Echinops_telfairi Locus GLOD5
snOPY snoRNA Orthological Gene Database
Echinops_telfairi GLOD5
Echinops_telfairi
GLOD5
GeneScaffold_6826
SNORA76
1967..2085
9527
TGAAGCACATTTGTACACTGATTTCCCTCATCATTCTCAAAACATTTGCTTCCTACTTG
AGCCCTTGGTATCAGCTCCTCAAGCATCATACTTTTAAGCAACAGACCAAAGTACAGTAG
CGTGGCTTGGTCTTCAAGAGCAGTGGATCAAGTTGTAGAGGTTAGGAGCCAGGGTAGGGA
GTCTGGTTTTTAACAAAATGACAATGTCATCATCATCACAGTTAACCCTTTTATAGCATT
TGCTATGTATCAGGCATTGTTCTGAGTCTATAAAATATACAACAATAAAAAAATATTCAC
AACAATCTTGTGAGACATGTATAAAATTATGCCCCCTTTTCAGAGGGGATACCAAAACCA
AAGTTACTTTGGTTTCTTTCTGTTACCTAAACTACTATACCACTGTGCTACCAGATCACA
GGACTCTTAGAATTTTATAGCACATGTACTGTAAACACACAAATTATTAACAAACGCAAG
TCAGAAAACAGAAGAGAAACATCTGGGAAAGAATCCAGAGAGCAGGCTAAGGGAAAGGTA
CACCCACTGGATGTTGAGATGAGTATCTAAATACAGATTCCCAGAAACATTTCTTTCATC
TGAGATGCTTTGTCCTTGTCTGGACTTCTGTGTAGTATGCTAAGGAGGATGACTGGGTCA
ACCGAGGCAAGGGAGGCCTTGCACTCATAGGGTTAGGTCTCCTTTGTGTCTTGTCAGGTA
TTTTTTTAGGAAAGAGATGGATTCGTTTGGGGATCACGAAGGAGAAGTGGGTCCTGATCT
CGCCTTATCTTTATTCCTAGCCCTTTAAAAGGAGAAATAGGAAAACAAACCGGTAGAGAT
ACATGACCTCTTGTGAATCCATACTTGGGAAATTAGAGTGTACTGAAGTTTTCTCCTGGA
CTTTTCTTTTGAAATAGTAGAAAGTATAGGGTTCAGCGGAGATGAGATGGAAACATGATA
ATCAATGACAATGTCTTTTTTTCTGTTTTGGTTTTTAGTTGTGGAGAAACAGCAGCCAGA
CTCCTCCCCCCTGTCTTATCCAGAGACTTGACCACATTGTGATGACAGTAAAGAGTATCC
AAGACACCATAATGTTTTATTCCAAGATTCTGGGCATGGAGGCTGTGACTTTCCAGGTAA
GCATTTGCCCAAATACCAAATTGCAGATGAAGTAATATTTGATTGTATACCAAAAACCCA
CACAATCCACTGCTACAGAGTTAATCCCAAGTCATACAGCCCTGCATAGGTTTCTGAGAC
TGTAAATTTTTACGGGGGCAGACAGCTTCATTGTTTCCCCAGCCAATGACTGGTGGGTTT
GAACGGCCAATCCTGTAGTTAGTGATCCAACAATCTCACCCTACCTTGAAAACACAAACA
AAATCTAAGACAAAAGATAAAAGGATCAATGGAGAAGATTCCAAACTTTGAATAATAGGA
CTTTCAGAGGGTGAACAATGAAAAAGGGGAGGAAATTAGCATAGACACAATCCAAGAAAA
CTTGCCAGTCTTTATATGGAGTTAACTGAACAGCTACTATATTGATGCTTAGATATTACT
TTATGAAATTATAAAACATCAAAGTGAAAAAGAAAGATCTAAAAGCCCCTGGAGAGATTA
AAAAGAAAAGTAACTCAAGGGAAACAGTAGTTCAAGGGAAACAGTAACAAGCAACAGTAA
CTGTTACAGTAACAGTAACTCAAGGGAAATAGTAACAAGTAACAGTAACTGTTAGAGTCA
CAGTAACAAGGGAAAAAGAAACACGTACACATCAGATTTCTCAAGTTACACCAGAGATCA
GGAGACAATTGCATATGACACCTTCAAGATTCTGAGGGAGAAATTTTTCAACCTATAATT
CTATGCTTAACTAAATTATTAATTCAGGGTTATATAGAATTAATATGTTCTTAGATATAA
TAAGACACAGAAACTTGTCCCACTTGCTTTGAAAATTACTTGACAAAATGTTGTATCGAA
ATGAATAGATCCTCCAGAGTTAAGCTGCAGTGCCAGAGCAAGTGCTCATGCATAAATGGG
GCCACCAAGGCTCTGCAGGTGGCCCTTTTAACCAAGAGCAACATGGCAGCCTTAAAAAAA
GAGTAAATCCCAAGAAGATCTCAAAGAGATCTAGAGAACAGGGACTCCATTTTGTGATGA
GAGGTAAGAAAAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTATT
AAGGTAGCAGAAGGACATTGGGCCTCCACTCAAGTACTCCCTCAACACAAGAATACTTTC
TTCTAGTAAATTGGCATTCTATGATGCTCACCTTCCCGACACAACCGCTGAAGACAAAGC
AGGTGAATAAGCAAATGTGGTGAAGAAAACTGATGGTGCCCAGCTATCAAAAGATATAAC
ATCTGGGGTCTTAAAAGCTTGAAGGTAAACAAGCAGCCATCTAGCTCAGAAGCAACAAAG
CCCACATGGAAGAACAGATCAACCTGTGTGATCACAAGGTGTCAAAGGGGTCATTGAAGA
CAAATGAGTGCATAAGCAAATGTGGTGAAGAAAGCTGATGGTGCCCGGCTATCAAAAAGT
ATAGCGTCTGGGGTCTTAAAGGCTTGAAGGTAATCAAGCAGCCATCAAGTTCAGAAGCAA
CAAAGCCCACATGGAGGAAGCACACCAGCCTATGCAATCACGAGGTGTCGAAGGGATCAG
GTATAAGGCATCATCAGAACAAAAAATCTTACCATAGTGAATGATGGGGGGAGTGCGGAG
TAGAGACCCAAAGCCCATGAGTAGGCCACTGGAGATCCTCTTGCAGAGGGGTCTCGGGGA
GGAGACGAGCCAGTCAGGGTGCGATGTAGTAACGATGAAACATACAACTTTCCTCTAGTT
CCTAAATGTTTCCTCCCCGCTCCCACTATCATGACACGAATTCTACCATGCAAGTCTGGC
TAGACCAGAGGATGTACACTGATACAGATAGGAACTGAAAATCCAGGGAATCCAGGGCAG
ATGAACCCTACAGATGAATGGCGAAATAGGGAGGGTAGAGGGAGAGTGGGTAGGAAAGAG
GGAACCGATTACAAGGAACTATATGTGACCTCCTCCCTGGGGGACGGACAACTAAAAACT
GGGTGAAGGGAGATGTCGGACAGGGAAAGATATGACAAAATAACAATTTATAAATTATCA
AGGGCTCATGAGGGAGGGGGAAAATGACGACCTAATGCCAGGGGCTTAAGTGGAGAGCAA
ATGTTTTGAGAATGATGAGGGCAATGAATGTACAAATGCGCTTTACACAATTGATGTATG
TATGGATTGTGATAAGAGTTGTAGGAGCCCCTAATAAAATTATTTTTAAAATTTTTTTTA
AAGTAATTTAAAAATACATGTGTAAAAAACTGTACCAAAATGAAATGCAGCCAGTGTACA
GTATACAAAATCTTCCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TGTATGTGTGTGTATGTATGTATATATTATAATACATATTATCATTGCCATAGAGCCAAT
TTAGCCTCATGGCAACCCCGAAGGACAAAATGGAACTGCTACTTAAAAATTTCTGAGAAA
AAAAAATTTCTGAGACTGTGAGTCTTTATGGGAGAAGACAGCTTCAACTTTTTCTGGTGG
AGCACCTGGTGGGATTTGAACTGAAAGCCTTGCAGTTAGCAGCCCAACATGTAACCCACT
ACACTACTAAGTCAGTATCTGTCTGTCTGTCTGTCTATCTAGCTATCTATCTATATATCT
GTCTAACATCTACATATGCTCTAGTTCAGGTCTACAGCCATGCCCTGATCATAGAAACAT
GTTTAAATATGTTTTGTTTAGAATAGTCCGGTACATATAACCTCTCACTTGGCTTAGTCT
TCTTAGGTGTCTTCAGCAGGATAAAGGATACCTTTTGCATCATGGGGGGGGGGAATGATT
TTCAAACACAATCCTGACAGAAGAAAGAAAAGAACTGATTTTGAGGTCAAGATTAATATC
AAAATTTTAACAAAACTTAAGTAGACATTTTCCCAAGTTATTGAAGATATGCAACAAGTT
TATGAGAATACGCCACCCTCTCCCCCCCCAAAGTTTTTAGGTGGATCAAGTGTTTTAAGT
AAAGTGGGGAAGATGGCAAAATGAACCAAGAGAGGGATAACGGTCCAGCTCAACAAATGC
AGCAGCTGCTGGGGCGGAAGTCTGGATAGTGGTGGAAGAAGACTGCAGAATCACCGTCAC
ATGATCCCGACTGGAGTTGGGCTCTCATGTTTCAATTTTCAGCAAACTTCTTGGTCTCAG
CCAACTTTCAACTCCATGGGGTGCCAAGAGCTTTGCGTGAAGATCAGCTAGCTTTTTTTT
GTTTCCTTTGAGTCCCTTGAAGATGTGAAAACTGACATTTTGACATACTATAAGTTAGGT
ACAGAATTTGGGGGTAAGGATGAGATAGAAACACTGCCTTCAGAAACATGTAGTCCTAAG
TGGGGGATCTGTCAAGAAACACTAGCTTCACAGTTTTTAATTGTCATTTAATACAGGTGT
CTGTGGGTTTGTAGCAATACTTTTTGATTTACCCTCATTACCTATTTATCTATAAAGTTA
AAAAGTCATTTGTCTCTGGAGATGAGATTTTGTTGGGGCAAGAGGCTTTTGTTTTTCGTT
AGAACCCTGCTCCATTTTGTTGCTGCTGTTGTTGTTGACCTTGTTGGGATAGGTAGGGGG
GCTTCAGCTCACACTCATCTTGGGGACTGAGTTTCAGGTTGTTTTCTCTCTCTAAATAGG
GAAACCGAAAAGCGTTGTGTTTTGGACACCAGAAATTTAACCTTCATGAGATGGGAAAGG
AATTTGAGCCCAAAGCTGCTAATCCAGTTCCTGGCTCCCTGGACATATGTTTGATCACAG
ATATGCCATTAGAAAAAATGGTCTGGCACCTCAAGGTAAGCTAAGCTTCCATTCTATTTG
AGAAAGCTACTGGAGATGAGATCCCTGGTAGTGTAGTTGGGCTGCTAACCTCAAGACCAG
CAGTTTGAAACCCCTAGCTGCTCCATGGAAGAAAGATGAGGCTTTCTACTCCTGTAAAGC
GTTACAGTCTTGGAAAGCCACAGGGGCAGTTCCACCCTGTCTTATAGAATCGACTCGCTG
GCGGTGAGTTTGAGTGCAGATGGAGTGAGAACAGAAACATGGTCCAGGAAGGTCTTCCTC
CAACTTCAGATTTAACATGTTTCTTACATCATCAGAACAAAAAATCCTATCATTGTGAAT
GAGGGGGGGGATTACGGAGTGGAGACCCACAGCCCATTTGTAGGCCACTGGANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNATACCTATGCACAATTATATACTGTCATATTTATGAACATCATTTTTCATG
TAAACAAATGCATTTAAAAAATTATTTATTGGGGGCTCGTACAATTCTCATCACAATCTA
TACATACATACATTGTGTCAAGCACATATGCACATTTGTTGCCCTCATCATTCTCAAAAA
CATTTGCCTCCCACTCTAGCCCCTAATATCAGTTGCTCATTTCCCCCCTCCCTCCCCCCT
TCCCCCTCAACAAATGCATTTTAAAAGGAAAATTTACATTTCTTGAAAAAAAAAGCTATT
TAAATTCTTTCCACATATATAATTTGTCTAAAAAGAAAATGTTCAATCAAGTAAATGAAA
AACCAGTATATCTTGTAAAAGAAGGACAACTACTTTTAAAAATCTATAAAAATCTAACAA
TGTTAAAAAAAGGCATCGAGTGTTAGAGCCTTATTAGTACCCAGGGGAGACTTGCCATTT
CATGTTTGTGTCTCAGCACCACGTGATGTCATTTCCTAGTGAGTCACAGCTCAAACTTCG
TACAGAACTGCTCAGCCTCAGGAAAAACAAAAAACAGCAATGTCATTAGATTCTAGCCAT
TTCAGCTTTTCTGGACTCTCTGGGCGTCATACTACCAAGGGAGATGTACAAGTACACTTG
ACCCTCAAACAACACGGGTCAAAACTGTACAGGTTCTTGTACACATAGATTTGAAAACCA
CAACTTCTTGTGAGAAGGTCATCGCTCCGGTAAATTGCATTTTGCAGTAAAGATGGTATA
TGGCCCCTAGTGTTGCTGGACATACTCCCAAAACAGAGAAAAGCCAGGCTGTGATAAGAA
AAAGTTGAGTTCCTTGATATGCACTGTAGATTCTAAGAGCCCTGGTGGCATAGTAGTTAC
ATGGTGGCTGGTAAACTCAAGGTCAATAGATTGAAACCAACCAGCTGCTTTGAGGAAGAA
AGATGAGGCTTTCTACTCCCTTAAAGAGTTATAGTCTTGGAAACCTACAGAAACAGTTCT
ACCTTGTCCTATAGAGTTGCTATGAGCCAAAATCAGCTTGACAGCAGAGTTTGGGGGACT
GTAGATTGAGTTCTGCTGCTGCGGTTGCCCGCCATTTCGAAATAAATGAATGCAGCCTAA
GGACCACTGGACAGGAAGAAATGGAGATTCAAGACACCCTTGTTGCAGCATGACAGCATG
AAAACCTTTCCCTTTTTGTGAAAGGGCATTTGTATTTTATATTGAAAAGATAATTTTATA
TGGGTGCAGTGTACAGTCCATCTAAATGCCACATATATGTTAAGCAACTGTTTATATGAC
TGTATTGGTAAGGCTTCTGGTCAACAATCAGTTATTTGTTCAATTTGGTGGGGGCATGGG
TCATACACAAACTTTCGACTATGTGGAGAGTCAGCGCCCCCAAATTGTTCAAAGGTCAAT
TGTATGGAGGAGGTGCCAGAGCACCTCTGGTGGTGCAGTGGTTAAAGCACTTGGCTGCTA
ACCAGACCAGCCATTCCACTGGAGAAAGATGTGGCTGTTTTCTTTTTTTTTAGGGCCCAT
ACAACTCTTATCACAATCCATACATACATCAATTGTGTAAAGCACNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNTTTGGGATGATGAGGGCAACAAATGTATAGATGTG
CTCTACATAATTGATCTATGTATTGTGATGAATTTTATGAGCCCCAATAAATGGATTTAA
AAAAAATTTTTGGTTTCACACAGGAACTGATGGATGACTTTTGTTTTCCCCTCTCGTTTC
AGGCTTGTGATGTCCCCATCGAGGAAGGCCCAGTGCCCAGAACAGGGGCAAAAGGGCCCA
TTATGTCCATCTATTTCCGAGACCCTGACAGAAACCTGATTGAGGTGTCCAACTATAGCT
CCTCATGATGGAGACTGACTCCACTCCATTCTGTTCCCCATGTTCCAACTTCTCCCTTCT
TCCCCACAAGCCCTTTCCCACCCTGAGAGACCACCAGAGATTGAGAATTTAAATACTTCA
CACCTGCTGGAGGGGTCCTGAGATAGGTTTGAAGCCAAATCTTCTGAATATCTCCCATAT
GTTCCACAATAAATTAATAACTTCTCAATAAACGAGCTCTTATTATGGTTTCTGGGCTAT
GAGTCTTTGTTCAAGGTTACAAGGTCTCTGAGATGTTTGGGGTAAGTAATAAGGGTGTGA
TAGTTCTGAGGGCCAAATCCAGGGTCATCCCCTTGGAATTCAAAGCCCCTGACTTCTTCA
AGTCAGTGAACCCACATTTTGCCATCCTTTCCAAACTTGTCCTACTTTTTCAGGTGTGTT
TCTGCCACCTGACAAACCTCACGGAACCCCAATATCTCTCTAATTTACATTTCCCTCAAG
GAGCAGCCCAAATGATATTTATTACCTCCTCCTAGAGAGCTTTCTCTGGTCTCATTCCAT
CTGTTAGGTCCAGCCTTGCCTCACTTGAGACTCAGCGCTCAAGAAAGTAAGTGGGACAGG
GCCAAGTTCTTTCTGTTTCTGTTCATACTGTCACAGTGCCAGCATTCATTCGTTCCATTA
ACAAGACTATATTAAGCATCCCAGTATACCAGGCTTTGTTCCTAAGGTTTGGGGAGACAG
TGTTAAACAAAACTAGATAAGCAAATCTATGTTTGCTGCCATTCTAGTAGATGATAGAAT
AAATAAAATATTAAGTATGTTGTTATTAGATGCCATTAGGTCAGCCCTCATGACTCATGG
AGTCCCCATGTGTAAAGGAAGGAAATACTGTACCATTTGCAAGGGATAGGATCATTGTAA
TTCATAAGTTGGGTTTTTAAATGTAATATTTTATTGTGTTTTGGGTGAAGCTTTACATTA
CAGTTATGTCCACCTAGCCCAGTCAACGATGCCTGCACAAGTTGCTCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1135, 5399..5554, 8402..8527
1001..1135, 5399..5554, 8402..8524
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved