTGTCGGAGGGAAATGG
CTGGAGACGAAGCTTGGTCACATAGAATTTGAAGACTGGTCTGTTTCATTTATTTCCTCT
CAGATGTGGGGGTGGGGTGGGGGGTGTACTGTGGAGATGTAATTGATTTACTGGAGAATT
TTCACTTTTGTGGACAAAGCCATTTTGGTCTTAAATCCTGTTTTGCTGTAAGAATTGACT
TCTCCCTGTCATCTTGTCAGCTTCTGTCTGTGTCGGCCCATAGGGTCAACCCAGGTATAC
TCCCCAGTGACTGGACTCAGTAAAGGAAATTCGAGAGCATGCTTTCTGGTGCTGCTTAGG
AGGGCAGCCATGAGAACAAGCATTCATTCCGCCCTGGCTTCTTGCAGCTTGGTGTTGTGG
TAGCTCCCCATGCAATCAAGTTACCAGAAGAGTCCATCACACGGTGGGGCGAGTATTGGT
GTGAGGTAACGGTGAGTTGTCACGTGCTGCCTCCTTTTCTGATTGGGTGGAAATCCAGGG
TTGCATGGTGTTACCTCTCGTGCATTCGTTGGCATCTGACGTTCTTTTGTCTACAGGTAA
ATGGACTTGACACTGTGAGGGTGCCCATGTCTGTGGTGAACTTTGAGAAGCCTAAGACCA
AAAGATACAAGTACTGGTTAGCCAAGCAGGCAGCCAAGGAAATGGCCTTCCAGAGCCCCC
AGATGTTCTGACCTGCCTCTGCCCCTGGCAGCCAGATGCTTTCAAGACGAGGTTCTGCAG
AGCAGAATCAGGAGAGGTGGCAGGAAGATGGAGCAGCACGCTGACCGCACTCTCACCTCG
GAATAACTACAGGATTTTAGAGCGCGTATAGGGACATCAGACTAAACTGCACATACATGC
TGAATTATCCGTGTTTGTCATCTTTCATGTACTGTCTTCACACGTCTTTATTGGGATAAT
CCTGCTGAGAATGCACCAAACTGCAGTTTGCTTAGCTGGACAGCAGTGGACTGAAGCCAT
CTAAAGCCCCCGTAGCCTCTTCCCAGGTGCAGCCCTCTGGGACAAATAGGAGGAGCTCTC
AGTGTCCGGTGTCTGACTTGTTCTCCTCACCTAAGCCAAGCACTTGTTTCTCCAGCGAAT
AAGAAGTTACATTCTTTGTAGGGTTGGCGACTGGGCTTTGGGATGAGAGTAGGCTGGGGC
AGGACATCCAGTGAGGAAGAGTATGTGTTGGCAGGCTACCCCCACAGTTACATAGAGCAG
TGGTTCTCCACCTTCCTCATGCCGCGACCCTTTCATACCGTTCCTCATGTGGTGGTGACC
CCCCAACCATAACATTATTTTCGTTGCTACTTCATAACTGTCATTTTGCTCCTGTTAGGA
ATCCGGTGACCCCTTTCAAAGGTTGAGAACGCCTGGGCTAGAGGGGGTTCAAACCTCTGA
GCTTGGGGCCAGCAGATCCGTGTTTAACCCATAACGTAACTAGGGCTCTTGTGAGGCTGC
TGTCTAGGAAAGTGAAGGGGCATGGAATCCAGAGATTGCATTGTCCTGCTGGAGCCCACT
GACAACCATTTCAGCATTGTCCTCCAAACCACTAGGTTCCTAGTTTCTTGACACGTGAAG
GCTGATGACGGCCAAAGCTTCATGGTAAGACATTCCCCCATTTTGGGTCAGTGGGAGGGA
TGATAATGGGGAGGAAAAACACCCTACCCCCTTCTTCTCAGACCCATGTTTTTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1120, 1276..1432, 4913..5037, 5237..5287, 7161..7262, 7727..7810, 7916..8043, 8052..8055
1001..1120, 1276..1432, 4913..5037, 5237..5287, 7161..7262, 7727..7810, 7916..8043, 8052..8055
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved