Echinops_telfairi Locus ENSETEG00000012522
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000012522
Echinops_telfairi
ENSETEG00000012522
GeneScaffold_2872
SNORA70
26182..26315
65595
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCAG
CCACCTTACGGACTTCAATACAGGCCTGGGGCAAGCCCAGGGGGAGGGAGGGCCAGTGGG
GGCAGCCGTGGCCGACAGCAGCGGCGGTGTGTACAGCGGTACCCCCGTGGAAGCGGAGGA
ACTACAACCAGGGAGTCATGGGGTGAGTGGTGACTTGCGGCCTGGTGGCCTGGCCCATGC
ACACGCCCAGCCAGGCACATGCCCAACAGAAAGGGGAATTAGGAGGAGACCGGGGTAGGG
CATTCCCTAGCCTTTCATAGCTGCTCCACAGGGGTTGCTGGCCCTCCCTGTGCCCTCTTT
CCCAGCCACCCCTACCATGCCATACTCACTGTCCATAACTACTCCTATCTCCCACATTCC
CACTTAGCCAACCTGGCGATACCCCTCAGTCATCACACCCTCTTCCCTTTCCTTAGTCAT
CCACACCTTCCCCTCTCCTTGGCTGACCAAGGTGGTTATCCACCCCTTGTCTGGATCCTG
CCTTCTCCATCCATACTTGTCTCCCATGCTCTTAGTCATCCAACCATCCTCCTCTTCCTC
ACACCCCAAGATGAGATCGCCTCGTGCAGGCACAACATTCATTCCCGGAAGACATTTGTG
TTGTAGTGTCTTTTGATGGTATAAGACCTGGAAGTGTTTCCATCGCCAAGAACAGAAGCA
TCTAGAATGTTCTTTCCCCTACCTCCAAGTTCAAACAGGAGATATATCAGCACTGTAAGG
CATTGCCTTTTGTTGACTCTTTGGCCGTTTTTTTTTTTAAACCCCCTCCTGGTGTTAGAT
GGCTTGTCTGTAGTGAGTGAAGAATAGTAGCTAAGTTTAGGCTGGTGAACTGTCTTCTGA
GGCCGTGGTAGAACTTTCCAGGAGTTCATGGTCTATTGCTCTAGCGTCTCACAGTGAAGT
TGTTCATCTTGGCAGAGACAGCCAATGCTTTTCATTCTAGGGGGTAACTTCATGCTAATG
AGTGAATATTGCACCATTAATGACTTTCTGTTTAAAGTTCACCTCTTACAAAATGGAATC
TTACCTGACCCTCAGTGAATTATGTACGTAAGCAGGGAATGCTTCCAGCTAGATTTCCCT
TCTGGAAGAGTCTCTATTCTCGGAATCTTTTTCTTTTGTAGAATAAAGCGTTGGGACCAT
GTCTTTCCTGTCTCTCTCGCTCTGTCACTCACTCACTCACTCACTCACTCACTCACTCAC
TCACTCACTCACTCTCTCTCTGTATGTGTGTGTGTGTGTTGCTTGAGTATGTGAATAGGA
CTTTCATATGGCTTTCCCCCTCCTCAGACCCCCCAAACGTGTTTTGCCTTGGGGCTTTAG
TAGGCAAATGAAATCACAGATAGTATTTCCATGTGAAGTCAGCCTTTTCTTACTGTTACC
CATTTAGACCTGCCCTGCTTGGGGTAGAAGAGTTTTATGAACATTTTAAAAGGTTTGTAT
AAAATAAGTTATGAGATCCATCTGCTTCAGTAACTAATGTCTTCTATAAGCTACTACTAC
AACTTCCATGCTGTGGAGAAAATGCAGTTGATCATTTTAGCACTGGAACCTATATATAGG
TTTATTCTTCTGTTGCTAAATCAGTTTCTAAGGTGCTCTCCATGGTCTAGTGGGTCCATC
CTGTTAGCATTTTCAAAGTCAAGTTTATTGATATTAAGGGCTTCTGATCGTTTCATATCA
TAGCATCTGTTCTTGTTAAGTTATCACTGTCAACTAAAACCTTGAAGTTCTCAAGTTGAA
CCATACTGAAGCCCTCTTTGCACAAATGTCTGGAAAAGAGATGGTATAGATCCATATTGC
TGCTACCTCTTTGGTGATTAGGTTAGAAATTGCCCTCTGCTACTTTTTATTTAATGTAGA
AGGTACTATAAAAAGAAAAGGTTCACATTTGAGTGTATGAAGAAACAAAATGTACTTGTT
CCTGATTCCAACGTTATATTACCTTTAAAGAGATTAAGGAGAGGAGTTTTCCTTTTTCAG
GGGGCTGCTGTGTAAAAAGTGACTGTACGCTTCTTTTAAAACGATCACTCCATGGGACCT
TCTATTATTTTACCTCATCCTTTCAATGATCTCGACAACTCAAAATTTGAAGAAATTTTC
AATTCTGAAGACCTTCAGCTTTGAAAAATATACTTTAAAATATCTTAAACTTGTAGAATG
CTTTTGTAAACATCTTTGTTTTCTTAAAATTATGTTTTGGTTTATGGATCCTAATTTAAT
ACTTTAAAAATCTGAATTAAAATTTACTTTGAATTTAAAATGGCTTTGCTCATTCTGAAA
AACATAGAAAACATGTTATCAGTATTCTGAGCTTTTAGCATATGGGCTGACACTTAGCTA
ATAAGTTAACAAATTATATGGTTCTCTGGCTTCTTAACTGACCATCTAGATAGGGAGACA
GACAAAAGCACATGAAAAGTGATGAGAATGAAAGAACAATATTTATTCTTTCTTACTTTC
CTTATCTCTTGGTGTTCTCTGCTTTAGCCAAATGCGTTGCCCGTTTATTCTTGAACAGTC
CTTCAAGATTCAGTGAAAAAGCCTGCCTTTTCATGATGCCTAAGTTCTCAATATTTTTGT
ACTTCCTCTGAACTCTTGAAACACTTGCTTTAGTGTGCTTAGTATAGCTAGCTTATGCCT
AATTTTCCTTTTATATGTGTGCTTCTTCTAATCTCATAGATGGAAAGTTTATTAATGTAG
AGTAAGACCTTGGACTTTCTTGAGGTCTTCACAGACCTTTTTCAAAATTAAAATCCCCTG
GATGCAACATCTGAGTCTTCTTCCTCATGTACCTACAGGACAGGGAGCGGGTTCCTCCCT
CCCTCTCTCCTGTCTTCCACCTCTCTCTCTCTCTTACTCACTCACTCACTCACTCACTCA
CTCACTCTCTAAGTTCCTCCTACTTACTCTAGTTTGTGGAATCCATTCCCCTTCAAGGCT
GGCTATGATCTTGGATTGCAGTGTGCCCAGCTCCTCTGGTTGTCCATGAACACAAGTCAA
GAAGCCCTTGCCAAGTATTTAACAATCACCATGGCAAAAGATAAGATAATGAAAAGTGAC
AAACAGGGAAACTTGGTCTTGAGTCCTGGTGTCCAGAACCTAGTGGAAGGTACTTGTCTA
AGCCCTTTAGAATGATTTTATTGCCCCCACTGCCAGATCCAGAAATTATTTTTTCAAGAC
TTTGTGTGACTTGTCAAAAATAATGCTTTGGACTATGAACTTGGCTGCAGTACATCAAGA
AAACCCTGTTGTATAACTCAAGTTTAAGGAATACTTTCTTGAACAAGCATGTGGGAATGG
AGATTCTGGGAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACTATGAACTGAT
TGAGCAGATAAACATAGGGTGAGAATTAAAAGAATTGAGAGGCCTATTACAAAGCCTTGC
CTAAAAGTTTTTTGTCAATTTGCAAATGTATAATTCTTAGTGAACTTAGACCTTTTAGGC
TATTGAATATTCTGCATTTATGTTTTGAAAATACCATTTAAAATAGACATTAAAATATCA
TTTTAAGAACACGTGTTCAACAGTTACTTTCATGGCACAACTTCTATCTTTCATGCACAA
TCTGTAACTGGTGAGTGTTGTTGCTGTCAGACTCTCAGTTTGTGGAAAGTTTTTCAACTT
CTATTATGTTTTTAGCTGTACTTTTTGCAATATATTGTATTCACACAAAATCTTAAGTTT
ATTGAAGGAAAGGAAGGAGGGGAAATAAATACTAGAAAAGTCTAAGCAGAAAAGGGATGC
ATGTAATAGAAAAATTCGAGTCCTTGTATGCTGTATCTTAACTTCTCCCATGAGATTTAC
ATCTTAACTCTTGCCATGAGAGTGCTGCCAGTAATCCTAATGTTTGGCATCCAAGAGCTC
ATAGGAAGAGAACTCAGGTGTGGGGTCTGATCAGATACTTGTTTCACTTGCTAGTTCTCC
GACAACCTGTCTTTCACCAGTATGGTGTAGATACAATGAAAATGACTAAGTATTCTTTTA
CTGGCTAAAGCGGGGGAGGGAGGGGGAGGATGAAGCCATTTTTTGTGTGTGGAAAAGTAG
AAAAGTTGTTATATTGCTTCACATAGCTTTTAATTCTCTCCATTTAAATTGGTTTGAGCA
ACATTTAGTAGAGGAAACTATTTCAGGATCACACTCATCACAGTAAAGAGCTGTGTAAAT
CACCTGTGTAAGTACAGTATCAACTTGAAGTGAATAGGCCTTAAAGGGCACTTGTGAAGA
ATTAGGGTCCAGTTTGCAGCAGCTGGTCTGAGACTCCTCTCTTTGCTCTTTCCTGCAGAG
CTGGCTGGACAGCTCAGAGCTGCTTGAGGAATTCAGAGACGGCAAGTAGAATGTTCTCTC
CACCACTCAGAATCTTGTCTAGGGATTCAGTCACTGCTGAACACCAGAAAGGCTTCATAT
TCATCTTTAAGATTACATGGAATTATTACTGTTTTAATAAGAGAGTGTTGGCTGAAATTG
AGGATGGTCTCAAGCTAGACTTTTCATTAACTTGGAACGAAACAACAGATGATACATTTA
TTTTCATCTGGCAAGTTGCTTAATGATATGAGACTGTTGTATATTTTGATGAGGCTTGGA
CCACATGGAAATTTGAATTAAAGATTTTAGAAGAAACCCTGAATTTAGAACCCTTTATGA
TGTAGCCTGGTTCCTTATGCACGTGAGAACTTTAAATCTGAAAAAAATCTGGCCATGGAC
ACAAATATAAGAAACAAATATCGAGAAACTAAGCTTACGAATTCTACCTTGTCATAGTTT
ATGCTGGAATAGTTGTATATATATTTTGTGAAGAAACCTACATTTTCAAATGAGTTGGCA
GAATAAAAGTGTTCAGTAAAATGGCAGCCTTTATTATCATGTTCTAAGTACTATGCTAAA
CCCTTAGGTAGGTGCCTGGCTCCATTTAATTTTTTTTTTTTTTCAGTTCTTTTTATTTTT
TATTTTTATTTTATTATTATTTTTTTTAACATTTTATTAGGGGCTCATACAACTGTTATC
CCAATCCATACACACATCAATTGTGTAAAGCACATTTGTACATCGTTTCTCAAAACATTT
TCTCTCCATTTAAACCCCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCGCTCCCCC
CTCCCGCATGAGCCCTCGATAGTTTATAAATGGGTATTTTGTCATATCTTGCCCTGTCCG
ACGTCTCCCTTCATCCACTTTTTGGTTGTCTGTCCCCCAGGGAGGAGGTCACACACAGTT
CCATGTAATCGGTTCCCTCTTTCCTACCCATTCTCCCTTTGCCCTCCCTGTTTTGCCACT
CACACCACTGGTCTTATAGGGCTCATCCGTCCTGGATTCCCTGTGGCTCCATTTAATTTT
ACTTAACTTTTTATTTTGAAATAATTATAGACTCAGGAAGTTGCCAAAAAAAAAAAAAAA
AGAGAAAAAAGTACAGTTCCATGTAGCCTTCACCCAGTTTCACCCAATGATATTATATTT
TGTGAAGTCATATTTTGGTTAGTTGGTGGGGGTAATGGTTAAATTTTAAAAAATATGTTA
GTTTTATACCATATTTTATACAAGGGGGCTTTAAAAAGTTCATGGAAAAATTCCATTATC
AATTTCATTTATCCGTGAACTTTCTGAAGCCCTCATATGAATAATGCCTTCAGCTTGTGT
AGAGTAAATTCTTCATTTTAACTTCCTGGCACAATCTGTTTCTAGATCAAGAATTGAAAC
TTATTTTTTCCTTACTGGCTCCTTAAGGTTACTGTTTTAACTATCAAAATATCATTACAC
AATCAAGTATGTAAACCTCTTGCCAAATAAAAATAAGTCCATTCAGATGGACATTTAAGG
TTAATTTCCAGTAACTTAGATTTAGTAAAGTTTTAGGTCTGTGATAAGATTTGCTATTTT
GCTATCTTTATTCCTTGAACTGTTCACCAGTGATTTTTTTTTGTTTGTGTTGGTAGAGGT
GAAGGCACCTTGGTGGCACAACATGTTGAGCATTGGGTTATTAACCACAAGGTCAGCAGT
TTGAAACCACTAGATCAGTGGTTCTCTACCGTTCTAATGATGCCATCCTTTAATACAGTT
CTTCATGTTGTGGTAACCCCCCCCCCAACCATAAAATTATTTTCGTTGCTGCTTCATAAC
TGTAATTTTGCTACTGTTATGAATCGGGTGACTGGTGAAAGGGTTGGTTGAACTCCAAAG
GGGTCGCGACCCACAGGTTGAGAACCGCTGTACTAGCTGCTCCACAGGAGAAAGACGAGC
CTTTCTGTTTCGCTAAAGATTTATATCCTCAGAAACCCAAATGGAGAGTTCTACTCTGCC
CTGTAGAGTAAGAGTCTAGTTGCAATAGACTAGATGACAGTCAGTTTTGGAGAATTTAGT
GTTAGCTTCAGTAAGAATACTTAATGAGCATCTATGTGTTTATATTACCTATGTATTTAT
ATTATATAATACTACTAATAAATGTCAATTGTAAGCACAAAACACAATACCTCATAAAAT
ATAACTAAACTAAAGAAAAGGAAAAAAAATGCATGTAATAATAATAGGATATAACTGCTG
TTAATTCTTGTATATATATTTTAGATATATCAATGCATATATAACAATGCATAATTATCT
AATTGCATAATTTCTATGATCATTATTGACTCTTACTAGTGTGGTATGCTTTTAAATTAT
GTTATTTTCATGCTAAGATCATTTTTTTCTTTGGGAGAGGAATATCAGAATATTGTGGAT
ATATCTTTTTAACAAAGAAATTGCTAATAATATCAAACTTTTTGTATTATATATATTTCT
ATAGCCATTACATTTATTTTTAATAGTTTATTGGCATATAATTCACATGCCATACAATTA
AATGAATTAAATACATAAAAATCAGTTGTGCAGTCATCACCACCATAAATCTTCGAATAT
TTTCTTCATCCTTGTATCCATTATTATTAGCTCCTCATTGCTCCCCAACTTCTTTCCCTG
CTACAACCCTAAGGAACTATTAATTTAGATACTGTCTCATACATTTACCTATCCTGGATT
TCATAGTGAGTCACAGGGGAAAACACATGAGGTTACATTTTAACCTAATGATATCTGCAA
TAATGCACTTCCCAATGCACCTTGAGGGCAAGAAAATTCACATCCCCAGTCAATGACCTG
ATAGAGTTCAGTGGAGTTTAATCCATGTGGGGACTCTGCGAATGGATTTTGGGTTTTCAC
TGGCATCCATAGCCTTCTGCAAGCCAGGTGCTCAGAATTTAAGTTCTAATACAAACCTCC
TCACGATCATGGATTTTATTATTAATAATCCTTTGATCACATGGGTTGGTGTACTTCTGT
GCAGAGCTAGAGTTGGACACTGTAGAATTCAATAGCACTCATTTACTAAGGCAAAACTCA
GTTTTCAGGACTAAGAAATGTCACAAGAAGCAAAGAGACTATGAAACTAACAAGTGTATG
GTAATCTGAAGCTGCCAGTTATTGAGTAACCTCAAAAGCAAGAGATTTAAACCAAGTCCA
GTGAGTTCCAGTGTCCAAGTTACCTTATGATAGCAGTCATCTGCTGCTTCTTACACTGTG
GCATTTCAGCTTTAAGTCCAAATGAGTATTCTGTTCCTTTAATCTACAAGAGTTATGTGT
AAGGTAAAGTCCAGTTCACTTAAGTGGGGTTTTCAAGTTGGATTCTTCTGATTTGGCCTA
TGAAGAATGCTGTATATCTTTTTTAAAAAAAAATCAAAAACTGAAATCTTAGGTAGCCTA
TACTAACACAGGGCCTGGATAGAAATTTGGTAAAAAATTCATGCTTAGGATCATACCGTA
TATACTCTAGTATAAGCTGACCCGAATATCAGCCAAGGCACCTAATTTTACCACAAACAC
TGCATTAAAAATGTGCTGGAAAAACTCGGCTTATACATGAGTGTATATGGTAATGCAAAT
CAGATTCTCCCTTTGGGGGTCTGTGTAAGGAATATTAAGCAGTTTCCCCTAGGGCAGACT
GCCCCTCCTTAGCTTACCCACCAACAGAAGTGATATCTCAGCCGCAGACACACCCATCCT
GTACTGAGCCCCGTTGCAGCAGTGTCTACTTGGGACGACTGCACAACCCCGCATGTCAGG
GTCTGTTTGGTCCTTTCCCTCTCCTCTTAAATGAAGAGCTGAGAGCCACTGGGGTACAGC
CGCCTCTGAAGAAGTGGTTTTTAAGATGTACAAATAAGGGAGTGATAAATAGACCCTACG
CATGGACAGACACACCACCATCTTGGTTGGGAGACTGAATTAAAAGATGATCTGACTTGA
GAACAGATGCCTGTCTCTATAGGTAGTGAGGTTACACAATATTTGTCCTGTTATGATCGA
CTGACTTCTTTTCCCCATGTTCTCCAGGTCCCTTCATGTTGTGAAGTGTTTGGTGGTTTC
ATCAGTGTTTTTTGGCAATACATAGTGTACCATTGTGTGCAGGAATAAAGTTTCTGTAGT
GATTCTACTGATAGGCTTTTGAGCTGTTTCCAACTTCTTGATATTATGAACAGTGCTGCG
ATTTACATGGGAGTGCATATTCCCGAACAGTGGTACGTTTACAGACCCACTGGAAAGATG
AGAGCTCTAATCTGTCTGCACTTTCTCAAATATTTTTTGTTTTCTATTGCGTTGGGTTGT
CATTTTTGCTACAAGGTGATATCTCATTGCTATTTTGATTTGCATTTCCTGAATGGCTAG
TGATTCTATGAGCATATTTCATGTGTTTGTTAGCCATGGAATATCATTTTTGGTGAACTG
TCTGTTCATGCCTTTGGTGCACTTTTTAAATTAGATTATTTGATTTTTTCTTATTGAGGT
ATTGCTGAATTCTAAAGATCTTAGAAACTAGTCCCTGTTCACTATGTCATTGCTGAAGAT
TTTCCCTAGTGTGTGGGCTCTATTTTTACTCTTCTGATGGAGTTTTTGATGCACATAGTG
TCTTATTTTTAGTAAGTCCCAGTGATCTGTGATTTTGTGATCTCATATTTTGTTTCTTAC
TGTGTGCTTAATTTGTTATATTTGATAGTATGTCTGTGCCCTGCAACAGGGCCCTGAAGT
TTGCCCCTGTTTTATTATCTATGATCTTTATAGCTCTTGAATTTGCATTTAGGTCTTTGA
TCCATCTTGAGTTTGTTTTTGTTTGTTTGTTTGTTTGTTTGTTTACATGGTGAGGTATGG
GCCCTATTTCATTCTTCTGCAGGTGGAGATCCAATATTGCCAGCAACATTTGTTGACGAT
ACCATTCCTTTACCAGTTGGTGTTTTTTTGCCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTTTGACTGGTTGGTGACTAATATAATTAGGATTTTGAAGTCGGAG
TATTAAGAAGTCTCTCTTACCTTTGTTAATTCTAAGGCCGTTATTTTGCTTATCCCTGGA
TCTCTACCCTTCCTCATAGGAAGTTAGTCATTAAATCAGCTTCTCCCATTGGTTTAAAGA
ATGAAGTTAGAATTTGGATCAGAATTGTATCGGTATTTATCGATTGCTTTGAGTATTATT
GTTTTTTTCCCTCATATTAAGTCTTTTTATCTATCAACATGAGGAGCCCAGGTGACATAG
TGATTAATTATGGGGGTTGCTAACCACAAAGCCAGCAGTTCACAATCATCAGGTACTCCA
CAGGAGAAGGATGAGGCTTTCTATTCACTGTAAGGAGTTGTAGTATCAGAAACCCACAGG
GGGCAGTTTTACCCCGCCCTACAGGGTCTCTGTGAGTTAGCCTTAACTCCGTGGCAGTGA
GTTTCTTTCTTTCTCCCCCCCGCCCAATCATTTTATTGGGAGCTCTTACAGTTCTTATAA
CAATGCATACGTCAATTGCATCAAGCACATTTGTACATAGTTGCCATCTTCATTTTGTTA
ACATCTTCTTTCTACTTGAGCCCTTGGTGTTAGCTCCTCTTTTCCTCCCTCCCTTGTGAA
CCCTTGATAAATTATTATTTTCATATCTTACACCGCTGTTTCCCTTCACCCACATTTCGG
TTGTTCTTCCCTTTTACGGGGGGCGGGTTGAGGGGGTGTTATACATTGATCATTGCATTT
GGTTCCTCCTTTTCTCCTCTTCCTCCCCCCATCTACCTCTTACTCTCTTGGTATCATTAC
TCCTATTTCAGTTCCTGAGGGGTTTATCTGCCTGAATTCTGTGTGTCTAGAGCTCTTGTC
TGTACCAGTATACATGCTCTGGTTTAGCTGGATTTGTAAGGTAGAGCTAGGGTCATGATA
TTGTGGGTGAGGAAGTTTCAAGGAACCAGAGGAATATTCTATTTTGTCAGTGTTATCCCT
TCCTTTGTGAGAGGTTGTCCAATTATCCAATGGGTTTTGGGTCTCCACTTTGACCTCCCT
TGTTCTCAACAATATAATTATTTGTTTTGGGTCTTCTGATACCTGTTACCTGATCCCACT
GACACCTCATGATCACACATGCTGGTGTGCTTCTTTAATGTGCACATTTTGCTTCCCTGC
TAGATGGCTGCTTGTTTAACTTCAAGCATTTAAGACCCCAGATGCTATATCTTTTTAATA
GCTTTGCACCATCAGCTTTCTTCACCACATTTGCAAATGCACCCATTTTGTCTTCAGGGA
TCGTGTCAGGAGGGTGAGCATCACAGAATGCTAGGTTAATAGAACAAAGTGTTCTTGCGT
TGAGGGAGGGCTTCAGTAGAGGCCCAAAATCTGTCCAGTTCCTCAATATAATACCATATA
AATATATGTACCATATATACTCCAGTACATGCTGACCTGAATATCAGTTGAGGCACCTAA
TTTTACCACAAAAGCAGCATTAAAAATGTGCCGGGAAACTCTGCTTATACAGGAGTATAT
ACAGTACATAGGGCAATACGTCTATTATTATGAGTTAACATATTTACAAATGTAGACAGC
TATATTTCTTCTTGAATGTTTTTGCTTCCTAGATCATGCCTCTGTTTCCTTTTCCCTTCC
TCCTGCCCCACTATCACTCACCCTTCATTTGTCTGTCAGTAATTCCTCTCGGCTAGGATT
CTGTTCCTCCAACACCACCAGGGTTCTTCCGCCCCCCTCGCAGTGACTCTTGATGCATGA
ACATGAGATAGTCTTCCATTTGTGTTGGTCTCTTTTGGTTTCTTGCCTTAGTGTCCTTTG
TACAGGTCTTTTCCCCCCTCCGATTAGTTTATTCTGGAGTATTTTATCTCCTGTGTGGCT
ATTATAAATGACATTGTTTTCTTGATGTCTTTTTCAGAGCATTCTTTGCTAGTTTAACAG
GAATCTGATGGATTTGTTTCTTAATCTTATATCCTGCCATGTTTGATCCTATGATTGTTT
CCAACAATCTTCTTGTTGGGTCTTTGGGGTTTTCTACGTATAAATTCATAGCATTTGCAA
ATATTCAGACTTTCACTTGTTCCTGGTCTAGTTGTATTCCTTTGATTTCTTTTTGTTGTC
TAATGGTTCTGGCTAAGACTTCCAGCATATTTTTGAATAAGAGTGGTAATGAGGGGTACA
TTTTTTTCTTGTTCCCATTTGCAGAGGAAATGCTTTTGGTAAGACATTGGCCATTGGTTT
TTCAGATATGGCTTTTTTTTTTGTAAGTCATTTTATTGGGGGCTCATACAACTCATCACA
ATCCATACATACATCAGTTGTATAAAGCACATTTGTACATTTGTTACCCTCACTATTCTT
TTTTTAAAAATTATTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATC
ACAGTCCCTACATACATCCATTGGGTCAAGCACATATGTACACCTGTTGCCCTCATCATT
CTCAAAACGTTTGCCCTCTACTTTAGCCCTCAATGAGTTGCTCATTTTTCCCCTCCCTCC
CCCCTCCACCCTCCCACCTGAACCCTTCATAATTCATAAATTATTATAGTTTTGTCATAA
CTTACACTGTCCAACGTCTCCCTCCACCCTCTTCTCTGCTGTCCATCCCCCAGGGAGGAG
GCTATACTTAGATTCTTGTAATTGGTTCCCCCTTTCTACCCCGCATTCCCTTCACCCTCC
AGGCATCGCCCCTCTCACCACTGGTCCTGAAGGAGTCATCTATCCTGGATTCCCTGTGTT
TCCAGTTCCTATCTGTACCAGTGTACATCCTCTGGTCTGGCCAGATTTGGCTTTTTGTGT
GTTGAGAAATTTCCCATTTATCCTTATGTTGTTGATGTGTGTTGGTATGGATGTTGGATA
TGGTAAAATGTCTTTTTTGTATTGATTCACATGATCCTGTGGTTCTTATTTTTGTTGTTG
TTGTTAATATGGTGGGTTGCAGTGACTTTTTCTAATGTTGGATTATCTTTGTGTAACTTG
TATAAATCTTACTTGATCACAGTGGTTTTAAAAAATTTTTTTCTTTAAATGTATAAATGA
TTGGATTCTATTTGCCAGGATTTTGTTGAGAATTTTTACATGTGTGTTCATAAGTGATAT
TGATTTCTACCCTAGTACCTTTACCTGGTTTGGGCTTTAGTAGGATTGTGCTTGTTTCAT
AAAATGAGCTTGGAAGATTGCTGTCCTTTCTATTTTCTGGAATAGTCTGGGTAGAATTGG
TGACAGCTCTTCTCTGAATTCTTGGTAGAATTCCCTGTGAAGCCACTTTTATTTCATTTG
GTTGTTTTATGATTTTGCCCTTTCTTTTCTAGATATTTCCACCTTCTCTTTCTAGTCTTT
TGTTAAGCTTGCCAATATTTTGTCAATATTTGTAATCCATTCCAAGAACCAACTTCCTGT
CTTGCTGATTTTTCCCCATTGTTTTTCAATTTTCCAATTCATTTATTACTATTTTAACTT
TTACAATTTCTTCTTTGGGTTGAGGGTTTATTCTGTTGTTCTTGTTCTAGTTGATGAAGA
TATTGTGCTGAGGGGTGAATTTTGGTTTGCTCCTTCTTTTTCCTGTATGCGTTGATTGTT
ATAGATTATAAATTGCCCTCTGCTAACTGCATTTGCTGTGTCCCAGAGGTTTTACTGTGT
CCCAAAGTTATGTTGTGGTTTGGTTCTATGTGTTTCAGGGAATTTTTGTATTTCATCTCT
TATTTGATCTATCACTATGTAATTTTTAAGTAGTGTGTTGTTCAATTTCCACTGTTGGTT
ATTTAGCCCCTGTTTTTTTTAAAAAATAGTTTATTTCTAGTTTTACAGCATTGTGGTCTG
AGAATATGGGCTCGGCAACCTTGATGGTTCAAAGTTTATTTAGTCTTGCTGAGTGGCTTC
ACTCCGTCTATTTTAGAAAATGTTCCGTGTGTACTGGAGAAGAATGGGGACTTGTTATTT
TTGGGTGGAGTGCTATGGATATGTCTAAAAAGCTGAATTGGCTGTGTTGTTTAGTTCTTT
GTGTTTGAGTTTCTTTTCTGATCTGTCTTTGCTTGAGAGTGCTGTATTGAAATCTCCAAC
TATTATTGCCTGTACTAATTCTCTCTTCTGTGAGAATTTGATTAATGTATTTTGAAGGTC
TCTCACTGGGAGAATATATGTTTAATATGGTTATCGCAGCTTGTCCCATTGCTCCTGTAA
TTATTATGTAGTGTCAGATTTTGTCTCTCCTCATGTGTTTTTGCCTTGCAGTGTATTCTG
TCAGAAATTAATATTGCCACTCTTACACCAGTTTGTTTCTATTAGCTTGTAATTTTGCTT
TTCCATCCTTGATATTTAGTCTATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTATTCTGGATTACTCTTATTTCACCCTCATATCTAAGGGATAGTTTTACTGGGTACAGG
AATTTTGGTTGGCAATTTTTCTCTCTCGATTTTATATGTCACTCCATTATCTTCTTGCCT
ATATGGTTTCTGCTGAGAAACCCAAACGTATTCTTACTGGTTTTCGTTTGTAGATGACTG
TTCATTTTCTCCTAGCTGCTCTTGGGATTCTGTCCTTTTCTTTGATGTTGGAGAGTTTGA
GTGGGATATGTTGTAGTTTTACATTGGGGACCTATTTATTGTGGTTCTTGTAGTTTCTTG
AATTGCTATTTTTTGCTCCGTGAATACCTATTTTTCCTCATTTACAGTGCTAGGGAAGTT
TTCTGTCATGGCTTCTTGTACTATTTTTTCCTGTAGATTTTTTGTTCTTGCTCCAGGATT
TCAATGAGAGGTCGTTTTATTTGATGGTGCTTCACATCATTCGTAGGCATGTTTCAGATT
CCTTTGATTTTTTTGGTTGTTTCTCTCCTACTATAATCTAAAGAATTGTATTCAAGCTCA
TAATTTGTGATTTAGTTTTCTTTAACTTTATTATTACGCTCCTTCCCCGTGTTTTCTAAC
GTTGCTACCTTATTTATCTTCTGGAGTTCTATTTGGCACAGGATTTCTAGTTTTTTAATT
CTTTCCTCAATCCATGGAAGGTATCTTAGCACCATTCCACTGAGTTCTGTTTCTGATAGT
TCCATGCTTGTTTCTTTAGAGTAATCCTCTGGATGTGGTTGTTGTGTAGTTGTTTGTGCC
TTGATTTTTTTGTGTGTGGTGTATCCTGCAATTGCTGTTTCTGCATGTGGCTGTTATTTC
TGAGTGGACTTCTAGGTCGTGTGGGGATAGTTAACACTGTTGACTGTTGCAGGAGAGGAT
TAATAGGAGAGGAACCAGATAACAACAACACAACAAAAATGACAGAAAGGAAAAACAAGG
GTAGAGAGAAGCAAAGGAACTGGGTGGGCAGCATTAAAGAAGGACTATAAGGTTCATAAA
GATCATGAAAAAATGTATTTTAAGAATGGTAATAAAATTAATAGATATCATAAAAATACG
TTTCAGAGGAAAAGGAGGGAAAGAACAAAAGAGATGGTGGAGGATGGAAAAGGTCGCATA
AAAATAAAAATGTACACTTAGATTTTTAAAAGATGCGCTGAATTAAAGATACTAAAAAGA
AGAGATGGTGCTCTTTGGTTTGGGAATCTTGCTGCTGTTGTAGGTTTGAGTGGGCTTGGG
GCACTTGGATGGGCGTGGTGTCAAAAATGTTGTTGGTGCCAGGTCAGGGGCCGAGGAAGT
GCCTGGGTCAGGCTGGTGGAGCTGGTGCTTGCATAGTGTGTCTTCAGTTAGTGCGGGTCT
CCAGGGATGAGTTCTACAGCTGGAACTCCCTGTGCATTGGCCCTGGGAGCAGCGCTCTCT
GGCGAAGGGAACCTTGATTACCGTCCTGCACTGCAGGTTCTCTTCTCCCTGGGAGGAGCT
GCAAAAGGGGACAGTGGGACGTTGGAGCGCCAGCATCAGCTGCCATCCCAGCTGGTGCGC
AAGTCACTTAGCTGCTGTTGCTGAAACTACAGAGGCAGGCTAGGGAGGGACCTGGGAGCA
GCAATAAATGTTATGCTATGGGATCTCTCATGGGGTCTCTTATTTCTCTTAAGTTGTGGG
GTGTGAAAGGAGTGGCAGCTGCTTCAATGACAACATTGTGTGGCAGTGCCACTGGTTAGT
CTGTGCAGCATCAGCAGTGGTGTATTTGTGTGGCTGGCTACGTGGAGGAGGGGCCAGCAG
TAGTGTCAGGGGTGCTGACTGGATGGTGGGGTCCTCCTTGCTGAGTGGCTGGCATGGTAT
GCCATCCCTGATGGATCCCCAAAGGAAACAGTGGCAAGAAGCAGAGGAGAAAGAGCAGAA
GAGGTGCTCCATGATGGGCACCAGTAAGGACCCATAGTTTGTTTGCTTAGGGATAGGGGC
GAGCATGTAGCATTGGCCCCACCTGCTGGTCAATGGTGGAGAGGCGACAGCTGCAGTGGC
AACTCTCAGTGAGGAAGCACATAAAGGCTGCCAGTAGTAGCCAGCAGAAGTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTACAATTCATTGCTTTTAGTACAGTCACAAAGTTGTGCAATCATCACAAGTATCTAG
TTTTAGAATATATTCATCAGCCCCAAATGAGACTTCGTACCCATTAGTACTTACTTGCCC
CTTTCCCCCACTTCCAGTCTATGTTCTGTATATCTGATTTTTCTATTCTGTGTATTTCCT
ATAAGTATAAGATGTAGCCTTTGTGTTTATCTTTTTTCTACTTAGCATAATTTTAATATA
CTTTACTTATATTATATTTTATATAATAACTAAATTATATAAAATAAAATACTTTTATTA
TGATTTAAAGGTTTATAGAGCTGATTATAAATTATACATGGATATTTTGTACACATTTTT
TCAATATATTCATTTCAATCCTCATTTTACTATTATCCCTCTTTCACCCTGTGTTTCCTA
TTTCTGTGTCTCCTTTCTAATATATTTTCTAGGTTCATCTATGTTGTAGCATGTAACAGT
ACTTCATTTCTTTCTGTGGCTGAATACTCCATTATATGGATATGCCAAATTTTGTTTATT
CGTTCATCAGTTGATGGACATTTGGGGTTGTTTTCACTTTTTAGCTTTTATGTATGAATA
ATGCTGCTGTGAACAGCAAACACACATTTTTGTTTGAACACCTCGATAAAAGAGGAAGTT
TCAAAAATTTTGTGGAAAAATGAACTTTTTGAAATGCACTGTATAAGTAGGATTGAAATT
ACTATTTTCTGTGGTTAAAATACGTTGAACCATTTGTGGATGTGCCAGGCTACTCTCCAC
AATGGTTGCACCATTTTATCTTTCCACCGTAGGGTGTGAGGGTTTGGGATTTTCCACATC
TTTGCCAGCTCTTGTTATTTTATTTTATGTTTGGCCATCTTTTTGGTGAGTGTGGTGTGA
TAATGTCATTGTGGCTTTGAATTACTTTTCCCTAATGACTAATTCCCTAATGTGCATACA
CTGGACTGCTACCCCAAAATTGGAGATTTGCGTCTACCCAGAAGTTCTTTAGAAGAAAGG
CCTATCACTGTGCTTATGGAAAACCAGCGATTGAATGTCCTATTGTGACACACATTGGGT
TGCCATGAATCATGGCTGGCTCTACACTTTCGGTTTGTTTTGTTTGAGACAGGACACACT
GAGAATCTTTCATTTGTCATTTGACCTTTGTATACCTTCTTTGGACAAATACATTCAAAT
CCTTTGACGTTTTGGGACTGTTTTCTGTTGAGTTATAAGAGTTCTTGATTTAATCTGGTT
ACCTACATTTATCACTTATGATAGGGCTTCAAAAAGTTCACAGGATGAATGAGGGGGAGT
GCAGAGTGGGGACCCAAAGCCCATCTGTAGGCAACTGGACACCCCCTCACAGAAGGGTCA
TGGGGAGGAGATGAGCCAGTCTCAGGGTACAGGGTAGCAACGATGAAACATACAACTTTC
CTCTAGTTCTTAAATGCAACAAATGCACAAATGTGCTTGGCACAATGGATGTATGTATGG
ATTGTATAAGAGTTGTATGAGCCCTCAATAAAATGATTTTTTTTAAAAGTTCACGGGAAA
ATGGAATTAAAAGATAATGGGCTTTTTCCCATGAACTTTTTGAAGCCCTCAGTGGATAAT
TTATCGGTATGCCTTTCCATACTATAGATTACCTTTTGCTTTCTTGATTGTGCTTTTTGA
AATAGGAAAGATTTTTTATTTTTATAAAGTGTAGTTTGTCTGTTTATTCTTTTGTTGCTT
GTGCTTTGGTTGCCATATCTAAAAAATAATTGCCTCATCTAAAATCATGATGTACACCTA
TCTTTTCACTATGAGTCAAAATTGACTTGGTATCAGGGGTTTTCTTTTAAAAGTTTTATT
GTTTTGATTTGTATATTTTGGTTTTTGATCCACTGTGAGCTAATTGTCCTTTATGGTATA
AGGTAGGTGTCCAATTTGATTTTTTGTATGTGACTATCCAATTGTGTCAGCACCATTATT
GAGTAAACTATTCTCTTTTTTTAGAAATAGTTTCTTTTTTTTCTTAAAAAACTTTTTTAT
CAATCATTTTATTGGGGGGGGGGCTCTTACAAATCTTATGATAATCCATCTTTCACTGGT
CTTAAGCACACTTGTACATATGTTACCTTCAACATTTCCCAAACATTTTCTTTCTACTTG
AGCCCTTGGTATGAGCTCCTCTTTTTTTCCCCCTCCCGCCGGCTTACTTCCACCCTCGTG
AATGCTTGACCAATGATATATTGTTGTTGTTATTTTGTGTCTTACACTGTCTGTTGTCTC
CCTCCACCCACATTTGTTATTCGTTCCCTTGGGTGGGCTATATATACGTACAACCTTGTG
ATGGGTTACTTTTTTCTACTCCCCTGTCCTTACCATCCCCCTACCCTCATGATACTGCTA
CTCCCACTACTGTTTCTGAGGGTTTTATGTGCCCTGAATTCCATGTGTCTAAAGCCCTTA
TCTGTACCAATGTGTCTGGTCTAGCCAGATTTGTAAGGTAGAACTGGGTCATGGTAGTGG
CAGCGAGGAAGCATTCTGGACCTAGAGAATTGATGTGCATTTTGTTGGTGCTATCCAGCA
CCTTGGTTGAATTGTCCCTTCCTTGTAACCCTTCTGTGGGTGGGATGTCAGTTGTTTACA
GAAGGACTTTGGGTCTCCACTCCAACCCCCCTCTTTCACATTGATTTGGATCTTTTGTTT
TGGATCTTTTGATACTCAATACTTGATCTCATTGACACCTAATGATCACACAGGCTGGTG
TGATTCTTTCATGCGGGCTTCCTTGCTAGATGGTTGCTTGTTTAACTTCAAGCCTTTAGG
ACCCCAGGCACTATGCAGTAGAACCCTGACCTCGACTTCGCTAATCTGTTCTTGAAGGAA
TGTCTAGAATTCGATGCAGTTGAGTTCTGAATCAATTTTTCCCATAAAAAATAACTGAAA
ATTGATTAATCCGTTCTCGATCACTAAGTTTTTACCCCAATCTTGCCTTTTAATACAAAA
CATTAAACAGAAATTTCAAAGTAAATAAGTTCAGAGTTAATTAATATAATTTAACTAAGA
AACACAACATTAAAAAAGTTTTTAACAACTACAGTATGGCCCATACCTTGAACTTGACGA
GGATCTGGATCTGTGACACAGATGTGGAGAGGAGGTATAGGGATGTTTGGAAGGAGAATC
CCCTTCCATAAAAATCAACTGGCTTTTTGAGTATTGATGCAGTTGAGTACTGGGGTTCTA
CTGTATCTTTTGATAGCCGGGCACCATCCACTTTCTTCAGCATATTTGCTTATGTACCCG
TTTTGTCTTCAGCAATCATGTCAGGTAGGTGAATATCAAAGAGTACCAGGTTACTAAAAC
ACAGTGTTCTTGTGTTTAAGGGAAGCCTGGAGTAGAGGCCCAAAGTTTGTCTGTTATCTT
AATACTTAACATATAAATATATGTACATTGGCCTCTATCCTTTTCATTATAAATGAATAC
ATTTACATATATACATGTCTATAGCTATACCTTTATAAATAGCTTTTGCCTCCTACTTCT
TTCCTCTATTTCCTTTCACCTTCCTCCTATCCCATTATCATGCTCATCCTCCGGACCCTT
ATAAGTATTTTCCAATTGGGTCTGATGAGGTGCCAAGCCCTGCCCCCTGAGTCAGAAGTC
TGTTTTTAGGATTCCTCAGGGACTTTGTTGCTTTGCTCCCCTTGCTGCCCTGTTGCACTC
CCTTTACGCTTTGCCCTGCTGTGCACCGGGCAGACCAGGCACACTTTATGCACAGTCTCC
AGTGATGTCCCCCATAGGGACATGGGTCAGTGAGGGAATGTCGTGTGTCGTTGTCATTGT
TGTGGTTGTGGGGCCGGCTCTATAGCTGCTCCAAGTGGGGATATCGTCCCCAGGGCATGG
TGGGCCATGATGAGGTTCTCTCTCTCTCTCTTTCTCCCACTTAGTTTTAACATGAAAGGG
TTTTGTACATTTTAAAGCTTTCATCAAGTTATTCTGTAGAAAAATTGGGTTACACTGTCC
TTACAATCAACAGTATATGTGAGTCACAGTGTTTTCTAAATCTTTCCTAATAAATGTATT
GGTATGAACAACCAAACTAATATAAAATAAGATTTGATCAAACATTAGTGAAAATAATAT
TTCATGGGTTCACATTCTTGACTTTTATTTTTCATTTGCTTGTTGTTTTCCTCATACATT
TAAAAAAAGATATTTTTGTCTTTTTCTTGCTAAGATTTAAGAACTCTTTATTTATACTAA
GCCTTGATCTATTCTGTTGTATGTGTGCATATACATATGTATTTTGCTTTTGATTTTTAA
ATGTTTTATTAGCGGACTTTTGGCAGGATGTTAGACCAAGCAAATATACTACAGAGATCC
TCTACAACAAATACATAAAAATCCAAATGAAACAGATGCCGATGATAATCTTAGATACCT
GAACTTCAGAGAAAAGGATAGAGAAGTGGATTGAATTCTAACTAGAAGAAGATGCTGAGC
AAAGTAGTGAGAGAAGAGACAAACCCATGAATTGTCTACTGTCCAGTTTTAGTTTTTTAA
AGTAACATTAGATTGAAACAGTGAACTGACAAAACAAATGCATACTTGTGACTGAGTATG
AAAATGCAATTGTGCCCATGGCCTAGCCGCATTTATACTTCTTACAGCCCCACCAACTCA
CTAACCACTACTGTACCAGCTGATCATCAAGAGACGGCAGTCAAAATCAGCTGTGCCTGT
CCTCAGTTGTGCCACATGAACTGAACAGAGAACTTTGTACACTCTCACATTCTTTAACAG
ACCTACGAGGAGATTGATGGTGAATGTCTGAGAACACTAGCATATCATCAATTAAATACA
AATACAAAAACAAAACAATTGCAGTTCACGTAAAGAAATAAGATAAAGTGGCTCAAACAT
GTGACCAAAATACAGCCAGAAGACCTTCTAAAAAATCGCATAGAAGCTGCTTGATAAGTA
GTTAAAAATAATGATATTTAGGTCATTTGAAATAAAATCGACAAATCCCAGCAAATCCCC
CCCCCCAAAAAAAAAGATGAAGTAGTCTGTGGTGAAGAAAGAGAAATCCAGGTTATCAGA
AAGAATAGCATATGGCCTCTTAAAGATTTATCATTAAAACAAGAGCCATCAAAATGAGGC
ATCAGCTAATTCCACATGGAAGCACGTCAGCATGCATGATCCAAGGATTGCATATAATAA
AATCCAAACCTGAGGAGGGAGTGGTATAAGAGCTTAAATTCTGAACCCCTGGTTTCAGAA
GGCTGCAATAACAGTGAAAACCCAAAGCCCATTTGCAGAGTCTCCCATGTAGATTAAACC
TTTGATGAGTCCCCTCTGACTATGAACCAGAGCTAGAAAAGGCCTTGTTACATTGTAGGA
TGGATTACTGCAATTGTATCTACTGCAGTGTGACACAATTGTCACTGATGTTGCCCTTGA
CTTAATGTATAATTGCTCCAGTTTTAATTTTCCACTTTGTTATCAATTGAGGGTTTTCTT
AGTTTCATTGTGTTGTTGTTGGGCTGTATTCTGTCTTGATACATGATTTCCTGTATATGA
AACCCAGATTAGGTAAACCTGTAGAGAGAACAACTGGATCAATAGGTTCAAAGGGATAAG
ACAAAGCAAGCTGGCAGGAAGTGGGGAGCTAATAACAATTATTGCAAGGAAGAGGAGATG
TCTTGGAATTGATTGTATTGATGGCTGCACAACTCTTATGAATGTAATTGAACTGTAGAA
GTGTATGAGATGTAAATTGTGTATTGGTTGAAATTGTTAAAAATGAACTATAAAAATAGA
AAAGGAGAAGATGAAAAGCACAAACAATGAAGTAGATGATATCATAATAAAACTAATGGA
AATAAAAAGGATGATAACAGAATACCATGAAATTTGAAAACCTAGAAGAAATAGACATAT
TTTCAGAAACATAAAAAGGCTACAAAGCAAATTGACAACAATAAATTCATAGCTACCAAC
AACAACACTGACTGTAAGTGGATTAAATACACAAGACAGCAGGAAAGAGTAGCAGAATGG
ATAAGAAAGCAGTTCACATTGGTCTACTGGTTATAAGAAACACATCTTAGATATAAAGAC
AAAACTAGAATAAAAGTGAAAGGATGGAAGAAAAAATTTCAAACTAATACCAATTTTTAA
AAAGTAGGCATGCCAAGACTAATATTTTAACAAAATAGACTTCAAGGCTAAATTAATCAT
TCAAGACAAAAACAAACAATTCCCCAACTCACTGTCATTGAGTCAATTCCAACTCATAAC
AACCCTATACACAGCGGTTCTCAACCTGTGGGTTGCGACCTCTTTGGGGGTCGAACGACC
CTTTCACAGGGGTCGCCTGATTCATAACAGTAGCAAAATTAGTTATGAAGTAGCAACAAA
AAGAATTTTATGGTTGGGGGTCACCACACACGAGGACCTGTATTAAAGGGTTGCGGCATT
AGGAAGGTTGAGAACCACTGCTATAGAACAAGGTACAACTGCCCCCGTGGGTTTCTGAGA
CTGTAACTCTTTATGGGAATAAAAACCTCATATTTCTCCCATGGGGTGGCTGCCTTATCT
TTCTCCCAAGAAGTGCCTGGTAGTGGTGAACTGCTGACCTTCTGGCTAGCAGCTCAACAC
ATAACCAAATATGCCACCAAGGCTTTGAGACAAAGAAAAGACAATGATTAAAGGACAATT
GAACAAGAAGATATAATCATAATAAATATTTGTGTACCCAACAAAAAAGCCTTCAAAATA
AACTAACTCTTACAGTTGAGTCGACAAGAGAAGTAGATAACACTGCAGTGGACTAGTAGG
AGACATCAATGCACCGCTCTCAAGGAAGGACAGAACAGCTGCGAAGAATGTAAAAAAGAC
TCAGAAGAGCTAAATCAAACAATCAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCAGAAGACAATAAAATAATAAAG
CAGAAGTAAGTGAATCAGAAAACAGAAGAAAATTAGAAATATTTACCAAGACAACAATTT
AGAGGAACAGCAAATATCAAATAAACAAAAAAGAGTAACATCACAAGAGAACCAACTGAA
AATAGAAAAGACAGTAACAGTACCACGAAGTACTGTACGCCAATGAGTTTGGAAACCTAG
AAGAACTGGACACGTCTGGAAACATACTATTAAATCAACACAGACTGACGTAGAAAACCG
CAACAAACCCAGAACAAAAGAAGAAATAGATCAAGCCGTTAAAAAACTCTCCTCGACCAA
AAATAAGTCTAAGACCAAATGATTTCACCAGGTAATTCTACAAAGCATTCAAGGAAGAGT
TGACACCAATTCTACACAAACGCTTCCAGAATATAGAAAAGGGTATTAAACTCTAAATTC
ATTTTATGAAGCAGGCATAACCCGGATACCCAAATCAAGCAAAGACATTACCAGTACAAA
AATTATAGACTGATAACTTGTGAATGTAGAAGCCAAAGTTCTCAATAAAATCGTAGCCAA
TAGAAGCCAACAAAATATATATAAAAATTCAAGTGGGATCCATGCCAGGTATAAAGGATG
GTTCAACATTAGAAAAGCAATTTAGCAGCCAATTAAGCCGATTGTCGTCCTCCTGGTGGG
GGCCGGTGTGCAATGGCTGCAAACAGCTAGCCTCCTTGGAAGTGTATGCAGCCCATTGGT
GTGTGTAGGCTGCCCTAAGGGACTTTGGAGACAACTCTTTGTTGCTTTCTGATGCCTCTG
GCCTGACTAATTTCTGCTCTCCCTAAATCAGACTCCAAACTGGGATGCCAGGTGCTCTGG
GTTTGAAACCTCAAGGCCTGGTGGCTAGAGTCCACACTGGCCAGGTTGTCATGTCTGTGA
CACTAAGCTCTAAAACAAGGAATGTGTGATTGAGGCCTTATGCAAGGCCAAGTTCAAGTT
CCCTGGGCGCCAGAAGATCCACATCTCCAAGAAGTGGGGCTTCACCAAGTTTAATGCCGA
TGAGTTTGAGGATATGGTGGCTGAGAAGCGCCTCATCGCAGATGGCTGTGGAGTCACATG
CATCCCTAAATGGCCCCTTAGACAAGTGGCGGGCCTGCATCCATGAAGGCCTTTGTAGCC
CTGCGCTGCCTCACTTGTACCCACCAAATAAAAAGTGAACTTCCTGATTTTAAAATAAGT
AATTTAATCCACCATATACATAAAACAATGGAAAGGAGCTACTTGGTCATACCAATTGAT
GCAGAAAAAGAGCATGACAGAGTCCATCACCTAGTACTGATAAACCACCCAGGAAAATAG
GAGTGGAAGAGACGATCCTTAGCACAATAAAACAATTACATAATGAAAAGGTGAGTGTCC
AACATAGCACTCAAAGGGGAGAAACGAAGAATTAAGCTTGCAAATGGGAATCAGACAAGA
ATGCCCTTTATCGCCAGTCTTACTCATTATTGTGCTGGAAGTTTTACAGCTATTAAGAGA
TCAAAAAGATATCAAAGGCATTTAAATTGACAAAGAAGAAGTAAAACTCTGTANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATAATTTTC
CTTTTTCTCTGCTTGCTCTTAGAATTTTTTCCTTGTTGATGATAGACATCTTGATTGAAT
TATGCTTGGGAGTTTTCCTTTTGGGATCTCCTTTGATTGTCTCCCTCCCCCTCTCCCCCA
GCTTCGTGAATAATATCTCTTCATGCTTTAAGTGCTGTGAATGCTTTCTTGCGGGAGTTC
TTGAACTATCCTCTTTGTGGATTTTTTTGTTTCTTCCTCTTTTGGAGCCCCTATAAGTCA
TCGTTGTTCCTCTTGATTGTGTCCCTGATTGTCTTCAGGCTTTTTTGGTATCTTATGCTT
ATTTTGTTATTTGTTCTTCTTTTATATTATAGTCTATAGATTTGTCTTTAAGCACACTAA
TTTGGATTCCATCTATTCAATTCTGTTTTTCTGTTTTCTGATTCTGTAGTGTTCGTTTGT
GTTTCTGTCTGTTAGGCATGTAGTGAGGTTTCTAGCTTTTCTGTTTTCACTTTCCTTCCA
GTCTCTTCCTTCGTCCGTTGTATGAGTGCCGTCATCATTCTTGTAAATTTTTTTTCTGGT
AATTCCTTAGCCTCTTCAATTTCAGGAATTTCATTTAGCTCTTGTTGGTGTTGGTTATAT
GTGTATATATCTCTCTTGTTCTTTTTGCGTGAACTGATATCTGCTGTTGTTTCCTTAACC
TCTTGGTGTAGCTGTTAGATGTTTTAGGGAGGTGGGGTTATGTGGGAGTAAATTCTGTTA
GGTAGTGCATTAGAGCCATGGTAAATACTTTAAATTAAAGTCTTGGGGGAAGAGTGTGAA
AGGATAGAGAAAGAAAGGAAGAAGTACACAAAAAAGGAAGGGATCTTTGATGTTACTTGA
TAGGTAAATAGAAAGGAAATTAGACCCCCCAAAAATGTCAGTTTTGCAATGAGAGGAATG
GGTAATAATATTTGATAGAAAAAAGATGTAAGAGTAATATAAGCTTTCGTTTTATGTAAA
TGAGAAAGAAGGATTAATGAGAAGAAAAGAAAGAGAAAAAAAAGATATATTAAGCAGAGC
TATGAAATAAAAGTTTAGTAATTAAAATTAAGTAAGGAAAGGGCAAGAAACAAAAGAAAC
AAAAATTGATAATAATAATAATTGAGATAGCTGTTAATGTAGGTTTGTTTGGGCTCTAAA
CAAAGTAACATAATTGTAATTTCTCCCATTGTCCTTATGTATACCATCATGATTAATGGA
GAAAAGAAAAGATTAAAGTTGTCAAGGATTTCGTCTTTCTTGGATTTATAATCAGTGCTC
TTGGAAACAGCAGTCAAAAGGTCAAAGGACGATTGTCTTTGGTAAATCTGCATAAAACCT
CTGTAGGATGTTGAAAAATAACAAAGCTACTTTGAAGACGAAGGCGAGCCTGACACAAGC
GATATTACTTTCAATCACCGCACATGCGTGTCTAAGTTGGACACTGAATAAGGAACATTG
GAGAAGAACCGATGCAAGTGGATCATGGTGCTGGTGAAGAGAATCAAAAATCCCGTGGAC
TGCCAACAGAACACACAAGTCTTAGAAGCCCAGCCCAGCCAGCTCGCGCCTCAGAGACAA
GGACGGCGAGACTGCATGTCACACACTCTGGACTATTGTCCAGAGAGACCTGTGCTTGAA
GAAGGTAAAGGAGAGGAACATTGGCAAGAGGAAGACCTTTAACAAGCTGAACGGACAGTA
ACTGCAACGATGGGCTCAAGCATACGGACAGTTGTGAGGCTGGAGCGCTGTTTGTTGTGT
TGTGCGTAGGGTCACCATGGTTAGGAAGAGTCTCAATGGCTCCTAACGACAACAACACCC
AGCACAGTTAAGAAATGCTGCAAAGGCTACTATTATACTTCCAATAAGACTTCTTATTTC
ATTTAATTATTTTGGTTTTTAATATTTCTAGACATAACCACTTCAGTTACCCATGAAATG
TAACATTAAAATTAAGATAACAATTTATAAAGTCATCTTTTTAAAATTTTANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCA
TCATTGTTTTCAAAACATTTTCTTTCTACTTGAACCCTTGGTATCAGCTCTTCTTTTTTC
CCCTCCCTGCCCCACGCTCCCACCCTTATGAACCCCTGATAAATTATAAATTATTATTTT
CATATCTTATACCATCTACTCTCTCCCTTCACCCACCTTTCTGTTGTTTGTCCCCTGGTG
GAGTGGGCGGGGTGTTATACGTCACTCATTATAGCTGGTTCCCTGTTTCTCCCCTTTCTC
CCCCGCCTTCCCCTTACCCCCATGGCATCACTACTCCCATTATTGTTCCTGAGGGGTTTA
TCTGTCTTGGATTCCTTGTGTCAAGAGCTCTTATCTGTACCAGTGTACATGCTTCAGTCT
AGCCTGATTTGTAAGGTTGGCTGGGGTCATGATAGTGGAGGGGGAGAAATGTTGTATGTT
CCATCAGTCCTATGCTGTATCCTGGCTGACTCGTTCCTTCCTTGTGACCTTTTCCCCAGG
GAATGTCCAGTTGTGTATAGATGGACTTTGGGTCTCTACTCTGACTTCCCTCATTTGCAT
TGATATATTTGTTTGTTTTGGGTCTTCTGATACCTAATCCTGTCAACACTTTGTGATTGC
ACAGGCTGGTGTGCTTCTTCCAAGTGGGCTTTATTGCTTCCTTGCTAGATGGTCACTTGT
TTGACTTCAAGCCTTTAGGACCCCAGACGCTATATCTTTTAATAGCTGGGCACCACCAGC
TTTCTTCACCACTTTTTGCTTAGGCACCCATTTTGATTTATTGTGTCAGGAAGGTGAACA
TCATAGAATGCAGGTTACTAGAACAAAGTGTTCTTGCATTGAGGGAGGACTTGAGTAGAG
GCCCAATGCCCATCTGCTACCTTAATACTTAACAAATATGTATTTAGGCCTTTATCCTTA
TCGTTATATATTAATATATTTACATATGAGCATGCCTATGTATAATTATACCTCTACACA
TGTCCTTTGCCTCCTAGTTCTTTCCTAGATTTCTTTTTACCTTTCCTTCTGTCCCACTAT
TCTATTTGACCGTCATTCAGCTCTCAGTATTTTCTCTTGCTACGTTGCATTTGATCAAAT
TCCATCAGGCATTCTACACCCTCCGAGTCATCAATTTTAGATCCCTTATTGTTCCCTTGT
CCCTGGGTTTGTTGCCTCCCCACCTCCCTTTCTCCCATCTCTCTACCATGTCCACCTGGA
GCCTTTGGCCCTGTATTTTCTGCTGGCATTGTTTATCCTGCTCTTATATGGGATAAGATA
TGCAAAAAGAAAAAAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTTGTAC
TTGTCCTTTTTGTGCTTGGCTTACTTCACTTAGTCATAATTTCCTCCAACTCTTGCCACG
CCATGATGTGCTTCCAGCATTCTTCACTGCTTTTTAGGGATGTGGCGTACTCCATTGCAT
GTATATACCAGAGAATTTTAATCCACTTGTCAATTGATGGAAATTTAGATTGATTTCTAA
TTCTTTGCACTTGTGAACTGAGCTGCGATGAACATTGGAGCACAGATGTGTGGTCGTGGT
CTGTTTCTTACTTCTTCTGGGTAGATGCCCTGTAGGGGGATTTCAGGGTCATATGGTAGC
TCAAATTCCATTTGTTTTAGGTATTGCCAAATCAATTGCTATGTTGGCTACATATACTTA
CAGGTCCACCAGCAGTGGATGAGAGTTCCTATCTCACCACACCCTCTTCAACACTTGTTG
TTTCGTGAATTTTTAATTGGGCTATCTTTGAGAGTATTAGGTGGTATCTCATAGTTGTTT
TATTTTGCATTTCCCTTATGGATAATGATTGGGAACATTTTCTCATATGTGTGTTGGCCA
TTTGGATTTCCACCCTCTATCACTTCCAGCACTCCTCTTGTGGAGCTTTTGGGTTTTTTC
ATATATAGGATCTTATCACCTGAGAATAACGATAATTTCACCTCTTCTTCTGCCAGATGA
ATACCTTTGATATCTTTCCTTTGCTTTAGGTCAGGGGTCCTCACACTACGGCCCATGGAC
CACATGCAGCCCACTGAGGACATTCAGCCGACCCGCTGGGTGGTTTTGCCGCCACTGCCT
GTCCTGCTTAGCAGCCAACTCGTCCAGTGTGCATAGGAATTTGTTCATAGTTTTTAAAAA
AATCTATAGTCTGGCCCTCCAATGGTCTGAGGGACAGTGAACTGGCCCCCTGTTAAAAAA
AGTTTGGGGACCCCTGCTTTAGGTTGTTAGCTAACACCTCTGGTATGATGTTAGATAGAA
GTGGGGATACGGGATATCTTTGTTTGGTCCCCTTTTTTCAGTGGGATTGTTTTCATCTTT
TCCGAATTGACTACCACTTTGGCTTTTCATATATGTAGCTTGTATTATTTTGAGGAATTT
TCCTTCTATTTCTATCTTCTTGCGCGTTGTAAACACGAATGGCTTTGGATGTGGTCAAAT
GCTTTCTCTGCATCTGTTGATATCATCATGCTGTTTTTATCCTTTTTCTAGTCCATGTGG
CAAATACTGCCGATGGGCTTTCACATGGCACCATGCCTGCATTTCTGGAAGGAATTCCAC
TTGGTCATGGTGAATTATTTATTTTATAAACTTTTGTATTCTATTGGCCAGTATTTTGCT
AAGGGTTTTTGCATTGATGTTCATTAGAGATATTGGTCTGTAGTTCTCAATTCCTGTGGG
ATCCTTGCCCACATTAGGTATCAGTGTTATGCTAGCTTCATAGAACAAATTTGGGAGTTT
GCCATCTTTTTCTAAATTCTGGAAGAGTTTGTGTAGGATTGGTGTAATATCTTCCCTGAA
TGCTTGGTAGAATTCTCCTGGGAAGCCTTCTGGCCTGGGGGCTTTTTCTGTTGGTATTTC
CTTGATAACCTTGTCTATTTCCTCTATTGCTATGGGTCTGTTGAGGTTCTTGCCATCCAT
CTGGGATAGTCTAGGGATGGCTTGCTTTTCCAAGTATTTGCCCTTGTCTTTCAAGTTGTT
GAATAAGAACCAGCTTTTTTGCTGCATTGATTTTTTTTTTTTTTTTTTTGGCATTGTTTT
CTTGTTTTTCCACTTCTGCCCCGAATTTCACTACCATACATACTCGAGTATCAGCTGACC
CAAATATCAGCCGAGGCACCTAAATTTACCACAAAAACTGCATTAAGAATGTGCTGGAAA
ACTCGGCTTATACATGATTATATATGGCATTTCTTTTCTTTTCCTATTCGTAGGATTGTC
CGGTTAGCTCTGCTCTAATTGCTGGAGATTTTATGCCAGCGTATCAATCATAAGTCTCTT
CCTTTTTCATGTGTGTACTTATATTGCTATCAAACCTCTGAGAACTGTTTTTGCTGTGTT
CCAGAGGTTTTGGTACCCCGTGTTCTCATTCCCATTGGTTCCTAAAAGCTTCCAGATTTC
ATCTCTGATCTTTGGTCAATACCCACTCATTTTCCAGTAGAGAGTTAGTTATTCATCCTC
CAATTGTTTGCCCTTTTCCCCCTTAATCATCCTTTTGTTGATTTCCAGCTTTATGGCATA
GTGACCCAGGTGAGAAGTCTTGAGCGACCTCTGTGTGCTTGACTTTGCATAGGCGTGACT
TGTGTCCCAGCAGGTGGTTTATTTTAAAGTATGTGCAATGTGGGATTAAAAAGAATGTGG
TGGTGTTTTGTTTGTTTGTTTGTTTCATTTGGGTGGAGGGCTCTGAAAATGTCTATCAGG
TCAAGTCACCTCATTGTAGAGTTTAGGTCAGTAGTTTCCTTGTTAAGCTTCTTTCCCCAT
GATCTGTCTTTCCTGGAGAGCAGTGTATTAAAGTCACCTACTATGATTGTTGAGCCTGAT
TTCTTTTTTCATCTTTTGGAACATTTGATTGACGAATTTCACGGATCTGTCATGGGTGTG
TAAGTGTCTACTATGCTCACTGGTTCTTGGTGTACTTACTGATCCCTGGAGCATTATAGA
TTGCCCCTCCTTATCTTGTTAGGGCTTTCTCCTTGAGATCAATTTTGTCAGAGATTAGGA
TCACAACCCCTGCTTTTTTTGAATTGCCATTTGCTTGGTATATTTTCCTCCAGGCTCTTT
TGGTTTGCTAGCTTGAGATGTGAGACTTACATTTTAAAGGTGAACAGTTTTCTGCAACCT
ATAATACTTGGGTTTCCTAATGATTTTTGTGTAGAAGCTTTAGCAGCATAGTGGATTACT
CATTGGACTGTTAGCAGTTTGAAACCCCCAGCTGTCCATCAGGAGAAAGATGAGGCTTTC
TACTCCTGTGAAGATTTACAGTCTTGGAATCCCACAGAAGCACTTCTAATCTGCCCTATT
AGGTCCTGGTGAGTTGGAATTGACTCAGTGGCAGTGAGTTAGGACAATATTCACATACTA
TAAAGTTCACCATACCAATGCCTTCCAGTTAGTTGTCCAAAGAACTGTCTTCCAAATGTA
TTGGCATAGATAAATATGTGCTTCTAGGGTTTCATCAGCTTGTTGAAACATTTCTATTGG
TATTCCATCAATTTGTGAAGCCTTGCTTTTGGCTAATGCTCTCAGTGTAGCTTATTTCTT
CCATCATAGCATTATTTCTTGTTCATATCTCTTGAAATGGTGAACTGTCAACTAATTCTG
TTTGGTACAGTGGCTCTGTGTATTCTTTCCATTTTGGGGCTGGGGGATGCTTCTTGCATC
ATTCAATATTTTGAATTCTAACAAATCTTTCAGTATTTCAACTTGAGGCTTGAATTTTCT
TCTTCTTTTTTTAAAATGTAATTTCCCCCCAACATTTTTATTGGCACATAATTCACATGT
TATACAATTGAACAGTTCAATCGTTCAATTGCATCAAAGGGAGTTTGTGCAATCAGTCAG
TTCTAGTGCGCCTTCCCCACTCCTGCCCTCATTGTTCACTTCCAAAATCCCCTTCCCTTT
AGATCGCCCACCCCCTACCTGTGGATTCCCTTCAACACCTTGTAACAATTAGTATCATTG
TACATCCATTCTTCCTGTGCTTCACTGCTGAGAAACCCAACAGGAAACAATGCAAGACAA
ATCCCACTAAAGTGGTAAGGATACAATCATATTAGTATAAAAGGAAAAGTACAAACGATG
CGTAAGAGAGAGAAGACCCCCATCAACATTCAATAAGCCAGGGAAGAAATTTTTGTCCTG
AACATCTAAGAGATATTTGCACCCAGTACAATTCAGGTCGTGTCTATAGGGAGGACAATT
GGCCTGGTCCCGAGTTCAATCTTGCACAATCAGATTGCAATGTTCTCTGCCTGTTAGTAA
GGCTGTTCTGGTCTCTTGCCTTGGCTAGAAGGATCTGTCAGCAGGTCGGTCTAACTAGAT
GCTCTATAGATAGATGGGTTTGGGGCTCCCACTGTCCTCCATAGCCTTCTACAAATTGGG
TGTTCATAATTTTAGCTCTGATACTTTTCTCTTCACCATACCAAATTTTGTAATTGTTAT
CTTGGATCATACAAGCTGCTGTGCTTCTTCTGTGTGGATTTATTTGGCTCCTCACATTGA
TGGCTGCTTGTTTGAATAAAGCCTTTAAGACTCCAGACACTCTTCTGATCGATAGCCAGG
CACCATCTGCTTTCTTCACCACACATTGCTGTAGCACCCTTATCTTCAGTGATCATTTCA
TAAAGGTGAGTATTGAGCAGGGCCATGTGATCAGAACTAACTGTTCTTGGATTGGGGCTA
GAATTAAGTGGGGACCCAAAAGACATCTGCTTGTCCCTGGGATATGCACAACTCAGGTTT
ACTTTGGTGGTCATATTATGATACAATCAAAACCCCATAAGCCCAACTAAAGGGTCATTG
CTAATCGAGCTGAACTTGATGGATGGCTTTTGATTTCTTTGGGGAGACATTTTTAGTCGT
CACTACTGGGGATGTGCTTCTGGCATGTCGTGGATAAAAGCTAGGGATCCTGCTAGCTAG
GCACCGGGCAGCCTTCATAACACACAATTATCTGGCTCAAATGTCAGTAGTATTAACATA
GAACACCCTAAATTTAAGTCATCGGCATGGTTCTGAGATGGAACATTTATCCGTTTGTTT
TTAGAGATAAGAGACACAAGGTTGTGATTCCAGTCTAAGTCCATCTCACCTCAGAATGTT
GAACTTTTTTTCATTGCTTATTCATTGTTGCAAAATTTGCCCTCCTAATCTCTTGTGTAT
TTGCACATCTACCAGCCTCAGTCTTTGACTGTTCTAAATGGATTGAGATTGGTTTAGGTT
TTATGTCACAACGTGATGGTAAGATGACAATATGTATTGTCTTCTGTGGGGTCAGCCTAC
AGGCCATCCCAGCATTTGTCTGTAATTGGGGTCGACTAACCTTAACTTAATTTTAACTTA
AAAATCCATGCACATGGAATCAGCAGTCGGGAAACTAAATTATGTATTTCATTGGCCAAA
TCTGTTGCGCAAAACCTTTTAAAAGCATTAAAGACTAAATATGTTACTTTGAGAAATACA
GTGTACCTGACACTGGCATCTTTATTGCCTCATTGCATGTGAAAGCTGGACAATAAATAA
GGAAGACTGGAGAAAACCGATGCCTTTGAATTACCCTATGGGTAAAGAATATTGAATATA
ACATGGACTGCAAAAAAACCCCACACCTGTTATGGTGGAAGTACAACGACAATGCTCCTG
AACAGTGGGGATGGCAACACTTCATCTTACTTACTTTGGGCACATTATCAGGAGAGACCA
GTCCCCTGGAAAAGGACATCACACTTGGTAAAGTAGAGGGTCAGTGAACAAGAGGAAGAC
CCTAAGGAGATGGACTGACACAGCAGCTGTAACAGTCGGCTCAGTCAATAATTGTGAGGA
TGGTGCAGGACCCAGCAGTGTACATATGAATCCCTGTGAGTCTGCTTACTCAATGGCACC
TAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNAGGGTGCAGTATAGCACCGAGAAACACACAATATC
CCTCTAGTCTTTAATGCTTACTCCCTTCCCTCCTCCCCACCCCCACTATCATGAACCCAT
TTCTACCTTACAAATCCAGTTAGACTCGAGCATGTACACTGGTACAGATAAGAGCTCTCG
ACTCCAGGACAGATGAAACCCTCAGTACTAATAATGAGAGAAATGATGCCATGAGGGTAG
GAGAAAGGTGGGGGTAGAAGACGGAGAATGGGGGAACCAATCACAATGATCGACATACAC
CCCCTGCCCCCCCCCTCGCTGGGGGACGAACAACAGAAACATGAGTGAAGGGACACAGTG
GATGGTGGAAAATATGAAAATAAAAATAATTTATAAATTATCAAGGGTTCACGAGGGTGA
GGGAGGGAGGGGAAAAGGGGAGCTGATACCAAGGGGTCAAGTAGAAAGAAAATGTTTTGG
AAATGATGGTAACATATGTACAAATGTGCTTGATACAATTGATGTATGCTTTTTATAAGA
ACCCAAATGAAAAATGATTTATTTTAAAAAATTTTTACGGTATCCGAAACCCTATCTAGG
GTCATTGTGAGTTGGAATGTATTTGAAGACAGTGGGTTTGATTAACCTTAACTTAGTTAT
GAGATGAATCCTGCTTAGAGAACAAAGATTAAGGATTTGTATCATAATGTGACAAGAATG
TATAGTTTCATTTTATGAATGAAGGTTTTACATGACAAGTACATGATAAGATCAGTGTGA
AAGAAATGTTTCTGTGTTGTAAACTACCATTAGTGAGTTGAATATTACTTTTAAGAAGTT
TTCTGTGCAGAGTATTTCCAATTTGAACCTGAAAGTTCATACTATATTATGTTCATAGAT
ATATTTATATGTTGTCTTTGTATATGCCAATACCTATGAGACAGAATTTCAATTCTGTGA
AAACATTAATAAAATATTTTGTAGTACCGAAAATTACCACTAGAGGGTAGCAAACTCCCA
TATTGCTCCCTCTTTTGGTGCCTTTCATCAAATACCCTTAATATAATAATTTCTTTTTCA
GGTCCAGATATTTGGAAGCTTTAAAACTGGCTTGTATTTACCTACAAGGTTAGTACATTT
GTGAGCTTCTCAAAGGATTTAACATTTCTAGAGTGTATTCACTTTGACTAATCAATATGT
AAATATAGAAACAAGAACAACCAGACTCTTGAAACAAAAATTTATTTACCTGTGTTTTAT
TTGGATTACCTTGAGACAGATCATCTTATCAAGTCTTGGGTGATACAGATTAATATAAAA
GCGAATATGGACACAATCATAGAATCTGTTAGTCACTAATTTTAGCACTTAACTACCCTG
CAGAGAATTCTGTATTCATCATTTACCTCATGAGCACAATGTAAAGGACGTGAGACGTTC
TGGGTGTACTGTGGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGT
TAAAAAAAAAAATTATGAAGGTTGAACAATAAAAAAAAAAAAAAAAGAAACTGTTTTGAA
AACGATGATGGCAACATGCATACAAATGCGTTTAATACAATTGATAGATAGTTAGAATGG
TAAGAGCACTCAACAAAATGATTTTTATATATATATAAAAGAATAACATAAAATACATAC
GTTTTCTTGTCTACATAGTAGAACTGAGCTACATAGGGTTTTAACCTCTCCGGTGGTAAT
CCTGAGGGTGCCTCGCGATAAATGTTAACTGTCACAAGCCATAACCCGAGGCACCCTCGG
GTTACACTGCAGAGAGGTCCCTTAACTGCGCCCCGGCCTAGCGGTGTGCTCTGTGTTTTC
ACGAAGCAGAACGTGGGGACCAGTGACCAGAGATGACATTTGGAAATGTCTGGGCCGAAT
AATACTTCAGGGAGCGGTGGGGAACCCCTGCGGAAATGGTATTAGACCACCAATACATTA
CTTGCAACTCCATTATTTGGCACCGACATGTCAGAATACAGATTTTCCCTGATTATGAAC
TTTTTTTCACTTCACAAACAATGGAGAATTGGGGTACAGAATTACTGACATAGTTAGACC
GCCAGGGGGTTAGAAACTGACCTTGTGGAGTCATAACTGCCAGGCTTGTTTTTCAAGGTG
CCCTTGGGTAGGTTTGAACTCCTAACCTTGTAGCTGTAGTCAAGCACTTAACTCTCTTCC
CACCCAGGGACTCCTACACATTACCTTTTTAACTTGACATTTGTACAGGGTTACTTCATT
CTTTTTGGTGGCTACTCCCTAGCCCTTTTCTGCAGATGTATGGATTCATTCACAAGTTCC
ACCTTGATATGTACGTAGAGCTATGGACTACACCTAAGGAGCTACTAAACCTCAAGGTGG
CACTTCAAACTCACCAGCTGCCCCTCAGGAAAGAGACGAGGCTCTCTGCTCCCATGAAGA
CTTAGAGTCCCTGAAACCTGAAGAGTATTACCCTTTTTTCCCAGTGTTTTTGCTGTTATA
AAAAGCTGCTGTGGTGAACATCTTGCTACACATCTTATTCACACTTGCAAAAAGGTTTTA
GGAAGATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTAGAAAAAAAA
ACTGAGAAACGTTTAAACCGAAATCTTAAGTGGAATGCTTTTCTGGTCACTTATGGCTTT
TCACCTTAACCTCAATAATTAAAAAATAATAAATTATTTTAAATAAATTATTATTGAATA
ATGTTTTTAAATGATTAAGAATTTTGCTTTTAATCCTCTTATGTTCTGATACTTTTGAGA
CTTTTCACTGCAGATTTTAACATGGAAAGGTGTGGTTTGCTTTTTGTAAATGTAAGTAAT
AGTATGAATTTCCCAAAATAAGAGAACAAGAAAGCAGCTAACCTTGAACTTAACCATCTG
AACTAGAATTCTTAGTATCAAAAGCATATTTATGTGGGACAGTGTTGTCCACTGCCTGAC
CCAGGACTTCTCTTTGATGCACTGGGCTAAGAGCATGTCAGCATCCTGAGCAGCCACAAA
ATGCACCTGTAAAAATCCTCTCTACCAATTCATACCTCCCCTGGAGCTTTAATATTTTCT
ATGAAAACAGTACAGCCCTATTATTCTATTATCTGTTGTCTGTTTAGAAACTATTACCCC
ATTTCCTTTTGGCTGCTATACTTTGCAAAGCTAAAACAATATTGACTTAGGATGTTATTT
ATATCCCTCCCGCTATAATAATTTAGAAAAAATTTAATATGATTTCTTCCTTTTTTTTTC
TTTTTTCTTCTTTTCTGTTTTAGTTACATCCCAGGGAAGATGCTTGCATTCCAAATACAA
ATTATGGTGTTCTCTTAATAGAATTTTTTGAATTATATGGACGGCACTTCAATTATTTAA
AGACTGGCATTCGGATAAAAGATGGTGGTTCATATGTAGCCAAAGATGAAGTACAGAAAA
ATATGCTCGATGGCTACAGACCATCCATGCTTTATATTGAAGATCCTTTACAACCAGGTA
TTAAAATTAGGTAAATTGGTGGGCATGAAATGAGAGGGTGTTTTTAGTATTTTACTTTAT
TTTGAATGGAAATGCCTCACTCCCAGTAGAAGTAGAATCCACTCGACTCTTAAAAACAAA
CAATAGGCCTGCGTGGATTTGTGTGCATCTGCAGCATAAAGATTTCTTTTCTTCTCTCTC
TATTTCCATTGCTCACAATTCTAACCAGTTGTCAGTGGGGGCTTTAGTGTGATCATTTGA
AAACTCTCCCAAGTCATGAGCATGGCGACATAGTTCTGGATTCATGAGCAAAAGGACTCA
CAGAGATGTTTTTTCTTTTGAACCCTTTCTTTGCTCTTTATTTTTGTATAGTCTCCCTGC
ATCTTTACCAAATTGGTGCTGGCTTGAACGTGAAAAGGAAAAAGAAAAATCCCTTTCTTT
ATTTTCCTTCAGCTGCAGTATGGGCTCACGCCCAACAATAGCGGTGAGGGGGTGGAGGGC
CAGGCAGTGTCTCCCTCTGTTGTACACAGGGTCCGGCCAACCCAACCCCTGAGAACGCAC
CTCTTTGCTTGCTTGTGTCTCAGTTTTTCCGCACGTTTTTTATTCTGATATAATTGTAAA
AATTCTAGACTTTGCATGATTAGACTCCAATGTAAATGCTTTTAAATCATTTCCTTTAAT
GTATGAACTCGGAAAGGGAGGTGGGAGAAATGCTGGCTGTCTGGGGGCTCTTTGCTGGTT
TATGGAGCTATCTTTTCACATGAACAGTTTTGTGTGTTCATTCGTCCAGGAAATACCCAC
CACGAGCCTGCTTTTACTATGCAGAGGCCTTTTACAGAGAACATTTAGGATTTTTCATGT
GGGGCACTTACTTGGGTTTTGTTAGGTGCTGTCGAGTCGATTCTAACTCCTAGTGACCCC
GTGTACAACAACAGAATGCTGTGGTTCTTCTTCTACTTGAACCTCGCACTGCAGCTTATT
GTTGCTGCATTAACCCCATTATCAATCTGTCTCCTCCCGGGCCTTCTTTTTCACTGCCCT
CCACTTTTCCAAACACAATGTCCTTCTTCGGGGACTGGTCTCTTCCGACAACATGTCCGA
AGTACCTGAGAGGAAGTCTTACCATCCTGGTCTCTGAGGAACATTCTGGCTGTACTCCTT
CCAAAACAGACCTAGTTGTTTTGGGGGCAGCCCATGGTACTTTCAGTATTCTTTACCAGC
ATAATAGTTCGCACACATCCATTTTTCTTTGGTGGTCTTTATTCAGTGTCCAACTTTCAC
ATGCATATGAGGACACTGACAACACCATGGCCAGGGTCAGGCTCACCTTAGTCCTCAGAA
GCACCTCCCTGCTTTTCAACACTTTGAAACAGCCTTGTACAGTAGATTTACCCAATACAA
TGTTTCCTTTTGCTCTCTTGACTGCTGCGTCCAGGAGCATTGATTGTAGATCCAAGAAAG
ATGAAATCCTTGGCAACTTCCATCTGTTTTCCACTTATGATGATGTTACCTATTGGTACA
GTTCTATGATTTTGGTCTTCTGTATATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATGCACTGTTACGC
AAATCCGCGATAGAGTGAAGCCGCGAAGTCGAAGCGGGAAGTGCCGGAGGATTCACTGTA
CGGTGACTCCTGTGTATTCTTCTCCGGCTAGAATCCTTTTAATTTGCCACTTGAGACTTT
AATTTTTTCTGAGTTCTTTCAGTTTAAGGTGTGAGGATTGTGTGCTTCCTTTTGGTTTTC
TAACTCTAGGTCTTGGCACATGTCATTATTATATTTTAGTTTGTCTTCGAGCCGCCCTTT
GAATTGTTCTCTTCAGCCCTTATACTTCATTTCTTCCGTTTGCCGTACGTATTCTAAGAT
TAAGAGCAAGTTCCTGAGTCTCTTCTGACATCCATGTTTATCTTTTCATTCTTTCCTGCC
CTTTTACTGACCTTTTGCTGTTTTCATGAACGATGATCTTGATGTCTTCCCACAGCTCAG
CAAGTCTCCTGCCATTAGTGTGTAATGTAGCAAATCTGTTCTTGAGATGTTCTCTAAATT
CACGTGTGATACTCAAGGTTGTATTTGGGCTCTCATGGACTTATTTTAATTTTCTTCAAC
TTCAACCTGAACTTACATATGAGCAGTTGATAGCCTGGTCCACACTTGGCTCCTGACCTC
GTTTTAGCCTCTGACATTGAGTTTCTCTGTTTTCTTCCCACAGATGTAGTCAGTATGATT
TTTGTGTGTTCTCTCAGGAGAAGTCTACTTGTATAGTGGACCATTGCTTCTATTGCTGAG
AAAGCAGTATTTGCAGTGAAGAAGTCATTGGTCTGGCAAAATGATATCATGCGATCTCCA
GCTTCATTTCTGTCACCAGGTCCAGATGATCTGACCACTGTTCCTTCTTCTTTGTTTCCA
ACTTTTACATTCCCTTAGCCGGGGATTATCAATAATTTTCAATGCATCTTGATTGCCTGT
TTGATCAATTTAAGACTGAAGACGTCGATAGAATTCTTCAATTTCTACATTACTGGCTTT
CATGATTGATGCATGAATTTGAATAGTAGTTGTATTGATTGGATTTCATTGTATGTAAAT
AGATATTATCCTCTCACAGACAGCATTGTACTTCAAGATAGCTCCTGAAATGTCTTGTTG
GGTTTTTTTTCCTGTTTTTCTTTCTTTTTTTAAAAAAAAATTAATTAATTTATTTTATTT
TATTTTTTTGTATTTTTTTAACATTTTATTAGGGGCTCATACAACTGTTATCCCAATCCA
TACACACATCAATTGTGTAAAGTGTATTTGTACATTGTTTCTCAAAACATTTTCTCTCCA
TTTAAACCCCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCGCTCCCCCCTCCCTCA
TGAGCCCTTGATAGTTTATAAATGGATATTTTGGAAATGTCTTGTTTTTCTAGGAGCTCA
CAACTTGGTGGAAACAATATCTATGTAGTGAATAGTAAGACCAAAAAAAAAAAGAGTTTT
GTAATTCATATTGGTTTTACTCTTAGGAGAGAACAGGCAGTTATTTGTTTATATATAGGA
TCATTCCTAGTGGGTCAGAATACATTTTAGGCAACTTTTATGCCATAATAAAATACTGCA
TGATAGAAACTCAAAGACTGGAGACCGATGGGACAGCTGAAAGTCCAGTCTTTAGATGCA
GCTCTTACAGGGATATTTATCACCTCTGCTGAAGGCTGAATTTTCATCTTACAAATGAAG
ACAGTTCATGCACATTTCGTCCAAGTTAAGCACTTGGTTAAGCGCTGTTTAAAGCTTACT
TTAAAAAAAGAAAATTATTAGCTTTTGTTTGTTAGGAGACTATTTTATATGTACATTTCT
TTTAAGGTAATGACGTTGGAAGGAGTTCATACGGGGCCATGCAAGTGAAACAGGCTTTTG
ATTATGCCTACGTTGTGCTGAGCCATGCTGTGTCACCAATAGCGAAGTACTATCCCAACA
ATGAAACGGAGAGGTAAAGTGTCAGCTAAATTCAGCCTATTGTGTCAAGACTGGTTGTGG
CTTTTGATCGTCAAATTAATGTTGCCCCTCCCCCTCTTGTTTTCAACATGCAGCATATTA
GGTAGGATAATTAGAGTAACGGACGAAGTTGCCACATACAGAGATTGGATATCATAGCAG
TGAGGCTTGCAGAATAGGCCTGCTCTTCGTGCCATGATAAGATTTGACCATTATGATGCC
GAGTATAGAGCTTCTATATGTGTGTGTTATGGAGAACGTTCATCTTGCACTCTTCAGAAT
GTGTACTGATAGTAGATACTCAGCAGTAGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAACTT
TCTAACCGTCTAAGTCAGGAGTCGATGCTGGCTCAACTCTACGAGAGCGTTCTTAGGCTT
CTGGTTTTGCTAAACGTTATTAATTTGGTTATTTTAAGACTGTACATGTCAAACCGTATA
CCAATTCAATAGTTTTTACTATGTATAGCTTTTTTTCTTAGATAAATTGCTTTGGTTGTA
GTCTTTTTTTAGTTTTATTGAGATAAGATTCACATATCATATACTTCCATAGTTCAGCTG
TCTTTTAAAAGAAAGTTGTACATATACATCACCACAATCAGTTCTAGTACATCCTTCCCC
TCCTGTCTTCATTATTTGCTCCCCAGTTACGCTCTATCTCTTCCCCTCTCCTGTCTCCAA
TAAGCTGCCCATGTCAGTCATTGTCTATATACATACATGCACCTCTTCTGTGCTTCATAA
ACTGGGAACCATACCGAAAACAAAATAAAAAGAAAACCATTTGTGTGTGTGTATTTAAAA
GAAGAAAGAAAAGACCCCGGGTAATACTAAAATAAGCCAGAGAGTAAACCTCTGTGGAGA
AACAAGCAAGGAATATTTAAACCTAGAACAAATCCAGTATGGGTCATGAGGAGATCAAAT
GACCATGTATCATATTATCTTGTAGTGCCATCCACCATAATCAAGTTTACAATCATCTGT
TTCATAAGGCTATTCACATCCCTTTACTGTGGCCAGAAGAGATCTGCTGGAGGCTTAATC
TGACTAGATCCTCTGCAGATGGATTTTGGGCTCCCACTGTCTTCCATAGCCTTCTATAAA
TTGGTGTACACAATTTAAATTTTGATATCTTTCCCTCTATAGTATTTGGATTTTGTTATT
TGCCATTTTTGGAGATCACACAGGCTGGTGTGCTTCTTTCATGTGGACTTAGTTGATGCC
TTATAACCTTTTAAGACCACAGGTGCTATTGTTTTTAGTAGCTGGGCACCATCTAATCTC
TTCCCCACAATTTGCTGTAGACTTATATCTTCAGTGATCTTTTCATGAGGTGAATATTAA
GCAGGTCCATCTCATAAGAAATAAATGTTCTTGAATTGGGGCTAGAAATAAGTAGGAACT
CCTATGAAATTTTAATAGCATTACTTTCCCCTACTATTTTATTATGAAAATATTCAAACA
TACAGCAAAGGCGAAAGAATTTTAATGAACATCCATGTACCCATCATTTGGTTCCACCAT
TAATGTTTAACTTGCTTCTCTGGTTATCTCTTCTTCATTTTATTCTTTGACACATTTTAA
AGTAAATCACACACATCAGTACCTCTCTAAAATACCACAGCTTGTCTTAGCTAGAGCTTA
ATAACTGTAGTTTTACTTTTGATATAAAATTGACATGTGAGGAAATAGATAAATCTTTAC
ATCACCAAATTTTATCAGATGTGTATATGTGTGTGATTCAAAGCCCTAACAAGACAAAAT
ATTACTACAGAAAGCTCTTTGATGATCCTTGTCAAGCCCCAGTCTCACTCTGAGGGACAT
GTATTGTTATTCTGTTCAAATGCTATAGATTAATTTGGTTTGTTCCATAATTTTATATAA
ATGGAATCATGTAGCATGTGTTTTTTTTTTAAGTATGTGTGCTTTTGTGGAAACCTTTTA
ACACTCAAAGTAGTGAGCTTTCTAATTGAACTTTTTTTTAATTGATATAATTCACATAAA
ATTTGCTATTTTTAAGTGTAAAATTTAGTTATTTTTAATATGTTCACAATGCAGCCACCA
TCACTATCGAACCGCAGAGCATTTCTACTCCCACCCCCACCAGAAAACCTTATACCTGTT
AGCAGTCCCTCTCAACCCAACTCCCTCCCACCCCCTGGTAACCAATAATCTAATTCCTAT
CTTTGTCCTGATTGGTTTATAATTGGCAATTACATCTACAGTAACATTTATTCATCAACC
TAATTTGAGTTGACTTAATTGAGATCTAAAATGAATCTTGACTTCAGTAAGTGTATGACA
AGAAGTAATCCAAATACATAAGCAGCACAATTATATGTTGTTCAAAATGATCATGAATCA
TTACAGACTCATAAATCCTCAGATGCAGTTTCCTTTTGTGCCTTTTTTGTTCCCAGAGCA
GTGCTATGGAGAATAGACTGCTGAGCTAGATGTTGCCAGTACAGTGGCCAGAAGCAGATC
TGGCCTCAAAGGAGGATTAGGAACTAAGAGTTTGTGATTCAGAAATGCAAAGTAGGGTAG
GAGAGCAAATGGTGGACACCTGAGAAGTAGCATCGTCATGGCCCTCAGCAGTCTAAAACA
GATGGGGGCTCAGCCATTTTCTCTGGGACACCCATCTCCCACACTGGTTAGACCACTGAT
TTGTAATCACAAGTTCTCAGAGATTGAGCCTCTTGTACCATTTATTTTGGGTTCAAGTAA
AGGCATTTAACCAGGAACTAGGACATCGTTCTTGACCATGTTTCTTGCATTAAACCACGG
TTCAATTTATGGCACTAAAAATGGAAATACACATGGACATTACGAGCTCCTTCAAGATTG
ACAAACAAGCTCCGATGAGGGCAGTGGATTTGACAATGAACTGATGCACCCTGACAAAAT
GAGTCACTTTAAATGTTTAGGGGAACATTTTTATTCCGCAGTTGCCTCAGTGTGCTTCCT
TTAACTTCCAAATGTTTAAAACTTAATCCAGAGAGTGCTTAGCTGAGATTGTTTTCCACT
CTTAATATTGAATATCTAGAGTATTAATATACTACTTTATAACTCGTGTCACTTGTGTTA
GGATTCTGATGCGACACCATGCAAAACCCCGAAACAGCTGCTCTGCCGTCCATCTACTGG
GAACCGAGTGGGATCACAAGATGTGTCCTCAGAGTCCTCTCAGGCAGTTGGGAGAATGCA
GAGCACCCAAACCACTAGCACAGCCAACAGCANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGGCTCTATTTTAAGGAACTAGGTTAAAAGAAGCAGGGTAGGGG
ACTTTAAGAGTTCCAAAGCATAACAGTATTTTCATGAGGAGGGAGCATATCAAACACGGG
GGGTAACATAGCCGATGCCCCAACCAGCAGGCCTTTTTACAGATTCAGAATCAAGCTATA
GAAAGGCTTCAGTCATTCATGAAGTAGACTCACGTGATGCTTTTGTATTAGTTCATAACA
CTCGTGTATCCCTGGAGATAACATGCCCTTTTTCTGTTTTATTACTCAGTACTTAACTGC
CTGTGAGGAAGTGATCAGGTCAGCCATGGTCACTTGATTAGCATTAGCTTTGATGTTGAA
AAGCTACAGAGATCATGTAGTCTACGTTTTTCTGGTATCTGAGATTGTTATATCACCAGG
AGAAATTAGTGGGAATGGGAGAAAGAAGCCAATTTGATAGAGGGCTCTGGCCTAAGGTTA
CCCCACCCTCTCAGAGCACAGTGCGGAACATAGGCAAATGCCTCTTTCTTGGCAGTAGAG
ATAAATCTCATGTCTGATTTGACTTGGAGAATCCACTTTACCTATATAACCTTAGTTGTA
TACACCAAACCCAAACTCATTTAGAAATAGCATTTAGAGTGACAGGGCTAATAAGAGACA
GGTGGAAGGAGAAAGCTCCGGGAACAGGTCATCAGCTGATGACCCACCTGCACAGCCCAC
CCACGAGCTGTACCTTCCAAAGGGGCCCTTTATTGTGTGGCATGTCGCCTGGTAGATTCC
TTAAGAAAACGTTCACGTATTCGGCTTTTTAAGATTTCCATGCAAGCATAATGTGGAAGT
ATTAGCGCTCAAAAGAATGAGCCTCATTTATCTTAGAAGATGTATTTGATCATTCATTGG
TCAGTAGTTTAACTTCCTATTCAGCATATTCTCCGGTTTCGAGAGTTCCCTTTGAATTCT
TCTGAGCGGGTCGGCTTCATCTGCCATACCGAGGCCTGTTAGACTCTTTTTGTCTTGTCT
CGCAGCATGGATTCACAAGACTCTTTCGTTCGTCCCAGCAAACGCTTTCCAAGCGTCAAC
TCAAACAAGCCATGGCTCCTTAGATGAGCCACAAGCGACGTCCGGGGAAACCCATAATCA
TTACTACCGTGGCAAGAAGAGGAAGCACGAACGGGACCCGCCCCCTTCAACCTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAGTCAGCGCTCTATAACGGACTGTTT
TCTGTGTACAATGAGCTCATGCTCAGGACAGTTGGATAGGGACTCCTGGGAGACATTCAG
GAGCCTTACACTGTTCAGATGTTGATTTAGCAACTGCGTTTTTTCCCAGCTCGCCACAGA
ATGGATCATGAAGACTGGCAACTGCAAACGTGAAAAGCAAGCAGAAAAAGGGGGTGGGTG
GGTAGGGAAAGGCTGCTCATTTGATAAATCATATGCTACAACAGGGTCATTTTAAGATTT
TAAGCTTGAATGTAAAATAAATATATTTCTCATTGGCTATATGCAGAGTTATAGGGGATA
GTACTCGGTGTGGGTAGAGTGATAGAAACAGAAGTTTCAGAGAATGGGATGGGGAAGGAA
AAAAAAGTATATAATAGGAAGTCCAGAGTCCAAAGAAGGAAGTGGTCTGTGCATGTTTTT
GTTTTGTTTTAATATTTTTGCATATATTTACCATTTTATTGTGTGTGTGTGTGTGTGTGT
ATAAAGAGAGAGAGAGAAAACCATATAGGAAATTGATATTTGTAATAGTGGATTTGTTAA
TACTTTTTCATAACATTACTGTTTAAACTGTCAACAGATTTTTCTCAGGATTAGTTTGAA
AAATAATCTGAAATTTCATCTTAATATCTATATATGAGAAAATGATTGGCATTGGAATGA
TTTGCTAGAACCCTTGTGAACTGCTGCAAAACATTTTTTCTCTCTCTAAAGAAAGGGTTT
ATGGTGGCAAATGACATTTATTTTATTTTGTAAAACCAAAAGTACGTGTACTTTTGTGCA
AACACTGAAAAACCCCTCCAGTCATCTGAGAATTGACTTACAACTGTTTTCTATAGTGCT
GTTGTCTCGGGCAATTGGGCAAGTACAGGACTTTGTATTTGTTTACTTTGCAGTCTTTTT
TTTTTTCTTCCTTATATATAAACAAAAAAACAAACAAATGAAAAAACCCAGACAAAATGC
CCCAAGTCTTGTCCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1002, 1004..1027, 1029..1064, 1066..1101, 25108..25231, 50701..50747, 51176..51296, 51397..51504, 51605..51733, 54863..55076, 59526..59652, 59753..59813, 59817..59819, 59823..59840, 59843..59855, 59937..59966, 59971..60122, 62941..63105, 64325..64350, 64352..64366, 64368..64400, 64402..64432, 64435..64488, 64491..64499, 64593..64595
1001..1002, 1004..1027, 1029..1064, 1066..1101, 25108..25231, 50701..50747, 51176..51296, 51397..51504, 51605..51733, 54863..55076, 59526..59652, 59753..59813, 59817..59819, 59823..59840, 59843..59855, 59937..59966, 59971..60122, 62941..63105, 64325..64350, 64352..64366, 64368..64400, 64402..64432, 64435..64488, 64491..64499
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved