Echinops_telfairi Locus ENSETEG00000016024
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000016024
Echinops_telfairi
ENSETEG00000016024
GeneScaffold_9119
SNORD96
1372..1450
5629
CGTGGCACCCTCAAGGGCCACAACGGCTGGGTAACGCAGATCGCTACCACGCCACAGTT
CCCCGACATGATACTGTCTGCCTCGCGAGGTACGTGGTGGATTACAGGGCTGGAGGAGGG
GTGCACGCGCTGTGCTGGGCGGGTGGCGCGTGACCCGCAGGCCCAATAGACAAACCACAT
ATGAGTGCGCCCATGGGGACTCCCATAAACTTGTAAGGTGCCCCTTTTGGCCCGTGAGGC
TTCCGGGACCAGGCACAGGCCATGGATGTCAGAAGTGTGGGACCTTTAGCTGTATTGTAC
CCGGAAGCCTACGGCCTGGCGGAGCGGTGATGATTTCAACATGCCATCTGAGCATCCGTG
CTGAGACCCAGAGGCTGTTTCTGAGCTACCGCCCTTCCCTCATTCTGGGGAGTAGGTATT
GGCGAACTCTAGACACTCCGTGATATCCTGGCCTCCTCTCCACTCCCTGAGGTCGCCTGC
CTTGTTGCTTCCACACTGCTAAGTTTTCTATGTCTAACATCATGGCCGACCTGTAACTAT
AAAGTTGTGTGAGTCACAAAGAGAATTACTTTGGGCACTCCAAAGTGCTAGTACTGCAGC
TCGTCTGGTCTCACCCAAACTGCAGTGTCCACGTTACACCTCAGGTGTACTTGAAATCGT
TGTTCAGTTTATCTCCAATCATAAGATACCTAGAGTTGGGAGCAAATTTGTGCGCACCTG
ATTTAAACTTTTTCTATTTAAAAATTATAGTTCAGTTACAGTTGAGGCCATGCTGAATCA
ATTTGCCCTGATAGGTAACTGATAGTTGCTTTTCTCTCATCTTCTACCTCGTAATCCCAT
CAGTGAGCTTGAACTTTTGCATTGTCCAGTAGGTTAGTAAGGGATCTTGAAAGGTGGGTG
TCTAGATACTCATGGCAGCGGGTAGCAGCGTTCTCAGTGGGTTTCCATTTCTGCTTATCC
TTCCTTAGATAAGACCATCATCATGAGGAAGCTCACGAGGGATGAGACCAACTATGGCAT
TCCCCAACGTGCTCTGCGTGGTCACTCTCACTTTGTGAGTGACGTGGTCATCTCTTCTGA
TGGCCAGTTTGCGCTCTCAGGCTCCTGGGATGGAACACTACGTCTCTGGGATCTGACAAC
GTAAGTACCTGCTTATTCTTGGCTTTGGGGCTTTGAGGGGAAAGCTGGGTAGAAAAGGGG
CTGACTGCTGCAATGGCTGAGTCCTGGCTTGAATCGATGGGGTTACAAAAACTAGGGAGC
AGTCCAAAGGAACTGTTTGACTGGATCTCTCATCCAGTCAGGTACCTAAAAGTTTGAAAA
TGGTTGCCTTGAGAGCTAGCTCTGCCTTGCATGGTGGTCTGGCAAGTGACAGGATCCTAG
TGATGACAGACGACATTGTCACCTGATCCCCGTGTGGGAGTGAGGACATGTCCTGCAATT
CTGAATGGATTCTCTGGCAGATACTCAGTTTGCTGGGGTCCGCTACATGGTTAGGATTCA
TTGGAGTGAAGCAAATATCCTGGCATAGAGACATGGCAAGTGTGGAAGGGAGGTTTAGCA
AAGTGTATTTAGAGAGTGACCCAGTCCTTCGTCTTAGGGGCACCACCACGCGCCGCTTTG
TAGGCCATACCAAGGATGTGCTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCT
CTGGCTCCCGAGATAAAACCATCAAGCTGTGGAATACTCTGGGAGTTTGCAAGTACACCG
TCCAGGTAAAATGAAGGGTGTGTGTGGGGTGGGGGTGGGGAGCTGTATTTGTATTTTCAT
CCAGCCTAAAGGGTCCTGGATGAAAATAGAATATCCTCAATGTCAGTATCCATCTTATGT
GCCTGGAGAGATTGTCTAGACTTTCGTGGGACAGGACATTGCCTTCTGTCTCCTGTAGGA
CGAGAGCCACTCTGAATGGGTGTCCTGTGTGCGCTTTTCACCCAACAGCAGCAATCCCAT
CATCGTCTCCTGTGGCTGGGACAAGTTGGTCAAGGTGAGTGAGCTTGGTGCCAGGGCCAC
AAGACCATTACCAGGGAGAAAGTGCTCTGCATCCAGAGGGTCACGGGGTGCAACTTTAAA
AGCTTGGCAGACCCCTTCTTCATAATTTATTAAGATGGTTCCGAATGCACTGTGGGTTGC
TATTTCATTAGGATGCAGCCTCGAATATTTCCCAAGTGGAGCTTCTTCCCAAGTCCCCAA
AGGGATATGAAACCTGGGTTTTTCTGCCTGTTTGACTGGATTATTACCATATTAGAAGTG
GGTCCTTTTGCTCACATCACTAGGGGTGCTCTGACTTAGAGGTTCTGTCTCAGGAAGTGA
GCACAAGCACCACATTCTGTGGTGAAGTTGCACCCTCAGTCAATTTTCCCTTGTGCTACT
TTGTAGTTCCAGGCCCTTAGGTTTTGCTGTTTGGTCTGCAGTGTTTTCAAGCGGCTGGAA
AACCACATAGTTTAGACGTGCTGAAGCAGTCCTTCTACAAGGCTGATCTGGACCTAAGCT
CCCACTTCTATCAACTCTTTTCTCTCAACTTAGGTGTGGAACTTGGCTAATTGCAAACTG
AAAACCAACCACATCGGCCACACAGGCTACCTGAACACTGTGACGGTCTCTCCAGATGGA
TCCCTCTGTGCTTCCGGAGGCAAGGTATTTAGGCGCAAATGATTCTACAATGTATGAGAA
AAATACACTTGACAAGTTTCTGGGGATTGTTCTTAGTAGGCTGTTAAAGGGGACTTTCTG
TAAAACAGGTTTGCTGGAGCAATTAATGAGGTTAATAACCTTGTTTCATAATTTATATGG
GAAGTTAAAATTTGTCAGGGTGTCTTAATGGGTTAGGGTCCTGAATTTAAGGAAAGCCGT
ATCAAGATAGTTGAGTCCTAGGAGGAAAACTGGGATTTGATTCAGATAAGGCTTGGGGGC
TGTTGGGATTATTTGTCAAGTAATGTTGCTTGCTTCACTGTACCTGTCCAGGATGGCCAA
GCCATGTTGTGGGACCTCAATGAAGGCAAGCACCTTTATACCCTTGATGGAGGAGACATC
ATCAACGCCCTGTGCTTCAGTCCCAACCGCTACTGGCTGTGTGCTGCCACAGGCCCCAGC
ATCAAGATCTGGGTGAGTGAGAGTCAGGCTAAGGACCCTGACTGCGCTTTGGCAGCCCTG
CCAACTCTGACTTCGCAGTGCAAGCAGTTCCTTTGTTACAGACATCCACTTAACGGGCTA
TTTCTACTTGTCCTTTAAAAGCAGGCCTTTGAACTTGTTTTGTCTGGCTCTGATTAAAAG
ATGCACATTGCTTTTTTTTTTTTAAGGAGGCAATTAAAAACTTTGCTAAAACCAAACTGC
CATGGAGTGGATTCTGGCTTTCCCTATAGGACAGCAGGATAGAAATGCCTCTGGGTTTTG
GAGGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTTTATTTTACAAAGTAAAAGATTGGTTGGGCTTACACTGTAAGATT
TCTTAGGTCTGCCAGGGGGAGGGAGGGTGACGAGTGCATAGTATTATGTGCTCCTGCATA
GGGAACCAATGATTCTGTAGAACGAGTACCTGATCTAATCTTAATTGTTTCCCTTTTTTT
GCAGACTCTGTTTGCAGGTTACACAGATAACCTCGTGCGAGTATGGCAGGTGACCATCGG
CACTCGGTAGAAATGTGTGGCACAGCTTTTTTGAAATTAAAAGACTGGCTTTCTGACCTT
TGGGAAGTATCTTTTGTGATACACACAACATCCAATTCTTTTTCATTGCTTACATTTTTA
AAGTTACACACCGAGCAACTGAATGCAGGTGGTAAATCAACTAGGCTTCCAAAACTTGGT
GTTTAAAGCCTTCTGTTGTGCTCCTGCAATCTAATGGCTTGTGTGGAAAGTTAACGAAGG
GAAAGATAATTGACCACCAGAGGGCCTGGTTGGCAGGTGGCTGCCACTTGTATGTATGTG
TATGTATATATATATCTATATATAAGTAACCGGTTTTCTAGGAAAGTTTGCACAGCAATA
GGTTCTCATTTAACAGCACAATTTTTAAAAAACGTTATTGAGGGCTCTTACAGCTCTTGG
AACAATCCATAGTTCACATTCTTCAGTGACATTGTTTACATTTTAAAAACTGCTAACATT
GCTATTCCATTTAACACAGCTGAAAGCAAGAACTAAACTTGTATCTACTGCAGAAATGAC
CCATGTCCCATCAACAGGGTGTATACACACACAGTGGAATAGTCAGCCATAAAATGAGGT
GCTGATAATGACTTCTAAAAGCATGTTAATTAAAATATGCCAGACACAAAAGGACAGTCC
CACTTTGTACTATCTGTTACCACTAATTCCTTTTGAGCCTATTTTGACTCAGTGGTGCCT
CCATGTGTACAACTGGAGAAGTGACATGGGGGGCCATGTCTGATTCTTTTCCAGCTTCCA
TACAGGAGACTCCCACGCCACCCTACCGTAGTCAGGTCATACTGGCCTCTACCCTTCATC
GTTCAGCCTATTCAGCCAGATGGTCTTTTGCTACCAGGAGTATTTCTGCTTGTCCTTACA
GGCCCATTGCTGCTCTGCTCTAGTCTGGTGTCAGCTTTGTGGCCTGTGGCACCTACACTA
CAGACAAGGATCTGGTACATCACTGATGGCTCTGGATTATGGGTTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1054, 1058..1132, 1136..1143, 1597..1744, 1918..2013, 2553..2663, 2991..3131, 3855..3965, 4564..4629
1001..1054, 1058..1132, 1136..1143, 1597..1744, 1918..2013, 2553..2663, 2991..3131, 3855..3965, 4564..4626
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved