Echinops_telfairi Locus ENSETEG00000002057
snOPY snoRNA Orthological Gene Database
Echinops_telfairi ENSETEG00000002057
Echinops_telfairi
ENSETEG00000002057
GeneScaffold_417
SNORD70, SNORD70
42427..42513, 43359..43445
58394
TACCAAGGGCTTAAGTAGAAAGGAAATGTTTTGAGAATGATGAGGGAAACAAATGTACA
AAAGTGCTTGACACAATGGATGGATGGGTGGATTGTGATAAGAGTTGTACAAGCCCCCAG
TAAAATGCTTTTTTTAAAAAAAGAAAGATCACTCTTACAAATGCAACACAAAGGAGGAAA
TATTTACTTTTTTAAAACTTTTTAACTTTTTACAGCTTTTTAAAAAATTTTTTTACAGCT
TTTTATTAAAGATTTTAACAAAACAAACTCATGAAAATTTAGAAATTCATTTTTCTGTTT
ATGGGAAAAAGCTTTTTATTGTGACTTGGATGAAGGATTAGAGTATATCATCAGTTTTAT
TTTCAGCCGTTCATACGCGTCTTGATGGGGAGATTTACTAACAGTTGAAAGACATCTACG
CTGAAAATCACTTCTGCCAGAGAGAAAATGCCCATTTAGTAAGAATGCCGAGTCGTTCAC
TTTAAGGCAGGGAAAAACAGAGTAGAAACCAGCGGCATTAATTAGCATTCTCCAAATTCC
AGATGCCGCAGGCAAACAGAAATGGCATCGTGTCGCATTTCTTTTGAGGTGAAATGTAAA
ATTTATAGAGGTAAACTAAGCGTTTCCCAGCAGGTTTCCCTCCCACCGCCTATCTGTAAA
AAATAAAATAAAATCTTGCGTGTTCTCTGAAATATCGCGAGAATGACCATTTGCTCCCGC
TTCCCCCATCCTCCAAGGCGGGAACGCTCCGGAAGTGACGGCACGCTATGCCGCACGTCC
GCTACCGGAAGTGACGTCGATATCCCACAAGCCGCGGCGGGGAAGGAGCACGTTCACGTG
CTCGGTCTGCGGGCTGGTGTGGGACGTGTAGGCATCGTGGTCGCTGCGCGCGTGTACTTT
TCCAGCTGGGGCCTTGCAGGCCTTCGGGGCCGCACGTTTGACTTTTGCCCGCTGGCATCG
GAGCTCGTGGCGGCCACGCAGCCCCCTGATTCGCCCTCACCATGTTGGTTCTGTTTGAAA
CATCTGTGGGCTACGCCATCTTTAAGGTAGGTGAAGTTGAGCCGTTGGAAGGAGCCGGCC
AGTGTTGAGGGACAGATCTGAGGGGTAGACGAGGCCGCTCCGAATTGCGTGTGTGCCTTT
GTGGGCTCAGACTCGGAAAGGAAGGAAAATGCTTCAGGTTTGGGTGGTTTTTACCTGTTT
CAGTGAACACGTGGCCCACCCTTTGGGATCCCGCTGTGCGTTACAGTTCGTCCTTGGTAG
TTTCAGGCATGTTTGAAATGATTTATCCTTTAAATAAATTTAGTTTGTGGGCACTAGAGG
ACCAAAAAAAGGAAGTCAGGGACTTTTTGCATAGATCAAACAACATATTCCAAGGATAAC
AGCTTTGGATTAATTTGGTGTGGAGGGGAAAACCAATTTCGAGAGGCGATAGAACTGACA
AGATTTGCTCAGATTGATGAAGGGTTGGCTTTAAGTAATGAGGGCTCACCAAGTCTGTCC
TGGATTCTAGAAAAATCAATTAAGTTTGTAGTTCGCTGGGGGCTGTTGAACAGGTTTCAT
AAACTTTTGTTTTTTTTAACGTGCTTTGTTTTACTAGTGAATTGTATTGACCTCCGATGT
TATTTGGGGGTAGATTTTTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGCAACCACCCCATAGAAAGGTTCAATCGGAAGGTC
CAAAGAAGGTTGTGACCCACAGGTTTGAGGACCGCTGGCTTTGTGGGTGTACCAGGGTAA
TTCACCAAGACGTTTTCAGTAAAGGAACCATAGTGAGAATGTAATGTATGAGTGAACAGA
TTGAGATTTCATCAGTACTCTGCACACCACCTTCCCTTAGTCCCTCAGCCCCCAGTAACT
ATTCTTTGTACTGCAGGCTGAGAAATCACCTCAGATTCGAAGGTGCTATCCTTGGTGGTG
TAGTGGTTACATGTTGGACTCTAACCACAAGGCCAGTAGTTCAAAACCGCCAGTCCCTCC
TTGGGAGAAAGACAAGCTCTCTACCCCTATGAAGACACAGTCTTGGAAACGCACAAGGGC
AAGTCCTACCTTCTCCTGTAGGGCTGCTGTGAGTCAGCTTCGAATCACTGATAGCGAGTA
ACCTCCTTTGACAGCAGAGGGACTAGAATCACAGAAGAGTTATGGTGTCCGAGATACAAC
TCAACTTCCAGCTGTTTAATCTGTTAGAAAAATAGTGTTTGTGGAGTGCTAGATTGGGAA
CCAATGGTTTACAGGAAGCATGAGCCAATGTAAGCGGACTTATTTGAGTGTGAATGACCT
GCCATGACCTGAAGGAAAGCAGATATAAATGTGGAGCTTTGACTGGTCCTTGTCTGCTTG
CTCTAGACTCAGACTTTGCTCTTTCTCACAATCTTTCTTAGATCTTTCCTCCATCCCTCA
CCAGTTCTTGGAACCGTGCTTCCTTTCCACTTCCCAAATCACAGATGTTTTCCCACCCCT
GTGAAATCCCGGCACTGACTGGCCGGAGAATGGTTGCAATTGTGTTCTTCTGGAGGAAAT
CCTTGCTTTAACTGCCAGGAATTCCAGGCTCCAATATGGTGGGGGCGGGAGCGGTGGGGT
GGGGGTGGGGCAGGAAACACTGGCACATTGCCCACTAGTTCATTGCTTTCTCTTTGTCCT
GCACGTTTCATTATGATACACTTTACTTTGTCTTCTCAATCTGCCCTTTGAAATGTCCTA
TTCTACTCTTTTACTTTCTCACTTCTTCTGTTTACTAAAGCTACTCTACATACAAGGGCC
GGTTTCAGTCTCTTGGACGCACATTTTGGTCTTTTGCTTTTTCTTTTTTTCCCCCACGTC
TTTTAAATGACCTTTTGCTTTCTCCATCTACCATGCCCTTGATACCATCCCCTCCACTCA
GCTGCTCTTCAGTCATTAGTATTCAGGGTGTCAACTGTATTCTTGCCATAGTCAAATCCT
ATTTTAGAAATGTGCCAAGACCCATATATAGGGAACCAAAAGGGAAGGACATGCTTAGCA
TTTCTCAAGCTGAAAAAACTGAAAAAAATTCAAGGCTCTAGAAACACGCACCATGCTGTC
CGCTGCAGCACAGACCTGAGAGAGGAAGTGAAACAGAGAGACGACTATGTTAGACGCATG
GATGTTACATGAAAGGACAAAGAACCCAATCAAACACTGATCGATGAAGAAACTGACTGA
AAACAGGAAGCAGAGGAGAGCCCCCACCAGCCAGCTGGCCCAGCACACGCTGGCCATCTT
CGAAGACAGCAGCACTTCCAGATGAAGAGCACGGGGAGTCACTTCACAGAATCACCAAGA
GGACACAGAATAACTGCGTAGGCACATGCAGAGTGAAATCAGGTCCTGATGGCTGGTTGC
AGCCAATGGAAAGAACCCAGGTGTCTTTGCCAGGTGACGAGAGGTGCAGTCTCCCGCCTC
TCTCACCCTCCAGGTGATTAGAAACACAAATGCCCCCATCCCTGGAGTCTTGACCAGTGG
GGAACAAGATATAAATCTCCTCCCACCTAGTCCCTCCCTCTCTCTGCTGACTACTATCTC
TCCCTGGCCCAACAATCCTGACAAGCAGCAGAAGTCATTCCAACACAGCACTGAAGGTTC
ACCCCTCCCTCCTGCCACTGCCAAACCTTCTTAGCTCCCTCCCCTCACAGCGTTCACACA
GACCTCCCCACCACTCACTTCCACCCCACTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTCTAGAGAGCTCGTTGACTGAAGCAAGAGAAAACGGATTTTAGAATAATTT
GTATAATGTGATTCTTTATATGCATATGCTCTTACAAGTATTATGTGAATAGTGGAAAAA
GGAATAGGGCGGGATGGAATAAAATAGACTTAATACTTTTAAATCTTTGTGTTAAGTAAT
AAGAGCCTCCAGGAGGTTCCTTGACCACATGGTAAGAAAGCATTGCTTTAGATACACTAG
TTAGGCATACTGGAAGACTAGCTTTCCTTTTTAAAGGTTTGTTACTTCAGTTGGCTGGAC
TAAACCATTCATTGTTGTCAATGATGTATTCTTGTTGGAAATGAATCTAAGTGATCTAAC
AAATATTCGTCACTACCACTGAGATGACAATGAATTCACTGTTTTTTTTAATGTATGGTT
GCTTTATTATAAAATTGTTTTATGTTCAGCACATAGCATATAGAGGAAAAAGCAAAACCA
AACATGAGCTGCCATTAAGTCAATTCTGATGTCTAGCACCCCATAGACAGACCAGAACTG
CTGTGATCTCTATGGAAGCAATTCACCCCATCCATCTTTCTCCCTTGGAATGCCTTTGGT
GGATTCAAGCTAATGACCTCTACAGTCAGCAGTAGAGCACTTATATTGTGCTACCAGACC
TCCCAATATAGATGGGGGAAGGAAGGGAGAGGAAAGAGTAGCAGTGATCAGACCTGGGAA
TGGTGTGTACACTGGATAGACATGAATACTACAAGATTCCTCTCCCAAGATGCACTCATC
ATTTTTACTGGGCCAGCTCTGCGTAGTAAAGAACACCTGTGTCCCAGTTTGGACCACCAG
GGGTTACACTTAAGCTTCTGTGTCTTTCAAAGTCTGCAACTTTCTAAATAATAGTCCAAA
CATTACTACCCCAACATTTGGAAAAACTAGTAATTATGTAAGGAATGGCTTGTTCTGTGC
CTTGGCACCTGGTAACAGGCAAATCTCTTTTATTGGTATGTGCTTTGGAAACACCCCAAC
ACCTCTTCTCCAGATGTGTGGCATTTGCAAAGTCAATGTGTGCCCATGATGTGCTTATTT
GTTTTTTATTCCAGAGTAAAGCTAAAACATTTTGAGAAATTTCAGGATACAGCAGAAGCA
CTAGCAGGTAAATTTAAAAAATATATGTACATATTATTTTAATTTGTTTTCCTTATTAAA
GAGTTCTGTGCTTGCTTCCGTTGCCTGAGTTTAACCTTACTCGATGTTGTCAATGATGCA
TTCTTGTTAGAACTGAATTTATGTGATCTAACTCAGATTCGTCACTACCACTGAGACAAC
ATTGAGTTAGCTTTTTTCACCATAGGGCTGGTTTCCCCACCCCCCAGTGTGATGAGAGGT
GAGAAGTGGTTAAGTTGATCTCCCTGTGGAAACCAGCAGCATAATGCTGAAGCACAATTC
ATTAAAAGCTGTACTACAAGGGACCAAGGTAATGTGGTCAAGTACACTGCTTTCTGATCA
TTAGTTTGCAAAAGTATATACAGTATCATAGCAAATTTTAGGAAGAATAGTTTTGCTTTT
TAATTTTAAAAAAATGCAGAGACATGAAAAGTTTGAGTACCTAAGGGAACCTAATCTTAG
GATAAGACATTTATTATAGGACTTATTAAATGAGGATTGACTTCACTAGAATTTGGGCTA
GGGGTTTTGTTTTATTTTGTGTTTTCATTTGCATCTATGTCACTCAATTTCTTAGTGGTA
TAATTTGAAAATGAGAGACAAGGGAGATGGTGGTTTTGTTAGATTAATTTTGTTCGACGG
TCACAGTAGAGAAAAAGGTATGGGTCTCTTGTGGGAAATCACTGCCATTACGTTGGCTTC
AGCTCCCTATTATACAGGACAAAGTAGAACTACACTTGTGGGTTTCCAAGGTTGTAACTC
TTTACAGGAGTAGGAAGCCTCATCTTTCTCCTGCAGGGTGGCTATTGAGCTCAAATTTAA
ACCGTGCAGTAGCGTGCAGCCTGCAACCCACTATGTCACGAGGGCTCTGAAAATTGGTGT
AGTTAGGTAGAATACTGTACTATTAATGGACACCACAACTTGAGTGGAGGGACAGGTTTA
GGAAGGACTCATGAATGGAACCATGGGAAGAAAACAACATAGTTACAGAGCTGTTACATC
TCCAGTTAAAGCCCTATAACCATAAAGTATGCTCTAGTCATTTTATCGTGAAAGTGTTAG
AGCTCTATCTGTCACATCCTTAAAGTTAAATAAGGAATGCAATCTGGGCAAATCCACAAG
GTGAGATTGTTGTTAGTTGTGTGGCAGCTCTAGTTCAGTGCAGGGTGGCATTGTGTGCAC
TGATCGCTAATCCGCAAGTGGTCCATGCTTAAATTGCCTTTGTTGGCATATTAGCCTGAA
AATCCCCCTTTCGGAATTTTTTGACTGGAGCGTTATTATTGGAACTANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATTCCGCCA
GGCCTGAGAAATTCGCTCCTAGGATTTCCAAGCCATTAGTTGTCTGGGTCATTGAAAGGT
TGCCCATTTGGGCCGTAGAGGGAATGAAGGGGAGCAGTCATAGAAAGCCCTGTGCCTACC
CTTTCCCCCCACCCTACTTTTACCCAGTACGTTGACTATCATGAGAACTGTCCTTTCCCT
GGGAATTTTCTAAATGATCAATAACAGTTTTTGACGTAAATAAGCTGTATGGCCATAGAT
AATCAGATACCGTTGTTTTCTTCGTGGCTATACAGTATTCTGTTAGGTGGATACATCACA
CTTTATTCATCCTATTCTGACCAACTTTTAAAGCTATGTGTCTCAGATGTGGTGGAAGTG
TCGTGGAGATTGTCTGATGGGCACCTAGGCAAGTCTCTCTTCACCGGTACCAGAACATGC
ATTTTAAAATCTAGCACAGCGTCATAAAAGCCTGATGGGCCGTCCTATCAAGGATCTATG
GTGGCCTAGAAGCTCCTGGTCACAGTAGCAGCTTGTGTGTCGTCCAATAACTTTGGTAAA
ATTTGGGGCTAGCCTACATTTGGTGTGCAGAAAGTTTGCTGTCATGGCAGGTAGAGGAAA
GACTTGAGCTTCTCTCATCTCTGTTACCATCCCTGTATAATAGACTTTTCAAATACATAT
TCTGAAGAGTCAAAAGCTTTTCCGTAAATGGGGGAGTAGGTTTTTATAAATATTAAAATA
AATCTATAATAAATTTTACTTACAAGAAATAAATTTAAGAATTAAAACCCAAGAAAAGTA
GCTTGAATCTTAGCTTCTTCAACAATAGAGATCCTTGTATGGAGTGAGTGAGTGATAGCC
TTTTCTCTTGCCAGGTGAGAGAAGTGGAATGCTTTATAATGCAAGTGGAGATAGAGTCGG
GAGGATGGAGGTAGTACCTGCTGGGTTGTTTTAGTACAAAATCCATGACATTAAAATTTT
TGCCAGGCTGCCATCTTGGTAGAAGTGCTTTAGCCTCAGCCAAAAGCCAGACTAATGTCA
AAAGAGGTGTTAGTACATGTAGGTCCAAAAGAAGCGTGAGGAGTACAAAATAGCAAATAA
TGAACTCACTACAACAAAAAGAAGTGGTTCCAGAGTAATTTGTAAGCAGGAGCCTAAGGT
GAAGTCTGGATTGGGGATTAATAAAGCTAGGCCATGCTTACCCTGTGACATGTCCTATGA
AGTGAGTGAACTGTTCTTTTTTCCTCTATAATAAACCAAAGACATGACAATTTTAGGGCA
TGATCTAGAATGTCAGGCTGCTCTGTGAATCTACAAAGAAGTGTAGTATTGGTCACCCTG
GTTTCCAGGCTTTCATGATTCTAGATCTCCATTCTTAAAAGAAGAGCCGTTTTAGGCAGG
GAGAGGGACACTGGCCCAAGTTCAGCGCCGGACTCTGGAGGATGGTGGTTAGGAAGATCA
AATGAGGTTATGGAAGCTATGCTTGTAAAACAGTCTTAACATTTATTATTTCATTTCAGA
AGTAATGTTGAATCTATTCTTTTGAAAGATAGTATTTGTTTTTTAACAAATTAAGATGTT
TCTATTGATAATTTGTGTTTTTTTGCTTTGTTTTTCTTTTTCTTAAAAAGCATTCACAGC
TCTGATGGAGGGCAAAATCAATAAGCAGCTGAAAAAAGTTTTGAAGAAAATTGTAAAAGA
AGCCCATGAACCTTTGGCTGTAGCTGATGCTAAACTAGGAGGAGTCATTAAAGTAAGATT
ATGATTCTTTGATGCCTCCTAGTCTCCCTGAGAAAATGAGAACATTTGCTTTAGCCTGAC
CAATGCGCTTTTTTTTTTTCTTTTTAACTTGGCTGCATTTTTTCCCTTTCCATAAAAATG
AAGCCATTGAGTTCGTTTGCTGTTGAATACGTTTTATTAGAAACAGGAGGTGAAGGCGGA
GGTGAAAGATGGAAAACGTAGATTCCCGCATTCACACAACAGCATGGAGTAGGAGCTAGT
TGTGTGGCTACATCTTTAGTTGTTTTTAAGTAGTTGTAACAGTGATAAGTTCATTATTAT
TTTGAGTCTCTGAAGGTTAAAACATGTAAAAGGTTTTAATTTGCGTTTTCAAGGTAGAAT
TGGTTAATTTTAAGAAGTTCAATGAAATAATTTTATTCTAATACTGCCAGGTACTCTGTC
ACTATCAATCTCTGTCTGAGGAACTGAGCAGCCATTTTCCTCATCCAAGGAACTGAGTCT
TGAATGTAGACATTACGCCTGTGAGAATGTGTAGTAGGCAGCACTGCTTGAGCGCAATGT
ACACACATGGCATCAATGTTTGCGCACAGAAGGGTGTGTTGAATGGTGGGATTATAAGTA
TTTGAAGTTCTTTTTAGTTCTGTGAAAACCTGCTTTACAGTGAAGAACATCTCTCTTATA
GAACATACTATATATTTTGGTTTTAAACCTAGTGCAGCATACAAAATTTGGTATGTGTCA
TTTGCCTGAGATAAACTAGAATTATGGAGATCTGTATGAAGCTGGAAAATACACTACTAA
ATGAAAAATAATGAAGCTACACAGAACAAAGTTTATTATCTATTTCTGTGGGGTGCATAC
AAAGTTTAAGTGCATATGGCACACCTACATGATAAAATGTGAATGTAAAAAAACTAATGT
CAATAAATTAATTAATTAATTAGTGTATTTGGAAACACAGGACAATAATAATAGTAATGA
GTGGAGGAAAGCCCTAAGGCTTGAAACTAACTTTGACTTTTTACTTAGTACTCACAGTAC
TATTGATTAGAAATGTCATCTCTATAGGATTTTTATATTATTAAAAATAAGCCAAAATGG
TTTATAGAAAAACGTTTTTACATGAACTTTGTGAAATCCCCTCATGTTTAATCAATGCTT
CACCTTTTTAGAAATGGTTTGAGGAAAGCTTTCTTTTTTATTTAATGTAAATGTTCTTCT
TAGAAAGTGATCTCAGTTGTATCATAGCCCGTGTAATGAGCTTATGCGANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAACAACGTTATCAGGGTATGGTGACATCCTCGGTTTATAGGTGAGCAACTG
ATTCCTAAAATCAGTAAAGCTGTAAGCAGTGAAACCAGTTTGAACTGAGACATTCTGCAT
TGATTGGGTTCTAACCCTGAGCTTAGTGTTGGGTCCTTTGTCTTTTCTGTTTCTTTGTTC
AGTTCTCCATTTGTGTGCTACTCCCAAAGTTCTCTTCTGTGGTGTGTGTGTGTGTGTGTG
TGTGTGTGTGTGTGTGTGTGTGTGGCCTTTTACTCAGGCTTTTAGAATAGAAAAAGGAAA
AGTGCATTAACTTCCCATGGTTAACCAGAAGTCTCTTAGAACAGATGTTTTTCTCCTACA
TATACTGTGGCATACATGTCTGAATAGCTTCTTGCATTTTGCTTGTTTCTTCTGAATGTA
GGTTTAGTGGCTATTGTGTATACTAGTGATTCTCGGCTAAGTGATTTGGAGCCTTAGTGT
CATAGTCAACTGATATATCGGGCTACTAGCCGCAAGATCAGTGGTTCAAACCCATTAGCT
GCTCCATGGGCAGAGTTCTATCTGTGAAGAGTTAACGGTCTCAAGCCCACAGAGGCGGTT
CTACCCTGTTCTAAATTAAAGGGTCTCGAGTCAGTTGATTTGATGGTAGTGAGTTTGGTT
TTTTGGAAGGGATATTAGCTAGCAATGAGTCAATTTTTATTATAAGAAGATTTTATGTAT
ATATACATATACATACATACATATACACAGCCCATCTCAAGAAATGAAATAAGCAATAAT
ATCACGTTAAACCCTCCTTTTTTTTTTATACCATTGTCTTATATCATTTATACCATCGTT
CCTGTTAATAAAGTCGGGGATCGTTTTTGTTTTTTTAAGATGTTAATTTAAATGCTTTTC
CTAACTTATTTCTCCCCTCTTCCCCAGCCTTTCTAGATACAGATTGAAATTCAGTGCTGA
TAAGGTGGATACAATGATTGTTCAAGCAATTTGTAAGTGAAATTAAATCTCTATTTATCA
TAATTTTTCCTACTAGGGAAACATTTGTAGTTCTCTGTTACTGAGAGGGCAGATCAGCTA
GAACTTTTAGTATGTGAAGTAGGTGAATGAGAACATGCAGGCTAGAGAAAGGGGAAATTA
CCATAATTGGACTCTTAAAAAACAATGGGTCCATCACATTTATTAACATTATATTATTTA
AGGTCCATTTGTCTTTTTTCTGCTGTAAATAGAGTCTGTGTAGTTTTGTATTCTGTCTGC
TTCCACTTGGTTTGATATTAAGTTAGCCTCTCAAGTTCCAGTTTCTTAAATCCTTTTCTG
TTTTCTTTTCATTTTAATTCATTACAGCTTTGTTAGATGACTTGGATAAAGAACTCAACA
ATTACATTATGCGATGTCGGGAATGGTATGGCTGGCATTTTCCTGAATTAGGAAAAATTA
TTTCAGATAATTTGACATACTGCAAATGTTTGCAAAAAGTTGGTGAGTAATTTGTATATC
CGTGAAGGTATCGAGAATAGCAGAATTTACTTGAATCGTTTAAAAAAGTATGAGTGATAA
TAAATTTTTTCTTTATAATATGGTCCTGGATACAAGATGGTGTTTCAAATTGCTTGTGCT
GACCTACTTCATCAGAATTTTAACCTTGCTTAGGGTGCAATAGAGAACATAATTCTTAGA
GTGATAAGTCTCTGAATTTGCCTTACCAGAGCTGATTGCAGATTTGTGGAGGAATCTTGT
AATACTGGAAATATCTTAAGAGTAGTTTTATTATCTGTACTATTATGTTCTATATGGAGA
TAACAGTAAGTAGTACTGCATAGGCACCTGGTGATTGATGGCTAATAAAGACTACTTGAC
TCTTGCTAATTTTGTTACCATATTATTTATTACCTCAAGAATCAGATTGAGATAGTGACT
GCTTGCTTGTTCACATTAGTCTAGGTGTAGCTACAAATTAATTTTGTCAATATTATTAGC
CCGGTTCTTTCTTTTGGACAGTTTGTCTAAGTTTTTATGGAGAATTTTGTTTGGGTTTTA
CTGTAACGCTGTACAATCTATTTTTAGAGGGCGGTGGGAGATGGTTTGAGCGAACGCTGG
TGGTGGCATAGTAGGTCAGTTTTGGCTGCTAACTGCAGCATCTGCCCTAAGAAGCCACCA
ACTGCTGTGAGGAGGAAGAGGGGCACCGTCGCAGACCCACAGGGACGGTCTCCGATCCTC
TAGGGTCGCTGGGAGTCAGCTGGGCTCTGTAGCAGTGAGTGAGAGAGATCACGATCATCT
TTAGAATTTAGTCTGGGGAAGGAAACCCCTAGGAGGTCAAACTTGTTCACTTTTTGTTTT
GTTTGGGCTCCGTTTTCATTGGATTATCTATTTCTTTTGCCTATTTGATGGATTTTACGT
AATACCATCCTCTGCCAACATTCCATAGGGGATCGGAAGAACTATGCTTCTGCCTCACTT
GCCGAGTTACTGCCCGAAGAGGTTGAGGCTGAAGTGAAAGCAGCTGCTGAGATATCGATG
GGAACGGAGGTTTCAGAAGAGGACATTTGCAACATTTTGCACCTCTGTACCCAGGTAAAC
CGATACACGTAGTAGAGAAATAGCTGGTACTGTGCAATAGTAATTTTCTGGTGGCGATGA
TGATTTATCTTAACTCATCTGAAATACAAGCATGAGGATGTACAGTCACTACCTCATCTG
ATGCCACTCTTAATTTTTATGGTGGGGGAAGGAGAGCTTGCTGAAAGTTAAGGATATTTT
CCATTTTTCCACAGTTTGTATTTGAAATTCGAAGAGGACTTATCCAAATAATTATTTGTA
CTATTAGCACTGAGCAATAAAGTGAGTTCTATCTTGGGATGCTAACTGCAAGATCAGTAA
AAATCCAACCACATCTCTACAGTAGATAAATTAGTCTTTCTCCTCCCATAAAGATGATTT
ATAACTCGCAGGGTCCCTTCTCCTTTGTTCTATAGGGTCACTGTGAATCAGAATCAGACT
CGATGGTAGTGAGTAGGAGTAGCAATAGGAACACAGTGAGAAAGCAGAGAGGTGTTGAGT
TCTTTACTTCTGAGGTCTGTCTGCCTTTTAACCTGTAGTGAGCTTTTTCTCTAGAAACAA
GCATACCACAATCACAGTGTGCATGACCCAAATGTCTAGCCGGTAGAGGTTTTTAATTAT
ATTATAAAAATAATATTCACTATCATTTTCTAAGAAATGGAGGTTAGGGCTATTAAATTT
ACCCCAGGGTCTTAAAGCTATTCTTTGGTAATGTAAAGTCTCTAATGTTTTAGAGCATCA
GTTCTCAACCTGTGTCGCGACCCCTTTGGTGTTCGAACAACCCTTTCACAGGGGTCACCT
GATTCATATCAGTAGCAAAATTAGTTATGAAGTAGCAACAAAAATAATTTTATGGTTGGG
GGTTCACCACAACATAAGGAATTGTATTAAAGGGTCACGGCATTAGGAAGGTTGAAAACC
ACTTTTAGACAAAGGATAATGTTCTAAAAGTTTTGTACCTAATACATCTTCTTTTTGACT
TCTTCATTGTGTCCTCATAATAGGTGATTGAAATCTCAGAATATAGAACCCAGCTCTATG
AATACCTACAGAATCGGATGATGGCCATTGCACCCAATGTTACCGTCATGGTCGGGGAAT
TAGTTGGAGCACGACTTATTGCTCATGCAGGTTAGGTGGCGGTTTTTATGGAATTTGTAA
GCATGGGTCTTCAAAGATTTGTTTTCTGAGTCAAATTTGTTGTATAAATTTCTGATCATT
TATTAGAGGAATATTAGAGATACAGGGAGGGAAATGGTATATAGGAGAAGACCAAGGACC
AGGTGTTCAGTGATGAATTTTATTTGCTTGGTTGCCTGACTTCCTTTGGGATCATGGAGG
CATCTTTAGTCACTACCTCTTCTGAGACACTTATGGTCCATGGTCAGAGGTTGTTGTGGC
TACGTAGAATATTCCTGAGTGAAAGGATGAATTGTTGTTAGCATTTCATCAGATTGCCAT
TTGCACACAATCAACTGATTCTCATCCAAACACAAAATATTTGACATTCAGAAAAGGAGG
ACTGGATTGCCATGTACTTATGCTTAAATGCTTATGTACTAATACCACCCCTATAGTGTG
CTACTAAATTAGAAAATTAACATAGGCGATAAATAAAATTGAACAAGTCTAACCTTCCAG
TTTGTCATAAAACCACATCATAAGTAGAACAATGCATAGTTCAATTATATCAGGCATGAT
TGTAGCATTGCTGCCACCATCGTTTTCAAAACATTTTCTTCTTACACTCTGATAGCAGCT
CCCCTCCCTAGCCCCAGGAACCCTTGTGTTTTTTGGGGTTTTTTTTAACCCTTGTTTATT
ATAGTAAATATTGTATTTCCTTGGAAAGTGTATTTGTTAACTACTACATTTTCTTTTGTA
GGTTCCCTTTTGAATTTGGCTAAGCATGCAGCTTCTACAGTTCAGATTCTCGGGGCAGAA
AAAGCACTCTTCAGGGCTCTCAAGTCTAGGCGGGATACCCCTAAGTATGGTCTCATTTAC
CATGCATCACTGGTAGGCCAGACTAGTCCCAAGCATAAAGGCAAGGTGAGCCTTTTTCTT
GGGCTGGAGCTGTGTGGGTGGGTGTGAATTATTTCAGTTAGCATTTTGGTTAATTGACAA
ATTGTGAATTCTGTAATGTAAAGAAAACATTTTGATACCCAGGAATTGTTGGGTATATTA
AATGGCAATTTTGGTGTAGGCTTATACAAGGAGAGCAGTCATATAGTTAAAAGCTATCTG
GTCAAAATCATCTAACTTTTTAAAGAATTCCCATACCAACTAAGCCAATACTACTAGTAT
TTGCCTGCATTTTTCTAGAATCTATTTGTTGATCTTTTTTTAGGGCACATAGTTGATGAA
TTAAACTGAAATTTACAAATTTCAAACCAGAGGTAGTTGTGTCAACCACTCAAAGTATTT
ATTGGCATTAAAAGGACCAACATGATATTTAAAAGACTTGAGAGGAAAGGAGTACAACTA
GCACTGTTGATGATAAACTAAAGGAATACAGTGAACTAGCTTTAGACATGAATGGCTACG
GATGGATCCCTTCATCAGAGTGAAGAGATGATACACAGGCTTCCAAAAGTGTGTGGGAAA
TCCCATTATCTTTTTAATTTCATTTTCCACAAACTCTTCGAAATGCTATGCTATAATCAG
CATTATTTTACAATGAGGGTGAATAGTGGCTGAAATAAGACTGTTGTTTTGTTTTTAATC
TTACAACGAATGGTGGTATGATGATTTGCTGTAATTTAAAATGGCTAATGAAGAGGGCTT
TGACATTAAAATTAGACTGTTTGTCTTCAACATTGTTCTCTGTTAGATTTCTCGTATGCT
GGCAGCAAAGACAGTCTTGGCGATCCGTTACGATGCGTTCGGGGAGGACTCCAGCTCGGC
CATGGGAGTGGAGAACAGAGCCAAATTGGAGGCCAGGTTGAGGTCCCTGGAAGACAGAGG
GGTAAGCGCCACATCCTTTCTGCTCTTGGGCCTGTTTTGACAAGTTTTGTAAGGAATGGC
ATATTGTGTAGGTTTGCCATTAAGTTGTGGCATTCAAAGCAAGTGTAAAGAAAATGATCA
GGTATTGCTTCTGTTGGCCCAGTGATATTATAAAATATTATACAAATATGACTAAAATTT
TGCCAATAATTTTATTTCTTCTCAGATAAGAAAAATCAGTGGAACAGGAAAAGCACTAGC
AAAAGCAGAAAAATATGAACATAAAAGGTGAGTAGCATTTGAAAGAAGATAGATGGATTA
ATTCTGCTTAGTTTTTGTAAATTTAAGGGCTTTGCTGTTTAGTTTTTTTCTTTGTCACTT
ATAATCTTCCATATTCACGACTTGCTTTGATACATCATTCTTACAAATCTTTGTTGTGTT
AAGTATACATACTGTGCTTACCTCTTTTCCCCTTAGTATTCAACATGCCCATTCCTAGAT
ATTGCATAATGAGTGTTTGCCATGCAAAATACCTATATATTATACTATTTTNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCCCCCAGCATTAGGTCCTCGTTTTTC
CCTTCCCTCCCCACTCTCCCCCTCCCTCATGAGCCATTGATAACTTATAAATTATTATTT
TGTCATATCTTGCCCTGTCCGACGTCTCCCTTCACCCACTTTTCTGTTGCCCGTTCCCCA
GGTAGGAGGTTATATGGAGATCCTTGTGCCCCCCTTTCCAACCTACCCTCCCAGTATCTC
CACTCACACCACTGGTCCTGAATGGATCATCCATCCCGGTTTCCTTGTGTTTCCAGTTCC
TATCTGTACCAGTGTACATCACCTGGTCTAGCCATATTTGTAAGGTAGAATTGAGATCAT
GAAAGTGGGGGGAGGGGAGGAAGCATTTAGGAACTAGAGGAAAGTTGTATATTTCATCAT
TGCTGCATCGCAACCGGACTGGCTTGTCTCCTCCCCGAGACCCTTCTGTAAAGGGACTTT
CTGGGTATTTCTTTTGTATTTTGTGAACTTTTTAATTTTTCTATAGTAACCATAACTTCT
GTAATTTTAAGTATTTTGTGATTTGAACAAAAATTTATGTTCCTGTGCCAATAGGCATGT
GAAACGCCAATTAGGTATACCATATTTCCTGTTTTCTTCTTTTATACTTTGTTGAACCAA
AAATCAATCGTGGGCTTAGTGAATCTGTGTGTATATCCCCTCTTTTTCCTCTGCATAATG
GAATTATTGTATTGAAGACAATGTAAAATTTTTGGTTTAGATATTTTTGTTTTGCTCTTG
CACTGCATTACCCAATCAATATTCTGAAACTTTGAAATGCTTCAATTTTTGTTTTCTGTT
GTAGTCAATTGATAAGAGAATTTCTCCAGTGTTCTATTGCATTGATGGAATTGTTTTCAG
AATTCATTTATCACTGGTCTTAAGGAGTGCTGGTGACGCAGTGGTTAAACACTACTGCTG
ATCACAAGGTATTGATTCAAACACACCACGTGGCTCCATGGGAGAAAGAATACAGTCTTG
AAAGCCTTGAGATGATTCCACTCATGGGGTCACTATGAGTCAAAAACGAATTCACTGGCA
CCTAACAGCATTTCCCTTGAGCGTAGTTGGCCAACTTTAAAAGATGAATGCCAACAAAAG
AAAGTTGAATGCTTTTACATTATAGAAACTGTGTTAGTCTTTCCAAAGCCACTAAAATGA
AACCGTATCCTTTGCTTATGTACGTAAGTCTAATGATATTTTCTTCTTTCGAGAAATATA
TCAAAGATATTTGTTGACCTTTTCTGAAACTGGCTTTTTTACAGTGAAGTAAAGACATAT
GATCCTTCTGGAGACTCCACACTGCCAACCTGTTCTAAAAAACGTAAGATAGAAGAGGTA
GATTTAGACGATGAAATTACAGAAAAGAAAGCTAAAAAAGCCAAGATTAAAGTCAAAGGT
TGGTTTCGGTTTTTCGTCATTTATACTTATTCTTTAAGAACAACATAAATCTTAGAGGTG
TATCTTTATTATGAAGCTGCCAGATTGAAAACTATTGGCGTTTTAATAAGCCACCAGGTT
CACTGAGAATACCGTAATTAGGATATTGTTAAATTAATTACTTAAGGAATGTATGGTGCA
TGCCTTTCTATCTGATTAACTTGAACCAATTGTACAAAAACTTTAGTTTCTACCATTGGA
ACTATCGTACTAAGAGTAAAATTAAAATTTTTCAAAGTGATTGTAAAATTGGTCAGTAAA
ACTTTTTTGATAGTTGAATGTGCGTGCAGGGGTAGTTGTGGAATATAGGAATTAGATAAC
ACAAAGCTAGTCACAGTATCCAACACTTGAAAAGTATAATTGTTATCACTGAATTAGTCT
TAGCAATAAAATTGTTTCCTGGGAAGAAGTTCAGACAAGGCTTCCCTGACCAGAAGAATA
GGTGAGAATGAGCATGGAGAAAGAACTCAAATTCCAAGTGGAGCTCAAGAGGAAGTGAAG
GGGGCGCTGTGTTCTTGGCACATAGAGAGCGAGAGGAAGCTATTAGGAGATGGTTAAGAA
TACCATGTCATGGTAGTGCATTAACTAGGTTAGTCAAAGGATGGGTAGAAAGGAGCATCA
AATGTAATGGTTTGGGACTAGGTCTGGAATTAATCAGCATCAGCTGTTTAGGTTGAGTTG
AGCAATGTTACTGTAGTTCCATTGGGATCTTGAGGGTTCTCAAATGCATCATCTGGCCAT
GTTAATTGCTTTGTCTACATTTTACTCAGTTGAAGAGGAAGAAGAACAAGTGGTCGTTAT
GGAAGAAGAGGAAACCTCTGTGAAGAAGAAAAAGAAAAAGGATAAAAAGAAGCACATTAA
AGAAGAACTGGCGTCTGAGGAAGAGCCATGCAGCCCCACAGCAATTTCTGTATGCTTCTT
TAGTTAACAATAATGGGTTATCATGGGCCAGCTCCTGTCATAATTAACCCACGCCCTAAT
GCACACTGCTTAGAAATTGGTTGTAAAATTTGGGGTTTGTGGATAGGCAAAAATAATGCC
GGGTTGAACTAATTTTTGAAAAGGCCACCTCAAACCTAGAATCTAAAAATGAGTTTGCTC
GAGATGTGGGGGTGAGATTTGCTAAACATTACTCTCCCAGGGGTACTTTTTATAGATTTA
AATTTCAGTTAGCTAAAAAAAAAAAAAACCAACCATCACTTCATAAAGCCTTACCCCCGA
TTTATTTTCAAATAAGAGATTTTTTAATTATTAAAAGGAAAAGATTATTACCCTTACATC
ATAGCTCTTTCTAAAGCTTTTTTTTTTTTTTTTTTGCTATTTTCAGAGTCCAGAGAAAAA
GAAGAAAAAAAAAAAAGAGAGAGAATGAAGACTAATGGAAGAGAACTCTTACTAATTAAA
CACTTGGATATAGCGTGTTCAAGACTCAAGTCAGGGATACAGGTGCCGCTACAGTGCTGA
GGGAGGCGGAATGAGTGGTTTATCATCGGTAGCATTTCAGTCTTATAACATCTTACGTCT
TCACATCAACTCCTACTCTCATACCATCATTTCTTAATCATTTTTGATATAAAAATAAAA
ATATTTTCTTCGTATTTTAAGGCAGTTCTGTGATCTCTTTATACTTTGGGTAGACAATCT
TTATCCCTCTATATTTATTTAGATTGATTTGTTTCTCAGTTAATTCAAAGTGACTTTTAA
AGGTAATTTTAAAGTATAAAATGTACATAAAGGGAAAATACCAACAGAAATTGACAGATA
AGTTTTTGTGAGTTTCTGAAAAATAATGTCTAGTGGCATCACATTACAGTTCCACACAGT
AAGTGAAGTTTATTGGAGGAGGTGAAAATGACTAGCTTTTAGTGTTAATTCTGTTTTTAT
ATGGCCATCTGTGTCTCCTTGTACTGTTGGTAGAAATTAAGACGCTCACAATCAGTTCTG
ACAACTTTTGAGAACTGGTCATTTTGAATAGTTTACTGGCTGAAGGAAAACTTGGTTGGA
TCACACAGCTATCCAAAATCCTATCTTTAAAACTGAAGAAAATATAATTTGCGAAACTCA
AGTAGGCTTTATATACCTAATTTTGATGCACACATTTTAAGAATTTAGGTGACTTGGATA
AAAGGCTACAATTTCTACTGTACACTCCATGCCTCCGTCTCCCCTTCAAATATAAGATTC
TACCTTTTGTGTTTGAACTGTCCATTGTCTTCCAGCTTCTCAGGCCTTCACTGATTTATC
TCCAATTTCAGTCCAATATTGCCAGTTCTCTCTGGTCCAGGCTCTACCTTTGCTGCCTAT
TAAGAATGTAATTTGTTGGCTTTCTCTAACATTAAGACTTGGCTTAAACACGTGCTTCGT
AATTTAACTTGCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 41952..42028, 43214..43266, 46490..46611, 48080..48216, 49347..49411, 49767..49901, 50848..50993, 51983..52107, 52113..52114, 52861..53024, 53806..53940, 54145..54206, 55844..55977, 56789..56928, 57346..57366, 57371..57394
1001..1045, 41952..42028, 43214..43266, 46490..46611, 48080..48216, 49347..49411, 49767..49901, 50848..50993, 51983..52107, 52113..52114, 52861..53024, 53806..53940, 54145..54206, 55844..55977, 56789..56928, 57346..57366, 57371..57391
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved