Echinops_telfairi Locus ENSETEG00000006941
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000006941
Echinops_telfairi
ENSETEG00000006941
GeneScaffold_8372
SNORA65
3709..3839
5643
GCAGGATACACTCAGTCCACCGAGTGCGTGGTAGAGATCACAGGGCCCCGCCCACAGGG
GCGTCGGCTGGGGATGCTGCCAGGCCTGCAGAGCCAGCTCAGGCCCCTCTGGGCACCGCA
CTGCTCACCCCCCTGTGCCACCTCTCATCTCTCCCTAACGACTGGCTCCTCATCCCAGCT
CCCTGCTGACCAGCTCTCGCTCACCCCCTCCCTTCCCAAGGTCTAGCTGTTTCCACCCTC
TTAATGACTTAATGACCCCCCCAAGATCAGCTCTTTCCCACAGGAGCCAGCCCTCATACC
ACCCATCCCTGGCTGGCCAGGTCACGGCCCGAAGGATAGAACCACACCCATCCTGTGTAC
CGGGGAGAGCCGCACCAGACCTGGTTTTGCAGATGGACAGCCCCGAAGTTCGGGCCCCCG
GGTGGGCTCCAAGGCGGATAGGTCACTCGGTGGGGCTGGTCATGGATGCCAAGTCGCCAA
CCGGGGCCGGAGTCGGGTCTCTTCCAAAAACGCAGGAGCTAAAGTCCTGCCAACCGGGAT
GACTACGTCTGAGAGGCTGTGAAGCGCGGAATCCCAGAACTTAAGAACTGGAGCGGATTT
AGATCTGCTTAAAATTCTTTCGGCAACCAAGATGCATAGACACCACCAGGAGAGAAGCAG
AGCACTCCGGGGGTTGTCAAGGGTCCCCGAGGGGGTGCGGATCTTTCAGGGGAGAGGCGG
TGCCCTAGGACGGGGACAGGGACCCCGGGGTGATAGCAGGGCTAGCGATCCCAGGAGCAG
CGCTCTTGTGCCTGTCGTCGCCGGAACGAACAGTCTCGAGATCCCCTGGGATCGCCTAGC
CACGGCTCCCCGCGGTGCCCGGCCCTCCGGCCGTGCCCCTGTGGTGTTTGCCCACAAGCA
ACCCAGCTGCAAGGGCGTCGTTGGCCGGCTGGGCGGAGACTGCTGATCTCGCGATAGCTG
GGCGTTCGAAGCTATATCCGACGTGATCAGGGCCACTTCCGGTCTTTCGGCTCGGAGGAG
GGTTCGGTGCAACTCGCTTCGGTCGTCCCGCATCTGGGTTCATCCGACACCAGCCGCCTC
CGCCATGCCGCCCAAGTTCGACCCCAACGAGATCAAAGTCGGTGGGTGCTCTGGGTGCGG
CCGGGGCTGCCGGATGGAGTTTCGCTCCTCGCCGCGGCCCGTCAGGCCTGCGGCTCCCGC
CGCACCGGCCTTCCCCGCGTCTGGTTTTCGACCCTTGGCCTTTTAGAGGCCTTCTGGGAG
CTTCCGGTGCTGCGATCAGGGTGCGGTGCGGTCCTGCTGGCGTGTCTTGAACACTTTCTG
GGCCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGGCGGAGCGGGAGGGGTGCCCCCCTCCAA
GGTTTCTGGCTGACTTGGAAGGAGGCTCTGGGTGGTGGGGGCAGCCTCAGGGAGATGCGG
AGTGGGGGGCTGTGGGACGGGGCTGCACTGTGACCACTGATCCTCTCTTTCTCCCAGTGT
ACTTGAGGTGCACCGGTGGGGAAGTCGGTGCCACCTCCGCGCTGGCCCCCAAGATCGGCC
CCCTGGGCTTGGTAAGTTCTTAAACTGTCTGGCAAGAGTAAAGGAACACGCCTCTCCTTG
GGAGTGGACTGGAACGCACGCAGCAGGAACCGTAGAAGGGTGGTTGTGAACAATCCCTGG
CGTAAACCCGCTTTTAGCAGGTCCAGGGCCTGGCTTGGAGAAAAAGCATGGCAGGGTTTT
GGGGACCACGAGTGGTTTTGCTACTTACTGGGCAGTGTGTGTTGGTCAGGAAAGTGAGCA
TAATAGCATCTAACGGGGAGATTGGGGGTGAATGAAGATGGGAATTTAATAACCGGTCCA
TGACTCCTGTAAATGTAAACTTCTCAAGGCTCAATGCCATCAAGCCACTTGTAACTCAGT
GACCCTGTAGGACAGACTAGAACTGTCTTGTGGGTGGTTTCGAATGACTGATCTTGTGGG
TTAGCAACTCAATGTGTGACCTGCCACCAGAGCTCCTGAGTGCAAACGTGTACGTAGAAC
CAGCTTTGACCTTACTTGCTCATCTCCCTGTGAGCACTCCATGTGACAGTGTTTAATGAA
CTTGGGTTTCCATGAATATCTTGGCACAGTTCTGTTTCCAGATACACCCCCCCAGTCANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTCAATTTAATGAATGCTGAA
AGGGAGAATCTAATGTGCAGTGAGTAGCAAGCAGATCTGAAGTGTGTTTTGAGCACAAAG
TGATTGCATGTTTCGATTATAGTCTCCAAAGAAGGTTGGTGATGACATTGCCAAGGCAAC
CGGTGACTGGAAGGGCTTGAGGATTACTGTGAAGCTGACCATCCAGAACAGACAGGCCCA
GGTGATTCATTCATTGGGTGTGAGCCCTGGGAGTAGACCTGACCCAGCTACAGTGGTTGG
GAGAATTGAGCTGATGGCCTGGGAACATGGGCTGTACACCCATTCAGAATATATATAACT
AGCTGGAGAACCATGTGCTTACCAATTTTGGGAAATGGGAACCATAAGATGGTTTTTTTT
CCCTCTTTTATAAGAGCTTGCACCTACAGCAATGAAGTAGTTCCTGCTTTTGTCCCCGAC
CTTGGGAGCACAATTTCATGTCTCCTTAGCTAATAAGACCCTGTCAGATTTGAAGATCCC
TTGAGAATATATAGCTTGGCATCAGATGTGAGGTATGGCTCCTTGACATCTAGAATCTCT
CCTTCCTGTAGATTGAAGTCGTGCCTTCTGCCTCTGCCCTCATCATCAAAGCCCTCAAGG
AGCCACCCAGGGATAGAAAGAAGCAGAAAAACAGTAAGTGTCCCTTTCCCCCAGGAATCT
GCCCAGTGGTGGCTTGCGATCCAGTGTTTAATAAAGGGTTGCGTGGCCTCCTCTATCAGA
ACCTGGGGTTAGCTGTTAGCCGAGGAGATGCTCCAGAGCCAAGCCCTAGTAAAGTGGCTT
TTCCACAGCCTGACTTGAACTCACTGATTTGTCTATAGCAGGCCAGCCACCCGCCACTGC
ACCCGACCATTCTCTGTTGGCTGGTGCAATCCAGTGGTGAGCTGAGAGTAAACCCCAGCT
TAGGAAAACAGGGTTGTTCTTCATGTGGATGACTCTGTGCCGAAAGCATGGGGGACAGTC
AAGACAATGATGGTAGACTGGTGTGAACTGGGTGGCCTTGGTTATGACCGGTTTTCTTTT
CTACAGTTAAGCACAGTGGTAACGTCACTTTCGATGAGATCGTCGGCATCGCGCGCCAGA
TGCGGCACCGATCTTTGGCCAGAGAACTCTCTGGTAAGAGCAGGACAGCTTGGAACGACC
TTGATTGGGATGTGTGGCTGAGACCCAAAACAAAAGACTGGCTTACGGTTGTGGTGGCCA
TCTTGGGAGAAGCATTGCATCTGGGCAGCCCTGGAGACTTTGAGTCTAGATGGAACTCTG
GGTTTTGGAGTGCCATTCCTGTTTCCCCAAATGGAGTATTCCCAACCTAGTATGAGAGTG
GACCTGTATGTTGTGAGCTGACTCTTATTAGCCTCAAGGTCAGAAATTCAAGTCCACCAG
CAGCCACTTCTTGGGGGGGGAATTGGTGAGGCTGAGATCTGTGGAGGCTTTACAGCCTTG
GAGACGTTTGCAGTGTAGGGTTGCTGAGCCAGGAATGACTCACTGTGTTAGGTGGTGGCC
TGTGAGGGGGAGCTGCACTGAAGGCATCTTCTCTCAATCGCAGGGACTATTAAAGAGATC
CTGGGGACCGCCCAGTCTGTGGGCTGCAATGTTGACGGGCGCCACCCTCATGATATCATA
GATGACATCAACAGTGGGGCCGTGGAGTGCCCAGCAGTAAGTGACTTCCACTGGTTTTGT
TTGGTTAAAATGGGGAGTAAAAGCTATAATGGGAGGTGGCTTGTTGATAAAAATGGGAAC
GTTCTAGGAACTGGGATGGGAGCATTTTTATATTGATAGGATTTCCTTTTTTTGTCTTCA
CAGAGTTAAGAACTGAAAAAGAAAACAATAAAGACTCATTTAATAACCAGCAGGTTTTTT
TGGTGTTGGTTTTTCTCAGGGGGTGTGGATGGTCAGTGGGCTTGAGGTGCCAATTGGGTA
TCAAACCCTCTGGGAACAGTTCAGATGAGGATGTGTTGTGGGTGGACACTTGATATTTAT
CGCCTGGTAATCCTTGGGATGCATGCTCCATCTTTGCCAAGTCTCATCTTTTAAGGTTTT
TATCAGTCTGACCTGTTGCATACTGTCTCTTAAACTTAGTGATGAGAGTAATGGACTGAA
TAGCAAGATACCTGGCACTGAGACAAACTACCTATTGAGCCATTAGAAGCACCACCTGGA
ATAGGGTTTCTGGGGTGCTAGACTTGAGCAAATGATTCTCATGAGAACCTGTTAGTGCTC
CCTGCATTGACCTTACGTGAAATTTCCAGGGGGTGGGGAGGAGAACATTTCTGGTCACCT
GAGTGAGCGATGCGAGGTAGGAAAGACAGCATTGTCAGGGAGAGGTGCTTGCTTCGGCGT
GTTTGGCCAGCACAGTCCTCCCATCTCCCTTGAAAGGGAGGGGTGCCAAACCAATCCCAT
GGTAGCATTAAGAAGCAGGCTATTGAGGTGGCCTCAACTGTACCACCACTTAATCACCCC
GTTCTCCCCGTTGCCCTGGGGCTGGTTTTTCTACTTAGCAGGTTAACAAAAGCTGGATGG
TTCAGGAAGACCTTACGCGCAGTAGCTGAAATAATGAGGACAGACTGGTTCACAGCTTTC
TTTGCTGACTGACTTCAGAGGCTGGGTGCAGATTTGCCCTAACATTGCTTTCCTGATTGA
CAACTCTTGAATTTTGTGGGACTACAGTTAGATGGTGGTGGGAAGAGATCTGGTAGTCTG
CTCCCATAAGGATTATAGTTACAAACCAGAAAAGTGTTCCTGGGCAGTTCTACTTAGTAG
ATTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1006..1120, 1737..1810, 2962..3060, 3431..3512, 3906..3992, 4423..4544, 4546..4587, 4599..4643
1001..1003, 1006..1120, 1737..1810, 2962..3060, 3431..3512, 3906..3992, 4423..4544, 4546..4587, 4599..4643
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved