Echinops_telfairi Locus ENSETEG00000018489
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000018489
Echinops_telfairi
ENSETEG00000018489
GeneScaffold_8019
SNORD49
1272..1342
3383
NNNNNNNNNNNNNTGTATTTCTCATCGTCTGCAACTTATTTTAATGAGGGGTGATGAAG
GTTGTCAGTTTGAAGGGGTTTGAGAGGTTCATGGATATTGTGAGTATTCGTGGGGGGCGC
AGAATAGGAACGTTGGTCGCTGAGCTGAACACTCACTATCGAATCGACTCCACCATAAAC
TGACCCTACAGCAGTGGTTCTCAACCTTCCTAATGCCATGACCCTTTAATACAGTTCATG
TTGTGGTGACCGCCCCAAACCATAAAATTATTTTCGTTGCTACTTCATCACTGTCATTTT
GCTACTGTGATGAATCTGGCGACCCCTGTGAAACGGTCGTTCGACCCCCAAAGGGGTCGC
GACCCACAAGTTGAGAACCGCTGCCCTACAGGCTAGAGTACAGCTGCCCTACCGGCTAGC
GTAGAGCTGCCCCTGGGATTTGGGAGGGTCTCAATCTTTAGGGGAGCGGGCAGGCCCATC
TCATTCCCCGCAGCGGCTAGAGGGTTAGAACCATCGACCTTGCAGTTACCAGCCCAAAGG
CTGTAATATTCCAGATGAGCAAACTGAGGTTCAAAACGAAGTAATTTGCTCAAGACTGTG
CAGCTTGCTAGCAACCAGCAGGACAGACACCCAAAACCTGGCCTGAAAGTCCCCGCGCGA
CCTAAAAACCACGTGTTCAGAGCCCGGCTCAGGAACTCCAGCTCCCAGCGTCCCTCGCCG
CCCGCTTACTGACCCAGAATTCCAGGCGGCGCGGGCGAACACAAGTGCTGAGCGGGACAG
GGGAGTCCCGGGGCGGGGCGGCGACGGCGTGCCTGTGGCTCGGCCGGAAGTTCCCGTGAG
TCTTTGCCAACCACCCCCTCCCTCTTGTGAGAAGTGGAACATCCCAACTCCTTAAGTTGC
GGAGGCGCGGCGGGCGCTGTCTCTTCGCCGTCGTGATGGAGGTGAGTTGGGTCCTGCCGT
TTGTCCCCAGACCGGGAGCACCGGCTTTAGTTTCGGGAAGGATTGTTCGGAAGGTTATCT
TCGGGGGGGGGCGGTTGGTAAAGGGGTGTTCCTCTGACCCCTGTTCTCGGTGGGCCTCCG
TGCGTGTCCCGCGGGCGAAACGCATGCGGCTTGTGTATTTCACAGGGTGATCGCAGACGC
GGCCTAAGACCCCCGAAGGCCCCGACCCCGTGCCTCTGGGCCGCGGTGGAGCATGCGGAA
ACCGGGGAGCTGGGTGAGTGGGGCTCCGCCTCGCAGGGTGGGCAGTGAGCCCGTGAGAAC
TGGCTGCGTGACTGGCCTGATGATATTGGTAATAGGAAGTGCCGTCAGACGCGATAACTG
ACGATGTCTGTACCTGCCTGACCACAGTCGCGGAGACGTGGGGTCGGTGGATTCGAATTG
CCCAGGTGTGTCGTGGCCATAACCTTATTTCTCTTTCCGTTCAAGGTGACAGGCCCGCTG
TGGAGCGCTGAAGACCGGAGCAGCTCGCCATGAGGTAAGCAATCGCGTTTGGTTCGATGG
GATAGCTACACTGTTTAACTTCCTTTTAGCTTTAAAAATGCTAAGACAGTGGGACTGACC
TTGAATTGGGATTTTGACACTAATAAGTCATTGGGTAGTACAGACCCTTACAGGCGTCTT
GAGTCGAAAGCTAAATATCTGGTGGCTCAACGTGGCTGAGCTGGTAGTATTGGAAATGAA
GTGAAATTGATATAGTCCAGACTTCCTGTATGCGTAATTTTTAAGGTGACCAGACGTCCC
AGTTTTTAACAATTTTCCCGCCCCCCCCCACCCCCCAGGGTATATACTGTTTTCGGCTGC
CATGTGGCTATTTCGCCAGGATATGAGTTTTATCAATGGTGTCCCGCTTTACCGATGCTA
ACATCTGGTCACCTTAATAATTTTGTTACTGGTCCTCAGATCAGTTGATCTGAGTGATCT
ATTTATGCTCACCCGGGTTAAACGTTGGAGGGAGGGTTGGCGGCAAAGCAGAATGCTGCC
GCCTGTGGAGGGGAAGGGCCTAAAGTAAGGCAAGTCCGAACTTGTGTGAACTTGGCTTTT
CACACAAAGGAGCCATTGTAGTCCCGATTTGTGTTGAGGGGTTGGCCACCTAGCAAGATC
TGGAGCATGTAAACAGAAGGGGTGCACCTATTCTGCTGTGGATAATCTTGAGCAGGTAGC
TGAGGGGGCAGTTTTCCTCATCCCAAGATCACCCCATTTTAAATCAAGTGAGATGGCCGA
ATGGAAGTCGAAACTTCCAAAGAATTGGGACTTGTTTGACTTAAGATGACCAGAAAGGCA
ATTTCATTAAGTGGGCTTTTCATTGGTAGTGAGGCTGTCGTCAGAAGTGCTCTCTGGTTT
GTGTTGTGTGTCCTCTGAGGTGTGTCGCATTCCCCAGGTTTTGACAACTGAACGCTGCAG
AATAGGACCTTCAGAGGTGGCAGCCCCAGCTCAACGTGAAAGGTAAGCCTCTGTCCTGGA
CAACTTAACCACACAAAAGGATATCATGTGATGAAATAACCTGAAATAGCTGGAATTACC
GGCAGATGGTATGGTGGTGAGTCTGGTTTTCTGAAGATATCTCACGCTATGGGGTGACTG
TTGGCTAAGGTGGGAAGTGAGATGACCGACCGTCCAGTTTCTTTACAGGTCACCGGAAGC
AGAGGCAGAATCTGAGTCCAGGATGGTGGGGCCACTGAACGTGGACAGAAGCTCGTTGAT
TATCCATGTTCAAGAGATGTAACTGGCTGCTCTTCCAGGACAAGCAACTTTGGTGTTAAC
AGCATTGTCCCGTCAAGCCCCAGAGGCATTTTACATTCTAACATTTGGCTTTGTTCAAGT
TCTTAAAAGAAGCTGTAAATCCCAATTTACTTTAAATGCACCGACTCAATTATAAAGGAT
TCTCTTTGGTACTGATTCTTAGAAACATGTATTTGTGAATAAAAAGATTTAAGTTTGACA
CAAGCTGTGGTCATCAGTCTTAGCTTTTATCCCTCTTGGTGACTTTCCAAGAGTAAGGCA
TCTCCAGTTCTGGGTGGTCTTTGCATAGCTCCTGAAGTCTCAGTGCAGACATGGGTCCTG
GGGCTCCAGCAGCGTCCTATGTTGTCAAACCTTGGCTTAGCTGCTTGGGGTTCCCCTCCA
TGTGCTTGTTCACCAACCTCTTATTTAAGGGAATTCTCATCATAGATCTTGAGCTTCTAG
TTGAAAATGTATTAACCTGGGATGGGATATTTTGGGAAATTACAAATGCCCAGGGACAAG
TGGGTGAGGCCAATTCTAGTAGGTATTCTGGGCTGCCTGTAGGCTGGATTGGTTGTTAGA
AACAAGTTGAAGGGTGGGTCCCAAAATGAAGGCCCAGGTGCCTTTAGAATGGAGTTTGGG
GGGGAAGTCTATTTCTTAACTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1006, 1008..1025, 1027..1041, 1043..1081, 1084..1095, 1098..1103, 1105..1143, 1147..1175, 1177..1190, 1192..1208, 1210..1212, 1425..1460, 1463..1473, 2377..2383
1001..1006, 1008..1025, 1027..1041, 1043..1081, 1084..1095, 1098..1103, 1105..1143, 1147..1175, 1177..1190, 1192..1208, 1210..1212, 1425..1460, 1463..1473, 2377..2380
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved