Echinops_telfairi Locus TOMM20
snOPY snoRNA Orthological Gene Database
Echinops_telfairi TOMM20
Echinops_telfairi
TOMM20
GeneScaffold_7038
SNORA14
1546..1678
15207
TCCCATCGCTGAATGTTGGTGTTCATGGATTCTGACCTCCCTGAAAACAAATTTACTTT
AATGTTAACAGCACACAGGTTGGCCTTTAAAATAAAGTGACCAGATTTAAAGCGGGACAC
CATTGACCGGGGGTGGAGGTGGGGTCGGGTGTGTGTGTGGGGGGTTCTTGATTAAAAATT
TGGCCTATATGGACCCAAATACACCGTTCCCTAGCTTGTCGTGCATTCTTTCCAAAAATC
GGGACGTCTGGTCACCTTACTTTAAAAGCAAGATCAAGCCGTTATCGACGGCAAATTTCC
ATCAGGAAAACAACGCACAGCACTCTCTGAAAGCTCAAAACTCAAACTCACTGCCATCCA
GTCCGCGACACTCACAGCGACCCCGCCCCACTAAATTTCTGAGATTAACTCTACGGTAGT
AGAAAGCCACGTCTTTCCACCGCGGAGGAGCTGGTGTTTTCCATCTGTGGTCTTGAGGTT
AAGCAGGCCAATGGATAACCTATTACACCAGGAGGCCTCCTTCCGGAAACTCAGCTGGCT
TGAAAAACGTGCGCCATTAATTACCGAATCCGGACAAGAAAGGATGGCTGCATCTTGAGG
TGCCTAAAGCGCCAGCTCCTGGACCCGGTAGTTCGGTGGTGCACAGGCGCAGAAGAGGAG
CCGGCGCCCTCTCCTCAGGCATTGCACTGGACGATCTCAACAAGGTTTCAAACGACGGCG
GATCCGGAAGTGACGCGCACGTGGGGTCTTGCGGCGTCCCTCACAAGGCTTTAGACGGCG
GCATAACCGGAAGTGACGTGAGCGTGGGGTCTTGCGGCGTCCTTCAAGGCTTCGGACGAC
GGCGGAACCGGAAGTGACGCTCGCGTGGGGGCTTGCGGTGTCTTTCAGCCGCCGGGAGCA
AGGTTTGAGCTGGGTCCTTCGTTTGAGTGAAGGTTGCCCCGCTCCACGGCTCCTTCAGGC
CTCCTATCCCCCACAGGCAACACTCCCGAGTCAAGGAAAGAATGGTGGGGCGGAACAGCG
CCATTGCCGCCGGCGTATGCGGGGCCCTTTTCATCGGGTACTGCATTTACTTCGACCGCA
AGAGACGGAGTGACCCCAATTTCAAGAACAGGCTGCGAGAGCGTGAGTGGGTCCCCTCGC
CCTAGGCCTCACACCCTCTCCTGGCTCCAGCACTAACCGGTGAAGGGGGTCCCATCACCA
CCTGGTGAAGCTCGGCCGGGTGCCCTCGGCGTGCGCCTAAGTACGGTTCGCGGCACCGGG
TTGGGCCAGGAAGGCGATGGCGCCGGCCCCCTTCGCTAGCCCCACTAATTGTCCGGCTCT
AGTGCGTGCTGTTTTCGATTTCCTCCATTTTGCGAGAAGAATTTTTACCCTCTAAACGTT
TTGGCTGTGTAAACGCAGTCCATGCTTGCATATTAATTTATATACTCTTGGTCTCGAGCC
GTTGCCCTTTTTAAAAAAACTGTATTAGAAAATAGAAAGTTGTTTTTTTGTATTGTACGA
ATTTTAGCCTGACTCTGAGTTTTGCGGATCCTGTGGAGCATCATTGCAGCATTCTTAAAC
CCTCTTGGTAGCTTCCTTTGTACTTCCAAGATAATGAATGAATGCTACAGAAATGGCAGG
AGAGTCCAAAAGGCTGAGCCTCACCTGTGGCTCACTCTTATTTCATACCTGCGACATTTT
AAATGAAAAGGTTAGATGTGCAAGAGCGAAAATAGTATCACCTAAATCCTGGGAGATTCG
GCTTTGAATTTCGAAGTACATCTTGCAACAATACAGAAGAGGAAAATTAGTTTTCTATAA
TAAAGCATGTTGTTGATGTATGAACAACAATGGTTGCTGAAGCCAAATAACAATTTCTGG
AAGTGTGAAATTGACATGTTAAATTACCTATAAGCCCCTACAAAAATGTGGAGGATTATT
CCTCTTTTGGATTGGTTAGAAAATCCTATTTTTGAAATAACTGTTTTAAGGCTACAAAGA
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGC
TGAGTAGGCAAATGATGTACTCTTTAGCTTAGTTTTGTTCTTTTAAAGAATAGGAGCCTG
ATTACGGAGTGAGTAATTACACATTGGCCTGTATCTGCATGGTCGGCAGTTTGAAACCAC
TAGCAGCAGCTCCATAAGAGGAAAACTGGGATTTCTACTCCTGTTAACGATTACAATATC
AGAAACCCACTTTGGGGTCCCTTTGAGTCAGCATTGACTCCAGAGCAATGAATTTGTGTT
GGTAGTTGAGAACCCTGACTTTGTGGTTAGCACAGTGAGTAACTACTTCTCCACCTTTGT
TCCTTACTTCAAGGGCAGTTTTTCAAATCAGTCAGTTTGTTAACTTTCCTGATATATTTT
GTAAAGAAAAATAAGGTTTAGGATTGACATGAGATTTTAAATTTATAAATGTATATTCAT
TAGCAAGAACATATAGCCACTTTGAAGAAGAAATTCCTAAGCCCATTGTCAAGCCAATTC
TTTCTCGTGGTAACCCTACAGAATGGCACAATGCTGCCTAAAGTTTCTAAGGCTGTAAAT
CTTTTTGGAAGCTGATGGTGGATTTAAACCACCAACCTTTTTTGTCTTGCGGCTGAGTGC
TTAAACACTGTGCCACTGGAACTCCTTAGACGATTACTTTAGGAACATCTCAAAAAAGCA
TATTTAAAAATTTTTAAATGAAATTTAGTTAATTCATTAAATGAAATGAAATTTAACCTC
TAACTTAGAGTGGCACTTACAAGTACTTTATTAAAAGTATCCTATAAGGTGTTAAATAAC
TTAAAAACATTAAGCGCCTTGCTTAGAAGAAATATCTTTAAATTTTTTAAAATTATGTGT
GTTTACAGTAGGTATGCCTATTCACACCCTTGTGACTGATATTTAGCAAATATTAAAAAT
AGGCCTGATTTTACTGATTGCATCTATAACTCTTTTGCTTGTTTTTCAGACTGTAACCAT
CTGTTCCTTTTCACAGAGCTTATTTTTGTTGTTGGTAGTTGTCTTCAAGATAGTTCTGAC
TCATAGCAACCCTACAGCGTGAAACACTGCCTACAATACAGCAGAATGAAACAGATGCCT
GGTCCTGTACCAACTGTGCAGTTGTTCTCATGTTCAAGTCCATCATTGCAGCCACTCAGT
CAATCTATCTTGTTGATGGTCTTCTTGCTTTTTTCTGTCTGTTTTACCAAGCATAATGTC
CTTTGCCAAGGAACAGTCAGTCATCTCTCATTAAGTTGTAATTTATATTGAATGCTTCAA
TCCCCCATCTCCATTAGCAAGTACTTCAATGGAGGAAAAAGGTGTAATTGTTGAGTACAC
TTATTTTCAGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGAGT
TTTGTTATTGTCATCTTTGGATCACACAAGCTGGTGTGCTTTTTCCATGTGGACTTACTT
GACTCCTCACTTAGATGGCTGCTTGTTTGACTACAAGCATTTAAGACCTCAGGCACTATT
CTGATTGAGAGCTGGGCACCATCTACTTTCTTCACCACACTTTGCTTTAGCACCCTTTAG
TGATCATTTCATGAAGATGAACATCGAGCAGGGCCATGTTATCAGAACTAAGTATTCTTG
GATTGGGGCTAGAATTAAGTGGAGCCCAGAATCCATGGGATTGTCCATGGGGTATGCATG
ACTCAATTGTACTTTAGTGGTCTTATTATGACAATCAGTATCCCATAGGATCAACTACAC
CAACAAGTAACAAACCAACCAGCAAACACAAAAAACAAACAAGCAAGCTAAAGGCAGGAA
AACAAAAGCTCATATCAAAATACTTTATATTAACTCAATTTATACAGTTCTCAACAGTAC
TGTGAAGTGTAGGTATTATATTTAGTTAACTTTTTTATTTGTTAAGATACAGCATTTGCT
ATTTTAATCTTTTAAAAAAAATTTTATTGACATGTAATTCATATAGAATATTTTCTTCAT
TCTTGTACTTTTTATTGGCTCCCTTTTCACCCAACCTCCCCTAAGAAACTATTGATTTAG
TTATTTTAAAAAAAAATCATTTTATTAGGGGTCTATGTACTATTTCTATGATTAACCTAT
TCTGTTACAAAAAGAAAAGCAAAAAAGGCAAAAACATCCCAACATAGTAACAAAACAAGA
CAAAGAAGTCATTTGTAAAGAAAGCAGATTACAATAAAAACTAGAACAAATTTTAGATGG
GTCAAAAGGGAAAGCAAATGATAAGGTGTTACATTTTAACCCAATTATATCTGCATAAAT
TCAGTCCCCTCACATTCTTGATTAATGGTTAAAGGGGATTCTTCTCAGGCTTAATCCAGT
TGGAGGGGGACCTTGTAAATGGATTTTGGACTTTCATTGTTATCCATAGCGTTCTGCAAA
CCAAGTGCTCAGAATTTAAGCGCTAATACAGTTCCCTGCTCCTGTATTGGATTTTATTAT
TTATAATCCTTGGATCACACAGACTGGTGTGCTGCTTCTGTGTGGACTTAACTGACCCTT
CACCTAGATAGCAGCTTGTTTTAAGATGTCAGAAGCTGTTCTTTATGATAGACAGGTACC
ATGTGGTGTCTTCACCACATTTTGCTATAGTCCTCATAGCGTCAGTGATCTCTTCATGAG
GACAAGAATCAAATAGGTCCACATCAAAAGAACTACTTTTTCTTAGATTAGACGTATGAT
TAAGTGTGAGCTCAAAATCCATTCAATGTTTTAAATGTACATAAGATTTATTGGCGTTAA
TTACATTCACAATGTTGTGCAACCATATCGTTTTCAAAATTTTGTCATCACCCTAAGCAG
ACATTTTAGTATTTTTTTTCTCAGTATTATTTTAAGACCAGTTTTGCATAGAAGAATTTC
ACAAACAGGTTACTGTAACTTGTCTAAGGTCACACTGCTGGAAATTGAAGAGCTGGGATA
GCCCTTATACTGTAAACACCTTTCCTATGGAGTGTACAATTAGATAAGAATTCAGAGCCT
GTTAAGTTTTCTGTTATCTGGTGGTTTGAATTGAAGACTGATAAGCAATTCTGGTGGTGC
TAGGTATACCATGGGTTGTTAAATCCAAGGGAGAAATATGAGGTTCTCTGCTCCATAAAG
ATTTATAGTCTTGTAATCTACCCTGTGGCTGTGGGTTTTGCAAGTGTGTTTCTGAGAACC
ATCACCTGCACTCCCCCCTTACACAAATCCATAAACACTTTATTTTGCGAAAGCATTCTC
ATTCTGGTTTTTCATTGAAGAACATCAGATAGTTTTCAACATTAAGTAATGGGAGAACCT
TTTGTTTTAGGAATAAAAAACAACAGCAGTAGCCTTAATTGCTGATTAGGTTTATTGACA
TAAAGGCTAGAAATCTGATGCTTGATCTTATCGTAATTACTCAGAGACAAAGGTGTCCAA
GCTGCCTCCATCCACTAATTTGCTGATCTTGGTGTGCCAGGGGAAAGGAGAAAGCCTCTG
GCCCAGGAATGTCACATTGTCCTAGGTTGGGGGTCCTGACAAATCGCTAGGGCACCAGAG
ATTGCAAGTCAGATATTTGCAGATGGAAGGGATGACCACTATAGCATTTAGGCTTTCCCT
CGTTTCTAATTCCCATTTTGAAAATGGTAAGATTAAAATACAGTGTACTTCTTACAGGAC
GAAAGAAACAGAAGCTTGCCAAGGAGAGAGCTGGCCTTTCCAAGGTAATAGTCTTAAAAT
AATTTTTTTGTAGAACGATTTAAAGTATGCTTTTAACGTGCCTTTTTGAGAAAGCTAGTT
GATAAAATAATCTATTTTTAAGTGTAATCTTTAGGAATAATAATCTGAGTTTAAGAGTCT
GATCCTTGATTAATTCCCCTTTGTTGGCTACACTAGACAGCTTGTTGTACAGTGTATACA
AGCAGTTTTTGAGAAACAGTTAGATGATGGTGAGAAACAAATTCATTGGCACTCATGTAA
GAAAGAGCTTTATATCAAGAAGTTATTGTATATCAGAAAAACATCCCAGCCCAGTCCAGA
TCAAATCCATAAGTCCCATACTAGTCCATAAATCCTTTGGCAGACTTATGCAGCCACAAT
ATTTGATGCAAAAAGCAGGAAGACCATAAGCCAGTGGGCAAAAAGTCTTGTGAATCAAAT
GGCAGTGGAAGCATCACAAGGCTGGCACAGATCTAGAGTGGTTCGCCAGCAGGAAGGTGA
AACAAAGAGGGGGCGGGGGGCACCTCAGAGAGTCATTTATCTTGGTAGTGCCTTCAAATG
AGTTCATCAAGCAGCAACCTGATTGACAGGCTAAACTCCACCCTATCGTCTTAAAGCCTA
ACTATCACAATCTCTAAAAGACTTGCACAGAAAGGTTCAGACATTGTCGCTCAACTGCTT
TAAAGTAACAAGACAGGATATTAATTATTAATAATTAATAATTATATTAATTATTCTTTT
TGTCAACTTTCACAGCACTATTAGCTATTAATTTTCAGTCATAGTACATTATTCATAACC
AGTAAACCAGAATCCTTCTGCCCTGACATTTTTATCTTGTGGAATGTAATATATAAACTT
GTCCTGGTGGTGTGTGGTGGTTATGCACTGGGCTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGGGGTGGATAGTATGTACATACCAGATATAAATGTTTTCATAGATC
ATGTGGTCATTATTATTTTTAATGACTACATAGGGTTTATCTACTTCATAAATAAATGTT
TTGTGGCATGTATAAGTAAATATTGTAGTACATACAGCTTTCCCCTTTATAAAAATTATT
TCTGTTGTCTGGATTCCCAGCTACTGGATCAGTGAGTGGTAGGTAGTTTTGCTTAGTTTA
TTGATATTCTGAATAGGTGATACAATCTCATGATTCAGTGTTGCTCCAGAAATCTGCTAC
ATGTAAACACACAAATACATCTGTACACATTATTTTTGTTCTGGCTTCACACAAATAGTG
TCAAATGATATACAAGTAGCGGTTCTTTTAGGAGGAAATTGGGCAAAAATATTAAATCAA
TAAATATTGGTTATCTTGAAGTGGTAATACTGAAATAGAAAAAGGAATGAAACAATTTGT
CCTAATACTACCTTTCTGAAATCTAACGTGTTCATTATGTTTTCAGTAACCCATTCTTAA
AAGACATTAGAGCATTTTTAGATTTAAGAACATAAGCAAATTCTTGCTGTATACTGGATG
GCCATTGAAAGATGCTTCCATTTCTGGAAAAGATTTTTTTACTTAGATCCTGTAGTTCAG
GGAAGAAAAATTTACATGAATAACAAGCTAATGTTTTAAATAAAAGTAAACTCTTTATTA
GATTTGTCAAAAGGCAAGCCATATAACTGGCATAGTCACAGTCATCAAATGATTGATAAA
AACGTCTCCCCTCCACACTTGCATTCATTTGAATGTAGACACTAAATTTTAGGCCTTCCA
AAATGATTGGTAAAATTATTTTATCAGTGTTTCAGAATGAGATATATGATTTGGGTGGGT
CATGATTTTCTGTGTATTGGTTCTTTTCCTTGACATAATTTTGGTATCAGTTCCAAACAT
TGTATTTCTGATTACAAAATAACCTATTTCCAAACAGTTACCAGATCTTAAAGATGCTGA
AGCTGTTCAGAAATTCTTCCTTGAAGAGATTCAGCTTGGTGAAGAGTTACTAGCTCAAGG
TAATAGTCATTAAAAAAAATGAAAGAACTAGCTGGACTTTTTCACACTAATGTGAAATTT
TTATGATAAGTGATATTTCTTATGTAGTTGCTTATTTTAAAATTATAAATCATGACAGAT
TTTTAGACATTTAAAGTATGTGGATCATTTTATTTAAGATTGGTTCTAGAAATAACTATT
TTTAGTAGATAAGCTACTAAGACCATAATATATTTTGAGTTTTAGCCTCACATTGGAAGT
AATCATTAAAACTGCTTCATTAAAGCCTCTGTAGTTTAGAAGCTAAAGCTCAGTTGGGTG
GGTTTGAACCAAGATTTTGGGCAGCAACTGCGCGTTTAACCTTTTACCATTGCATCTTAT
AGTTACATTATAATGTGCAAATATTAATGAAGGTAATATAAGGAATGTCCTCCTTCAACT
TCCATCTAATCATAATGTTTTCTATATAGGGAAGAATGATTAACATTTATCAAACTTATA
TGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCTCATGAACCCTT
AATAATTTATAAGTTATTATGTCTTATCTTACACTGCCTGGCGTCTCCCTTCACCCACTC
GTCTGTTGCCCATCCCCCAGAGAGGAGGTTATATATAGATCCTTGTGATCGATTCCCCCT
TTCTATCCCCCCTTCCCTCCTGGTATTGCCACTCTCACCACTGGTCCTGAGGGGTTCATC
TGTCCTAGATTCCCTATGTGATTCCAGTTCCCATCTGTACCGCTGTGCATCCTCTGGTCT
AACCAGGTTTGCAAGGTAGAATTGGGATCATGGTAGTTGGTGGGGGGGTAGCGTTTAAGA
ACTAGAGGAAGGTTATGAGTTTCATTATTGCTGTACTGAGCCCTGAGTGACTCATCTCCT
CCCCACTATCTGTCTGCAAGGTATGTCCAGTTGTCTACAGGTGGGCATTGGGTCCCCATC
ACGCGCTACCCTCATTCATGATGATATGATCCCCCCCCACACACACACCTTTGGTGCTTG
AAGCCTGGTCCCTTCGGCCCTTCATGGTCACACATGTTGGGTGCTGCTTCTATGTGGACT
TTGTTGCTTCTGGGCTAGATGGCCACTATATCTTTTAATAGCCGGGCACCATCCACTTTC
TTTACCACATTTGGTTTTGTACCCATTTTGTCTTCAGTGATTGTGCCAGGAGGGTGAGCA
TCAGAGAATGCCAATTTGTTAAAACAAAGTGTTCTTGTATTGAGGGAGGGTATGAGCAGA
GGCCCACCAGTTTTTTGAGTCAGTTTTGCCTTTTAACTAAGTTTTTGCCTCATTTTATTA
TCAGTATTAAGACTTAAAACATTTCTATTATAAAATTAAATTTCTTTTATCAAAATAATT
GAGAAATCTGAAAACTAATCTCAGTATGTTTATAAATATTTCTGGTGTAAATTAGCTTTT
ACCTTAAAAATCTGTTTGAAGTAGTTGCTCTTATTAATAAAAATGATAGTTAGTATTAAG
CTGTTTTTCCTCTGTTTACAATTGCTAGAGTTTTTACAAGGTTGAGCTACTCATGTGATG
TGGGACATTTAAGAACCAGCTTTTCTCTTTTGTCAAGCATATGCATATCAAACATCAACA
GTTTCTCCTAGTATTCTTTCATTGTGCAACCATTTTCACCCTCCTTTTCTGAGCTGTTCC
CTCACCCACTAATGTAAATTTACTGTCCCTTCAGGTTCCTATTTAATTTTCCAGGTTGTT
TTTGTGGATTTGATCTCACATTTTGCTTCTAACAAGCAAAATTATCAAGCAGATAGTTTT
TTACTAGTTAAGGTAAACTATTGACTCATTTAAGAAGACTTTAGCGAGTTATTTTTGATT
TAAGGTCTAAAGATTTATCAGGGCAGTAGTATATGGGGACAGCTTTAATTTATATTTTGC
TTCTCCTTTCCCAAGAAATATTTTCTTGACATAACTAGAATTTGTCATTTTCATCTAAAG
AGTTGCAAATGGTCCAATTCCTCTCCATACTCAAGTAATTTGTGCTCTACCTATAAAGAA
AAGTTGGATTAAAGAAGAAATTTAATAATATAAGCAGGACCTTTGGATTAGGGAGCCCTG
GCCTTAATAACTTAAAGCAAATTTATTAATTATCCTAAGCCTCAATGACTTCACGTGCAA
AATGTGGATATGCATAAGCATGTGATATAATGAAAAACCTTCAGCAAGTAAAAAACTTAT
TAAAAATTACCTTAAGAGTGTCAAGAGCTATAAAGGGTTATGAATGCTGACAGAAGACAT
GCTTCTGCATCAGAGACAAAGGACACTTTCTAGTGATTTTGTATGAATGTGATTATCCCA
TCGGTCTTTAGTTGGTGAGTAGAATTATCACAGCAACTGGCAGTAATCAGGATATCAGCA
TGTGCACTGGTTCCTCAAACTCCATTTTCCATAGGTGACATTTGTACATGCAGTAGTGGC
ATTACTGGAGAGGTAGCCTGAATTTAGGAATCTGACCATAGTGAGCATATGTACCCTTGC
CCTTTGCTCTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACATAGTTTAAA
CTATTTAATTACAGAAGAGTCTAGACAGTGTATGGAATTTGGCTTAAAAACATGGTGTAG
ATAGTAATGAAAAAGCCATTGAAAACCCTGTGAAGCATAGTTCTACTCTGGCGTACATAG
GGTCCCATGAGTTGGAATTAAGTCAGCAGGCAACTGGTGGTGATGAGAGCTAAATCTTAA
GCAATGTATTTTTCTTTCAAAAGTAATGCGTGAGCTAATAACAAAAAGTACAAAAAGGAA
GAAACTGTTTTAAAACTGATAGTGGTGGTGATTGTACAATACTTCGTGATGTGGTTGAAC
TATTGTATGATGTGTGGACTGTGTCTTAATAAAATGTTGTGTGTGTATACGCATGCATGT
AACGTGTCTGCCGTAGAAAGCTTATAGATGGCGGGGGTGGGGCGGATCTTTAAAAATTTT
GAACTCAAGCTCTAGAATCTGAGAAATGATTTAACCATTTTTTTATTAATAGCAAAACAT
CTAAATGACTGGGCATAAGAGTTGGTAATTGTACCTTGGAGTCAAGTCAGGAAATATGTA
TGGTAGTGTTAAGTCTTAGTTGTTAGTGTATTACATTTAGTGTATAGTTTTGTTTGCTTG
CTTCTTCCTTGTCATTTCTAGTATCATAATTTTTTTCTATTAGCACCACTTAAATTTTTT
GATATAATTAATACATGGTAACAAAAGTACAAAAAGGTTTTTGTTTAAAGTGAATTTCGG
CTTCCTTTCTACCTCAGTCCCCAGTTTTCTGTTCTTTTGAAGAACTGTGCATTCCATTGT
TAGTAGTTTCTTACATAACATTTGGGAGACATTGATAATAAATTCAAACACTTTTACACC
TTCGTATCTATCAGAACTTTTACACCTTCGTATCTATCAGAACATATGATTGATTCATTC
TTATTAATAGCTACGTTAAAAAAAATCAAACTCATTGTCATTGGGTCTACTGTGGCTTTT
AACACCCAGTATTGGGTTTCTGAGATGGAGTTCTTATGGGAACAGTTTCATCTTCTTCAG
AGCATCTGGTGTATTTGAACTGCCAACCTTGTTGGTAATAGCCCAATGCCTAACCCACAG
CACCCCCAGAACACCGTAATGGTTGCCTAATAATCTAGTTACGTTGATGTAGATTATTTC
CAATTTTACTTGTATGTTGTTTTTCATCATCATCAGTTGGAGTTATAATGAAAACTTCAG
AGTTGACTATTTGATAAAAGGAAAGGCTTTTTTTTTTTTTTAAAGGAAAGGCTTTTGAGC
TATATAATTAATTTTATTCTTACAGGTGATTATGAGAAGGGTGTGGACCATTTGACAAAT
GCAATTGCTGTGTGTGGTCAGCCACAGCAGTTATTGCAAGTGTTACAGCAAACTCTTCCA
CCACCAGTTTTCCAGATGCTTCTGACTAAGCTCCCAACAATTAGTCAGGTAAATGGAAAT
GTGAACTAAAGCTCTGTAGAATCTGAGAAATGATTTAAGATTTCTTTAATAGCAAAACAT
CTAAATGGCTGGGCATAAGAATTGGTAATTGTGCCTTTGAGTCAAGTCAGGAAATATGTA
TGGTAGTGTTAAGCCTTAGTTGTTAGTGTATTACGTACCAAATTACAGGCCACTCTCAGC
TCCTCTTTAAAGCTAGCTCTTTTGCCCTGCCCTTTTGTGACATCATATATCCTGCCAGGC
GTCCTGGCAGAGAACAGAGGGGTCATGATGACATAGCCTAGAATTTACGTGGACTTACCT
ACTTCTGCTGCTATGATGGGCTTGGAGCTAATTGGACTACATGCCCAAATCCCTGATGAG
AAGTGCAAAGTAACCACTTATATAAGATTATTAATAATTTATGAGTTTCAAAATGCATTC
TGTACATTTTGAATACTTTATATGGAGCCCAAATAATTCCCCTCTCTTCTGGGGTTTATN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGGGAAATATAAGACATACGATGCAAGGGTGTTTATGCTGAACCTAGAATCCTGA
TTATTTGTTAAGTCCTTATATTTTGAGAGACTAAATTATTTCTTTTTTTTCCCCCCCCTT
TAGAGAATTGTAAGTGCTCAGAGCTTGGCTGAAGATGACGTGAATGAGAAAACAAATGTC
AACACAATATGAAGTTACTTTAAAAATTCTGAAGTTGGAAAAGAAGCAGCTCTTGAGATA
TAAAAACAAATACATGCTTGTTGTGGACTGTGTGCTATACTGAAATATAATGAAGTTAAT
TTTTACATATATAGATTGATTTGTCTTATTTATTTTTTCCCAGTGAAAAGTGTATTTTGA
TAGAGAGCTTTTCATTTTATAAATACACCATGAATTGACAAAATAATGATTTTGTTTATT
CCTAAAACACATAATTAAAGCGTACATTTAACATTACCCATGTGAAAAATAGCCAATGCT
CACATTTTGAAAGATAACATGAAAATACATTTTTCAAGCTACTATATTTTATTACATACA
CATCAGAGACTGAAAAAATTGTGTTTATTAAAACTAAGCATTAAAATTGAGAATATTTTC
CAGTTAATCCCTTATACAACTATGGGAGATGTGCTGCTGCACTCTATTAACCTCCACCCT
GTGTATTGAAATGTTTCGTCTACATCGTTGGCTTACTAGGCTCTGGATACTTACCTCCTT
GTATTTTAAATATTTGTAGTTGCAAATAGTACTGGGAATTAGATCTATGTACAACCTTCA
TCTAGCAGAGTGAACTCACCAATTCATGTCAATTCTCTTTATGAAGTTAGGGAATTGGAC
CAGGTATCCTTTTCAGCTCCTAATTTACCGTGTATGGTTCTGTAAGAGGAGACTTTCTAC
TTCTGTGAGAGATGTACAGTTTTGGAAACCCCAGAGCTAGTTCTACCCTGCCCTTTGGCA
TCTCTGTGAGTCAGTTTATTTAATGGCAGTGCGTTTGGTTTGGTTCAGCATTTTCAAACC
CAGTTACTTTTGTGAAGTGTTTGGATCAATAGGTCTTGCATTTTTTTTATATTCTCCATT
TTTCATTGTCTGCCTTAGTATTTCTAAATTGATCCTTAAAGTGGTTTAGCTATCACGTCA
GTTTTCACTGAAATCTATGGTTCTGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 6537..6583, 8557..8638, 12925..13067, 14163..14207
1001..1121, 6537..6583, 8557..8638, 12925..13067, 14163..14207
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved