Echinops_telfairi Locus TSR1
snOPY snoRNA Orthological Gene Database
Echinops_telfairi TSR1
Echinops_telfairi
TSR1
GeneScaffold_6467
SNORD91
6838..6930
11349
NNNNNNNNNNNNNNNNNNNNGCGGGCCGGGAGCGCGCCACGCGGGCCGCTGTCATGGCA
ACGCGCCCGCGCCCGCCCCGAGGGCGCTAATCCGCATTGTGAGCGCCCGTCGCTGGCCGG
GCGGAGCGCCGGGTGGGGCGTCCCGGCGGGTGCCGGGCCCGGCTGGCCGTGGGCTGTGGA
GACGGCCCCCGCGCCAGCGCTGGATCGAATCCAGCAAGACGCTCCACTGGCTAGTCTTCT
GATGGGAAGGAAAGGACCCGGGTCGCAGGGGTTCGGGCCTCCGCGGGAGAGGGCTCAGCC
TGGCCGGGCGCCAAGCCTTCCACGGAGTCTCCTCCTTGCCAGGCGGATCGCCCCCTCCGG
GGGCAAAGCTTGTGGGAAAGAGGGATGGGAACGCAGCGGCTCGGCGGTCCCCGGGGAAGC
AAGGGTCCTCTCTACCTCCCCTCGGGGTCGCCACGTCAGTCTGGCTCTTCCTTAGGGATG
TGTGTGTCTATGGGAGGGGGAGGGGGATTTGGGGCGCGGGTGGGAGTCAGGAACTTTGAA
CGGGGCCGGCGAGGCGGAGAAGCCCGTTCCAAAGGATTCGGCTTGGAACCTTCAGCAGCC
TCGCATAGGGATTGAGGGAAAGACGGCTGTTCAAAGTGACAGCGAACACCTGCTGCTGCA
AACCGATGTAAGTTCGAGGAAGGGCTGCACCTTCCACGGCGTCCGCATCTTGCTACGCGA
TGCAACTGCATAGTGCCAAAAAAAGGGGGGGGGGCAGATAAAGAGGGCAAAATCTGACGC
CTGAACCGAGAACCTGAATCACAAGCGTATGACATTTAAAGCCCTCAACCGCGACAGCCG
CGTGGGAAAAGTTAACACGGCGGGTAGGCTGCGACGCTCCCGGGGAGCACACCCAGGCTG
AGAGCCCAGCCCCTCCGCGCAGAGCCCGCCCCCACCGTGAGAACCGGAAGCGCTCGGGCC
GACCCGGAAGTAGTGCTGACTTCTTACACGTGAGTGGCAGCATGGCGGCTCACCGCTCTG
GCCCGCTGAAGCAGCAGAATAAGGCTCATAAAGGCGGGCGGCATCGGGGTCGGGGGTCCG
CTCAACGAGATGGCAAGGGTGAGTAGAGAGGGGAGGAAGAAGAGTTGGCTGCTGAGCCGA
GGTGAACGGATTTTCCCCGTTCTGAAACCGAGCTCCCATCTCTGGCCTGGGCCCTAAATT
CCAAGTCCCCATTTTTGACTTTCTTTTGGTGCCCAGCACAGACTCCCTTTCTGATCTGCC
CTCCAGGCCGACTCGCAGTGAAAGCTCTAAGCAAGAAAGTGAGAAGAGAGCTCAGCCGAG
TCGATCAGAGGCATCGGGCCAACCAGCTCCGGAAGCAGAAGAAAGAGGCGGTGAGAGGAG
CGGGAGGCGGGGAATGGCGTGGCTTTTCAACCGTTTGGGGCGGGTGAGGACTCGAACTAG
TAGATGAGACCTTGGGGGTGGCGGGGAGGGAAGAATCTTAGCGCACACGTGTGGTGTTTG
CCTCTAGAGCTAGGGCATCTTCAAGTTTGATCCCAGTCCCTGCCACTCACAAGGTGAAAC
TGGTTAGGGGGCGCTTCTGTGCTGTTGGAAATGAAATACTGGAAGGACCCACCGAGATAC
TGAACCTTTCCGTCTCTAGGTTCTGGCGGAGAAGAGACAGCTGGGCAGCAAGGATGGCGC
TCCCCATCACGTGCTGGTGGTACCTTTGCACGACAAGGTTTCCCTTCCAGAGGCCCTTGG
TCTACTTCAGGAGAGCGACACTGGAACGGTACACCCAAGTGAATGGGGAAGCACCCACAG
TTTTATGCTGCTGTGTCCCCGGTTGAAACATCGGTGGTTCTTTACATCGGCAAAACCAGG
TTAGGGTGCTGTCTGCTTTCTGCCATCATTGCTTAAATAGTAGTTGTTTTTGTTTTGCTT
TGAAGTTCAAGTGCAGCCAGCCACCTCTCACTGACTTGTTCTATCTCTAGGGGATCTGCA
CACACTGTTGGACATGGCTAAAGTGGCTGATACCATCCTGTTCCTCCTGGATTCACAAGA
CGGCTGGGACAGCACTGGGGATTACTGCCTTTCTTGCCTCTTTGCTCAGGGGCTTCCCAC
CTATAGTAAGTGAGTTAGGGAATATTGGAGGGCATGGAATGATAGGAATGTTTCTTCTCT
CTCTCTTTTCTTTCTTTTTCTTTCGAACACCTATTATCTGCCAGGACTCTGCCTAGCACT
TGATACAGGGACACCCTGAAAACTGCTCGTAGTAGGTTGTATGTGCGAGGGGGCCTCAAA
AATTTGTGGGAAAATTCCATTATCTTTTCATTTCGTTTTTCCAGTGCTCCCTCTCATTTC
AGGCTGTCCTTTGCTCAGATGAGGGTTCGGTTTCATTGTGAAATGTCTGTAGGGTTGCCG
GCTGTTGGGTCGCCCTTGGTGAACTGCACGAGGACTGTCTTGTCATAACAGTGAAGCGCT
CGACCACTGAGCTCCTTTTCTTTCTCTCACAGCACTGGCTGTCCAAGGAGTTTCTGGACT
TCCACCAAAGAAGCAACTAGATGCCAGAAAGAAGCTAAGTAAAGCAGTGGAGAAGCGCTT
TCCTGATGACAAACTCCTCCTGTTAGACTCTCAGCAAGAGGCAGGGCTGCTGCTCAGGCA
GTTGGCTAACCAAAAGCAACGTCATCTTGCCTTTCGGGACCGGCGGGCCTACCTGTTTGC
CCACTCGACTGACTTTGTGCCCAGTGAGGAAAATCATTTGGTTGGCACTTTGAAAGTCTC
CGGCTATGTTCGAGGGCAGGCCCTAAATGTGAATAGCTTGCTGCACATCATTGGACATGG
AGATTTCCAGATGAAACAGATAGATGCTCCTGTGGACCCTTTTCCCTTAAATCCTAGAGT
ACTTAAATCCCAAAAAGACCCACACATGGCAATGGAGGTAAGATTGGTGTTCTTGAAAAG
CATATATTGTGGATTCTTACATGAGCTGATACAGAAGGGAACTAAGAAAAGGTGGGCTGT
ACACTTGGGTCAATGGAGGCTCTTGCTAGTTGGGAGTAAGGCAATAGTTAACTACAAATA
TGTCCATAAATAAACTATCCAGTATTTTCTGGTGCCCTATACTTTAATTGGCTGTAAGTT
AATAGAACACATGGGGTCACTTCCCTAAAAAGTGGCACACCCATGGAACAAAGATGAGAT
AGTATGTGGGTAAGGTCCTGACCGGTTAAGGAAGTTGAGAAAGTAGACCAGCAAGCTTTC
ATCAGGCTTCAGCCCGGTGTTGAACAGGGTGAACAACTGAAGAGAGGTGAAAGACTATCT
CAGACGATGAGGCTGAAGTCACCTTGGCACAATTGTGCATGAGAGGATCTCTTTGAACTC
TGAAGAAATCAGTATAAGAGTGACTTGATTTGAGTAGGAGAAGGGGGCAGGTTATGAAAG
GCTTCAGAAACTTTTTTTTTTTTAGCAAAACCCCAGAACTGTGCCATCGTGTCCGTTCTG
ACTCCTAGAGACCCTATGGACAGGGTAGAGCTGCACTTAGAGGTTGCTGAGGCTGTAAAT
ATTTATACCAGAACACTTCATCTCACCCAAACTGCTGCTCTGGGGTTAGCAGACCAACAT
GTAACATGCAATGTTAGCAGGGCTCTGTGAAGCTTTTGAATAGAGACATAAACACTAGGA
AAGAGTCACTGGAAATATTTTGACACGGTTTGGTGATTTGTTTTTCTACGTGAGCACTCC
CTCTAGTGTAGAGCTTTTGGGTTCTGGGGTGAAATCGTCCTAGGTTTGGGGTTCATTCTT
GGCCGACCCTCAGCTGCGTTTGCTTTTCAGGTTTCTGCTACAGATGCTGTGGTTGAAATG
GAGGAAGACCTTAAGGTTCTAATGAAAGCCGACCCGGACCGACAGGAATCTTTGCAATCC
GAGGTTATCCCGGATCCAATGGAGGGAGAGCAGACCTGGCCCACCGAGGAGGAGCTGAGT
GAGGCAAATGGTTGGTATTGGCTAACTTGTTGGTAATTCTTCCAGCCTGGAATTGTGGCT
TTGGTTCAGTTACAACAAAGACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTCTGTTTTGGAATGAATCGATAAAACAATCTTAGAATTATATCATGGTTTATATA
GCTGTGTGGGTATGGTTTGTTTTGAAGCTAGTGAATTAAATTTGGGAGTCGTTCTACCAT
AGTGGTGGCTAGACTGGTGTTGGCAGCAATATAGGTAGCCACTGCATTTTGGAAATTTGC
TTCACACTGCTTGGCTTTTATGAAAGACCTACATTAGTGTTTGTTTTTACTGGCCAGAAG
GAGAGCCCAAACTAGCATTCAGTGTTTGTTTTGCAGCGGTGAGAGTGGCATCACCAAGCC
TTCTCTGGAAACTGCTGTACAGACATTATTTCTTCTCTATACAGGCTGTGTATTTATCAT
TCCATTCCTATTTTTACTATGTGCTAGTGTTAGTTTATATGTTATTTGGTATGGTTTGCT
AAGTTGATTTTTGGGTCTGGGAAAGCTCAAAATTTTTCCTATATTGAATGATATGCCAAT
AAAGCAGTTTAACACCTAAAAACGAATGGTAATTATTTTATGCCACTGCAGCTTATACAT
TGTTTCATAAGAATGCGTTACTCTGAGATAGCAGCGGAAACCTACACTTAGTTCTTGCCT
CGGTAAGGATACCAGGAGTAAGTGGAGAGAGGAGGTATGTAATTTACTTAACTAGTTTAG
TCTTTTGCAGGCGTACCGAAGGAAGGTTCCAAGGTGGTGAAGAAGGTCCCCAAAGGCACA
TCCAGTTACCAAGCTGAGTGGATTTTGGATGAAGACGGTGAAAGTGGTGGGGAAGGAGAT
GACTACGATGATGATCTGGAGCGGGAGGATTTCATGGATGAGGAATCCCAGGTGAAGAAA
GGGGCCCTCGGGCCACTCTGTGAACGGGCCCCAAATGCAAGACAAAGAACAAAGCTGATC
CGGAAGGGGGTGGGGAGTGGGGTGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTT
TATTTAAAACTTACGTGGCTCAGACTATGTCCATGTGATGCTAGACAAGAAAAACACATG
GTCCCTGCCCCTTAAGGACTAACATTATAGAGAGGAAGGCAAGACGTACATATCAGAAAA
ACCAATTATAACCAAGTTCTAGGTTGTGTGGTAGACTTATAATGGTACAGGGCTTCAGTG
AAGGGAAAATATTAGAATGAAGTAGCAAATGATTCCTGTCGGAGTTAATACCCAATTAAA
GTCTAATGCTTGGAGGTTTGTGGGGAGGAGAGTTGGTAGAATAGCAAGAGTAGAGACACA
TGAAGATGCAGATGATCACGTCTGCCCTGAAGATGAGTCTGACCAATGCCAGTGTTTGAC
TGGCTATTAGAGAGGTAGGGCTTTGCTCAAAGTTCTTGTTTAGCAAGTTAGAGAGCCACT
CCATGGGCAGCCGTAGGGAATCACTATAAATACTTATCCATCAGTAGTGAGAATCTTGCA
TTTGGGTCTGAAATGCTTGTTACAATTTTGAGAAGTAGCCTTGGTGTGGATGTTGGGTTA
TCTTGAGAGATGGTGAGTAGAGCCCTTTTAAGGTACGTAGTGCCTTAGCCGTTGTAGAAG
TGATTGAGGACAAGGGTAAAGGAGCGTCATAGAAATGTTGACTTGTTAATTTCTTTAAAA
CCTGTGTTCTAGGTTTCAGAAGTACCGAGGCCTCAAGAGCTTCCGGACATCTCCGTGGGA
CCCTAAGGAAAACCTTCCTCTTGACTATGCACGGATCTTTCAGTTCCAGAATTTCACTCA
CACTAGAAGACGCATCTTTAAAGAGATTGAGGAAAAAGAGGTTGAAGGAGCTGAGGTATC
TCCTGCCTTGTCCATCTCTGTCACTGGGGGCCCTTGATTTACTCCTCCTGGCATGAGAAC
GACTATCTTCGTTCGTTCTGTGTTGCCCATAGCTGGGTTAGGGGAGCCACTGAGCCATTG
ATGGAGTGGTGGCGGGGAACAAGAGGTACCAGGGACGTTAAGTGAAAGGCATTCTGCAGG
GAAAGAGGCGACTTCCGGAACACGTTTGTAGAGAACATCTGCTTCCTCCTCACTGGAACC
TTGAGGCTAACCCTGCACTTGTTTTCTGCTTTCTTCTGGCAGGTTGGCTGGTATGTCACA
CTGCATGTCTCCGAAGTCCCTCTACCTGTGGTTGAATACTTCAGGCAAGGAGCACCCTTG
ATTGCGTTTTCCCTGCTACCTCATGAACAGAAGGTCAGATGATGTCTTGTGGGAAAATGG
GATCCTGGCACTCTCCTACCAGTTGTTTTGGCTTAGTTTAAATTCTGTTTCTGAGACTGG
CTCTCTGCTCCTTGGCATGCAAACGTTCCCGCCTTTCGAATGAGAAGTCAGAGAGTAGTA
GAGAAGTCAGTGATGGTTTTACCCAGAATGTCTGAACCTGTCTGAAGCATCTCAGTGATG
CGGCCTCTGTGGTGCTGAGACTTCTCTGATAGGTAGGTATTGAGATTTTGAGACAGATAG
AGCAGATTTTGAGTAACAGTTGGCAGCCTTAAAAACAAAGGGCTTATGTCAAGGGTGCAG
TTTCTTTTCTCCTGGTCAGGAGTCACGTAGGTTAGGGTGTGTGTGAAAACCTGACCTTTG
AAGGAGGGCGGGGGAAACAAACACAGAAATAAATAATTAAAAACCAACAACAACAACAAA
AAAACCCTGACCTTTGGATGGTATAGGTAAGGGTTGGGGAAGAATAAACTTGAATATGGC
TTGAGGTGTGTGATGAGTCATGACTTGAAGGCCGCTCACGTGTGTGATGAGTCATGACTT
GAAGGCCGCTGACTGGCCAATCTATGGCTTGACTACTGTTTGCTGCTGGAGGTAAAGGAA
GAATCAGTGGCGCATCATGGACACACGGCCATGTTAGCCATGGCAGTCCCTAGAGGGAAG
GTGAGCCGGCCAGCTGGTTAGACTGTTAGGCTGCATCCCAGACTGTGACGTTGTTTTCCT
CCTTTGGTCTCCAGATGTCAGTCTTGAATATGGTTGTGAGTCGACACTCCGGCCTCAATG
AGTCTGTGAAAATCCAAAGAGGAGCTTGATCTTCCACTGTGGGTTCAGGCGCTTCCGAGC
CTCACCCTTATTCTCTCAACACACTGCGGGTTAGTAGTTGAGGAAACAGGCTGGGTTTCT
TATCTACTTGTCTTGTCTTTTCGGGGGGACTATAAGTCTACATTAACTGCGTGTGTGCGC
GTTGCTAACCCAGTCCGGATACACACGCTAGTTCTTGGGATTAAAGGTCTTTTTTANNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGTCTGAAGCATCCGAGTGATG
CCATCGATATGGTGCTGAGGTTTCCTTGCCATGAGAATTTGTTCCAGAGGAGGCTTTGAG
TAGGATCTGGCAGCTTTATAAAAGGGTGTGGTGGAAAGACTGGAACTCGGGCATCTGACG
TGCCAGTTGCAATGTTGACTGGCTGGAGGTTGGGTGTGGCCCACCATGGGGTAAATAGAC
AGGTGTAGGCTATGATATGCTGAGACTGGACAGGCGGCTAGGGGACATTTCTGTGGCACT
AACTGCAGCCCTACACTTGGGAGTGGCAAGATTGCCCGCCCATTTGAGGGCTTGTGAATA
TCACCTGCACACAGTTTTCCACTCTGGCAGAACTGAGTAGTTGGAAGAGACTATGTATGA
TCCACGTACTTACTATCTGGATGTGAAAAAATTTGCCAACTTTGTACTCAAGAGCTGTTG
AGAACTTTCAAACCCTGAGTACAGTCCACGCTCTGAGATTCTAGTTTTCACTGGAAAATC
ACTGATAGGATTCTCTTCATTGTATTGCAGCAGGAAAAAAAAAAGAACTAGTGGGGTAAA
CTAGGAGCTCTGGTAGCATAATGTGTTACGTGTTGGGCTGTTAATGGCAAGATCAGCAGT
TCAAAACCACCAGCCTCTCCTCAGGAGAAAGAAAGCTCTTTCTATCCCTATAAAGAGTTA
ACCCTTTGGAAACCTCTATGGGGCAGTTCTTTGCTGTCCTATAGGGTCAGAGTCAGAATA
GACTCGATATCAGTGAGTTAGTGGGGTAAAGAAACACAAACTACCTTAGGTTTAGAAGTT
GTGATCTACTAACAAATGACTTCTGTTAACTCTCCTGGCAGCGGATAAGCATAAGTTTCA
GAGATTCCTGCCTCCTGAGGGGGCCCTGGTGGCGACAGTGTATGCTCCGATCACGTTTCC
ACCTGCATCTGTGCTGCTTTTCAAACAGAACAGCAACGGTGAGTGGAGTTCACAGAGGTG
ACCAGGCCTGAAGAGCCTTAATAGGATCAGTACTGCTTTCTCTTCTTATGTAGATTTGGG
AGCCAAATGGTAGGAAGATGTTATTATTTTCAGTGTATCTGAGTCTCAGCAGCTCAGTGG
AGCTAAGGCAGGGGTGACAAAGGGCTTTCTTTTGCCTGAGAGCTTTTGCTTATTGGCTAA
GTGATCTTTTTCATGGATCCAGGAGGCTAGGCAATAAAGGGCATCCCTACTTTTATAGAG
TTTCTCTTAAGAAAATCTTGCTCGGAATCATATAAATACAAGTGCCTTGCCCATTCCCGT
GCTGGTAAAGAACTCAACTCTTTGGAAGCTGGAATCTGTGGCTGGGAGGCAATAGGAATT
TTTCTTCAGAGCCTTGGGAGCCAGGCCGTCAGCATTGGCAGAGGCCTTTCGCTTCCTCTT
CGCTGCTCTGGCTTCAGGATCGTGGACCTACCTCAATAGCTTTTGCGGCTTGTTCTTCTG
TTTCAAATTCTACGAAAGCAAATCCCTTTGGGTCTCCAGTGGACTTGTCATGTGGAATAC
TTATGTAAACAACATTACCGCATTTCCCAAATACTCCTTCAGTCTAGCTGTGATTAACGT
TTTGGGGAAGTAATTCCTATGATGAATAAAAAGTTAGTAACCAAAATGGAATAGACTTTA
AATGTTAAAATGATAAAAAACAGTAAAAGAAAATCTTGCTCCAGATCAGTGTGTCCCAAA
GTGGGCAGTAATCACCCCCAGTTGTGTGTGTGCTAGAAGAACCCAAGGGGCACCGAAGAA
CAGATACCAACACTTTATTTTGGATTATGGTACAAGTTTTTAATTACTAGGGGGCACTAT
TTATTTCTGAAAAGGGGGCCAAATAGTGGGGCCAGTACCCTAAACTAATGATTTGGCCTC
GCCTGCTGAACAGTCGCTCTACTTTTGTCCTGTAGGCATGCACAGCCTCATTGCTACAGG
CCATCTGTTGTCAGTGGATCCCGACCGAATGGTCATCAAACGGGTGGTTCTGAGTGGTCA
TCCTTTCAAAATCTTGACCAAGATGGCAGTAGTGCGTTACATGTTTTTCAGCAGAGGTAG
GTAGAGGGGACCTGGTAGCCTGTGCGGGATGAGGTTGGGGGCCAACATTTTGTAAGTATT
TCATCTTGGTCTTCTGCCATGTCTCCTTCTTAGAGGATGTTCTGTGGTTTAAGCCAGTGG
AACTGAGAACAAAGTGGGGCCGTCGGGGACACATCAAGGAGCCTTTAGGTGAGAATGCCG
GGTTCGGGACCTTGGCTAGTTTCCCAGTGCTACTAAGTTACTAGCAAGCTACAGGTGTTC
GATTCTGACTAATTTGCTGTTTACTTTCTAGGTACTCATGGCCACATGAAGTGCACGTTT
GATGGGAAGCTCAAATCTCAGGACACAGTATTGATGAACCTCTACAAACGAGTTTTCCCA
AAATGGACTTATGATCCTTATGTGCCAGAACCAGTGCCTTGGGTGCAAAGCGAGGTTTCG
ACAGCAGTGCCTGAAGTGGATATGGAATAGCGGACTCAAGGGATTTGGTCTTGTTACTCG
CAGTTGGTGATTTATGGACAGGAGGGCTTGCATGTTGTGATTGGGCAACATTGGCATCTT
CTCCTTAAGCCTATAGGCCTGCTATGGCTTTTCTTGACCTCAGCAAGGTGTCTCAGTTAA
ATATGGCCACTTTTCTGTTGATAGTTCACCCCCGCCTCCCAAAAAAACCCTATTAAATTA
TTGAGAAATAGCAACTCTCAATTGGGATTTTAAAGATCTGTTTTAAGAGAAGACAAGAGA
TTTGACACCCACTGAGGGGAAAGCTTGTAAGTATCTATAGGGACACTGAAACCCGTCTTT
TACATAAATTAAAAACAAACCGACTGATATGGAGCTGGCCTTTCAGCCTGCTTCACCCAA
GTTAGGGACGCTAAGTCTACATTTCCGCCACTGAGCACAATACAAATGTTCTTTACTTCT
GGGGACACGGCTTGAAAATGCGGAGACAGGACAGCAGCTACTCCCACACCCGCTGTAGGT
TCAATGAGTAGTTTCATCCTCTCCCACACCAGCTGGGTTGCATGCTGTTGGCAGAGACAG
GAGTAAGCATTCGTGAAATGGGGCAAGGGCCTCGTGGCTCAGTGTTCAAGGCCAGCTGAA
GATACATGCCCCAGCTGAATTTTCTTGTTGCTTGGTATGTTTCCCAGGGGAGAACAGGGC
TTTTCTCTCCTCAGCTCTGCTTCTGTATTTAGGGTACCCCACACATGCCCTGAAGTTACC
ACCTAGACAAGACCCCAATAAGTTGGTTGTCCCCCCCCCCCCCCCCCAAGCCTCACCTTA
ATCTCATCCTCTGTGACCGTGAAGACATCATCCACAAGGTCTCTTATGATAGGCCAGGTG
TTTAGGGCAATGCTGGATTTTACACCATCGGCTATGGTTTCTGGAGAGTAAGGATTGGGG
ATCAGTTTCCCCTTCCACTTGGACTGGTAGCAGTCATCTGCATTCAAGGGTTCAGCAGCG
TACACTTTTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1266..1369, 1639..1858, 1970..2104, 2492..2916, 3810..3969, 4810..4970, 5166..5356, 6132..6294, 6582..6692, 7454..7511, 7513..7526, 7528..7588, 8681..8797, 9755..9895, 9993..10067, 10171..10349
1001..1097, 1266..1369, 1639..1858, 1970..2104, 2492..2916, 3810..3969, 4810..4970, 5166..5356, 6132..6294, 6582..6692, 7454..7511, 7513..7526, 7528..7588, 8681..8797, 9755..9895, 9993..10067, 10171..10346
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved