Echinops_telfairi Locus C2orf28
snOPY snoRNA Orthological Gene Database
Echinops_telfairi C2orf28
Echinops_telfairi
C2orf28
GeneScaffold_9058
SNORA72
3734..3865
6759
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGAGCCTTAGTCCGCTCTCCAACCCACA
ATGGGACCGACCCGAGGGGGGGGCACCGGGGACATCCTCGCGCCGCGCTCGCCTGCGGGC
TCTTACCTCCGTGGCTAAGGTCCTCTCATTTTTAGCGGCACCGGGACTTGGCTGATTCTT
CCTGGGAAGGCAAGGACAAGGGACTTAGTACACCGCCGCCAGAACGTCAGGACACGGCGC
GCCGCCCCGGGACCGAGGTGAAGGGGACTGGGTGCCCCGAGCGTCCTCGGGCCGCCTCTT
TCAGTCTGGGCTCCCCCATCCTTCCACGCTCCTCCAGCAATCACCTTTACTCCCCTTCCC
GCCCCCGCTCCCGCTCTCCACGCACGAGGTACGGAAACCACCAAGCTCGACGGCTTTCGG
ACACCGGCGAGAGCCGCCCACGCACGCGCCCCGCCCCCCCGCGGCTGTCGGGCCCCCGCC
CCCTCAGGCACGCGGCCACCCAGGCCGCCCTCCTCAGACCACCTGCCGTCTCGCCTCCAC
ACGTGGGTCGGGCCGTCGCCCGAGTCCCCCCAGAGATTGGTGAGAGCCGGGTGATACCGG
GCCCCGCAAACAAAAAGCCCCAGCCTCCATCTTTACTCAGGATAAAGGCGTGTCCCCGAG
TCTTTTCTTGACACGACCACGGCGTAAAATTGCAGGAAACTCCGGGCCGTTGGAGCCGGC
GGTCGGCTCAGTGGAGCCGAGAGGCGGTTTTGGGAGGGAACGGAGGCTCTGCTAGGGAGG
GAAAAGGAGACGGGGGCCCCCAGAAGGAAGACTGGGGGCGCTCGGAGCAGATGTCCGACC
TCCGCCCGCCAGGAGCACGCTAGCCCGCCCCGGGTCGACTGGCCACGCCCCCGAGGCGGG
GCGTGGGGCGTGGCCCCCAGATGGGCGGGGCCCCTGAGGGGCGGGGCCATCGCGCGCATT
CTTCCGGAGCCTCCGAGAAGACGGCTCGGTGGAAAATGGCGCGCCGCGGGCCCGGCACTC
GTCCGAGCGTGGTGCCCTGTGTTGCCGCCCTGCTCCTTGCTCTGGGCGTGGATAGGGCTC
TGGCGCAACCCGAGGTACAGAAGCAAGTTGTCGGTCGCGCCGAAGTAGACAAGTTGGCAA
GCCGGGGGTTCGCCCCCCGCAGCCGGTCTGCAGCTCCGACTTCGCCCCGGAGGCCTCCCT
TCGAACCGCGGGGCCTCCAACGCGCCGGCCTCCCGGCGACCCCGTCCGTCCTACCTTTCG
AGGCCTTTGAAGTTTCGATGGTCTCGCGCCTCAGCTCGGAAGCGCTGGACGTTGTTCTTT
CCGCAGAGGAGTCTCCGGGCTCTTCCCTAACTGTCCACGCATGAATGTCGCCTTTCGTGC
CGCAGCAAGACTGCGCTTTCTGTAATGTTTGATGAGTTCCTTGTGTACCTTGTCCCTTTA
TACCAGACCGAACTGGCGCTGACGGGTTGAGAAATCACCGGAGAGGGCATAATAAGTCGT
CTTCGGACAGGGCGATCTTTAGAGATGAGGGCCGCAGGCCGGGTACTGATCGTCTCAGTT
GAGCCGGTTTGGCCCGAAGCAAAGAAAGGCACCTGTGACCCAATCTAACCCGATCAAAGG
CAGGACCCGAGTCAATTCCCTGCCCTCTTTCATAAGAATCCCGGAGATGTGTGTTGGTGG
TTAATTCTTTTTTTTTCTTCTTTTTCTGTAGTTAATTCTTAATGTCCGTGCTTTTCTTGG
CTTTTCTTTCTTGGGTTGTAATAGGTTCCTCTCTTCTGCAGATATGCAGCCAGTGTGCAG
GGACTGCGCGGAATTTGTCGCAAGTGGCTCTTTTTTGTATGCAGACACCGAAGCTAAGGT
TGCAAGCCCGCTGCTGCCTGAATCAGAAGGGCACCATCTTGGGGTGAGAAAAGAGAAGAC
ATCCCTGGATTCAGAAGGGGGGAAAAAGTGTTTCTCAAACAGGCTGTCATGGAAAATGCT
TGATAGACTTTTCGTGTAAATATTGATGCCTATTTGGCACCCTCTAAACCATGATTCATT
CTCAGACTTTTAAATCTGTATATCATTTTTGGCCATGGAATAATCCTGAAATTCTTTCTG
GTTGAAACTGCATAAAAATCATGATTTTTGCCTTTAAAAACATACTAAGCTCTATTAGGC
CTTCCTTTTAAAAATAGGTTTGTTCTTTTGCTTACAATCAAGTCTGTGTTTTTCACTGTG
TGTCTCTGTGAAACTCTCCCCATATCCTCCATGAGACGCTTAAGATGATCTTTTTGCTGA
GCCCTTCCCGCTTGTCTTTGAGGCATGTTCCTCTCACTGTCCACTGTTTGTCTTAATCCT
TCAGATTCATTCCTTGGCCCTCTACTCTTCTCCCTGTACATTCTCTGAGAGTCCACCTGT
TTAGCTCCCCAAATGAAATCTTAACATCTTTTGACACCTCTTGAAGCTCCAGGTATATAC
TCACTTCCAACTTCTATACTTCTTTCGAGTGCTTCATCTTCACTACAGACTTCTCAAAAA
CCACATTTTTCCTCTTTTTTGGTTGTTTGTTTATCACTCTCTGGCTTTAAAACTACGTGT
ATTACTATTTTGCTGGTGGGATGAAGTTCACACCATGAATTCAGCATTAGCTGTCTACCA
CAGACTGGTCCCATATCCACCTTTCCAACACAAGGTCCAGTTACTTGTCGAATGAAGCTC
CGTGATCAGGATCTGGCTGCACCTAGTCGCCTCCTCAAAGGCACTGAGTCTTTTGTTGTT
TTGGACAGCCTCTCTCTGCCGTACTTGGGATTGCTTTCTCCCACCAATTTAGGACCTAGC
CATCCTTGAAGGTCCACATCTTCTGTGAATGTGCCCCACTCCACAATCCCAGGATCATAG
TTCCTTGATTCACCACTCACGTTTGATCCTGGTCTGTGTCTTTTTCATACTGCAACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGC
CCTGATGTCCAGCCCATGGTAGGAATATGCCTGGAGGAAATGTTCCTTTTTGTGACTTGC
TTCTCTCCCACAGCATCTCCCAGTTGAAAGGTCTTCATGAATCTGGGAATCATAGTGTTA
TAATATGTGATCCACTAATCGAGACCAGGACCAAATATCTTGTAGTAAATGGGCAGGTAT
GAACTAATAGGGCAGAGTACTTGTGAGAGCTCCTTGCTATCAAGTCGATTACGATTCATA
GCAACCCTCTGTAGGGTTTTTTGAGGCTCTAAATCTCTATAGGAGCAGACAGCCTCACAT
TTCTCCTGAGGAGCAGCTGGTGGGTTTGACTCACTGGCCTTGTGGTTTGCAGTCCAACGC
TTCCCTAACAGTACTGCCAGGGCTCCTTTATTTAGGAGAACAGTAACATCCAACCAGAAC
TTTGTGCAAAGATGGCAGTGTTCATACCTGCACCACCCAATGCAGGAGCCGCCAACTACA
TATTAGTGTGTGTACCTAGCACTTCAAGTGTGGCCAGTGCAAATGAGAGACTGGATTCCT
AATTTAATTTTAATTCTAAGACCATGCATGTGTCCCCAGGTTCAGTTCTTTCCCTGCATC
TGGTTTTCTAAATGGTGGTGCTAAGTCAAATCTGAATTTCTGTATGAAATGCAGGAAATG
GCTGGCACTCCAAGCATCTTCAAATTTAAGATGACTGTCTAGTAAAATAACAACTGCTGA
TTTGCAGAATTTATGTCTAAAAGGAAATTCCACAATGACCAGTTGTCACTAATCAAATAT
AAAATTATTGTTGTATTTCATACAAGTTATAAGACTCAATAAGCAGCTACATGTAGCAAG
TGACAGCACTGTTGGACAACGCAGGGTTAAAACAAACCACAGCACTTAGTATGTGATTCT
AGCACAGCTGTGGTCAGTGAATCCACAAACCTAGAAGGGACTTGGGCATTGTTCTTTTTC
CAATCATTTTATTAGGGTCTCGTACAACTCTTATCACAGTCCATCCATCCATCCATTGCG
TCAGACACATTTGTACATTTGTTGCCATCATCATGGGAGTTGGGTATTAAAGACAAACCT
TGTCATATATCCAGAAGACACTTCCTTACAGAGGTTACTTGTGTTTCCTCAGGCTGGATC
TCCAGAATTGTTCTCTGAAGGACCCTGGTCCAAACTTTCATCAGGCATATACTGCTATCA
TCATGTAAGTGGTCACAACAAAACAACAAACATACGTTTGTTGTTACAACGACAAGCATA
CTGCCATAAATTCTGACTCATAGCACTGTAAGACAGAGTTCCTGTAGGACAGAGTAGAAT
GGGCCCTGCGGCTTTCCGAGACTGTAATTCTCTGTGGGAGTAGAAAGCTTCATCCTTCTC
CCATGGAGCAGTGGGTGGTTTAGAACTGCAGCCCAACTTGTTTCATTCCCCTCAAATGTG
AATGTGGCAAAGGGCTGGTGGGGAAATCTTTGGGGATGGACTCCTAAAAAGATAGATGAA
TAATAATGTCTAAATTTACTCTGGGTGGGAGCTGTATTACCAGACTAGGAGGATGACTGC
ATGGATCTAGGGCGAGGAGAATACTGACCCTGTGCTTTACAGAGACCTGCAAGCAAACCC
CCTCAAGAAGGACTTGGCTAATGCCTTCCGTGGTTTCACTCAGCTCCAGACTCTGTAAGT
AAAGAGTGTGGGGTTAGGGAATAAACTACGAGAGGGGTACTGCTGGGAGCTCAACAACTT
TACGTTGAGTATATTACAACTTGCACTGCCTTCAGGTTACTGCCGAAAGATGTCAACTGC
CCTGGAGATATTGGTGCCTGGAGTACAATCACCACTTACGTAGACAAGCAAACCTGCCAA
GGACAAAGGAACCTTTGCAATAGCACTGGTGACCCAGGTATGTCTTCTCCTCTTTACCTT
TCTGGGAACTGCCTTTCCTCCCCTATATGCTCCATGTGAAATCAGAAAAAAACAGTAAAG
GTGCTGAGAGTTCTGAGCTCCTTTCTTGGGAGTGGGGGGGGGATGATTGTTGTGTTCTGA
CTATCTGACCTACAAAGGATGGGGGAACTTAAATTGAAGCAGCTGTTTAAGAAATCTATC
TGATGAGACTCACTGATCCTCTCTGTTTCTCGCTGGCTCCCAGAAATGTGTCCTGAGAAT
GGACTGTGTACATCGGATGGGCCTGGGCTCTGGAAGTGCCTTTGTGCTGATGGCTTCCAC
GGCTACAGGTGCATGCGCCAGGTGAGGAATCAGGCCTCAGCTATGAGAGGAATGCATAGA
GCTGGAACCTCAGTAGGGGCTATTGCAAATAGCTTTACAGAGGATCAAAGCTGTAGGAGA
TTTGCTCCAAATAAGGTGAATTGGGGAAGAACTAGACGATAAAGGGTCATGCTCAATGAG
ATGGTTAATTCGCAGGGCTCCTTCTCACTAATTGTGTTCTTCGGGATTCTGGGATCCACC
ACGCTATCCATCTCTATTCTGCTGTGGGCCACCCAGCGCCGAAAAGCCAAGGCTTCATGA
ACCCCTGGGTCTCCTAAAGAACATGGATCTATCTGAGCCCTGCCTGGGTGTTGTGCTTCC
TAGACTGGCATCACCAAGCCCAGGCCGCCTTCGGAAGGAAGATGGAAAACTGCCCCATCC
CCCTGCGCTGGGGACGCATCTCCATTTGCTGTTGACGATAATAAACAACTCGTCTTGTTT
GTCTTTTTAGGGGATTGGCCCTGCCTCGGCGTCTTTCTTGGTTGGGGTGGGAGGGGTGGC
TCAGGGAATCGGTGCTTTCTGGTTTGCGCAGACTGCTCGGGAGGAAGAGGATTCCGCGAT
GCAGCTGCGCCGCCGCCTTGGCCCCGCCCCGTGCGTGCCCGGCCCCGCCCCTCACGCCGC
CAGCTTCCCGCGCCGCCGCAGACTCCGCGGCCAGTGCGTCGAGCTCCTGCGCGGTGCACG
GCAGCATCTGCTCAGCCACCGGCGCCCTGAGCCACGTGGACCGGCTGCGGGCGCGTAGTC
CTCACGTGGCTGCCGCGCCGGCGGGGGCTTGCCTCGCTCCGCCGCTCACTCGTGCTCGGC
CCTGCCTGCGTTCCGTCCTCATGGCGGCCCTGGTGTTGGAGGACGGGTCGGTCCTGCGGG
GCCAGCCCTTTGGGGCCGCGGTTTCGACTGCCGGGGAAGTGGGTAAGCTAAGCAAGCCCG
AGCAGGCAGCCGGATCTCATCCCACTCTGGTGCCCCTCNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGGACTGGGGCATTCCCATCTCTG
GGCGGTGCGCTGAAGGGTGCCCTGCCCGAGCCTCGCCCTACCTCTTTCCTGCAGTGTTTC
AAACCGGCATGGTGGGCTACCCGGAGGCCCTCACTGACCCATCCTACAAAGCTCAGATCC
TAGTCCTGACTTACCCTCTGATCGGCAACTACGGCATCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1028, 1030..1034, 1039..1059, 1062..1076, 1079..1128, 1130..1138, 1144..1150, 1152..1163, 1172..1273, 1961..2082, 4372..4443, 4842..4913, 5015..5136, 5383..5480, 5655..5759
1001..1028, 1030..1034, 1039..1059, 1062..1076, 1079..1128, 1130..1138, 1144..1150, 1152..1163, 1172..1273, 1961..2082, 4372..4443, 4842..4913, 5015..5136, 5383..5480, 5655..5756
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved