Echinops_telfairi Locus VPS24
snOPY snoRNA Orthological Gene Database
Echinops_telfairi VPS24
Echinops_telfairi
VPS24
GeneScaffold_8944
SNORA61
52143..52261
84110
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGAGGAGAGCAATCACCAGGGGGCTCAATCAGATTGCC
CTGCTAAAATGTATCGTCTTTTTTAGCCAGATGCCTCGAGAATTTTACCAAGCTTAGAGT
CAGTGTGGGGGACAGTAGGACACACACATACACAAATAACCCTTTCTCCCTGCCACCGAG
TCAATTCCAAGTCCTTATTTGCACCCAGGTAGGTAACGGCGATGGCCTGATCAAGAGCGG
GGACAGTTGGCATAGACAGAGGTGGAGTCCACACATTAGACAATTACAATTGTGGATACT
TGGTACGAGAAGACCCCAAATAAAAGCCAACCTCTTGGAAACAACAAGCAGAAGGCCTTT
TACGTTCTTATCATGACACCCTGCGGTTTAGTGACCTGGCGATGGCAAGAGAAGGGTAGT
GGTTGTTTTGGTGAGAGGATGAGGTCCTATGTATGCAGGAACTCAAAAAACAGAGGTCCG
GAAAATAGTTATCAAAATGCAGAGCATCAGGCGCAGTTCCAGTTTAGCACCGTAATCAAT
AAACTGGCACCCGCTGGAGGAGTTAATACGACACTGCACGAAAACATGCCCGCAACCACG
CGAACGCCTTCCGAGCGTCCCCGACGCAGCCACCCTTCCCAGGGAACCCAGCCCAGCGCA
GGCACGCGCATGCGCACGGCGCGCGCGTCGCCCCGTCGCGGCCGCTCCCCGCGCCGGGCG
TCCGGCGCTTCCTCTCCCCGGGCCCCGCCCAGGCGGCTGCCCGCAACCTGCCCGGCGCTG
GGAGCGCAACGGCGGAAGGGGCAAGGCGGCGTCAGTTGGCCATGGGGCTGTTTGGAAAAA
CCCAGGAGAAGCCGCCCAAAGAGCTGGTAAGGGCTACGGCGGCGGCCGAGGAGTGGGTGG
GCTTGCGTGGGGCGCGGAGGAGTGCGCGAGCGGCCGGACACTCCCCCCGAGGCCGGCTGG
GGGCCGCCCGGCCCCGTTTCCGGGGTTTCCCACTCGAGTGAGGCGCCGAAGGGAGCGTTC
CTGAGGCGGTGGGAAGAGAGAGCCTTTGGCACCGCAACCGCCGGCCCGCGAGCCGCGGGC
TGAGGTAAGGGTTCGTCGGGCTCGCCGCGGGGCGCAGAGCCTGTGACGCGGCCCTGCTCC
CGGCACCCCTTCCGGAGGCGCGTTGGTACGTCCCGCCCGGAACCGGCCCCGGCCCCAGCG
CAGGCCCCGCCTTCGCGTCCCCGCAACCGCACGTTTGTCGCGACCGCCCCGAGTGCGGGT
CGCGGGTCCTGGGTTTCCCCCCCCCCCCCCGCTGTATTGGGAGCGGGGCTCAGTGCCCTC
TCTCCCCAGCCTTAGAGCGTGCTGACCACTGATTTTGATTATATCAGGGACCTGAGTCAG
AATGCTAATGATAGGACCCCGTTTGAGCTCATCTACCTGTTACTGAGCGTGTGGACGCCA
TGTGGTGAAGAGGTGGGTCCTGCTTTCCCCCTCTCAGCTCGGGGACAGTTCATGCCTCCG
TGTCTTACTCTCCACTCTTGAGTAGGGCTGAGAATAACGTCACTGCAAAAGGATCAGAGA
TTTGAAAGAGGGAAATGGCTTGTGAGCTTGCTGACACGTAATAGGTGTTCATGAGGATGT
TAATGGTTTTGCTACTATTCAAAGGCCTTAGGAAAGCAGACACTCAATTTATATTAGTGC
CCTCCAGCAAGTTACTTAATTTACTCTGTGTTAAAATAAAAGTTCTGGAGCATAAAAGAT
AGGAATTTGTGGTATCATTTTGCAAATGGCAAAGAAGTTTCGGTGAGCATTACATAAATA
AACATTTTTCTAAGATAGTTTTTATTGTAGAAGTGTATTCCCCTCTCCCTACTAAATCAG
CAAGGTAACGACTGGTTTTATTGTGTTTACTCACTAATATGTAATGAATAATGTCACATT
TTTTTTCATCACATCAAAGATTCCTGTAGGTATGGCAGTTATCTGTCTTCTAACCCTGGA
GCACTGACCTGTAACAATCCCTTTCAGGGACCAAAGTAGCTCAGGTGACACAGTAGTTAA
TGTTGGGCTTTTAAATCACAAGATTTGGATCCACCTGATGCTCCATGTGAAAAAGATGGA
CAGTTTTGGGAACCATAAGGAGCAGATCTACTTTAATCAACGGGGATTGATAGGAGTTTG
AATCAGCCGGGACCAAATACCCAATAAGCACAGGCTTACCTGGACTTGCTCACAAGTTGG
TAGTGAACAGTTTCATAGATTAATACATGAACAAGTACAAATAAACCTACACTTAGCTTG
CTTATTGGGTAATCTGCCATTGAAGTTAAGCTTATTACTTCAGTTTTAGCTTTGTCATTC
ATCAAAACAAATTATGGGAAAACAATCTCTTTACTGTCTAAACTGGTCTCGTATATATTA
CTTTCTTAAAATGTATGTTTTAAAATTACTAGCTGTTCGAATAACTAATAACAAAATGTC
AGTATGGCTTCCAATGGAATAATCTATCTGGGAAAACAGATTAACACCAGAAAATGGCAG
GGCAGATGTATTAGGTATTTTTTAAGGTATGCCTGCCAGACTGACTCATAAAGACTCTAT
AGGACAGAACAAATTGACCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNCCCCAATTTATTAAACGGAAAAGGGAAAATACAGTAAAACAT
TTTGGACGTTACAATGATCATTTATTATTATTATATTATTTATGGCATCTAGTTTACAGT
ATTACATATTTCACATACAGTATTATTATACATAGTTCTTACAAATACTGTAATCAATGG
CATGCAACCTCCACGATTTTCTTGCCATCTTTGATCATATCCAAAAGTTTTACCTTTTCC
TGGATGGTGAGCATCTTCCTCTGGCGCTTATTTTTATTGTCAGAAGGCTTAGAAGAAGCA
GCTCGTTTAGGAGCCATCATAGGGCTTAGATAAAATTTCTTAAAAATCGCAAACAATTAC
AGTACACTGTACAAAAGCAAAAATGCATCTGATACATACCTCCGATACGTAGCGATGCAG
ACAGAAGCGTGTACGTATGAGCCAATCAGTGGCAGTAATGACAGAACATGCGCTGTTACG
CAAAAACCGCGATAGAGCGAAGCCATGGAAGTCGAAGTGCGAAGTGGGGAGGGTTCACTG
TATAGATAAAATAACTACTAGCTAAAATATATTGAACTAAGTATTGTGCTGGGCATTTTA
AAGGGGCTCAATGTTATGGAATAGGTTTTGGAAACCATAAGGAGCAGAGCTTCTTATCTT
TCTGGGGTTGCTAAGAGTCTGAATCAGCTAGATGGCAGTGAGGACTGTTTGTTATCCTCC
TTTTACAGGTGTGAAACTGAGGCACCGACATTTTAGATAATTTGCCTGAGGTTACACAAG
TAGACATACAAGGCGCTTTATTCTTTAGTTTATGTTCGTAACTATGCTAGCTTTCAAAGG
GAGATTATAAAGATATAAGACTCAAGAAACTTAGCATCTAGCACTTGCGTTTGGCCCAGC
ACCCCCTTTTCAGAAAAGCAAAAATAAACTCTGTGACCGCCCCCAGCAATTTAAAACTTT
TGAACTGTAGTCCATAGTCCAGGATAAAAGTATAGGTATGTGCTTTTGCAGCTCCCCTTC
CCCCCACTGCATCTTTTGAGGAAACGCCCCCGGCCCCCCTTGCCTCAAGGGTAATATTGC
TTGCTTTGGGAAACACTGATGTAGCAAGACAAGCATTTCGAGGACAGGTCTCATTCGCTA
GCACATACACAACACACATATATCTGTAAGAATTCAGGAGTGGAGTGAGCACTCTACACT
GGGGTCATCAAACAACTTGACCCTGTACTGTCGTGTTTTTTACACATTTCCTGCCTATGA
ACTGTTTCTTCACTATTTATTTGTATTAAATGATTACTGTTCCTGGTGCTAGAGATGCTG
GATGCTAGAGATGCCCAAGGTTTTCTGCAAGTTCCCCTTCTCAATAGTCCAAGATACCAT
TTCAGTTCTGATGAAATCTTATTCTCATTTGTCGGAAGAGTGTGTCCATTTGCTTTAAGT
TCAGCCTATACCAAACATTAAACCCTCTCTTTACACCTTGTGACTTGTGACCAGAGGAAG
TGTTTTCCCACTTGTCATGATTATTTAGTATTGAGTTTGTCAGTTCCAGAGATTGTTAGC
GTCAGGTGCTGTTGAGTCAGTTCTGACTCATAGTAATCTTATGAATAACAGAATGAAACT
GCTGTCCTGAGCAGACATGGGATATAGTCTTTTTTCCATTTACCTTTTGACCTACAGGTA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTTGTTAGGTTAATATGATGGAAAACTGTCCAAATGGCA
AGAACGCTGTAGTCAGAACTTGCTGTCGCCGCCAATGTGGAACTGCTCATCGATCATGAA
GAAGGGGAATTGACAGGTCAAGACCTAATAGATTTTGAAGAAGAAAGAAATGGTGAAGAG
GAAAGAAATAATGAGAAAGAAAACAGAAATTGTAAAAAGAGAGTACAGTAAAATTTCCCA
GTTAAACCAAGGACTTCAGTTCCTAAAAACATGAACCTCAATGTTGATTGTTTTACTAAA
ATCAATAGGCAGGTTTGGGAAGCAGTGCAGTGTTACCACAAAATATATGAAGGAAAAGAT
GATACAGACAAGTCTTAATTTTCTGAACGGAAACATCCTCACAATTTCCAGGAAATACAG
ATGATCCAGAACGTTCCACAAATGGAGTTATTACCATGGCTGACAAAATGCCAACATTAT
TGTACTCTTCTGTATCACCCGAGTCAATTTTGATGATCTGCATATTTTTATAATACATAT
ATTAACATATAGTTATACATTTACTTGTAATGTTTTTAAGCCCTAAAGGCAAAATTTTTG
ATTTATAAAGATATTGATAAAAGACTATTAATGAAACCTATTTTTAAAATTAATTCAATT
TTCAGTAACAGTAGTATCAGTGAGAATGTAGAGAAATTGGAATCCTTACACACTGTTGAG
ACTAAAATGGTGCAGCAACTTTGAAAAACAGTTTTTGACAGTTCCTCAAAAAGTGAGAGC
CCCTGGGTAGATATCCAAGAGATGGGAAAACATCTCCACATAACAACTTTACATGGATAT
TCATAGCAACATTATTTATAAAACTGAAAAGTAGAAACAAAGTGCTCAACTGATGAATGG
GGAAACAGAAGAGAGTCTTATAATTTAACAATGTAAATTACTGTTTGGTAATAAAAAGGA
ATGAAGTTCTGGTACATATTACAACAGGTGAATTTTGTAAACATTAGTTAAAGAAGCCAA
ATAATATATGATTCCATTTATATGAAATGTCTAAAATAGGCAGTTCTGTATTAGCTTAGT
GGTTGCCAGAGTCCTGGGGGAGGGGAGGAGATGAGAAGGGACATGATTGCTAACAGGTAT
AGGGAAAATAGTGATGAAAATGTTCTAGAATGAAATAGTGGGACTGTTGTAAATATATAC
CCAAACCCATTGGATCATATCAAATGCTTGAATGGATTTTTATGGTACATGAATCATGTT
TCAATTTAAAAAAGAAAATCTCTTCTGAAAGCTAGTTGTTTTCTATCCTCTGATGAATTG
TATTAATTAAATAAAGCTAAAGAGAAATCTTTACAATTCCAGGTATTGTTACTATGCGGT
CCAATTTTTTTTAAGATACCTCTACTTGTTTAAAATGAAATAATGAATCTGTCTGGCTAT
TAAAATTGTGTGTTGGGATGTCACATGTTGAGTGGTGGGAGAGATGGGTTGTATCCTCAA
ATCTCTAGTATTACCACGGGCAATTCCCTGTAGGACTATGGGCATGACAAGGATTTCAAT
TGAGTCCTCAGTGTGTATGCATCTACTCATAACCCACCCATTAAGAAGCATATCATATAG
ACATTTTAATTAATGACTGTATAGACATTGTGTTCCCATAGTTGCAGAAATACTTTATTA
TTATTATTAAATGGCTCTGAAATGTGCTTATAGTAATTTTTTTGTGTGTACAGTAATTTT
ATGAATGGGGAAACAAAAGAAAGTCTTATAATTTAACAATGTAAATTACTGTTTGGTAAT
AAAAAGAAACGAAGTTCTGGTACATATTACAACAGGTGAATTTTGTAAACATTAGTTAAA
GAAGCCAAATATTATATGATTCCATTTATATGAAATATCTAATATAGGCAGTTCCATATT
AGCTTAGTGGTTGCCAGAGTCCTGGGGGAGGGAAGTAAAATTCAAAATTTTAATTTTGAA
TACCTGTACTAACAATTGTTAGAAAGGGACAGAAAAATTAATTTCAAAATTTTGCCAAGT
TTAATCTGATTATACTTGTTTCTGGGGTTAATGAATACCTACCACATTAAAAAATTATAT
CTTCCTATATACATGTGCTTCTATAAGGAGTCCTGCCGACACAGTAATTCAGCATTCAGC
TTCTAACAGAAAGGTCAGCATTCAAACCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNCAACAGAATTGCTGAGTCAGAATTGACGTAGCAATATGGAATGAGGCTT
AAACATTTTTTTGTATTGACATTTAGATTATGATTTGAATAGATGTGAATGCCAGTAAAT
CTCCTGGCTTACTAAGATTTTTTGTGTCCTGTGTTCTAAGTATAGATATCCAAAGGGAAG
AAGAAAAAGTAAAACGATCTGTGAAAGATGCTGCCAAGAAGGGCCAGAAGGATGTCTGTG
TGGTTCTGGCCAAGGAGATGATCAGGTCAAGAAAGGCCGTGAGCAAGCTCTATGCATCGA
AAGCCCACATGAACTCCGTGCTCATGGGAATGAAGAACCAGCTTGGTAAGGTGATAGTCT
CTGTGCAGCCACCTTGGCAACAGTCATGCTCTTGCTGTTTTTTATCAACACTGGATTCTG
AATAGGAAAAGCAGACGCAAATCTATTCTTTATATTGTCTTAATTGAGTTATTATACAAA
TGAAACTATTATTTTTAAGCAATCATGCTTCATTTATTCCTTCAACATCTTATATTCACT
GATTAAATCTGCTCTGTTCCACAGAAGTCATGTGTCTACATTATACATTATCATGTTTTT
TTTTTTGCCAGTGTTTTTGAGATAATGGTAAAACTGACATTTAACTCTGTGTTGTTTAGT
ATTTGGAATATATTTCCTCATGTGAACAATATTATGTTACTGACCTGATAGTTGAGTGTT
AGGAGTAAAAAGCTGGCCTATGTGTTAGAGGGAGAGTGAAAAATTCCCTCCCTCCATCAT
AGTCCCAGAGTAGCCATAGGAAAAATTTAAAGTAGCTTAAATTTGACTTTGACTTTGTCA
TCTCCTTTTATATCTCATCTCTATCTCCATACTACTTCCTCCCATCTTAGGAGTCAGCAG
ACTGCCATGAGTGTTCAACATGCATATGAAGTGCCATTTTTAGATAATTTTTTTCACTCG
TGTTTAAAATGAAAACATAATTTCGTTTCCTTTCGTGTCCAGTACCATACTGTTTGCAGT
CTTTTGCTGGCATCTGTCTACAAGCCACGGAGTCTTAGTGGTGTAGTGGGTTACTCGTTG
GGCTGTTAATTGCAGGGTCAGTAATTCCACAGGGGCCGTTCTGCCCTGTCCTGTAGGGTA
GTTATTAATTGGAATAGACTGGATGGCAGTGAGTTTTTTGAGTATTTGAGCTTTGAATCT
TCAGATCAGTGACAACTTGACCCATAGGCTCATATTACATCCCTTTGGTTTCTTTTCTTA
CTTCTATTAAATTAGAAAATTACTGTCAGATACTTAGCTTGAATATTGATTTAAATGGTA
GAGAAATATTTCACTAAAGGATATTTTTATCTCTCCGTTAGCTACTAAGTCGATGAATAT
ATCACACTCAGAAGTTAGAGTGAATGCTTCATTTTAAAGGGCGGGACCAAGTGAGCAAGT
GGTTGTTTTGGGCTGTGGAGGTTCATTTTTAACATTCAGATATGGTTTTTAAATATGCCT
GATAGGTATTGTCATCAATTTCTTTCTTCAAAAACTAAAGAAAAAAATGGGTAGAAGGAG
AGTGTAAAATAAACATCAAAATCATGGTATCCCATCGTCTTAAAAAGAATGTCAGGATTA
GATGAGCTTCATTTAAAAATATTGTTTTCTGTCCTAAAGTTGTGTATTTAGGCTCTTCAG
AATCCTAGCTGTCTCACAAAGATTCTCCTTTTGAATAAGCCATGCATTCAGTGCTATGAA
GGAATACTTAAATTTTGTCAGTTGAAAGCACTAGTAAATGAGCCTTTTTGCAGATAGTTT
TGAAAGTTTCGTGTTTGTACCTATTGTGTGTGTGTGTGTGCGTGTGCGCGCGCGCAGCAT
GCTGTAGGTTGTATGTTCTGTTGATCAGGACAAGATTCTCTAATTTTTTTTCTCGCTCTA
CTGAATCAAAATCAGAAACCATTTTGCATATTCTGTCTCACCCCCACCCCATGAACAAGG
TAATTTATTACTTGACTGTGGTTGCTCCTGGGTTTCCAATTGATGTATGAACAGGTTTGT
TCCAAACAAATTGTGTTTAAACTTATGTGTGCAAGTGGATGGTGACAGAGAAATTCTTTC
AGTTATATACTTAGTCTCATAAAGATAGCTTCCCCAAAAAAGGACACTAATTTTAAAAGC
ATTGCTGGAAAGATCAGCTGAAAAACAGTCTCTGTATTTGCATCTTTCAGAGTTGCAGGA
GGAAAAAAGCTGCACCAGAGAAAGGAAAGAACTCTTGCTACAAAATCATAGAAACTGTTA
TTACACAAAAAATCTCCATTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAGTTGTATTTGGTAATATACTGCACAGATCTCTTTAGAATATTGAAAAACAAGGATG
TTACTTTGAGGACATTGGTTTGCCTGGCTCAAACCATGGTGTTTTCAGTTGCCTCATATG
CATGTGAAAGTTGAATACTGAATAAAGAAAACCAAGATGCATTTGAATTATGGTGCTAGA
GAAGAATATTGAAAGTACCACAGATGGCTAAAAGGGCAAAGTGCCTGGCCATCAGAAAGA
ATAGTGTCTGGAGTCTTACAGGTTTGTCTTAAAACTGTCAGCTAAGTCCACATGGAAGGG
AGATCACCAGCTCATGTGATCTAAGGATTGTAAAATACCGAATTCAAGATCAGAGGAGGG
AACTGTATTAGAGCTTAAATTCTCAGCACCCTGTTTGCACAAGGCTATGGATGACAGTAG
GAACCCTGGTGGTGTAGGTGGTAAGCCTTGGTCCACAATCTGCAAAATCTGCAGTTCAAA
ATTACCAGCAGCCCCATAGGAGAAAGGGCCTTCTACTCTCATTAACAATTACAGTCTCTG
AAACTCCTAGGGCAGTGGTTCTCAACCTTCCTGATGCTGTGATCCTTTAATACACGACCC
TTTCATACAGTTCCTCATGTGGTGGTGACCCCCCCAACCATACAATTATTTTCTTTGCTA
CTTCATAACTGTCATTTTGCAACTGTGATGAATCAGGCAAACCCCTATGAAAGGGTCGTT
CGACCCCCAAAGGGGTCTCAACCTACAGGTTGAGAACCACTGTCATAGGGCAGTTCTACT
CTGTGCTAAAGGATCGCTCTTAGTCAGCATTGACTCTGACCAGTGAGTTTTTTTCAGTTA
TGATGACAGTGAAAGCTCCAAAATGTATTTTCAGATTCCCCATTGGATTAAGCTTCCAAA
GAATTCCCTCAGACCACGCTCTAGGGACATGAATGAATAGTCTTGCCCTCAGACGAGAGT
GCAGTGCAGAGTGAATGACCTCAGATAAAAATTAGGTTAAAATTTAACATTATTTATTTT
CCTTTTTGACTCATTTTTAATTTGTTCTTGTTCTATTCTGCTTTTTCTTGGATTGAGAGT
TTTCTGTGTTATACTTTGTTATTTTTTTTTGGTATGATTTAAAGTTTTCTTTTAATTTTA
GGATTGTTAGCATGTCTTTAAAATTTTTTTAGTTTGAAAATCTTTTTTATTTTATTGGTA
CTTCATCCACATATTATACAATTCAATTGTTCAGTCATATCAAGAAGAATTTTACAATCA
TTACCACAATTTTAGAATATTTCTTCTTTTTACTCACTATTAGTGTAATTTTTTAAAATT
GTGACAAAAATAAACAGCAATACATGGCCCAATTCGACATGTATAATTCGGTGCCATTGA
TTATACTCTGTTATGCATGTATGATTTTCTTTATATGAAATCCAGGATAGGTAAATCTAT
GGAGACAGTAACTAGATTAATAGTTTCTTAGTGTTATGGCAGGGGAGGTTGCGGGATAAT
GGGGAATAATAATGAAGAAAATATTCTAAAATTTGTGATGATTTCACAACTCTTTTACTA
TATTTCAACCATTGAATTGTATGGTATGTGAGTTATATGTCAATAAAACTGCTTTAAAAA
ATAAAAGTAATGGGTAGAAAGAAAGGGGGAAAATAAACCAGCTATATGAATAATTGTAGA
ACTTCCATGCATGTGTTGTAAAAGTTCTTAAAGAGGGCATATTTTAATATTCCTTCTATT
AAAAGTCAGGGAAGGAATTGATGTTGGAATCTAGCAGTAGAAAAAAAATTTTCCCAGTGA
AAAATAGCATAGTGTTTCTAGTGAGTCTCCTACAACCCAACACATTACCCTCTCTCCTTT
TGCTGTTCAGATGGTCAAAGCTAAATTTAAGCTCTAGGTCAGAGGTTCCCAGCAGGGCAC
AGTTTCACCTCTCAGGGAACAGTTAGGTGTTCCAAGACACTTTGGATTGTCACAATTGAG
GACGAAGAAAGTTGCTACTGACACCTAGTGGGTAGAAGTCAGGAATGGTGCTAAACTTCC
AAAATGTTCACTGCAATGGACTTATCTGGCCGAAATGTCTACATAGCTGCTGTTCAGAAA
GTCTACCTGAGATCTGTGGGATAAGGTCACCCTTTTGAGCTTTTGTATTTATTGTATTAT
TACCTACTATACTTGTCTTTTGAATAAACCACTTGAAATCACCTTTACTAGTAGTAGTGT
ATAAACTGTAAGCTTGACCTTACATTTGGGGAGTTGTCTAAATGTACACGAGCATAGTAT
TTTTTCTTTGTCTGCATGGGTACGGCACCCAATTGTGCCGTTGACTTTGATACTTGCATG
TAAGAGCTTTGTAATATCTTCATTTGTCTTTGGGTTCTTTGTCACTTATTCTGTGTTAGA
TGTTTCTTCTTAACTCATCTGTTTACCCATTTCTTCTCTTAACCTTGTTAAAAAGAAAAT
CATTATCTATTCTCTTAAAAGAAGTTTACCTTTGAAGCTTGAGTTTTGTTTTTCTTATAT
CATTTTATTGGGGGCTCATACAACCCTTTCACAATCCATACATCCATCCATTTTGTAAAG
CACATTTGTGTATTCGTTACCCTCATCATTCTCAAAACATTTGCTCTCCACATAAGCCCC
TGGTGTCAGCTCCTCATTTTTTCCCCTCCCTTTTCGCTACCCCTTCCCTCATGAACCCTT
GATAATTTAGAAATTATTATTTTGTTATATCTAACACTGTCCACCTTTCCACCCCACCCT
ACCTCCACAAGGCTTGGGTTTTTTAATATTACTATTCTGAATTTTCATTTGTAATTATTG
TGAAATATCATGATAAAATGCCATATTTTCTTTTGTTGTTTCAGATAATTTTTTAGATGT
TAACTGTTTACCGACATATAATTCACATACCATACAATTAAAATTGTTTAAACATATTAA
AGAGTTGTGCTGACTTACTGTTCTGTAATTTATCTCTAGTTTCTAATACCCATTGCAGGG
GCTCTGCAAAACTGACAAAATTCATGATTAAAGGGTTATAAGGCAATTAATGAGTTTTAT
GCAAGCGATAAATGCTCAGGTTAGTTGTTTACCAGGACATATTATAAAAATCTTTCAAGT
CTGCTAATAAATACCCAAAGCGGCATATGACTTGCTGTAAGCCTCAACTCCAATGCATGC
AGTTCAAGCTTTGTGGGTCAGTAAACCAAGCTTTCTGAATTAAGTGCCCAGAAGTACCCC
ACTCCAGTAAGCCTCAGCTGGAAGGCATTGAGCTCCATTTCCATGGTTCAGCAAGCCCAG
TTCAATGCCTAGAGTCACCCCACTCCACAAGCCAGCCTCCCACACAGGAGCACTTAACTT
ACTCCATGGGTTGGGAAGTCCATGCTTTGGTTCCTAGTTCTACTCCTCCTCCTCTGATGG
TATAACTGTCATTTGGATCCAGGGAGGGTCACTGTACAGGGATTTCAGGTCCAGAGGACA
TGTTCCACTCCTGGCTCTTGCTAGTAATGAGATTTCTCATGTTTCTCAGAGAGCTGGTTT
TATATACAGCAGGATGGCATTGCAGGGAATGCTGTTTGCTGTCACTCACAGGCAAATCCT
ATCAGCATTTCCCCCACCATTTCAGACCCATGCTTGGAAAGGTGGTTTGGTGAGAGAAAC
TGTGGCTAGAGGAGCCACATGAAATCACCCAGTGCCCCAGCAGTCCCCACAATGTGGGAG
CCTTTTCTTCATTATTAGTAGCTCCCTACTTCCCACCTCTCCCCTACCACAAGCCCTAGA
AACTGTTAATTTACTGTCTCTAGATTTGCCTATCCTAGATTGCATGTAAAGAAAAACAAA
AAAATAAGCACCCCAATAACAGCAACAAAAAAAGCCTCAATTCAAAGCTAAAGCAGAAAA
TAATTAAAACTAGAACAAATTTAAAGTGGGCCAAAGGAGAGAATAAATAATGTGTTAAAT
TTTAAATTAACTATATCTATATTAATCTACTTTCAGTGCACCTGGTAGCAAAGCTGTTCA
TGTCCTTGGTCTGTGGTCAGAGGGGATTCTCACGTGGGTGACCTTGCAAATGGATTTGGG
GCTTTTACTGTTAGAATTTAATCTCTAATACAGTTTCTTCCTCCAGTGTTGGAAGAAGAA
TCCTTGGATTATTTACAATTTTTGGATCACACAGGCTGGTATGCTTCTACCATGTGGATT
TAGTTGACACCATACTTTCTTGTAATTTTATTCATTCTATTTGTAATAGCCATTTTTAAA
TTGAAGATTGGCAAGAAAGAGTTGGGGGGGGGGCAACTTACATTATTACCATCATTTTAA
AATATAGAGTTATTTGGTCTTTCTAGGTGGTATAATTAATATAGTAGATTTTGATTTCTC
TGTTTTAAATGTACTGTTTAATTTTTGTTCTTGTTAATTAAACTGGTAAATCAAGTATCT
CTCAAGTAATTTCATTTTTACTCTTCTACCTTGAAACATGATATCATTAGAAATTTATTT
TAAATGTTTATGTAATATTATTAATATTTTATGAGCATATGAAGATACTCGACATTGTAC
GTCCTTAGGGAATTGTGTATTACAACACCAATGCAATACCAGCTCACGTGTGAGAATAGC
TAGCTAGCATTCAAACCCCGTCAACACCCAGTGCTGGTAAGAGCAAGGAGCAGCAGCCAC
CCTCACCCATTGCTGGTGGGAATATATATCAGCTCTGCTGCTTTGGAATAGCTTGGTAGT
GACTTCTTAGCATGTGACCCAGCAATCATACTTCTAGATGTGTACCCAAGTAAGTGGAAA
ATAAATATATGTCTATATAGAAACCTAGATGCAGGTTATTTTGTGTTAGGCCAGTTGACT
AGAGAAACAAATCCAGAGACACTCATATGTATAAGAAAGAGCTTTATGAAGGGATCAGGT
GTAAGGCATCATCAGAACAAAAAATCTTACCATAGTGAATGATGGGGGGAGTGCGGAGTG
GAGATCCAAAGCCCATTAGTAGGCCACTGGAGACCCCCTTGCAGAGGGGTCTCGGGGAGG
AGATGAGCCAGTCAGGGTGCGATGTAACAATGATGAGAAATACAACTTTCCTCTAGTTCC
TAAATGTTTCCTCCCCGCTCCCACTACCATGACTTGAATTCGATCTTGCAAGTCTGGCTA
GACCAGAGGAGGTACACTGGTACAGATAGGAACTGAAAATACAGGGAATCCAGGACGGAT
GAGCCCTATAGGACCAGTGGTGTGAGTGGCAAAACAGGGAGGGTAAAGGGAGAATGGGTA
GGAAAGAGGGAACCGATTACATGGAACTGTGTGTGACCTCCTCCCTGGGGGACAGACAAC
CGAAAAGTGGATGAAGGGAGACGTCGGACAGGGCAAGATATGACAAAATACCCATTTATA
AACTGTCAAGGGCTCATGAGGGAGAGGGGAGCGGGGAGGGAGGGGAAAATGAGGACCTAA
TGTCGGGGGTATAAATGGAGAGAAAATGTTTTGAGAAACAGTGTACAAATGCGCTTTACA
CAATTGATGTGTATATGGATTACGATAACAGTTGTATGAGCCCCTAATAAAATGTTTAAA
AAAAAAAATTTAAACCCCCCCTCCAAAAAAAAGAAAGAGTTTTATATCAGAGTAATTATT
AGAAAACATCCCAGCCCAGTCCAGATCTAGTCCATAATTCCAATAAATTCCTTTCCAGAC
TCATGTAGCACATGCAATGACGCAAAATGCAGGAAAATAACAGGCCAAGTGGATGCAGAG
TCTTGTGGATCCAGTGGTGGTGGAAGCATCTCCAAGGCTCTAGCAGGTCTCAGTGCGGCA
AGTGACTGAACAGCAGGAAGGTGAAACAGAAAGAGGCTCTCAGGGCTCAGCAAGTCTCCG
TGTTGTGTGGCTTGTCAACAAGAAGACAAGGCAGAGAGAGAGGAGTTCCCAGAATCCTCA
TGAGAAGGCCATGTCCACAAGGAGGCATCATCGAGCTGTGACCTGCTAGACTTCCCCCTT
CTCTCTTAATATTATGTAAATGCCACATGTTTTAGTCACAATTACCAAAAATTAGAAGCC
ACCCAAATGTCCTTCAACATATGAATGGGTAAGCAAACTGTGGTACATCCATACAACAGA
GCATGCAGCCATAAAGTAAAAGAATTATCAAACTATGAAATGACAGAGGAACTTTAAATA
CATACTACTGAATAAAAGAAGCCTGTTTGAAAAAGCTACACAATTGTCCATTTGAACTAT
GTGACATTCTGAAAAAAGACAAAAGGACAGAGATGCTAAAAAGACCAGTGGTTACCAGTG
GTCCACAGGGAGGGTGGAATAGGTGGAGCACAGGGCGTTTCTTAGGGCAGTGAAACTTTC
TCTGTGGGACACATGGCATGCGTTTGTCAAAAATCCATAGTGCTGTACAACATAAAGAGC
AAGTGAATCCTAATGTAAACCCTGGAGTTCAGTGAATAATACTGTATCTATTATTATTCC
GTCTGTTTTAATTGGTGATTAGCAACAAATGGCCATCCTTAGTCTTTAAGTAGCACAAAA
TTTATTTTCTTAGTGTTTATGGAGCCTAGAAGTCCAAATTCAAGGTGTGGCTCAAGAGCA
TACGTTCTCAAACTTATTTGACCTATTGCCCTCTTTTCAGAAACAAAACAAACAAAAAAA
AGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAATGAAAACTTTTG
TAGTATAGCCTGTATCCAGGATAAACTATAAGTACCTGCTCATGCAACCCCCTGGATCAT
TCTAAGGAGCTGTGGTGGCATAGTGAACATGTTGGGCCGCAATCCACAAGGTAGGTGGTT
CAAAACCATCAGCAGCTCCTCGGGTGAAAGATGGGACTTTCTACTCCCGTAAACAGTTAC
AGTCTTGGAAACTCACAGGGACAGTTCTACCTTGTCCTATAGGGCAGCTGTGAGTCAACA
TTGACTCGATGGCAGTGAGTTTGGATCATTGAAACACCCCCCAGGGAGTGGTGTTGCCCA
CTTGGGGAAACACTACTGTAAAGAGGAGGCCCTTTGTCTAATTCAGCTTCTGGAAGTTGC
AGTCCCTGAAGTTCCTAATAGATGAATCTGACCTCTGTGTGTGTCTGCCTTTTTTTGGTC
TTGTTCTTTTTATAACTCAGAAACCATTAAGTGTAGGACTCACTCCACTCTGGTACAGCC
TCATTAAATGGCAAAAGAAAAACCTTAATCCAAACACTTTTCAATAATTTTAGCACATTT
TTTTTTGGATGGGTCCATAACACACTAGTACAAGAAGTCAATAGCTGGGGGTGGGGTGGA
GGGAGCCTCTGTGCAGGATTATATGGAAACATGGCACCTGCTGCCTACATTTTCTGTAAA
TGTAAAACCACTCTAAAAGACAAAGTCGATTTAGAATTATTTAGAAAATTTTTTGTTATA
TCAAAAGCATATATTTCATACTTGATAGTGTTACATTTTGGTAAGGACTGTTTTTAATTA
TTAAATCATTGTATCTGCCACACACTGCTGTTTTCCTTGTGGAAAAGTGGAAATTACTTT
GTACTGCAGTCCTTTGCTTTCCTCGCTGTCTGCTTTTCCTACCTTTCTCTTCTGTATTTA
ACTTCCAGTCACACTGCTTTTTCACTTGCTGGAGACACCACACTGTTAGCATCCNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNTAAAGTTTATATAGCAAAAAGGAATATAGCAGC
AAATTAGTACAGCAAGCTCAGTCCAATTCACTTTTGTGGGACAATTATTATACTGAAGGT
CCTTCCAACTCATGAGGCCAAGGAAGCAGACAGTAGGAAGATGAAGTGGTGAGGGGTAGC
AGAGGCCAGCAGCGCAGTGTAGCAGAGCAGGTCACTGTAGCAGATCCCTCACTGTGTAGG
GATGCGAAATGGCTGGTGGGCGCTGCAGTGTCAGGAGTGGTGGCAAGATGAACCGAGTTG
CCCTCAGGCAGCAGACACAGCATGTGGGGCCATGCCACAGTGTGGAACAGCATGGTACAG
TAGCACAGCACACGTGAGGCAGGGCAGCTAAGTCAGGCAGCATGCTGGTCCAACTACCGG
GGAGAAAAAGGGGGGGCAGCTTCCAGCGAGCCATTATCTTGGTCACACCTCCAAAGGAGG
TCATCAAGCTGCAACCTGATTGACAGGCTAAACTCCACGCATATCTTCTTACAGGTGCCA
TGTTTGCACAAAGAAACCTATCACTTAATGAACTTAACATTTTGGAATTTCTTGTTCTTT
CATAACTACATATATAATTCATTATTTATTTTAACCATACAGAGCCTTGAAACTTCCCAG
TAACCCTGCTGATCTTAATAAATAGGCATTTGGCTTTCTCACTTCACGGTTCAGAGAACT
GAAGTCTTCCCCTCAATGGGCCAGCCTCCTCAATCTGCAGAACAGTCATGAGATGCTGTA
TATGGGGCACATCTCCCTGGTCATTCCTGTTTCTGTGCTGCTGGTTCAACCACAGATGTG
AAACCTTCTGAGATTTCTGCCTTCAGATGGAGGGAAAACTTGTTGTCTGTTTGCCCGTTT
TGGTTAACAGCCGTGAACAGCAGAACAGTTCTTCCAGTCTCATGAAGTTTCCCAACAGAT
TTGGAGGGTCACCAGCTCTTTATTGTGGCATGTTAAAGACATCAAACAAAAACTCCCTGT
CTTTGAGTTGGTTCTGACTCATAGCGATCCTATAGGACAGGGTAGAACCGCTGCTTTGGT
TTTCCCACACTGAACCTCTTTATGGGAGCAGGTAGCTTCCTCTTTCTCCTGCAGAGGAGC
TGGCGAATTTGAACTACTGACCTTGAAATTAGTCACTCAACTTAATAACCCACTGTACAA
CTAGGCTTATTAGCGATATTAGGGGTGAAAATATCAGCTGCCCCCATGGCGTCATCTAAA
AAACAGCCTTAGACTGTAATCTCTCCCTGGCCACACAGACAGACATACAGACTCACTCTC
GCAGATCCTGATTTCTCTCATTTTGCTGAGGCCTGGCACTCTCCACAAGCTGGCGTACAG
GACCAGAACTTGGGTAGCCCAAAAGCTGCCTTTTTTCTGACAAGGTCTAGAGCTATCACT
TCCATTTGTGACTTGTCCTGGGTCACAGCTATTCAAAGCTTGCCTTCAGGCTATGCCTAT
TAGTATATGCTCTCATGATTTAGAAAGTTCAGTCTCTTGGTCCACTAGCACAGCAACGTA
TTCGAAAAGTACAGAAATAACTTACGGAACCCTTACCCCGCCCTCCTCTTATTGGAATGA
GTCATCATTGGGCTGTCTATCTCCCTACTCCACCTGCGTTACTCTGTCATACAATCTCGG
TGTCACCTTTTTCTCCTTTCAGCCGTGCTGCGAGTGGCTGGCTCCCTGCAGAAGAGCACC
GAAGTGATGAAAGCCATGCAGAGTCTCGTGAAGATCCCAGAAATCCAGGCCACCATGCGG
GAGCTGTCCAAAGAGATGATGAAGGTGACCTGGGGCTAGCCCTGCTTCCTCTTTCAAACT
GTAGGCACTTAGGACATGCCTGAAGGGTAAGGATGGATGGGAGTGGACAGACTACTGCTG
CTGGAACTGTTCTGAGGACAGAGGAGCAGCAGTGAATACTGTTCAGAACCTCTTAGGCCA
AGCTTGGTAGACGCTGAGTCAGGTTGCCAGATGCACCTTAGGAGAAGCAAGAAAAATATC
TCCCAAGCTTCAGGGGAGGTGGGGGATTCAGGGAGCAGTCTTGGGTTCTAGGAAGGTAGA
GTTTGTAGACTCCAGCCTGAGCACAGAGACGGAATGACACCTGGCTCCGTGGGCTGTTCC
AGGGGTCGCAGTCAAGCTGTCCAAGGAAGCTTTTCTAAACTTAAGCCAGGTAAACATTTC
CTGCAAAGGGCTAAATAATGCATATGTTTTATGCTTTGTGTCTCTCTGCTGTTAATTACT
TTATAGTTTGAAAGCAGCAATCAATAATTGGTAAATATGAATATGGCAGTGTTCTAGTAA
AACTGTTTTAAAACTAGGCCTCAGACTGAATTTGGCCCACAGGTCATAGTTGGCTGGATA
TTCCCAAGCATTCCCCCCCCCCCCCCCCAAAGACTCGTAGGAGGAGTTGGTTAACCACTC
AGCTGCTAACCAGAAGACTGATGGCTTGAACCTCTCAGCTGCTCCACAGGGGAAAGATTT
AGGAGTCTAGTTCCATCAAGATTTATAGCCTTGGAAACCCCATGGTGCGGTTCTACTGTG
CCCTGCAGCATTCATCTGAGTTGTTTGGGTCTAGAACTAAAAAAAGAGAGACTAAGAACA
AGATTCACCACTTGTCAGTCAGTCAGTTTGTTGTCCCGTGGCAGCCTGCTTCTTTCTGTG
ATGCTGGCAGCTCTGTCACTGGTACTTCAAATACAGCGGGCCACCCAAAGAACAGGTTTC
AGCGGAGCTTTCAGATTAAGAACAGACTATGAAGATGGAACATGCTGTCCACTTCTGAGG
GTTTAGCCACTGAAAGCCGTAGGAATAGCAGCAGAACGTTGTCAAATATGTTGTTGGAAT
ACGAACCCTTCAGGTTGGAAGTCACTCAAAATGAGTAAGGAAGACGTATCTTCTCAATGT
AGAGTCAAGCATGATGACATGGATGCAGGAAAGCTTTCGGGACCTTCATTTGCAGGTGGG
ACATAACTCAAAATGAAGAGAAACAGCTGCAAACATCCATTGATCATTGAAACTTGTATG
AAGTATGAATCTAGGAAAGTTGGAAGTAATTAAAAATGAAATGGAATGTACAAAGTTCAA
TATGCCAGGCTTTAATGAACTGAAATGGATGGGTACCAGCATTTTTGAATCAGATAATCA
TGGTTTAATGTACTGGTAATGACAAATCCAAGAATGCTGTCACTTTTATCATCAACAAGA
ACATTTCAAGATATATCTTGAGCTCTAAGCTGTCGGTGATAATATGTATGTGCATATAAG
GAAATCTAGTCAATACAGATGTGTTAGACAGGGTTCTCTAGAGAGATAAAACCAAATTGC
TGATAATTTAATATATTTATTTATAAAGATAATTAGATATATAACACAAGAAATGAACTG
TTAAATTATATACAGATAGATATATAATACAAGAAATGAACAATTAAATTATAAAGCACT
ACAAATGGCTCAATTCAACTCACTCCTGTGAGAGAGTTGTGAGACACTAGCAGTTCTTCA
AGTCTAGTCTGCTGCCAGGTCTTCCTCTATATAAAGAGCGAGCTAGGCTATGTCAGCACA
GCAGCCAATCACAAGGCAGGTCACCAACCGCCAGTCCCCAGCTCCAGAGAAGTCTTAAAG
GGACCTCAACTTATAGCAACACAGGTCACAGGCTAGGCGTCCCACAGGTAGTGTAGCCTG
TAAATTGAGGCACAGAACAAGCAAGGAAGTCGCACACTCGTCCGATGATCAAAGAGCGAG
AGACAAGAAAGGCAAGGCTCACCCTGCCATTTATCTCTCCACCCTTCAGTTAATCCCACT
TGTGTTTATCGGCCAGGCTGGCACAATAAACTATCTCAACAACTATTACTCTCATTTATG
CACCAACCACTAAATTTAGTGATGAGGAAACTGAAGAGTTCTACCAACTTCTTCAATCTG
AAAGTGATCTAACATGCATTCAAGATGCATTGGCAATTATTGTTGATTAGAATGCAAATG
TTGGAAATAGACTGTGGAGGTTTCTAAAGGGGAGAGGGCAGAGGTGGGAACACATACCAA
CAGACTAGAAGGTTGAGAGGTATAGGCTTGATTGTAAAAGAGAACAGAGGTCCGTAGGAG
GGAAAAGAGAAACCGGGCCATAGAGATAGGCTAGAATTCAGGGGTGGTGAATGTTGATGA
GTGGTTTGATGGCTAAATGTAGAGTTAATAGTCTGAACTGTAACCCCCAAACCTAATTCA
TAAGAATAATAAAAAGTTGAAAGCAAGAGGAAGGAACAGCAGTTGGAAAACACAAGGGGT
ATCCCGCTCAAAAAAAACAGAAAAAAGCTCCACTGGGCAGAACTTTCATAATAGGCATTT
TCCCCTAGGTTAGCATTGAACAACTCGCTCTGAGTTGGTGTACCCAGTGGTGTCGCCTGG
GAAGGTTTTCTGGTCACATGAATTTTTTCATAAGAGCATTTTCGCTTGAACCTTGTTTTT
TTGTGATGGCCAATTTAAGAGAACAGCGTGCAACTGTGAAATTTTATTTCCTGCTGTGGA
AAAATGCTGCAAAAACTGTTGTGATGTTGAACACAGCTTACAAGGACAGTGCTATGGGAA
AAACTCAAGTGAACGAGTGCTTTTCTCGTTTCAAAAACGGTGAAATGTCGATTGATGACA
AACCTCGTTCTGGACGTCCGTCAACTTCCCAAATGGTCAAAAATGTTGACTCGTAGTACA
TTTGGAGTTTGTTCCACCAGGTCAGACTTCATCAAGATTTCTATTTAGAGGTTCTGAAAA
GACGGTGTAACAGTCTGAGACAGAAAAGGCCTGGTTTGTGGCAGACGGGACTGGTTTTGC
CATCATGACAGTGCACCAGCTCACGCAGCCGTCTCAGTGGGCTAGGTGAGTAAGGAGCAT
GCCTCTCTTGCCACCTGACCTCGCTCCACGGGACTTTCTGTTTCTGCGAATGAAGAGGGA
CATGAAAGGACAGTTATTTGACAATGTAGAAGAGGAAGGAAAAAATGAGAGAGGTGCTGT
CAGTCATTCAAACAGATGAGTTTGAAAAATGTTTCCAAGAATAGAATTGCAGATTTGACA
AATGTATTAAGTGTAATGTAGAGTCCTTTGAAGGTGATAAGGTTGTTTTGTAAAAAAAAT
TTAAATTCATAGCTTTGAAAAAATAAATTCCGGGGTTTTTTTTGATACCCCCTCTTATGT
CCTTGGTGATAGAAATGAAGTTGGAGATTGCATGATAGAATATGGCAAGACCAACAAGGT
GTTTTTTTCAGCAACATAAACAGCAACTATAGGTTTAGACTTCTCCAGGTGGCATACACA
GAAATCAAATTCACCACATCTGTGGGAAGAGATGATGAAGAAGCTCAGTATGAGCAGCTA
AAATGAGGCGAGGGACTGGCTGAGGAACACAGATCATCATTTGCTCATATGCAAGTTCAG
GTTTAGGTTGAAGAAAATTAAAACAAGTCCACAAGAGAGCCAAAATACACCCTTGAGTAT
ATCATGCCTGAATTTCCAGAGCATCTCACGAGGAGATTGGACACACTGACAGAAGACCCG
ATGAACTGGGGGAGGACATCATCCCTGAATAAAGCAAAGGTCATTAACAATACAGGAAAG
AAAAGATCAAGGGGGATGTCAGATGAGACTCTGAAACTTGTCTTGATCACAGAGTTGCTA
AAGCAAATGGAAGGAATGAGGAAGTAAAAGAATTGGCACAGAGAATTTCAAAGAGCAGTT
CAAGAAGACAAAGTATTATAAGGAAATGTGCAAAGACCTGAAGTTACAAAACCCAAATGA
ATATGCTGCACATATCTTAAGCTGAAAGCACAGAAGAAGAAACTCAAGCCTTGAGTTTTA
ATATTAAAAGATTCTGTGGGTAAACTTTTGAATGATGCAGGAAACTTGAAGGTGGAAGGA
ATACAGAGTCACTTTACCAAGAAGAACTAGTTGCCATTCAGCCATTTCAAGAAGTAGCAT
ATAATCAAGAATTGGTGCTACCAAAGGAAGAAGTCCACGCTGCACTGAAGTTATTCGCCA
AAAATAAAGCTTCCGGAATTGATGGACTGCCAATTGAAAGGTTTCAACAAGCTGAGGAAG
CACTCACTTGTCTCTGCCAAGAAATTTGGAAGACATCTGCCCACCTGGCTAACTGACTGG
AAGAGGCCATATTTGTACCCATTCCAAAGAAAGGTGACCCAACTAAATATAAAAATTGTT
GAACAATATCATAAATGTCACATGCAAGTAAAATTTTGCTGAAAATTATTCAACGATTGC
TACAGTACATCAAATAGTAGCTGCCAGAAATTCAAGCCAGATTTGTGGCACAAGGGTTAT
CATTCCTGATGTCAGAGTGGTTGTTGGCTGAAAGCAGAGTAACAGGAAGGTGTTACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTGCTTAGCTGCTAACCCAAAGTTTGCTGTTTGAGCCCACC
AGCACTCAAGGAGAAAGGTGTGGCCGTCTTTTCTGAAAGAGACCACCTGGAAGCTCTGTG
GCGCAGTTCTACTCTGTCCGGTAGGGTTCTTATGGGTCAGAATTGACTCTACAGCACACA
ATCCAAACCCAAAGTGTATCTGTCATCCAGAACAAATAAAACGTGGTGTTACATTTGCTT
CATTTTTTTTAATCATTTTATTGGGAGTTTATAGAGCTCTTATCACAATCCATATAATTT
CTGATATTTTGAAATAAATAAAACATTCATAATAAAGCAGAAGCTCTTTGAACACTCTTT
CAATTTCATTCCTTCTCCAATCTACACAGATAAACCCATATCTTGAATTTTAAAATTTAT
GTAGGTGATATTGTACCTTCTTACATCTTTCTCCTAATTCCCATTGCTGCGTTTTGAGTA
TACACCCATAATGATATGTGTAGAGCTAGTTCAATTATTTTAACTCCTGAAGCTGTCCAA
TCATGTACTTACATATCACATAATTTTTCCCATTTCCCCCAGTAATAGGCATTAGATGTG
AATAACTTTGTGTGTATCCTCCCATTGTGCATATGTGTAAATTTTTTACTTTTGCACATA
ATAAGGATTACTTTCAGCAGCCCTAGTGTATTAAAGCGATCTGCAGCTGACTGAAAGGTA
GATGGTTTGAACCCACCAGCTGCTCTGAGGACAAAAGATGTGGCAGTTGGCTTCCATAAA
GATTACATTCTTGGAAATCCTCTGTGGAAGTTGGACTCTGTCCTCTAGAATCATTATAGG
AAACACCAGTGTTAATGTAGGTTAGGCATTGGGCTGCTAACTGCAGAGTCAGTGGTTCAG
GCCCACCAACCCCTCCATGAATGGAAGATGAGGCCATCTGCTCCTGTAAGAGTCTATAGT
CTTGGAAATCCTATTTAGGTTCTCTGAGTCAGAACCAAATCAGTGGCAATCAGTTTGGTT
TTGTAGGGTCATTTTGAGTCCAAGTTGAAACAATAGTCAGGGGGTTCAGGATTTCTTTGT
TGTTGTTAGGTGCTGACTCATAGTACAACAGAATGAAACACTGCACAATCCTGCGCCAGC
CTCATAATCTTTGATGTTTGGTCCTATTGCAGCCCTTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCTTACCAAACATGGTGTCCTTCTCTTAGGACAGGTCCTTCCTG
ATACCTTGTCCAAAGTAAGATGCAGTCTTGCCATTTTACCCTTCTATGAGCACTTCTGGC
TGCACATCTTCTAAGACTAAAGATCTTCCCAGACATGTTTATATTTGTTATCTGGCAACT
CATTGTAGATTAAGTATCCTTTGTCAACACCGTAACTTTTTACATGCATCAAGTCGTCTT
TGGTCTTCATATTCATTATCCAGCTTTTGCATGTACGTGAGAAATGTACTCAAAGTGATA
CGTATGGCTCTAGTTCAGTTGAAAATATCATGGCTTGAGTAAGGTACACCCTAGTCCACA
GAGTGAGATGTTTGTTTTTTAGGACTTTAAAGAAATCTTTTGCAGCAATTTTGCCTACTA
CAATATGTCGTTTGGTTTCTCTACTGCTTTTTCCATGAGAATTGATTGTGAATCCAAGGA
AAATGAAATCTTTGACAACGTCACTATTTTCTCAGTTTAAACGAAAATTCTTATTGATGC
TGCTGTGAGCTTATTTTTTTCCCCCTCTTCTGTAATCCATCCTGAGGCTGTAGTCTGCCA
TGGTCATCTTCATATCTTGGCATTTCTTTGATTAAATATGGTGAAATGATACAACAGGCC
ATGTACCTTTCCTGAGTTTAAACCATGTAATATTCCCTTGGGTTCAAATGAATGTATCTT
GGGTTTAGGTACAGGTTCCATATGAGTACAATTAAATGTCCTAGAATTCCCATTCTTTGT
GGTGTTACCCATAAATCGTTATGACACCCACAATTGAATGTCCTTATATAATCAACAAAA
CATAGAGAAACTCTTTCTCATATCCTCTGCTTTCAGCCAATATCCATGTGGCATTAACAA
TGGTAACATAGCCCAACAACAAGACAATTTGTGTGTCTTGGTTTTTAGGCCTGTTTCTGG
GGTTACTTGGGGCACTGATTCAGAAAATGGCTTTGTAGACTGCATCTGCTGTAGTTCTTA
GATACGGTGTTCCACTAGATTTGCAGCTATTAACTGATACTAATTTATTACTTTAATCTC
ATAGTTTTATATATGAGAGTTCAGACCCACAAATTACAGAATAAGACAAAAAAAGGTAAG
AAATCACTTAAACCTTTTTTAGATATCAAGGGACTTCAAGGGAAGGTGTATATAGGTACA
TGGTGGCTAGTTGGTTACACATTGAGCTGCCAACCATAAGGTCGGTGGTTTGAACCCACC
CATCACTCTGTATGCTTGAAAAGATTTAAAGGTTTGGAAGCCCAAAGGGGCAGTTTTTCT
CTGTCGTGTAGATTGCCATGAGTTAGAATTAGTTGGATGGCAGCGAGTTTATCTTTTTGT
TAGGGAGGCTGTCCAATATATACAGAAACTACAAGTTGGATACTGCAATGGCAGATTACA
ACCTGAGAAGGGTGAAAAATAAAAAAGAAAATGAAAAAGGCATATATATATATATGAAGC
TGTGAGGGTGATTTAGAGTGTTGATAATGTAAGACTTCATAACAATTTTCATCAGTATTT
TCATGATCTAAATTTTCTTCAGATTAAACATTTCCAAACATATTTTATATAGAGAAGTGA
ATACATAATTCATATTAAATGATCCAGAGGTGAGGTTAACTCCAAGCTTCTTGATAAGAA
AAATTCTAACATTTTTCTTTAAAGAGTTTCTGCACAGCTGGGGAAGTTGTGCCATCTTAT
AACAAGACTGGAACATTTTAATTTCATAAAGGAGTTTGAACTCTGACAGACCCAGTTTGC
GTTTCAGAACATATGAGTCTCTTTATTATACCAAACTCGCTATCAGATAGTTGATTTCCA
CTCATAGTGACCATACAGGATAGAAGAGGAACTTCTCCAGTGCATTTCTGAGGCTATAAA
TCTTTGTGGGAGCAGGGATGTCTCATCTTGCTCGAATAACTGACCTTGTGGTACGCAGGC
AGACTCATCACTGACAACGCCACTATGGCTCCTTATTTATTGAACTGAAAAAAACCCAAA
CTCGCTACCATGGAGTCAATGGTGACTCATGATGACCCTGTAGTTTAGAGTACCACTGCC
TCTGGGTTTCCAAGACTATAACTCTTTATAGGAGTGTATATATTTCTGACCCCCTTTTAA
GATAACAAATTAGAACTGCCTGCTATTCAGTTCCTAATAAACGTGAAATTATACTTGGGG
AAAATTCCAAGTTCATGCAGTTTGCATTGTTCACTATCTTTGGAAAGACGAACATCATCT
GAAGTATGACTCGACCTAAATGTGTAGTACAACACAAACTACTTAAAGCCAATGTGCACT
TCCTTTATCTCAGGCTAGCTAACGCTACATGAAAATATCTTGATTTTTTTCCTGGGTGAG
CAAAGTGAAGAGTAGTATAAGGCATATTTTCTGTATCAAAAACCAAAGCTGATGAGGAAA
ACTGGTGCCATTTTTTGGAATTAGGTCAAATATAGCCAGAAACAAGTCAGTTTTTGAAGC
AGGAAGATGTGTTCCATGCTCGCTTCCGAATCCAGCTTGAGCTTCTGCCAGTCCCTCATC
ATTGTACTGCCATGGCCATTTTTACATGATCTTGAAAGTTTTACTTGTATTAATGATATT
GCTTGACAATATCACTGCATTCTATAGGAGCATCTTTCTTTGAAATGGGTGCAAATAGGG
ATCTTGTCCAATTAGTTTGCCAGGCAGCTGTCTTCCAAATTTCATGGCATAGACCAGTGA
GTGACTTTAATGTTGTTTACTGAAATGTTTTTTTCTTTTTTAAAATCCAAAATGGGTTTA
TTGGGATGGCTTCCCACCCATCTTGATTAGGAGTTTTTTTAGTGCTGCTTCCGTCTGAAG
GAGCACCCTTCTGTAAGGCTTGCGTTTCCTCCTGTAGGCTGACAGAAGACAGTAGAGCAG
CCAACACACAAAACTACTGTTTGGGCATAGCTGAAGATTGTGGTGATTTATAGAAGCCTG
GGTATTTGACATCCCCAGTAAGGATTGGGCCTCTGCACCAGACACTTCTTGTGTTTCCTC
TTCTGGAGAGGGTTGAAGGAGATCCATTTCGAGAGGCATGCTTGCGTGGGAAAGTCCTCA
CCATAGGAAAGGCTGTTGAAAGTCTTCACCATAGGAAAGGCTGTTTCTATTGGTAATCTG
TCACTGATACAGATAAGCGCTCTCCACACACAGAATCCAGGATAGGTAACCCCTCAGGAC
CAATCATGAGAGTAGCGATACCATGAGGGTAGGGGGAAGGTGTGGGGAGAACGGGAAAAC
GGATCACAATAATCGACATAATAATGCCTGCCGCCCCTTCCCCCGGGAGGGACGAACAAC
AGAAATGTGGGTGAAGGGAGACAGTGGATGGTGTAAAATATGAAAATAAAAATAATTTAT
AAATTATCAAGGGTTCACAAGAGTGGGGGTGGGAGGGGAAAAAAGAGGAGCTGATACCAA
GGGGTCAAACAGAAAGAAAATGTTTTGGAAGTGATGATGGCAACATGTGTACAAATGTAC
TTGATACAATTGGTGTATGGATTGTTATAAGAGCTGTCGAGCCCCCAATACAATGATAAC
AATAAAGAATGTAGTTAACAAGCCCCATGAGATACCTAGTGAATATCTCAAAATGATTAG
AGCCCATATAATATTACTTATTTCCTTGCCCCACCATAAAAACTTTTCCCTCTTTAATCT
TCATCTTTGTAAATGAATCTGCCTGCTCTCCTCAAGCTGCAGCCTTGGAGCCCTTCTTTT
GACCTTACAGCTCTCTTTCTACCCCCGTTTTTGTTTGTAGGTGAGTAAACAGCCGAGTGA
ACAGTGTGGAGTCCATGTCTGACCTCCTCAGGCTACACAAGAGAGACAGAATCCCAACTC
CACACCAACCCAAGGCCGATGGCCACAAAACAGGTCACACGTACCTCTACCCTCCGTCTT
TTACCCTATTCTGATACCAACTGCTCCTCCCGTGGCACTAAACTTTGTTGCTGGGTTTAT
AATTCGTTACAGTGGCCACACAAGAACTTAAGACATAACTCACAATTTTGGGAGTTTATT
AGGGAAGCTAACAGGTTACCACAAGCCAGGATCAAAAAACAATGAGCAAGCAGTTTTTGA
TCCATAGCAACACGTCTTCTCAGCCAGCTGCTGTGTATCTCTCTGGTCCTTAACCTCTCG
GACACAGGGTCCTTTGGCCTCGGCCTTGTTGATTGGACCAGGAAGCCCACCACTGACTGC
TCTGCCTCACAGTCTCCTCCTTTTTGGTCTCCCTGCTGAAGCCTGTGGTGCCTCTGCCAC
TTCAGACAGGGATCTTGCACGTGGTCCACTGATGGCTATACTTTGATGGACCCAGGATTC
TCTGTTCCTATTTCTGAGATGTCTCTCTTATACACAGGGGAAGGGGCGACCAGAACTAAC
CAATCAATCCCCTATATTAGTGGTTCACACAAAATTGTTTTGCACTATTCGTAACTGGCA
AATTACAGTGAAATGGGCTAGAAGACTCATAAGTAAGTAAATTGCACTTTCACCACAGGT
ACCATGGAAAGTGAAGCTTTCTGCTTTTGAGTTTTTCACTTACATAAATTGCTACCAGTT
TGAGTTCAAGGCTAGTTATTATCTCCTGGGATTTCTTCCAGTAGCCTGGTAATGTTTCTC
ATTGGCTATACTCATCGGCTGGCAATTCATTTTTCCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
ATGATCGATGACTGTGCTAGGACCCAATCTAAATTTGCCCCACTTCATATTATTATCACC
ACTTTCCCTTTAATTTTCTCACAGAGTTATAACTACCTAAAATTAACTTGTTTCTTTATT
TTTAACTTGCAGTCTGCCTCCTCTCACTGGTACAGGGGCTTTATCTGTCTAGTCCACTCA
AGTGGCTCCAGCTCCCAGAACAATCTGCTAGCACGTTCCACTAGTTTCCATGTTATATAA
ACTCTTGATATTAATTCTGTAGCAGGAAGAGCTTTTTAAAAGAATGTTTTTCAATAGATT
ATTTTGCTTTCTTTCCCAACATATTTGCCATGAACTTTGCAGCTCATTTTACAGGTTTCT
TGGTAATAGTAGTGACTTCTCCCTTCTCCCTGTTTGATTGTTTTGATGTGGAATGCATTC
TTTTTGTTGGCTGATAATTGACATGTCATACCATTCAATAGTGCACTTACATCAAGAAGA
GTTGTACCATCACCATCACCACAATCAGTTTAAGAACATTTTCTTTATTCTTGTCCTCAA
TCATTATTAGCTCCTCATTTTCCCCTAACTTCCTCTGCTAGACCCCCAAGGCCCCATTAA
GCTATATTTATTTACCTATCTTGGATTTCATATACAGAAAAAACATTTCTAAAACAGCAA
ATTAACAATAACAGTAAAACAGATAAAAGCCTCAATTGGCAAGAAAGCAGAAAATATTAA
AAACTAGAACAAATTTAAAATGGATCAATAGGGAGATCAAAATATAAGGTGTTAAATTTT
AACCTACCTGCACCTGCAACATCCACTTTCCAGAGCATTCTGCATGACAGGAAGGTATTC
AGAAATCTAGTCTGTAGTCAGAGGGGATTCACCAGGGGCTTAATCCATGTGTATTTTCCC
TTTACTTTTTTTCTTTTTTAACGGAAACAACTTTGAAATGGGTCAAAAAGGAGATAAAAG
GATACTACATTAAAAAAAAAAAAGGATACTACATTTTTAATCCAACTACACCTGTCATAA
TCGACTCTATGATGCTCACTGTCTGATAACAAGGCTATTCACTTACCTCAACTATGATTA
AAGTGGATTCTCCAGAGGCTTAATCCATGCGTGGGCCCTGCAAATGGATTTTGGACTTCC
GCTTGTAGTGCAGCCTTGAATAATGCCTTTGCAATTCGGGGAACGTCTACCCATAGTGTC
AGAGCTTTTCAGGTTCATATTGGAAAGCACCAGTTTGTGCATGTTCTAAAGCATTGGTTT
TCAAAGTAACATTCACCCACTCTCAAGAGTCCCAAGGCCCTTTCAAGAGGTCCACAAGGT
CAAAACAATGTCAAGTACTATGGCTATTGCATTAATTGTGCAATTGAGTAACACTGCTGA
AATGTTAGCACAAATCAAAGTTGTGGTAATGAAGCGTGCTGGCCATTATTATTAATTCTT
CACTGTTAAAAAAAATCTGTTTCACTTAAGGATGCTCTTGATGAAGCTGCAAAATTTATT
GTATTACCTCTTGAGCATTAAATACACTTCTTTAATATATTAAGTTTGATAAAATTGCAA
ATTGTGTTATTTAGTATATAAAGTCATCTTTGGCTATCTATGATTTGCAGCTTTCAGAGA
GCTGCCAGCTTGAGCATTAGATTACCTAGAACACTATTTTTATTTCAACAGTAATTAATA
AGCATTTTCTGCACCTGACACCCATCCCAGAGAGAAGCTTTAATATGAAGACGAGAAAAA
GGAATATGTTATTTCTTTCAAATACATCTAGCTTTCTTAGATATTTATGTTACAAATTTC
TGTTTTAAAAACAAAAATCAAGAAACATCTTGCTTTGAGGGCTAGCAAGAGGTGTTTCCG
GCACTTTAAAATTTCCTAAGTGTCTAGAATGATAGAGGGTCTCTATTAAGCCATTTAACT
TCAGGTGGAATTTTAGACTTCTTTGTCATTTCTAAAGAACCAGCTGCTCCAGGGGAGGGG
CATGATTCTGTGTGCTTTGGAAAGATTGACAGGGTTCCAAACGCTTTGATATCAGCGACT
TTGCCATTTATGGTAAATACATAGAGAGTAAGATTCGTGAAGGAGTACATTGGCTTTCTA
TTTTTATACTTTATTTGGTGGTTATATTTCTAATGTCTACTAGGCCTGTTATATGTTTCT
GGTTTTTGTATATTTTTAGCCATAGTCCTCATAAAGCATTGCCATTTCCCAAGAAAGTGT
ACTACTTTGATGTCTTAACAGCCTCTTACACTTAGCAGCAGCACAGAAACTCCTTCCATT
GAATTTTGGTTTGGAAAGTATGGTTACTTTAATCACTGTTCTGCCTTTAGGAACATGCAC
TTTCACTTTTACAAAAGGAATTTCCAAGGAGATCGAAGATTAAATGTGAGAAAATAAAAG
TATTAAAAGATTCTGGAGACTGTAGTCCTTAGACCTTTCAGATCTGGAACTGAATCCCAC
CTACATCCTCCATTTCAGGATCAGTGGGGGTCACTTTTCACATAAACAATCGCTCATTAT
TACAGCCACTGTTGAGGGTCTTCCTCTTTTTTGATGACCCTTTATCAAGCATGGTGTCCT
TCTCCAGGGACTGATTCCTCCTGGTAACATGGCAAAAAGACGAGCTGAAATCTTATCATT
CTCTATTCTAAGGAGCATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAAAAGACATCAGTTCTCCTCCAGTATCTTGTATTCATTGTCCAGCTTTCCTATGCACAC
GAGGTCTTTGAAAATAACGTGACTTGGGTCAGGTACTCCTTAGTGTCTATGAAGTGATAG
CTTTGCTTGTTAACACTTTGAGAGGTCTTTTGCAGCACATTTGCACAATACAGTGCATTG
ATTTCTGGACTGCTGCTTCCATGGGTGTTGATTGTGGATCCAAGCCAACCAGAATCCTTG
ACAAGTTTCAGTCTCTTTTTCTGGGTATCATATGTTCAGTGGTCCGTTTGTGAGGAATTT
TGCTTTCTATATGTTGAGGTGTAATCCACTGTACTCTTTGATCTTCATCTGTAAGTACTT
CAAATCTTCACTTTCAGCAAGTAAAGTTGTGTCATCTGCATATTATAGGTTATATTAATG
AAGCTACATTTTTCTCATGTAGTCAAGCTTCTTAGATTATTGGCTCAGCATGCAGACTAA
GTATGGTGTGTTAGGCTGGATTGACTAGAGAAACAAATCCAGAGACACTCATATATGTGT
AAGAAAGAGCTTTATATCAAGACGTAATTATATATCAAAGCATCCTGGCCCAGGCCAACT
CAAGTCCATTAGTCCAGTACTAGTCCCATAAGTCCCTCTTCAGACTCACAGTCACAAACC
ATGATGTAGAATGCAGGAATATCACAGGTTCTATATCACTCTGGGTGCAGAGCCATGTGG
ATCCAGTGGCACTCGACACATCACAGGGCTCTGGCAGCAATCAGAGTCAGCCAGCAGGAA
GGTGAAGTCCGAGAGAGAAGGGGGGAGGTTCCCAGGACTCCTTATGAGAAGGCCATGCCC
ACAAGGAGGCACCATCAGGCTCTGTGATCTGATGGATAGGTTGAATACCATCTTTGCACT
TTTATATATCTTCAAATTGACATGAAATTATGTAACTACCACATATGGTAAGGATTCTCC
TGATTTTAAACTATACCCTATCCTATTCTGTTCCTCTTTGGTTTTGCATGAGCACAACCA
AGTGTTTTGAAATTCCCATTGTTTATGTGATCCATAGTTTGTTTTGACCACATGAACTAT
CACATTATTGATTTTGCTGTAGTTAATAAAACACAGGTACATATCTTTCTGGCATTCTTG
CTTCAGAACAAATCATCTCACATTAGCAAAATATCTCTCATTCCATATCATCTTCTGAAC
CCTACTCAAATTTCTGGCAGCTCCCTGTTTTTGAAATATCTTCAGCAATTTTAACTTGTG
TGTGATATTAATAACACTGTTAGATAATTTTCATATTCCTTTGGATGCCCTTTCTCTGAA
TGGACACAGATATGGATCTCTTCCAGTCCATTGGCCAGATAGCTGTCTTCCCAATTTCTT
GGCATAAACAAAATGAGCATCTTCCAGTGCTGCGGCCCAATTGGTATTCCATCAATTTGT
GAACCCTTGTTTTTCAACACCTTCACTGCAGCTTGAACATCTTTCTTCATTGGTTCTTGA
TCATATGCTACCTCCTGAAATAGATGAATAGTAGATCAATTCTTATTGGTACAATGACTC
TGTAAAGTTCCCTGCATTGGTCAGTATTTTATTTTGCCCATAGAATCCTTCAAGATTGAA
ATTTGAGGCTTGGTTTTTATTCTCTATTTTTTTTTCAGCTTGAGAAATGGCCTTCTAACT
CCAATTCTTTGTATGTTTTATTATAATACTTTGTTTTCTTGAGCTGCTCTTTGATATTTT
GTGTTAAGGTCTTTTATTTAATCAATTCTTCCTTTTGCTTTAGCTTCTCTATTATTACAT
CTCTCTTTTGGTGAAAAATATTTGAGGTTCTTTTTCTCCACAGGTTTCTGCGCTTTGTAG
GTTCTGGCTTTCATAGGTTTTACTGTATTAAACTTGAAACATTACATAACCCCCATTGTA
AATGGTACTTCAGTTTGAGTACAGCATCTGTTGACATAAAATTTGTTATTAATATGAATT
TATTGGTTTTGTATTTAATTTTGAATTTGCATTAGTTTAGTAATTGTATGAGAGTAAATA
AGCCCAGCAATTTGTGCCCACTTAAGAGAGAGAGAATCAAAGCCAACAACTAGGAAATGG
TACAAGCAGGAAGCCATTGTCTTTTCTTCAGTAGAGGGAGGGAATCGTGCTACTTTTCAG
ATTTGGCCATGGCACTCAACAGTAGGAAGATGACAATTATGTAAGAAAGCAAGTTGCCAA
GCACTGTATGTAGTGAAAATCCATTTAAGTAAATGCAAATATGCAAAAGTAAATAGAAGG
GTGTGTTTGTGTTTTTAAGTATGTTAGCAAATGGATAAACAGAGGTGTTGAAAGATAATC
CATCAAGGTGGGGGGAGATAGGGGACACCAATCACAGTGATCTAATATAACCCCCTCCCT
GGGGGACAGACAACAGAGAAGTGGGTGAAGGGAGACTTTGGTCAGTGTAAGACATGAAAA
AAATAATAATTTATAAATCATCTATATTTCTTTAAAAAATCATTTTATTGGGGGCTCGTA
CAACTCTTATCACAATACATACATACATCGTGTCAAGCACATTTGTACATTTGTTGCCGT
CATCATTCTCAAAACATTTTCTTTCTACTTGAGCCTATGGTATCAGCGCCTCATTTTTTT
TCCCTCCCTCCCCCACCCGTCCTCCCTCATGAACCCTTAATAATTTATAAATTATTGCTA
TTTTTTCATGTCTTGCACTGACCGATGTCTCCCTTCACCCACTTTTCTGTTGTTCGTCCC
CCAGGGAGGGGGTATATGTAGATCATTGTGATCTGTTCCCCCTTTCTCCCCTACCTTCCC
TTTCCCCTCCCGGTATCACTACTCTCATTATTGGCCCTGAGGGGTTTATGTGTCCTGGAT
TCGCTGTGTTTCCAGCTCTATCTGTACTAGTGTACATCCTCTGGTCTAGCTGGATTTTTA
AGGTAGAATTAGGATCATGATAGTGGGGGGGAGGAAGCATTAAAGAACTAGAGGAAAGTT
GTATGTTTCATCATTGCCATACTGTACCCTGACTGGCTCAAATCCTCCCCCCACCCTTCT
GTAAGAGGATGTCCAGTTGCCTACAGGTGGGCTTTGGGTCTCCACTCCGCACTCCCCGAC
TTTTTGTTCTTTGCCTGATACCTGATCCTATTGACACCTTGTGATCACACAGGCTGGCGT
GCTTCTTCCATGTGGGCTTTGTTGCTTCTGAGCTAGATGGCCGCTTGTTTCAGCCTTTAA
GACCTCAGACGCTATATCTTTTGATAGCCAGGCTCCAACAGCTTTCTTCACATTTGCTTA
TGCACCCACTTTGTCTTCAGCGATAGTGTCAGGAAGGTGATCATCATGGAATGCCAGTTT
AATAGACCAAAGTGTTCTTGCATTGAGGGAGTATTTGAGTAGAGGCCCAATGTCCATCTT
AATACTACCTTAATACTAAACCTATAAATATATGCACATAGATCTATTTCCCCCATCGTC
ATATGTAAATATATTTACATATGTACATGCCTGTATTTAGACCTCTATAAATGCCCTTTG
CCTCCTAGTTCCTTCCTCTGTTTCCCTGTACTTTCTCTTTTCCCACTATCATGTTCAGCT
TTAATTTGGGTTTTAGTAATTCCTTCGGTACATTGCCCTTGATCAAGCCTTACCAGGCCT
CCTACACTCTCCTTGCCGTTGATTTTGGATCACTTGTTGTTCCCTTGTCCCTGGGGTTAA
CACCCACTTCCTGTCCCCTGGCCTCCCCCTCTCCCATGTCCCCCTGGAACCATCGATCCC
ATTGTCTTCTCCTCCAGATTGTTTATCTAGCCTATCTCATCTAGATAAACCTGCAGAGAT
AATAATATGCACAAAACAAGGCAGAACAACAAAATAAAAGAAAACAGAACAACAACAACA
AACAATTGGGCACCATTCCTGCAATGTGTCTCCAGTGTTGTCCCCAACGATTTATAAATT
ATCAAGGGTTCCTGAGGGAGGGAGGGTGGGGGACGGAGAGGGGGAAAAGTCAGGAGCTGA
TACCAAGGGCTAAAGTAGAAAGAACATGTTTTGAAAATGATGATGCCAACAAGTGTAGAA
ATGTGCCTGACATAATGGATGGATGGCTGTATTGTGATAAAAGCTGTATGAGCCTCCAAT
AAAGTGATTTTTAAAAAAGAAGAAAGATAATCCATCAAACTTGGTAGGGTTCCCTCTGAA
GAGAGAAATTGTTGGGATTGGAGAGAATGGGAATATTCACTTTTTTAGTATAAGAAATAC
TTCTGTTTTGTTTGAATTCTCTTGATAGGGGTAAATTTAATTTTATTTTTTACGTATGGA
TATTGTCAAGTGTATATAAAAGTGGAGAGAATAATCTAATGAGCTCCAATATATTTGTCA
GCCAGCATAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGGACCCTGCAGTTCCCTTTCCCATCAGATCAAAACACTGATCTGGGTGGTCATAAAGAA
GGAAAAGAAACAGTGAAACGGCCCCTCAGTGCTGTCATAGCTCAGGCTAGTTACAAAAAG
GATCAGACTAGATTGAGTTTGCTTCCTCAGTGCTCCAAGGGCTGAGTTAAATGAATACAA
CTCTGGGCAGCTGGGCTGCAGCAGCCTAGACTATTATTGTATTTGTGGGGAGGAGTCTCA
TGTCTAGCTTTCTTGTCCCCTGGTTAATGGAAGTAAAAATAAAAGTTTAAGAAAGGTAAG
TTGGAGTTAGAATCTTGAGAATTAGGTGGAGGAATTTTGATTGCATTTCATGCACAGTAT
TGGCGAGCTGGGGAACCCTGTTGGCACAGTGGTTAAAGCACTCAGCTGCTCATGGAAAGG
TTGCTAGTTCAAACCCACCAGCAGCTCTTCAGGAGAGAGATGTGGCAGTCTGCTTCCATA
AAGACGACAGCATTAGAAACCCAATGGGGCTAGTTCTCCCTCTTCTACAGGGTCACTATG
AACTGATAGCAGCCCGAGGGCAGTGGGTTTTGGTATGGTTTAGTGGAGAACCTCTGTCTG
CACAGTGTAAGCTGGATTACAGGTATAGGAGGGACCATGGTAATGAGATTGGAGGCAGTG
GACCTGGGAGTAATGGGGTTCTTCAGTGGGTTAGTCTAGGGGGGATGGAGTGGAAATACA
AGAACTGCTCTGGGTGCAGAACAATGAGACTTGATGAGGGTCAAACACGTCTCACGTGCT
GTGACCTTTGAGTCTTCTGCAGTGCCATTCACAGATACAGCAAACCTGGGGAGGAGGAGA
GGCTGTTTGAGGCTGACCACACTGGCTCCCTGGGGACCAGCACCTACGCATCAGGCCTGT
GGCAGAGATCCACAGGGAGGGTGATTGAGAGGGCGATTTGAGGGTGTTCTTGTAACTGAG
GATAGAACTTGGGGAGAAAGGGGTGGGGGCCTGCATTTGGAGAGCTGGAGAAGACAAGAG
AAAATGAGTGGTATAACTAGGGTTCCCAAGATGTGCTTGAATCCTATCTCACTCCTACCT
CTCACTCCTCTGTCCTACTTCCAGCTAGTTACTTGGTTGAAAAGCCAGCATTTGACAAAG
TCCTTCCTGTACCTTAAGATATTCCTCTATTAAAAAAAAAAAAAAAGATACTCCTCTATT
AAAATGCAGGTGTCCCTGGGAAGGGTAATCCATTAAGCCTTGAATGCAATTAATATACTG
TCATGATTAGATGCTTTCTAAATGACAATTTTCTGACAGTAGCTCCTTGAAGAATAAGAT
GCATGATGAAGATATTTTGATTCAGGGAGAAGGTTAACAGAAGGGTTTAAACGTGGGACA
GGTTTTGGGTGCTCTGCAGAGAGGAGGGCCTAGGTAGCAGAAACTGCATAGGAACTCAAT
AGTTGTGGGAACTGGCAGTGCATAATCCCTGGGCCTGTTGTTATATCCCCCTGTAACCTA
TTTTCCTTGTTTTGTTTCCACACTTTGATTGGAAGGAATACTTTTGTGATAATACTTTCT
TTTTTTAAGAATTAATACCAAACTAGCCCAGGAAGTTGGAGAATGAAAATGTTGCAAGAG
TCTAACTTTTGCAAGATGAGAATCTGTTTGATTTCACCCCCACTCCTCCCTTGAGTATAT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNGCCTTAAGCCAGACCCCAGTGTCAGCCCATGCCTGCCCAGCACCTATAATC
TAGACCCTCCTACAATCTTCTACAGACCTTTCTCTCAGTTCCATGGGGCCCCACCCTGGC
CCTGGGCATTTGCTAACAGTGTCTGCTATGGCTTCAACAGCGTTCACACCATGCCCTCAG
CTCCTGCATTCCCAGTTTACATTTGCCATGTTAGGGTAGTTACTTCCCATGAGGTCAGGC
ATATGCTCATCTGTCAGTTCCTCAAGAGCTGCCATATAATGACTGGGTTACACTGGGAAG
CTCTGCTGCTAGCCAGGAGTGGCCCTCGCCAGCTTTAGAGACCCACTTCCCTGTGAGCCG
TCCGCCTGTGGACAGAGGGCAACCTCCAGAGCTGCTTTGGCTCAACTACCTAGTTTGCCA
ACCCCAAACTGGCTAACGTGGATTGAGCTTGGCCAGTGCTGGCCCCTGAGGGGGATCTGT
TAGATAGGTGGCAGGAGTGACTTTTTATCTGTATTTAGGCTGGGATCATAGAAGAGATGT
TAGAAGACACCTTTGAAAGCATGGATGATCAGGAAGAAATGGAAGAAGCAGCAGAAATGG
AAATTGACAAGATTCTGTTTGAAATTACAGCAGGTATGACTCAGTGGGACTCCGCCGCCT
CCTCTCCCCATAGTGGCCATTCCTCCCACCTTCTCTAGGGTAGAGCTTCCGCAGTCAGAC
TTGTTTTTATTTTCCTCATTGCCAGTGAGTCCATTCTGACTCACAGCGAACCTATAGTGG
AGAGTTGAACTCTCCCTGTGGGTTTCCAAGACTTCTGTAGGCTTGCATTCCCAGATCCAC
ACATAGCTCAGGTGATAGAAAGAGCACAGAGTGGACATCTGGCAAGTTTCTGAGAGCAGA
ACCCTCCATAGGAAACTCCTTCCAACCAATCAGTTCTAGACATGATAGGACATGGCCTAC
GTCTTTACAGGAATAGAAAACCTCACCATTCGCCCTGGGAGCAGCTGGTGTTTTTGAACT
GTTGACCTAATAGTTAGCAGCCCAGGGCATAACCATCGTGCCACCAGGGCTCCTTGTTAT
TATTTTAGGTTGTGTATATAAGTTATTTCTTGAAAAATGAGCACAATATCTTTGTTAAAA
AGCACAAAAATAAGGAACTTTTAAGTTCCTAGAGCTTTTAAAGGAAGCTATTTCTACTCA
TATATGATTCTTCAGTTTAAATTGGTTCCATTACTTGGTAACAGTTTGGCAAGAGCTGTA
AAAAGCTATTGAACTAGCAGGTCAACTTTTAGGAGTGACTCTATTGAAAAAATTAAGGAT
GGGCTCAAACATTTTGCTCAAAGAAGCCCATGGAAGTAGAGTTGATCATTTTAAACCTTT
GAAACACTAAGTACCTAATGATTTAAATATTGGTCGAATCCGTTGTGTTATATCTGTTTT
AATGGAGTACTTGCCTTAGGCTTCTCTAGAGAAATAAAACCAACGAGAAATATATACACA
CGTGTGTTTCTGTAGAGAGAGAGAGAAATTGGTCTGTTTACTGTTTACTTACTTGAAGTA
AGTAAATATATGTGAAATATATATATATATATATATATACATATATATATGATACATGTG
TGTATACACACACATGCCCTCTACCATCACATAGGTTCTAACTCTCCCGAGAAGCAAGGG
CTCCCTTTAAACAGATGGAACCATCCAAAATCCATAGACTTGGTGCAGGCTTGCCTCCCA
AGATCCATAGCTCAGATAATGGGTAGAGTATAGAGTGGAGAAGGGCAAGTTCTGTCCAAA
GATCTATTTACAGCTAAAGGCAGAACCCACCCTAAGGAAACTCCCGTTTCAACAGACCAG
TTGATTGTATAGCATGACATGGCAGGTGATTGCATTAGATTACATCATGGAACAGCAGCT
AGTCAACTATTTGTCCAAATCACAAGACACCATAGCCTATTCCAGTTGATACATAAAGTG
AACCATCACAAACCTACCAAGCCTATGATAGACAGTCGCTTTGCTACAGAAATCGGTATC
ATTTCCTAAGAAGTCTATAGAAAAAAATCTAGGAGGGAAGATAAAAACGGCTTTCATAGT
TATCCACTCAGTGATGGTTAATGAGTTTTGGGGATTTTATTTCTACTTTTGGATTTCCCG
AGTTTTATGTTTAATAAAAAATATAATGGGCAGAACTCTCTGTATATTTGTTATTTGGGT
TTAAGCTCATAAGAGATAGTGCCTGGGGGGGCACCCGTGTGGAAAGCATTTTCCACACCT
CACTGAAAGGGCTCGGGGGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGTTTAAGGATTCAAGTCCAGA
GTATCAAAACCCAGGTTCTTCAAATAGAAATCCTGTTATTATGATTTTGGTATCATTACA
AGCTGATGCTTGCACATTGGTCAGTGAGACAAACTTGATCAAAATAGCCTGCTCTTTTCC
TCTTTCTTGTGCACTTGGTCCAGTTGTGAGGAAGGCAGGGAGCCCCAGGGGCCAGTTCCT
TAAAGCCGGTGCTTTGGTAACCTGCTGTTTTCTCTTCAGGGGCCTTGGGCAAAGCACCTA
GTAAAGTGACAGATGCCCTTCCGGATCCTGTGCCTCCAGGAGCAACAGCTGCCACAGAAG
ATGAGGAAGAGGAGGAGGACGACGAGGCTCTGGAGGCCATGCAGTCCCGACTGGCCACAC
TGCGCAGCTAGGGCGGCCCAGCTGGCCTGCTGGGTGCACGCACACTCCTCTGAAGTAGCC
ACCAGTGTGTGTCCCTCGCACTACACCTGTCTTGAGGCATCGCATTCTGGAGAAGGTTCT
CTGCTAAATCTCTTTCATTCTCTGCAGTGGTCTTAGGGGGATGTCTTAGGTATCAAAGGG
ATTGTTTCTTCTGAGAGGTGGCGTGATTAAATGCATCCTTTTCAAGGGTATAAACAGAAG
TATCTTACTGGGGAGAATTCTGTCTTCTCACAGTACTTCTGAGAGTAGAATTGATTGCCT
GAATGTTGAGGGCTCTGTACATTTTTGCCTGTAAACACTATATAAATGGATTTTAATAAA
TTTCTGCTTGACTCTTGGTCTTCTGGTAGGCTGAACTGACATGGTGTTTGCTACCCCAGG
TTGTTGGCCTTGGAGAGAGGATGTGCTCGAACGCTTCTGCTCTGTGGGTGCTGGTCCTGA
GCAACCAGATATGGGAGGGAGCCACACACCTGTATTTTGCCATCTTTTTAACCAAAAATG
ATGCTTAGCGATTGCCCTGTGCCCTGTTGGCTGAAGAGTTCACATTGTGTAGTATGGCCA
GGTACGTGTCTGCACTGTGTATGCTGTGATCCATCACTCTCCTGTTACAGGTCGTGCCCA
GAGGTACTAGCTGTGGAACCTTTTGCCCTGACTGCTTCAATTTGCTTTGAGCTGGTTGTC
ACGGGTCATGAGCTACGGGCCTGCCCACCAGTGCTTTGGAAAAGCTGCGCACTGACCAGC
AAGGGGCAAGGGTGTGGTCATCCATCATGACATGTTCTTGCATATCTGGAGCATCCTGAA
AAAGCACGTATAAATGTGTCAGCTTTGACATAGGTGACCTGAGATGGAAAGTGCTCAAGC
TCAGCAGAAGGGACAGGAGACCCTCCAGCAGGTTCTCAAGTGCAGAGGGCCTGCCTCTTC
CTCAGTTTTATCTCGAGACTACAGCTTCAGGACCACATTTATCCAGCTAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 5141..5201, 7725..7904, 19522..19643, 80738..80852, 82959..83110
1001..1045, 5141..5201, 7725..7904, 19522..19643, 80738..80852, 82959..83107
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved