Echinops_telfairi Locus ENSETEG00000017902
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000017902
Echinops_telfairi
ENSETEG00000017902
GeneScaffold_4674
SNORD73
4449..4514
5352
GGGGCGGGGAGGAAGCATTTAGGAACTAGAGGAAAGTTGTTTCATCGTTGCTACCCTGC
ACCTACTGGCTCGTCTCTTCCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTTGGGGGCGAT
TTTCCCCTCCCCGGCCTTTTGGCACTCTCGACACGGGCCCAATGGCGTGTTGGCAAGAAA
CAAGCGCCCCTTCAAAAAGGGGCCAAAAAAAGGAGCTAAGGAAAAAAAGGGTAGGTGTGT
CATCCCCCAGGGATGCTGAATTTTGGGGTTCCTGTGGAGTGGGCGGGCCAGGTGCTAGAT
CGGCGGCGTGGCCGGATTGGCGTGTTACCGCCGAGATTTGCGCGGTCCTGTGTCCGGGAG
ATGCACTGCGGGCGGGCGCCTCTGGGTCATGGAGGATGGACCCTTGCTTGCTTTCGGCCG
GTTGGGCTTGGCACACAACCCGTTCGAGTCGAATTGCCACCACCACTGGGTTCCGGGGTG
TTCCTTCACTTGTTAACGCCGCGCCGACTTACTGCCTTGACTAAAGTGGGAAGGCGCACT
GTCCCTACAACTAACACCCCCCCCCCCCCGCGGTTGGAGCGCCGTGGAATCGGAGGCTCT
CTGAAGGGCCACGTAATGTTCACGAGACGCGGAGGCCAAGGCTTCATAGTGGAAGGACTC
GTGGAAGCGGGTGCGTGGTGGACATGGAGAGAGCGAATTCCCATGTGCTTCCCTGAGTTC
CTTGGGAGGGAAATCGTTTCGGTAACTGTTAATTCTGTAAAATAGTAAGGGGCAATAATA
ACGACGCTATTGAGAATGGAAAACCAAACCCACTTAAAAGCAATGAAGTGATCTTCTGTA
TAACAATTTTTTTTCAATCCAGGGTGGATCCATTTTCTAAGAAAGATTGGTATGATGTGA
AAGCACCAGCTATGTTCAATATAAGAAATATTGGGAAAACACTAGTCACCAGAACTCAAG
GAACCAGTAAGTATCCTATCCTTGGTTTGCATGTATCTTAAGACCTGTATAGTCTCTTGT
TCTGTGGCACTAGTGTCAGCTCCTAATTAACAGCGTTGGCCCCTATGGTGCATGTGAAGC
TGGGTGGTGCTTTGGGGAATTAGTGCAGATTTCAGCTTTAAATTAATGTGTCAACAAATA
ATCGCTTTCCAGTTGGATTTGGGCAAAATGTTAAATCTTTTATAATTTATTGTTTGGGTA
AGCTTTAAGCTTTTTTTTTTTTTTTTCTTACATTTTAAGCAACAGGGTAAGCTTTTATAC
ATGAAAGTTGCTGTGACTTTTAGGTCTGTCTTAATAAGAAATTTTACTCTTGTAGAAATT
GCATCTGATGGCCTCAAGGGACGAGTTTTTGAAGTGAGCCTTGCTGATCTGCAAAACGAT
GAGGTTGCCTTTAGAAAATTTAAGTTAATTACCGAGGATGTTCAGGGCAAAAACTGCCTG
ACCAACTTCCACGGCATGGACCTGACGCGGGACAAGATGTGCTCCATGGTCAAGAAATGG
CAGGTGAGCTCAAATGCTGATGACAGTCCTGTAGAATGCGTGATGAAAGGCATTTGCTAG
GAAATGATTAGCAGCTATCCAGTGCTAACTCAAGGCCTTTGTGCAGCTGAGCCTCTTACT
GTGTCCGAGATTAAATGCTGGTTTGTTGAAGTGAGCTGTGTCACAAGAATCAGTGGTGGT
TGAGGACTGTCTCTTGGATTATATGCCTCGACATCTGGGAGCAGCACTCTAGTAGTTTAC
TGGGGTCCCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTGAGGA
CAAGAATGCTTTTGTCTTAAAAAAAATAAGCTGAATAGCCAAAAAACCTCAAGTTTGGGA
ATGTATGGGAATAAGTGATGAAAACCTGTTTCGGTCCCAGCTGATGTCCTGTGATAATGC
ACATTTTCTGATGTTCCCATGCAGTGTTCCTCTGACTAAAGGGGGTTAATGGAACGGCAT
TCAACTTGGGTCCAAAGGGGCTAAGTGCTAATTTACCAATAACTGGCCATAGAATTGATT
TTGTTAACTTTCAACTCGGGGTAAAAATAGTCTTTTACATGAGGGTTTACATGTGTGGGT
TTATGCTAAGCCTTCTCTGCTATTGCAGGAGATGGCTTATTGTCTTACATGAGCAATTGA
CCTTTTTTCCCCGTTATTCTAATTTATTGGTGGTTTGCAGGATTCCAGACAGCATTGGGA
AAGACATAGAAAAGGCTTGCCAGTCTATTTATCCTCTCCATGATGTGTTTGTCAGAAAAG
TAAAGATGCTGAAAAAGCCCAAGTTTGAATGTAAGTGGAATTTGCAGGTTGCCTAGATGA
AAAAAAACAACAAACTGGGGACAGATGGTTTCGTTTTTTGAAGTCAGATTAATGGTCACA
GTGTGCTATAACAATGTTTTCTTTCCTTTTAGTGGGAAAACTCATGGAGCTTCATGGTGA
AGGTGGCAGTTCTGGAAAAACTACAGGTGATGAGACAGGTGCAAAAGTGGAACGAGCTGA
TGGCTATGAGCCACCAGTTCAAGAATCTGTTTAAAATTCAGACTTAATGTTGACAAATAA
AAGAACTTATTGTGATGCTGTGCTTCTGAACATTATTTTTAATGACAGCTTGGTGGACCA
AATGTTTCTGACCTGCTCTAAGGACTTTATTGTCCTTAGTCATATAGTTGAGAAAGGGGT
ACATATTGTTTACCATTAATAACATGTTTGGAGGGTTTCAAACATGAAAATGATTAGTAT
TGCTTTGAAGGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1008..1018, 1020..1028, 1030..1042, 1045..1059, 1062..1069, 1702..1805, 2155..2342, 3377..3585, 4780..4889, 5012..5133
1001..1006, 1008..1018, 1020..1028, 1030..1042, 1045..1059, 1062..1069, 1702..1805, 2155..2342, 3377..3585, 4780..4889, 5012..5130
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved