Echinops_telfairi Locus UBAP2
snOPY snoRNA Orthological Gene Database
Echinops_telfairi UBAP2
Echinops_telfairi
UBAP2
GeneScaffold_1928
SNORA5
55426..55560
136204
GGGTAGAACAGCCTCTGGATTTCCGAGACTGTAACTTTTTTTTTTGCTACTGTCATTTT
TTTCTTTTTCTTTAAAAAATTTTATTGGGGGCTTGTACAACTCTTATCACAATCCATACA
TCCTTCCATTGTGAGACTGTAACTCTTTACATGAGTAGAAAGCCTCATCTTTCTCCCACA
GAATGGCTGGTGGTTTTGAATACTGACCTTGTAGTTAGCAGCCCAACTCATAACCCACTA
CTCAGTTCCTTTGTTGGACATTAGTTAAAATTAAGTTTTGTGTAATCATATACATAATTA
TATTTTGATGGCATATAATTTATATGCTTGGCACATTTAGAAGCTGTTCAGTAAATAGTT
GATTAAATGAAGGAAATTTTTATGTGCAATTTTTATCTCTGAGTTATTTTTTTGGGTGTT
GTTTATAGATAAGTTTTAACCTTTGCATATGGCTTGTCCTCCGGATCACATCTTGAACTG
GATTATTGCTAGGTGCAGTCTTGACTGGAAGTAGGCTAGGCTCAATTTTGAATTCACATA
CCAATTGCAAGTGGGAAGAGCCCTATAGAACTAACTGCATATAGAAAAACTATACCTAGT
GGTATATACCTAGTGGATGGCACAGGACTGGACGATGTTTCATTCTGTTGTACATGGGTT
GCAATGAGTCAGAACCGTTTCGATAGCACCTAAGAACAACAAATGATAAAATGATTGCCC
ATTAAAACTGGTGGCACTTCAGATTTTTGTTTAGAATTGCTAAAATTGCACATCATATAG
CTGTTTCAATTGCACAAATAAAGTTGGTTTAAGAGCTAATTGCACAATAAAAAATCCTAA
GACTGTTTCTTAACAATTTGGGTTCGAGAGTTTTTATGTTTTGACTCACCTCTGTATTTT
CTTCTCCCCTTTTTCTGTGATTTGGAAGTTTTGCTTACCATTTCTGCTTTTCCCCCCCAG
ATTTTCTATTTTGTACATACATTATTTTGTATATACTGTATATGATGACTTCAGTGAGCA
GTGACCGGTCCCGAGGCGCTCGGGACAAACCACAGGTTTCTGTGGCACAGTCAACACAAC
CACAGAAACAAGTAGTACAGGTAAGTTTTTGCGGAACTTTCCTTGCCTTATTTAGATTAA
GTAAATTAAGAACACGTAGGTAATTTAAAGTTCTCTCTTGTGGGAAAATGCAGGACTTTG
ACTCATGTGTGGAAAAGTAGTTATTAGGAAAGATATCACTGAACAAGTATAGTTGGGTGT
TAACACCTTTTAAATCCTGAACTTTTCCCTTCTACTCATTAGCAACTAGCTGTTGCTTTT
TCTTTATATAGTGCCTTTAACCACCTCTCTTTACTATTAATGTAGAGCTTTAACTGCCAT
GCCAACAGGGCTCTTCATTAGAATTTCAGATGGATGATCTGACTTCGCTTTAATGACTTA
TTATATGAGCTTTAAAAATATATCCCCAAGTGTTCTGTGAAGGACATAGAGGGGGGTTCT
CTAATTCACTGTTGTATTAAATTTTGAAGTATCAGATTAACTTCATGTTGTTAGTATTAA
CAGATAGATGTCTTTGCCGATTTGGTGATTGCCCCTAAATACTCTTATGCTGATTCGCTT
TTATTCACACTTGAATCGGAAAGATTGTCCAATGTTGAAAAACTTGGACTTTTTGAACGT
GGCCTTCCATTTAGAAATAAGTGCTAAGGACAAGTTTGTTTCATGAATAATCTGTTTTCA
AGGAAGATATATAAGCTATGTATGTATATTCATGGGCACCACTCTGCTGATCAAAGAACA
GAAATTAAAACAAGGACATTTAAAATTTTTATTTATGTTTTATCAAGTTGGCAAAGATTA
AAAAGATGGTTTTCTGAAGGGAGGGCCAAATAATATGTTTGGATTGTAAACTGGAGTATC
TCTTTCTTCCCTGGCTGTTACCCAGAGAATTGAGACTGGAATTGGGGGTGCTTTTCCTTC
CAGGGCTTGCCACTGATAGTGTTTGTCTGGGTCCTTTGAGGATTGCTCTGTTGATCTAAT
TAGGAGAAAAACATACTTACCGAGTTGGGGAAGGCATGTCTAGATCCTTATATTTCTAAT
CTTTCCTTCGTATAAAAGTATAATGAGCACTTACAAATATTATGCATTATAGATATTATT
CATATATCTAGTCATCTTATCCCCCCAACAGTTTTATTGACACATAATTTACATACCATA
AATTTCAGTAGTTCAATCTTTCAATTAGATCAAGGAGAATTTTACGATTATTACCACAAT
TTTAGAACCCCATCCTCCCATGGTTAAATCATCTTTAAAATGATTTGTGCAATCACAATC
AGTTCTAGTTCTCTGTTCCCCCCCCCCCAACTTCATTATTTTCAGGCATCTAATTTTTTG
AAGTCTTTTCTGGTGAGCTAATTTTAACTTTATTCAGTAAAGTGTGTATTACCCAGTTTT
AAATTTCCAGTAAGCTTACTGCTATCTAATTGATTTCAACTCAGTGACCCTATATAGGAT
TTCTGAGACAACCTAATATTTCTTCCTTGGAACTGCTGGTGGGTTTGAGTTGTCGACCTG
GTCACTGGCATTCCAATGCTTATCCCACAGTGCCACCAGGGCTCTTTGTGATGTCCAGTT
GAGGTTTTCTCAGATAATCTATGGAGATAGCTTGATGTGAGAGAAATGCATGAATATTTA
GACTATGAATAAACCTGGGGTTGTGCCCTGGGCCTACCACTTAACTAATAAGTTGTTATG
TAAGTCTCTTTGAACATGACTTTAGTAGGTTTTGTTTGCTTGTTTGTTTTAATATGATTT
CAGATTTAGAGAAAAGTTTCAGTGTAGTACACACAATTCCGGAATGTCCTTCACCTAGAG
CTAACATTTTTACCACATTTGCTGTTGTCCTTTCTCCCTCCTTTTCTCTACATATTTCTC
TCTGGAATCTTTGAGACGAAGTTTGTAGACATGATGCTTATATCTTCCTAAACACTTCAG
TGTGTATTTTGAAAACAGAAAATACAAAACAAAAAAACCCAAGCCCTAAAACAGGGACAT
TCTCTTTCTTACAGTGCGGTGATCAAAATGAGAAAATTAACTTAATCTTTAGATTTTGTT
TATATTTTTCCAATAATGCCCTTCATACATAATTAAGTCCCAAATTATACGTTGTATTTA
GATGTCAATTTTTAGTCTCCTTTAATATGAAACTGTTTTTTAGTCTTTTATTGTTTCATG
ATATTGACATAAGGGAATAATGTGTGTCAGTAATTTTGTAGGATGCCTTCCAGTTTGGGT
TTGTCTGCTGCTTTCTTATAATTAGAGCCAGTAGAACTATGTTATGCATTTTTGGTAAAA
ATAGGACAGAAATGATTTGTTCTTCTCAGTGCACCATGTCATAAGGTGGTAGGTAAAGGT
TGTTTTATATGCAGGTGCTCAGTTTTATTACTTGGTTAAGGTGGTGTCTATAAAGTCTGT
CCAGCATCTTGTGAGATACTATAAATCCCAGTTTTGTTTCATTTTTAGTGCAAGATGGAG
GATGATAATTACTTTGGATTAGAGATTGTGTAAAGTTGTGATCAGGAATAATTTACTCTG
ATTGTATTCTTCATCCAAATTATAAAATTAAATATAATTTAAAGATTATAAAGTGCCAAA
GAAAATTCATGGTTTCTGATAAACCAAGGAAAGTAAGATGCAAACTTATACACACAAAAT
TTAAAATTAACACAGCCATTAAGGAAATAATATTAGCAGGCAGAAGAATGATTTAATTAA
TATAATATTTTATTTTTCAACTCTTCTGCATAGTAGATAGGAACAGGAAAACATTTGGTC
CCATTAGAAAAGCTATCAGAACATTCTTCATTGTGAAAACTGCTTGCCCCTTGGAGCTTC
CGCTCCACACAGCTTGTTTATGGAACATATGAGGATGCATCAAAAATCTCCCGGAAAATG
TTAAAAATAAAAAATTCGTTTCCATGCACTTTTTGAAGTCCCTGTGTACAACTCCATGCA
GCTTGTATGCTGGAGAAATTTGGAAAGAAAGTTAGTACCAATGGCTCTTTTCTTGGCAAG
ACTTTTTTTCTCATCTTGTAAGTTGCCTGGTGGGCCTCACCACAGTTTGTATAAGAAGAG
AGCACACTAACCTTGTTGAACTTTGAATTACCAGTTGGGGCCGCTTTTCCCCCTTTTGTT
TATCAAGCTATACAGAGCACTTAGCATTTAATTAGAACTAAGCCTCTTAACTTTCTATCT
TCTAGTTTATGTTTGGTGGTTTTAAAATCCATTCTTTAAAATACCATATATACTTGTGTA
TAAGCCGAGTTCTTCAGCACATTTTAAATGCAGTTTTGTGGTAAAATTAGGTGTCTTGCC
GATATTCAGGTCGACTTATACTTGAGTACATACGGTAATATTCTTCTTGACTAGGAGAGT
TGCAAAGGTGGAAAAAAAAGTTAACATTCGGATTAAAGGTAAATTTCATTCAGGTGGTGC
CCTCCGTGGTATAATGAGGCAGTAGTGATCCAATGTAGAATTGTGCATCCCCGCAGGAGA
CTTGGGTTTGTGTCCAGTCAGTGTAGCTACATCTCAAGCACCCTACTGACGCCGAGTTGA
TCCCACTTGTGGTGATCCTGTACGACAGAGTAGAACTGTGACTCTTTACAGGAGCAGATA
GCTTCACTTTGCTCTCTCATGCCCCTGATGGGTTTGGACATCTGACCTTGTGGTTTGTAG
GCCAGGGCTTAACCCACTGCGCCTCCAAGGCTCTTCCATCTGAAGCATAACCATGACTCA
TTAATGGAACTTTGATCGGTGCTGTGATGTTGAAAAGGTTTTAGCAGAGCTTCCAAGTGA
ATTGATAGTAGGAAGAAAGGCTTGGTGACCTACATCCAGTGAAAGCCCTGTGTATCTCAG
TGGTTTGGTCCTGTTGTGCATGGGGTCCTCATGACTCAACAACAGCGAACAGCAGTGTTA
TAATACTGTACTTGGTGAACAGCTATTGGATATATCAGCTGTGCTTTCAGAAAGTTTTAT
CTAGATGGTCTATAATATACCCTCTTAGAAATGAAGCAGGTGGTAACCACTGAAGAGAAA
TACAAAGAATATTTGAGTCAGAGTATTTAAGCTGAGGAAGGCAAGTCTTTGAACATATTA
GTAATTGGTATTTACATTTGTGGTATTGGTAAGGACTATTGAATATACTGTGGACTACCC
AGAAGAAGGAGAAAATCCGTCATAGAAAGAGAAATGCAACGTGAATGCTCTGGACATGTA
CTCACGAAAGACCAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTAATCAGTTTCCGCTTTCCACTGCGCCCGCCCTCTACCCTGCATATTACTTTTTCTTC
TTTCTTTTTTTAATCATTTTATTAGGGGCTCATACAACTTATCACAATCCATACACACAT
CAATTGTGTAGAGTGCATTTGTACATTCATTGCCCTCATCATTCTCAAAACATTTTCTCT
CCACTTAAACCCCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCGCTCCCCTCTCCC
TCATGAGCCCTTGATAATTTATAAATTGTTATTTTGTCATATCTTGCCCTGTCCGACGTC
TCCCTTCACCCACTTTTCTGTTGTCCATCCCCCAGGGAGGAGGTCACATATAGTTCCTTG
TAATCGGTTCCCTCTTTCCTACCCATTCTCCCTCTAACCTTCCTGTTTCGCCACTCACAC
CACTGGTCCTGAAGGGATCATCCGCCCTGGATTCCCTGTATTTTCAGTTCCTATCTGTAC
CAGTGTACATCCTCTGGTCTAGACATTAATTTTTCATTCAACAATTAAACACACTTTGTT
TTATGCCATTAATTTCAGGCCCTTCAATATATAGCAGCACTCTTCCCACATTTCCATTTG
TTGCCCCCTTTTGAGGAGGACATCTCTTGTGCTGTAGTGCTTGTTTAGTGACTGGCTGAG
AAATGTGCGCTGTGGGTGGATTTAGTTCCAGTGTTGCAGGATATCTTAGGGTCACAGTCT
TTGGGGTCCTAGCAGCATCTCTTTGACTAGTGAATATGGTCTTTGTTATGATTCTGAGTG
TTCTATATTTTCCCCCATTGTATTTGTTCTTTGATCTTGACCATTCTTGTCTCTTAGCTG
TTGAATTCACATCTCTTGGTACCGCTTCATAGCTCCTTCGCAACATTAATTCATGTTTGA
TTTTTTTTTCTTTCTTTTTTATTAAATATTTTATTAGGGGCTCATACAACTGTTATCGCA
ATCCATACACACATCATTTGTGTAAAGCGCATTTGTACATCATTCTCAAAACATTTTCTC
TCCATTTAAACCCCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCACTCTCCCCTCC
CTCATGAGCCCTTGATAGTTTATAAATGGGTATTTTGTCATATCTTGCCCTGTCCGACGT
CTCCCTTCACCCACTTTTCGGTTGTCTGTCCCCCAGGGAGGAGGTCACATATAGTTTCTT
GTAATCGGTTCCCTCTTTCCTACCCACTCTCCCTTTACCCTTCCCGTTTCGCCACTCATA
CCACTGGTCCTGCAGGGATCATCCGCCCTGGATTCTCTGGATTTTCATTTCCTATCTGTA
CCAGTCATGTTTGATTTTTAACGCTTGCTAAAATTTCAGTAGTTCACCCTCTAGTTTCTG
CCTTACCCTCTTATAATTGGTTAAAAAATGAGACAGCATGAATTAAATAGGCAAACCTAT
AATTTGTTAGTTGAATTCATAATCTTTGTATTACTTCAAATCATTCATGCTGTAATGTTG
GTGAGTTTTATATAACACTCGAAATGTGAACATGAGTAAATGAAGTAAAATTGAGTTTTC
CTATGTATACTTATTTTTCCTTAACCTTTGCTGAAATTTGTCCTGTTTTTCAGAGGATAG
ACATTTGTAATCAGTCCCTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTATGTTTCAT
CACACCGCACCCTGACTGGCTCATCTCCTCTCCCGCAACCCCTGTGTAAGGGGATGTCCT
GTTGCCTATAGATGGGCTTTGGGTCCCCACTCCGCACTCCCCCTCATTCACAATGATAAG
ATTTTTTGTTCTTTGGTACCTGATACCTCATCCCTATGACACCTCTTGGTCACACAGGCT
GGTTAATTTACTTCAACAATAATTATTTGTTTAATGGTTCCCGCCAATACTTATGTCTTG
TCTCTAGTCATTTTGGTTGTCTGAAGGTGATGATTTTATTTATTTCTCAGGAAAGGCTCA
TGGTAATATTATTCTTGACTTCTGTTGGTTGATAACAATTTATATCCTTTATACTTGAGT
ATAAAGTCAGTTTTGTTGACTATAAATTACTCACATTGTGTTCACTTGAGTATCTTAAAT
GTTACTTCACCACCGTTTGCACAAAGCATTGCTTTTGACAAGTTTATTGCTAATCGAATT
TCCCTGTCTCTTTCCTTTTCTGCCTTGATATCCAGTAGTGCTTTTCGTTCTAAGGCCAGT
ATTTTTACTAGAAAAGGTCTTACTTATGTGTTTTTTCCCCTTGTATTTTTTTTTAATTCT
TGTATTTTAACTTTTTCTGAGACATTTTTTTTTTTGGATTTTAGTTTTAAATATTTATAT
TCCCTTTTTATGTTTCTTCCTCAGGGATACTATTTTCACAAGTTTAAGGTTGAATTGTGT
AATTGTGTTTCTTTCTCCCATTACATTTTACTCTTAAAAAAAAAATTACCCTAACCCTTT
ACTGTCTTATTTTTTCAAGAGCAGTGGTTCTCAACCTGTGGGTTGTGACCCCTTTGGGGG
TCGATTGACCCTTTCATAGGGTCGCCTGATTCATAACAGTAACAAAATTACAGTTTTGAA
GTAGCAACAAAAATAATTTTATGATTGGGGGGGTCACCATAACACGAGGAACTGTATTAA
AGGGTTGTGGCATTAGCAAGGTTGAAAACCACTGCTCTAGAAGCATTAACTTTTATTTGT
TTATTTTTATTCAATCTGAAACAGGAGCAAGCAATGTTACTTTTTTTCCTTGAATGATTT
CACTGGCTAAAGGGATATTATCCTACTCTATTCTTTTTCTTTTAGTCTTCTTATTGGGAG
CTCTTAAAGATATCATAACATGATATCTTTATCATGTTCAATCACATCAAGCAGTGCTTT
ATAATTGCTACCACAATCAGTTTAAACATTTTCTTTTTTCTTGAACTCCTTGATATCAGC
TCCCTCCCTTACCTACCCTACCCCAGGAACCCTTACTCCATTTACACAATCCAATATATT
CATTCACATACAAATACAATTCTGTTGTTCATTCCCATGGAGTGGGGGCTATACAGTCAT
CAATGCTAACAAATCCTCATCCCCCATTTTTTAAAATTATAATAATTTTGCACAGGATTT
TGATTATTTTCCTAGTGATTGCTTTTTAATTTATTTTATTAAAAGGTCATTTTCTTGAGA
ACTCTTACAGCTCTTATAACAACCCATACATCAACTGTATCAAGCATATTTGTACATCAT
CATTTTCTAAACATTAATTTTTCTATTGAGCCCTTGGTATCAGCTCCTCTCCCACTCCCC
CCCCTCCCCCCAGTCTAGTGATTATTTTGTATATGAAATTAGTTTTCTTGTACTTGTGGG
CAACAGCATGGTTCAGGGTGACTTTCTTAAGAAAGCTTTTTTGTGTCATTATCATGGCTT
GTTTCTGAAACTTTTCTTGTTCGGTTTTGATTTTTCTCTCAGCAGTCCCAATGGAAAGGG
AGTCTTGGCTGGTTAGTTTTAAGAGTTTATAGTGGCACCGTAGCCCAGCCTTTTAAAACT
AGGGCTTTGAACTTGTTGAGTTTGTCTGATGAAGCAAAACTGCATTGTACTAAAGTTTGT
GAAAAAGTATGGGTGCCTGGAACAATTAAGGCTTGTTAACCTGCTGGAAAGGTGATGTCC
CTCTTAGAAAGCAAAGGCAGTGTTAGCATTGCAGAGGCTGTCACGTGTGTTACCTGGCAG
AGTCAAACTTCAATGTTCTGCTCAAAGATGGCTGCTAGCTGGGCCACTTTGAATGTTTTA
CTTGGAATAGTCAGTCCAGTCTCCAGCTTCAGATTCCAGATTTTTAAGACTCACTATACT
GCTTCTGAATCTCCCAGGGCTTTGACCTATAATCTGTTCAGTTCTTGTCCAGGCACCCAC
AATTTGAAAATTTTGATTTGTCTTGGTTCTGCTTTATCAGCTATGACTGAACTTGAATGA
ACAGGTTTGAAGCTCTGCTTTAAACAATTCTGCAACCTTATACTCAGCCAGCTAGTGGAG
CAGTCAAGATCTTGCAGTTCCAACCCGCGTCCTCAAATTGGCCTGCCACACTGTCGAGTG
TGCATTAGCCGCTGACTACTGAAATGTTCTTCTCTAGTATTTGTTAGGTGTTTTGTTTGC
TTCTACTTTCTGTGGCATAAACAGAAACTATGGAGATCTTTTCTCTGTTAATGGTCACCT
CTCTGGGTTTGTGAGGGATACCTTGTACCTAGTTTGGGTGTAAATTGTTGTCTCTGTGTT
TTTGGTTATGCTGAAAATTTGCAGGAGGATTTTAGAGAGCTCCCACATACCCTTTACCAG
ATCTGCCTGATTTTTAACGCTGTATAACGTTTGATCTCTCATATTCTTTTTGTATTTATA
CGTTTATGTCTCTCCCCATGTATACACTTGTACATACAGTATACCTTATTCGTTGCTTTA
AACTATTTGAGAGTAAGTTGTATACATTCTACTTTTTCTATTAATACTTAAGTGTATGAC
CACAAGGTCAGCAGTTCAAAGCCATCAGCCTCTCCACCGGAGAAAGAGGGGGCTTTCAAC
TTCTGTAGAGTTACAGCTTCAGAAACTGTAAGTGTAGCAGACACAGCTCTGTCCTGTCCT
ATGGGGATGACATGAATTGGCAATAACTTGATGGCAGTGAGTTTGGTTTTGGTTTGATGT
ATTTCCTAAGAACAATGGTAGTTACTCATATACTGTATATGCTGGTATATAAGCCAAGTT
TTTCAGCACAGTTTTAATGCAGTTTTTGTGGAAAAATTAGGGGCCTTGGCTGATATTTGG
GTTGACTTATACTCATATATGGTAGTTCACTAATTAAATTTAATTAATATTTCCAGTGCA
CTCTATAGTTAATAATCTGGTAATATTTTTAACTCCACATAATGGTCTTCATAGTACACT
TTCTTCCTCCAATACAGAATCATTGCATCTTGTATTTAATTGACATATTCTTAACTTTAA
AATTTTTTAATATTTTTGGGCATATTCTTTAGTCTCCTTTTGTCTGGAACAATATTTCAG
CTTTTGTCTTTAACAAATACAGGCCAGTTTTAAAAAATTAAGAAATCACTTTTGGGGGGC
TCTTACAGCTCTTATAACAATGCAATACATCAGTTGTATCAAACACATTTGTACATATGT
TGCCATCATCAGTTTTAAAACATTTTCTTTCTGCTTGAGCCCTTGGTATTAGCTTCTCTT
TTTTTCTCTCCATCCCTACCCTCCCACCTTCATGGACCCCTGATAAATTATAAATTTTTA
TTTTCATATCTTACACCATCCATTGTCTCCCTTCGCTCACATTTCTGTTGTTCGTCCCCC
GCCCCCAAGGGGACACACAGTTACTTTAAAGAATGTTTAATATTTGCTGATAATTAGAGT
CAGGTTATATATCTCCTGTTGTAATACTACATAAATGATGTTGAGTACCTCTTGTAGAGG
TACATTGTCCATCTCTCTTCTTTTGGTGCTTTTGATTTTAATCAAAGTTTTGTCTATTTT
CTTTAGTGTATAGTTGTATATTTTCTTATATACAACTATATATTTTCTTATATATAGTGT
GTAGTTTATAGTTTAGTGTATAGTATAGTATATAGTTTCTTCTAGCAACTAATAAGCAGC
CTGCAAGGAGACATTTTGATACCATGTGCAAATCTCTCAGTCCTCATGAAATGTTCTATC
TTAGAATTAGCATTAGTTGATGATTCTTGTCTGAACCAGTATTGACTAGAGTGTGTGCAA
AATGATGTTCTAATTGCCCTGCTGCCCTTGACTTAGTCTTTTTTTAATGTGTTACATTAA
TGAGTGTCTTTTGTAAAGTTTTGCTTTAATAAGTGATGAAAAGCTGAGCCAAAATGGTAA
TTTTAGGTAAATTAAATTGGAAAGTTATTATTTTTTTAAGTTGAAAATGCTTTTTTGGGG
GAGGGATTGGCTGGAGGTGGGAAAGATTTGAAGAAAGAGGCTACCCTGTGCTGCTGGTGG
ACCATAAACCTCTGCAGCCTCTGTGAAAAGCATTCTTTGCAGATGATNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCGCAGAGTTTCGATTTAAACATCAGTCTGTGTTTA
ATGTAGCAGCAGCATTGCGGCAGTCAGGTTGAGGTCACAGCAGGCACAGGTTGGTGTGAA
AGGACTAGCCATTAGACGGGACACTGCAGGACAAGAGAACTGGAATTTTATAATCAGCCA
GTGACATGTATTGGAAAGACCTTGTGCAGAATGGTTTAGCAGAGCTTAAACGGAACATGT
ATTAAACGCTGAGATGAAAAGCAGTTCATTAATTTCTGATGTTTTCCCTTTTAAGATAAT
CAGTAGTTTAAACAGTTTGATGTAAAATTAAAACATTTTTTGGGGAAGGGGGATGCACAT
AAAGAGTTTAACCTTTTTACTTCAGGAGTTAGTATAGATTGCTAGCTAACTAAAAGTACT
TTTCTTTTTAAAAAATTCAACTATGTGGAGTAATTTCAGATGTATAAGAGTGTTGCACAG
AAGTGGTCGATACAGAGAGTTCTTGAGTGTCCTTCACCTAGTTTCCTTGTTCACATTTTA
CACAACCGTGGTACATTAGTCACAACTAAGAAACCAAATGCGTACACACTATTTAATTCA
TTCCAAAAAAGGATAGCTTTAAAAATTGTTTTTATGTAGCTAAATATAGCCTTTTCTCTT
TGGAACTGACCAGGACACCATTTTGGAGTTGGCAGAGGTTAGCTGGTTGAGTTGGTTTTA
AGCCAATATCAGGCAACCTTTCCACAGCTTTCTTCCTGTTCTTGTTCTGGTTCCCCCACC
CCTAAGAGAGAGAATATTTAAATAAACCTCCTGGTCCATGGAGATGAACAGGGACTGTAG
GCCATTTGGCTAAAGGAATGGGACCTTTATGCTATTTAATTTGGTGGCTTCTCTTTGCTC
TATGAGAACAGGTTGTGTACATTTGAGGTGCCCCATATTCATAGAGTCCTTTTGTTTTAA
TCAGTATTCCTGTTTGTTTCGGGCTATTGCTTGAGAGTTCATTCATTTAGCACCAGTGCT
TGACATCTAACTTAGATTTTTGGTATTCAAATTGTAAATTTTATGTGCTTTCTAGGCAAC
AGCGGAACAGATGCGTCTTGCTCAAGTGATCTTTGATAAGAATGATGCAGATTTTGAAGC
TAAAGTTAAACAGGTAAGTTTCTGGTAAAGCATAACTCATTTTATAATTTGTTTTTATTG
TGCATAAAAGGAGAATTTAGTTTTGAAGTAGGTTTCTTGCTTAGTCTAAACTCATATTAT
GTATTGGATATTGGATTTGGTATTAACTATGATTTAAACTCAGTCACTGCTGTAGATCAC
ATTTGTAGTGATCTATAGGCATGGTAGAACTGCCNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCAACTGTCTAGTAGGTATTAAACTGTAGCTATTAGGTATAAAAAC
AATTAAATATAATTGAAATGCAGTAGATGTTTAAATTACAGATTTGTTCACTGATACCTA
TTTGTTTCTAATCTATGATTGTTCATAGTGATTTTGATTGCTTCAAACAGAACACCTTGT
TGAAGCTAGGGGGAAATAGGATGTCCAGTAGTGAATTTTGGGATAACTGCAGAATTATAA
TCATGAGACACTGAAATACAACTTTGTGTGTATGTGCAGCATTGCATTCACGAAGTAGGA
GGTCATATCAGGAGCATTGATTTTTGTGCCAAGTAATTGTACTGGGTGTTTTGTGCAAGG
TGAGCCACATAGTAATACTTGATCTTTGTGAAACATGCTTCTTGTTAGTTGATGTGGACT
TGGCCCCGACTCCTGGCGTCACAGTCTTACACCAGTTGTACACTATCTTTGTGCTTATTG
GTGTGGGAACCATTTAGTCTCATCTAATACTTGAGGAGTTCATAAGTTTGGGAATCCTCT
GCTATTGAATTAAGGGCGAGTAGTTATGTATCTGATCTTGGATGATCTGGAGATGTTGGG
CATGTGAGTAAATAAATAAATACCTGTGTGTATACTAATCTGATAATTGGTCAGCTTGGA
AGAGGATTGAATTGTAGTTTGACTCTGCTAGTATCTGTGAAAGGACATGGGATAGTTATA
AAACAATAACAACTAAAAGCAAATAATACAAAAAGTCAACTTGTTCTTAAATTTTATGCT
CAGTTTAGAAGGGTTGAGTATTTTCTGTCTTTATGTAGAAGAATATTGAAATTAACAACA
AGTGGTGTTTTTGCTCACCTTAACCATTTTCTGATAATTTCAACAGCTTATGGAGGTGAC
AGGGAAAAATCAGGATGAATGCATAGTGGCCCTACATGACTGTAATGGAGATGTGAACAA
AGCTATCAATATATTGCTGGAAGGGAATTCAGATACAGTAAGTATAATTAATAATAATTA
TTCATGGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCTAACAAG
CTTAAACCCTCCCCTCAGGTAGGTAGGAATGAGGTACGATGGGAAGGTGGGGGAAATGAC
CCCTGCCTTGATGGAACAGGGCTCAACTCGTTAGGAAAAGTTCACATAGTAGGATGGGGG
ATTAGCTTAAACCCTCTCTTCTACTCCTCTATCTCTCGCAATGGGGATTGTAGCATGTCA
CCTTTGATCACCACCAGATAAGTGCACTCTCTCACAATGGTTGATAAGTTTGCAGTAAGT
CGCAGGTGAGTAGGTCTTGAAAGATATGTACACCCTCTAAAATTTTACTACTTTGAATGA
AGACTCTGAATGATATAGCTCTTCTTTTTGGTAGACCTCATGGGAGACCGTAGGAGGAAA
GAAGAAGAATTTTGGAAAAGAAAGTTCAGAAAATAAAGAAAATAGAGAGAAGAGAACTGA
GAGAGAAGCGAGTCGTGGCCGTGGAAACACCAATAACCGGAAAGGAAGAGGTGGCAATCG
TGGCAGAGAGTGTAAGTACAGACTTTTTGTCTCACCTTTATTATGAAAAATTTCAACATA
CTGAAGGCCAAAGACTCGACCAGTATCTGAATGCCCATAGATCCACATCCTCAATGCTAT
GTTGTTTAACATAGTTAACTCTTAGTAATGAGCTACAGTTGGCTACTTTATAAGGGTTGA
ACTCTGCTGCAATTTCCTATCAACACTGGCCTGGGCTATAGGTAGGTAGTTGTGTCTCTT
TTGACTGCCTTATGGTGCAAAATAAGTGCACTTTCTACTTTTAAAGGCAGAGGGGGTTTT
ATTCCTTGATTGACAGAACTATATTTTCCTCCTTATTTATTGATGCTCATGGTACAGGTG
AGGGATAGATTAATAGGAAAGTTACTGAATGGGAAGACCTAGGGTTTGACACAATTTATC
CAAAACAACCCTGCCTTCTATGCAGACTAACCAAAATAGTTAAATTATGAATGAATAAAA
TGTAAATACTTTCCATATCACCCTAGAGACTTTTGCTAGCTCATTTATTCCTCAGATATT
TAGTGGAGGTGCCTACTTACTGTCTACTCTTAGGGGTGCTGAGAATNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAATTGACTGCAGT
TTTGCTTGAAGCATTGCTCAAATGCAGTAGGGGTTGTTCTCCAGATGAGCATTTCATAGT
GGCACAGTTCTAAGAATTTTATTTCTAAGAAATACTAATAAGATTTGTTCATTCATCCAA
CTGTTCTTTACTAAACTTCTGTAATACTTGTGCCATCGAGTCAGTTCCGACTCATAGAAA
CCCAGTGTACAACAGACGAAAGCACTCCTGGTTTTGTGCCCTCCTCACGATTGTTGCCAT
GTGTGAGTCTGTTGTTGTAGACACTGTGTCAGTCCATCCCCTTGAGAGTCTTTCTCTTTT
TCACTGACTCCCTACTTTGTCAGCCATGTTATTCTTCCCTAGGGACCAGCTCCTCCTGAT
AAAGTGCCCAACGTACAGGAGACAAAGTTTCGCTGTCCTTGCTTCTAAGGAGCATTCTGG
CAGTGAAAGATGATGATATACATTGTATCAGAAGTCACTTTTATCTCTCCCTCCCTTTGA
ATGTTAATTTAATCAGTGGGTTGTCCATTTTTAATAAGTTTATTGATTAGGGGTTTTAAC
ACCTTTATCCTGATTTATATGTTGTAGAATATAAATAATTTCTCATAGAGTGAAGAATGC
TATAACTTATACAATTGGCTTTCTTTATGGCAGTCTTCAAATTTTTTTTGCCTCTCTGAT
ATTGAATGCTTTAGCAACGGGTATTAGCACTTTTTAAGTGAAATACATTTCTGTGACATT
TACTTTTTTGTCTTTGGAATTACTTGTTTATGGAATGTTTGGGGATTGGATAAAAATGGA
ATAAAGAATAACATTTACTGTGAGTGATTTACTATAGCACACATTTTGCTAGAATTCTCT
GAAGGTTGTTAGTGTTGTTTTTATTCTCATTTACAGATGAGAATACTGAGGTTTAAGAAA
GGCAGATTACTTGCCTAGGGCCATGGTGAGCTTCTCTTTTGATTTCACATCTGTCTGTCT
TATTCTGAAACCTGAGTTCTTAAGGGAGATGAGAATTAGTGGGAGGATGGTGATCTATGT
TGCTGCCACCTTCCCTTAAAGATCGCAAACTTTTTCAACTTTGAGATCAACGCAAATAAC
TTTTCATTATAAAAAGATGGGAGTGCTGATGGGTAGATAGCCCTGAGAGCAAAAGAACTT
GAAGTTCTGGTAGTGTAGCGGTAACGTGGTGGGTTGCGATCTGCAAGGTGAACACTCACA
ATTTAGGAAACTCGGGGGGGAATTCTGCCCTGTCCTATAGGGTCACTCTGAGTTGGCAAT
GACTCGATTGCAGTGTTAGGTTTGTTTTTGTTGGATTGAAAAGGGGTTGATTTGTTAAGA
ACCAAACCAAGTAACGACACATGAAGAGACAATATTGGCTAGCTTCAAAATTCATAATTT
AAGTAAGTTTACTTTTAAGAAAGCATTTAAAGTAGCAGGACTTGGGCTTTATGTCCCATG
TAAGTTAAATATATATATGTAAAACTTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGGTATTATTACCTGTTATCTGTGCCTTTCCATGGTTTGCAATTGAACAA
AATTGGAATAAACTCTGTGCTGTAGTTTTGATTTAGGGAAAACTCAAATAGAAGAAAAAC
TATCACTATTTTAATTCCTTTTCAGAATTTTCAGAATAATTCCATTTCAGAATTAAGAAA
TGCTGTAATTGTAGATTTTTAATCTACCGTTGTTTTAGTTTTCCTATTTCCTGAGCCTTT
TGGTTCTATGTTAGCCTTTTTGAAAGTGTGTTTCTGCTCCTGCCTCTCATAGATGTCAGG
TATGGTCTCCTACAAGAGAGTTAGAAAAGGAAAGTAGCTGTTTTTGCTCTTTTCCCTTAG
TTAGGACTGAAGAGAATGGAATCGATTGCAATCAAGGGGACAAGTCTTCAGATCGTGGCA
AGCGAGCCCGTGGTGGTAGAGGTAAGCCTTGGGTAAGAGGGAAGTAGGTGCTTCTGATCT
GAGGGCCAAAGGCAGGCTTGACTGGATTCCGAAGCACTATCCTTGTAAAAATGACCGATT
TTGTGGAATCAGTTGATTTGTTTACTCGTGTTTGTGAATGAACTGTGATGGGATCAAGTC
GTTTTGAGGAAACCTATTGGTGGTATTCAGATGAGCTGAGAAAGTCTTATATATCAATTA
TTTAAAACTCAGGGGACCAAAAGTGATTATCAGATTCACTTATATTGGGCTTTGACAGAT
GTGTTTTATCCCTGTGTGGTACTGTTTTTAAAATGGAAATTATTGATGTCCTTCTTCCCT
TTCCAAATGATCCCTGGGTAGAAATTATTTTCTTACACTTATCACTTAAGGACGTCATAA
GGCACTTCAAGGATGTACTTTCATAGATTTGAGAGTTATGAATAAATTTATTCAGGGTTA
TAAAAATCGATAATGTAATAAAAATATGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNCTTTTAAGAAAGGCATTTAAAAGTAGCAGGACTTGGGCTTTATGTCCCATGTAAGTTA
AATATATATATGTAAAACTTAGGTAGGGGTTTACATTTCAGATTGTTCATTTTGTATTCC
AGTCTAAGCTACTCATCAGTTTACTCCTTTCTTATAACCTTAAAAAAATAGCAACACATA
CACACGTTATATATCATACACCTAAATGTAACTGTATTTAAACAGACTGCTGAAGGGCAG
GAGGTCTGCTGGCTGCTGTTGGATGAGCATTGGACTACTAACTCCAAGACTGGTGGTTCA
AAAACAGCAGCTGCTTCTTCGGAGAAAGATGAGCTATCTACTACTATCCAGATTTTATAG
TCTTAGAAATTCTTACATAGAGTTGCTGTGAGTTGGAATTGACTTGATGGGAGTGGATTT
ATTTTGGGTTTTCATTGAAGGGTAGCAACTTATGTTTTAGCAAAAAATAGACAATCTTTT
CAAGTGTGTCTTGTCTGGAGAATTACACAGGGCCTGAGAAAAAAACAATACCAATATTTA
CAAAACCACAGTTATTTTGCTTAGTGGATATTCATAAAATACATTTAATACAAAGTAGGC
AGCTGTATAGGATTTTTCTTTCACTTTCATAGATTTAGGACAAATGTCCTTGTTTTATGT
ATTTTCCAAGACATTTGGTTATAAGTCATTTAATGTCTTTTTTTTCCTCCTCCTTTTTAA
TTTTTCATTGTGAATTAGGTGAAGGTTTACAGAGCAGATCATAGTTAACACAGAGGTGAG
TTCAGTTCCAGACCATAGTCTTGGGGGCCTCACCAGTATCTGACCAGTAAGCCTTGTTGC
TTTTGTCATTTAATATCTTAATTGCTGGTGAATTAGTCTTAAAACAGTTGAATGTTTCTC
CTGGTTCCAAGTTAATTGTTCATCTGTTGGGTAGTATCCTTACCTTTTTATCTAAAATTT
TTTTTTAAATGATGGTGTAGGTGAAGGTTTACAGAGCAAAACATATTACTCTTTCTTTTT
TTTAAATCATTTTTTGGGGGGGCTCATACAACTCGTATCACAGTCCATACATACATCCAT
TGTGTCAATCACATTTGTACATTTGTTGCCATCATCATTCTCAAAACATTTACTTTCTAC
TTGAGCCCTGGATATCAGCTTCTCATTTTTTCCCCTCCCTCCCCACTCCCCCTACCTCAT
GAACCCTTGATAATTTATAAATTATTATTATTTTGTTATATCTTACACTATCCAATGTCT
CCTTTCACCCACTTTTCTGTTGTCCATCCCCCAGGGAGGAGGTTATATGTAGATTCTTGT
AATCAGTTTCCGCTTTCCACTGCGCCCGCCCTCTACCCTGCATATTACTTTTTCTTTCTT
TCTTTTTTTAATCATTTTATTAGGGGCTCATACAACTTATCACAATCCATACACACATCA
ATTGTGTAGAGTGCATTTGTACATTCATTGCCCTCATCATTCTCAAAACATTTTCTCTCC
ACTTAAACCCCCGACATTAGGTCCTCATTTTTCCCCTCCCTCCCCCGCTCCCCTCTCTCT
CATGAGCCCTTGATAATTTATAAATAGTTATTTTGTCATATCTTGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNAGTACTTTGAGGTAAATTGATATATTTATTTTGGTTTTATTAGGTAAAGAA
ATACAGAAACAAACAGGCCAAGCAAAATCATCATAGAGTTTTTCTTAATATGAATGTCAT
AGATTAATGATGTAATGGGCTTTTCTTTGTCTTGACCTTTTCATGTTCTTTTTGGATTGT
ATGGTTTATGTGGGGTTTTCTCATCCGTAATTTAACAAATAGGAACAATGCAATAGAAAA
TACACTCAGTTTTTATTCTGGGTGGGGGGGAAAAAGGGGAGCTTTGTTTTCCTAGTCACA
ATCTTTCAAAATAGAGATAAACTAAAACCAGCCTGCCAGACCAAATTTTTCTTTACCTTT
TGTTCTTGACTTGAACAACTGGCCTCATTCATATGGGCAGTTTTCACAAGTGTAGAAAGG
GGCTAATATCAGGTGAACTTCTTGGAAAATTTTTCCGGTTTAACTGTTGGAGTTGGAAGT
GAGGATCTGACAGAGGATTTCGGTAGAGCTGAAATACTAGAAAGCCCAGGGACGTGTTTG
CCAACAGGCTCCTTTGGTAGCTTTCCCATGGTGAAAGGGGCTGTCAGCTGCTGGCATTCC
TGATGTGTTTTTCTAGGACCTTCTTGGAAGGGTAGCTTGTATCTAGATGGTAAAACTGCA
AGCAGTGGACTTGTATAGAGAGAGACCAGCCACATCTGTGATGATCACAGAGCAAGGAGC
AACTAAAATAATATTCTTTGCATCAGTATTCTGAAGAGCAGGCATGATACATTTATTGTT
TCATAAAGAACAGTAGTCAAATTGCTGTTATTTGGTTAGTGGTTTTTTAGTCTGTCAGTG
TATTTTAATACTTTCAGAACATTTTCTTCTTTCTTGTGTCATTGTTAGTAGCTCCCTGTT
GTGGATAACCTTGCTATCTAATGTGAAGTGCATTGGAGAGTGGATTATTACAGACGCAGT
TAGGTTAAGATTTAACACCTTAACATTTGACCTTCTTGACACATTTAAAGTTTGTTCTAT
TAATATTTTCTGCTTTCTTTTATTAAAATTTTTTAATTAATTAAAAAATTGTTTTATTGG
GGGCTTTTACTGCTCTTAAATTTTTTTTAACTTAAAAGAGCATTTTATTGGGGGCTCTTA
TAACTCTTATAAACAATTTATACCTAATTTTCAAAACATTTTCTTCCTACTTGAGCCTTT
GGTATCAGCTCTTCTTTTTACCCTTCCCCCCTCTGCTTTCTTTTAGATTGAGGTTTTAAT
TTGTTGCTGTAGGTTGGGGTTTTTTTGTTTGTTTTTTGTTTGCAGGGATATGCTTTTCTT
TATTTGAATTCCAGGATAGGTAGATCTAGAGAGAGTAACTGGATTCATGGTTTCTTGAGG
GGAGTGCAGGGAGGGATCATATCTATTCTCTTCGTGCATTTGTGTTTCTTTTTAAGTGTG
TGTGTGTGTGTTTAAGTAAATATGCCCATACTGTTCTTGGTATAAGTTCCAGAATAATAC
GGAATGTAACATCACTAACCATTTTTGTTGACTGTGGCTTTCAGTGTTAAAGGTGTTTTA
TTAGTTAACTAAGAATTTGAGCATTTGCTCAGTATAGATGTTGTAGAGTCCCTGTCCTGG
GGAAAAAATGTAAGAGTTACCAAAGCACTGATTTATTCTTTAGAATAATCTTCTGAAACA
TTGGACTTACATATTTTTTCCATTGAAAGGGCCTTGGTCCTTCCCTGGGCTGTTAGATGA
GAAAATGGTTTCAGGGAAGTGAGCACACCTAGGACGCATGTTGCTGGTAGTATGAGGAAG
AGAACAGTTTTGCCATCTTCCTCTAGCTGACGGGGCAGTTTGCGGCAATCTACTGAAGCT
ATCTGAGTTGTTTGAAGTGGAGACTTGGACGCAGCTGCTGTTGTTGATGCTGACCTTTTC
CAGCACACTTGCAGAGTTTCCTTTTTTAACTTTCTGGCCTTAGGATTTGTATGTCTCATA
AATTCCCACCTTGCCACTCTTTCCTGTTTATTTTGCTTTGCAACTCAAGTATTTTTTGAT
ATTGTTTAATGATTTCTTAGCAGACTCCCCCTTTAAAAACTGGCCCCTATTAATATTTAA
CCATGGTTAGTGCTATTTGCCACATGGATGACACTGAAATAGAATTTCTGTTAAAATGGG
TCCCCATGAATCCACTTAGCAGGATCAGTTGTGTTTTTTGTTTTCCTTTTGTAACAAATC
ATACAATTCACCATTTAAAGGTACACTTCGCTGCTACTTAACATAGTCACAGAATTGTGC
AACTCTCAGAACATTTTCATCACCCCAAAAAGAAACCTTGTACCTTTTAGCAGCCACCCC
CTATTTCCCTCCACCAGCTCCAGGCAACCACCAATTCTATTTTTTGCGTGTTTTGGGTAT
TTCATAAAAAATGGCATCATATGGAGACTGCCGGCTTTAACTTAATATAACTTAATATAA
TGCCGTCAAGTTTCATCTGTTTTGTAACCTATTCAGTACTTCATTTATGGCCCAATAAAA
CGCCATTGCTCACTATTTTATTTTTATTTAAGCTTTGTTCTTTTAGCTTTTTATATAATT
AAATGTTTTACGTCTTAAGAATTAGCTCTCGTTTAATAGACAGGTTTTTTAATTATTAAA
AATTAACACTAATATTAAACTGTCTTATTCCTAAATTTGGATTGTTTTCTTACCCAAATC
TGATGGATGAAAGGTGTCTTCCTAGATGAAGTTTGTATTCGGTATAGTTGTGGTTTACCT
CTGGCAAACCTTGGGTCCTTGAAACTGAAGAAAGGTAACCTTAGTCAGTCTGGGCCTTGA
GACAGGCCTTTAAAATAGTAAAATAAAATTTTTTTCTTCCTCTTTTTACAGCTGTGTCAT
ATTCAGTGCCTTGCCCCATACATGGGAGCACTGGCCCTACAGGCTGCCACAGAAACACTG
TAACTCAAGGGCCCTGTCCATCTCCTCTGGGCCTCAGGGGTAAATGTTGTTACAGACATT
ATGCTACTAAACCTTGTGGGGTGGAGGTAGACTGGTGGGCCTATTGCCCTCACCAGGTAA
ACTTGTGGTCTACTTAAAAAAAAAAAAAATCACTTTTGAGATTTTGTAAAGAAAGGGGGA
TTTCTGATTTATGCTTGTTTGGAGCCTTGGTGGCGTTGTTTGGTGAGAGGTAGACTACTA
ACTGGCAGGTCAACAATTTAAACCCACCATCGGCAGTGGGGGAGAGGGATCAGGCCGTTG
GTGCCTGGGAAGATTTACAGAAAACTTCAGAAACCCTATAGGAACCCTATGAGTCAGAAT
GGACTTGTTAGTTTTTTATTAAGTTGCATATAAACGACCATCTCTGGAGACACAGGAGCT
CCTTCCATTCTCTCCCTTCATCTAATTCTGCCCCGGACGCAGACTTGCTGCCATCGTGAC
TGCTGGTTCAGGGGTAATGTGCTAAAAGTGATAGAACACAGAATGCAGTGACTTAGTGAT
TGCTCTCCTTCTGGTTTTCTTTCAAATGAAAAGAGAGCCTTATGTTATGATGTTTGCACT
TTCTGATTTTAAAAGACCTACTTTATTTTATAAAACTAAAATAAAATATTATTACTTTTT
ACATTGTGTTAAGCTGCAGCATACCACAGATATTGTACAAGCCGAATTAGATGCTGTCCT
ATAGCACTTGGGTTACTTACTGGGTAGGTAGTTGTGCCAGCAGGGACCAGTAGGTCAGAT
GCACTGGATGAGATGTTGATGTTGACAGGAATAGTGACAGTACTGTTTGGGTAGAGGAGT
GTGTAGAATGAAGTCGGTAGCAGTATGTGCGGGACATGAGCTGTATTTGTTTCTTTCCTT
TGAAAGGACTTGGACGTGGCAGAGGGAGAGGGGGAGGAAGGTTCTCTACTCAAGGAATGG
GGTAAGTCAAACAGTCCTACATTTGTAGTTGCTGCCTTTTTACTCTGGTTTCTCCCCTTC
TTCCTATACCAATTTTACCACTAGTGATTTGGGTGTTTTTAATACTTAAAAGAAGCTTAT
TAACAAGTGAAGTAGAAAAAATTGATATTTTAATAGATAATAGAGCAGGGCTTCTCTCCC
TTGGCATTTGGACATTTTGATTGGACAATTTCGTGTTTGAAGCAGGCATTATCAGGGGGC
AATTTAAGTTGTTTAGCAATATCCCTGGTTTCTGTCTACTACATATCAGAAGCACTCACT
CCATCTCCTTGCCTACCATTCAAAGCATTATAAAACAAAAAAACAAAACACTGAATTCCA
CAGCCATTGATTTGACTCATAGCAACCCTAAAGGACAGAATAGATCTGGTGCTTTTGGGT
ACCAGAGACTGTGAATCTTTATAGAGCAGGCATCCTCCTTTTTCTACTATGGAGAGTGGT
TGCTAGGAATGAACAACGGACTTTGGGGTTAGTACCGACCAATAAGAATATAAAAAATGT
TCCCCACATGTTGTAAAATTCTCCCTGGAGGAACACTCATCCCTGATTGAGACCTGCTCC
TTTGAGAACTGTTTGGAACCTTAGGAGTTTTATTGGTAAGACTCTTTGAGTGCTAAGTAA
ACACAAAGCTTACGTAAAAGTGATCTTTGTTCCCCTGAATCATGGTACTAAAGGATGGGC
ATACTATCACTAAATACGTTTAATCAGCAGTTTATTTAAGACTTATGGATATATATTTTT
TACTTTTCTGCTGCTTCTAAAGCAGCATTTCTCAACCTGTGGGTTGCAATCCCTTTGGGG
GGAGTGGTGTCAAACGACCCTTTCACAGGGGTCGCTCAAGACCATTGGAAAACACATATT
TCCGATGACCTTAGGAACAAAGACGTTGGCTTTTTACGCATACTGTCACAAAATGTAGCA
ATGTAGTTTACTGTTGTTCTCTTAAGACTGTACCCATGCTGCACCATGCTTCAAGACAAA
ATTTAATTTATTTGTCATTAGAAATGAATATTTCACAATATATAATTACATATTATTTTT
TGTGATTAATCACTATGCTTTAATTATGTTCAAGTTGTAACAATGAAAATACACCCTGCA
TATTAGATATTTTACATTACGATTCATAACAGCAAAATTACAGTGATGAAGTAACAACGA
AAATAATGTTATGGTTGGGGGTCATCACCACATGAGGAACTGTATGAAAGGGTCGGGTCA
CTGCATTAGGAAGGTTGAACCACTTTTCTAAAGGATTCGTTTCCACTGGACTTTTAGAGA
AGCTAAATTTTTAACATAATAGATGGAGGACAAGGAAGAAAAGGAATAGGCTTTTGTCTC
CAGGAGCTTCAGCGCAGTCCTGTTGGGCCAGCGCCCTCTATAGGTGGTAGTACCTCTGGG
CATCCCTAATTTCACCCAGACCTTTCTGCTTTTTTCAAAAGGGAGGGATGAAAACACCGG
GAGCAAACACTAAAACATTTATGTTTGACCCCTTAAGCTCTAAACTGCTCTGTGCTTTTT
TGTTACTGTTTTAAAATCATTTTATTGGGGGCTCATACGTGCTCTGTGTTTTTTATGGTT
GTTTTAAAAAGTACTTTTTTGGTGAACATTTCAAAGATAGTTATTTATTTTGGCCTTTGT
TTAAAAACTCAAATCATGATTTCTTATGTTTTCAGAGTAAGAGGTTAGCTTAAGATTTTA
ATGAAAATGGAGGATATTAAACAAAACATTCAGCTATTTATACTTAACATTTCTTTGCTT
TTTTTAAAAATTTTTTATACTTAACATTTCTACACAGAAAAAACAACCACTTTTTCTAGA
GTCAGTTCTGACTCGGGCCCACTTGTGATTCGTAGAGTTTTCAGTGTCTGAGGTATTGGG
TAGCTTGATAGGGTTTTACTTAAGGTGCCTCTGGGTGGACTCAAACCTCGACCCTTGTAG
TGAACAGCCAATCACTTTAACTGCACCAATTAGTGATTTCTTCCTAGAAATAAGGAACAT
ACAATTTTATGGTAAAGATTAAACAAATCAAAATTGGATTTTGATTTTGGAACAAAGAAA
CTTGTTTTCTTCTTCAGTGTGGGCTTGGTGTCCTGGAAGCGGATCTCTTGTTTGCACACA
GTGATCTTGCCACCACCTTCTTCCAGGTGCAGAGGCATCTGTTTTTGACCTTGGTAGTAA
CCTGATGAATAAGCTATAATTGAATAGGGGACTAAGGGCCAAGTCTTTTGGTGTTGCTGT
GTGAAGAAACTGGACTTGCTCGGGGAAGATCATGTACAGTCAGCTTTGTGGCTTTGATGC
TTGCTTCATTTGCCTTTATTCTTTATTTTCACCCCAGAACATTTAATCCTGCGGACTATT
CAGATCCTTTATCCTCAGATGGATGTGGGACAAAACCAGCAGTTTGGGAAGCCACTCAGA
ATGGTGCAGATGAAGGAACTGGTAAGCATTTTAGTCTTGCTTTGCTTTTTAAATGTTTTA
CCTCCACCCTTTTGTGTTTTCATACAAAGATGATGTCAAAATGTGTGCAGGTGGAGAACA
AAAGAAGCACAGGCTGTTGCCCTAGGTCTGAGCTGGTTCTTAACCTCCAAACTCTCTGAC
TTCCTAATGGTATTTGTTTTGTGTTTTTACCTTCTACACTGATTCAGGGACTGTAGTTGG
CAATCAGTCACAAGTTAATCCAAATCAGATTCCATTCTCCATGTGTCTGGGGAACTCTAA
AATTTTTTAGATGTACATACTGCACATTCAGAATTGTGGAAACTAAAATTTAGCCAGATA
AAGTGGTAGGTGGTTGATGGGGTTGGGGCAACATTGTTTCTACAAGGTTTTCTAAGTCCT
ATTTTGGGGTTATTTTCTGGAATTTCTGGGTAAATATTTGTTATTGCAATGTTTATTTAC
ATAGAGCTCAATTTAGCATTCCAAAACATAAATCTATAGCTTAAAAAGTTAGCATCCATT
AACATCAACCCTGGTTTAAAAATAATGACATAGGTACCATCCCAGAAGTATAGACTAATG
AATGAGAAATTAAGGATAGACAGCAAAAGTTGTAATGGCTGTTTGAAAAGACTAATAAGA
TTGATAAACTTCTCTTGAGACTAAACAAGAAAAAAGCATGAATAATTGGTGGCAGGAATG
AGAAAAGGGACATTGATATAGATTGTATAGACAGTGAAATATCCTAAGAAGATACTTGTG
TTAGTCCAGGTTGACTAGAGAAACAAATCCAGAGACACTCATATATATATATATATATAT
ATATATATATATATATATATGTAAGAGAGAACTTTATATCAAGAAGTAGATATGCATTAA
TAAAACGTATAGATCAAGTCCATAAGTTCAATATTAGCTCATAAGCCTGATATTAGCCCA
TGAATTCCTCTTCAGACTCATGCAGCACATGCAATGATGCTGATTGCAGGAAGATCACAG
GTCGGTGGGTGGAAAGTCCTGTGGGCCCAATGGCAGTGGATGCAGCTCCAGGGCTCTAGC
TGCCATCAACATAGCTCCATGTGGCTTGTCAAGAGGCATGTGAAGCAGAGAGAGTGTGTG
TCCCACCTCCAGGGAAGAAGAGAGGAAACTTGAGAACCCTCATGAGAAGACTATGCCCAC
AAGGAGGGATTACCAGGCTGTGACCTTCATTCTTATTTATCAAGTTGACATGAAATTGTG
TAACTACCATAATACTTTATGGATTAACACAATCTCATCAGCCCAGATATAAAATTATTA
ATCATAATAATAGAAAACAGAACCCAATAAGACAGAGGCAGAATAATACTATATCAAGAT
CATGTGCCCACATGGAACAACATATCAACCTGTGTGATCACGGGGTGTCGAACGGATCAC
TGAAGACAAATGGGTGCATAAGCAAATGTGGCAAAGAAAGCTGATGGTGCCCGGCTATCA
AAAAGTATAGCGTCTGGGGTCTTAAAGGCTTGAAGGTAATCAAGCGGCCATCAAGCTCAG
AAGCAACAAAGCCCACATGGAAGAAGCACACCAGCCTATGCAACCACGAGGTGTCGAAGG
GATCAGGTGTAAGGCATCATCAGAACAAAAAATCTTGCCATAGTGAATGATGGGGGGAGT
GCGGAGTGGAGACCCAAAGCCCATTAGTAGGCCACTGGAAATCCCCTTGCAGGGGGGTCT
CGGAGAGGAGATGAGCCAGTCAGGTTGCGATGTAGCGATGATGAGAAACACAACTTTCCT
CTAGTTCCTAAATGTTTCCTCCCCGCTCCCACTACCAAGACTCGAATTCTATCTCGCAGG
ACTGGCTAGACCAGAGGAGGTACACTGGTATAGATGGGAACTGGAATTACAGGGAATCCA
GGACGGATGAGCCCTATAGGACCAGTGGTGTGAGTGGCGAAACAGGGAGGGTAAAGGGAG
AATGGGTAGGAAGGAGGGAACCGATTACATGGAACTGTGTGTGACCTCCTCCCTAGGGGA
CAGACAACCGAAAAGTGGATGAAGGGAGACGTCGGACAGGGCAAGATATGACAAAATACC
CATTTATAAACTATCAAGGGCTCATGCGGGAGGGGGGAGGGGAAAAATGAGGACCTAATG
TCGGGGCTTTCAATGGAGAGAAAATGTTTTGAGAAACGATGTACAAATGCGCTTTACACA
ATTGATGTGTGTATGGATTGGGATAACAGTTGTATGAGCCCCTAATAAAATGTTAAAAAA
AAAGAGAGATCATGTTAAAATTACATGAGAATAGGAATTGTGTGTTCATACAAAACTTTG
TGCATTAATGTTCATGCCAACAGGATTCATAATAGCCACCCCACCCAAAAATTCGTTAAC
TTGATTAATGATAAATGAAATGTGGCATAGTTATACGATGGAATTTATTAAGCCATATAA
AGGAACGGTCCTGATATGCTTCAGCATAGATGAGTCTTACAGCATGCCAGGGGAAAGACG
TCGGCCGTAAAAGACCATACATTGTATGATCCCACTCATATGTATTATCTAGAGATAGAA
AATTGATTAGTGGTTTCCAGAGTTGGGGGAGGCAGGAATGCACTGTGACTGCTAATGGCC
CAGTTTCTTTTTGAGATGATGAAAATACTCTGGAATTAGATCATGGTACTTCACAACCAT
ATGAATATACTAAGAACCACTCAATTATGTACTTTAAAATGATGGAGTGTATGTTATATC
AGTAAAAATCAATATTATTTCTTTAACAGAATAAAGAAGAAATTCACTCAAAAAGAAAAG
CATTTGACAAAATTCAATATCTGTTCATAATTTTAAAAGGATCAGAAATCAAGAATAGAA
GGAAAATTTCCCATAGAGATTATCTGCATAAACTAGAGCAAACATGCACATAGAGGTGAT
GTGTTAAGCCTTGCCTGCGGCGTAAGAGAAAGATGCTCGCTCTCACTGCTCGTACTAAAC
ACTCTCCTAGAGGTTCCAGCCACAGTAAGGGAGTACACAAACACGTGTAAGGGATGAGAA
GGAGAAAACACTGTCATTTTTGGAGATGATAGAGAATAATCTTTAGAAAGGTTATTAGAG
TTAAAGGAGGTTCACAGAAGTCTCACTATTGTGCCTTTACGTTTATCGTTGACTCAGTCT
TTACATTTATTCTATGATTTTCCACCACACCACAGTTTTCCACGTTGTCATTTTTTTTGA
TTGTTTAAAATCGTGTTTACTCAAATGTAGTTTATATATATTAAAATGTACTCTTCACAC
AGGCATACAGATCAGGTGGGTGAATTCTGAGAAAGGCATAAAATCACAGAACCACCAATA
AATGGAAGGATGGTATTCTTATATACTAGCAGTATTGTATAAAAACCAAACTCACCACCA
TTGAGTCAATGCTGGCTCATAGTGACCCTGTAGGACATGGTAGAAGTGCCCTATGAGTTT
CTGAGACTGTAACTCTTTATGGGAGTAGATAGAGCCCCATTTTGCATGAATGACATAAAA
TTCACAGAAAAAAATGTATAGTTTATAACACCATTGTAGGGATGGAAGGTGGGGTGAGGA
GGCTATGAATAGATCTGACAACATAGATGCAAAGTTCTTATTCTATGCTGAAAATTATGT
AACAATGAAAAAATCAAAAGTCCCAAATGAAGGGATGCCTCGCTTTATTGTGTTTCACAG
ATATGGCATCAATTGTAGATTGAAGGGTTGCAGGCAGCCCTGTGTGTCATGCTAGTCTAT
TGGCGTCATTTTTCCAACGTATGCTTGCTTTTATCTTTTCACATTTTAGTAATTCTCACA
ATATTTCAGACTAGACTTACTAGACTCTAGTATAGTGTAAGCATAACTTTATATGCACTA
GAAAACCAGAAAAATCGTGATAACTTGCTTCATTGTGATATCACTGTAGTGAACTGGTCT
GGAACTGCCGTACACATCTCTGAGATGTGACAGTAGAAAGGGTTCATAGTGTTCATGAAT
TGGAAGGCTCAATATTCTTCAAATGTCATTACTACCTGTGATAGTTACATGTTCTGTTGT
CAATTTGAGAGTATTAAGAGTGAAGGGGTAGAGTTTAGCCTGTCATTCAGGTCACAGCTT
GATGACCTAATTTGGAGGCGCTAAGGAGATAAATAGCTTGCTGGAGGCAGGACCCACACT
CACTCCCTGCAAGACATTACTGACAACAAGCCTGATAGAGCTATGCTGATGCAGCCAGAG
ACCTGGAGCTTGAGGGGCCACTTGGAGACCCACGCCAGCACTGAGAAGCCTCTACTGCCA
TTGGATCCACATGACTTTCTACCCACTGCCCTGTGATATTCCTGCATTTGATATCATTGC
ATGTGTTTAGTGAGTCTGAGAGGAATTTACAGATTGGTATTGGACATATCGGCTAATACC
GGACTATGGACTTGATGGATACCTTTATTGTTTTGATATGTTAAAAACCTTCCATTGTAC
ATTAGTCCACAGAACTGGCATCAAATACTCACGAGGTAGTTTATGATCTGACAGATGACA
GTTCTTTTGGACTCAAAGAATATGGATGGGTTTGAAATATAAAAATTTACTTGGTTTAGA
ATCTTATGAAATGCTTATAGTATCTTCCATTCAAAAAATCAAAGCTAGCTGTAAAAATTC
ATTAGACAGATGTAAACTATTTTTACAACCACTTGGTAAAATAAAAACCATTGGCCTTAG
CTTATAAAAGTGTCTGACAGATTGGGCTTCAAGGAGTCTCTGAATTTTACATTGTTATTT
TCCTAATTGGCTTTCTTTTAAGTACTTACCTTAGAGGTGTAACCTTAAATTCATTTGCAC
ATAAAGCAGTCAAGTCAATTTTTTGGCTTACACTGTACATGCTGTCATTGAAGTTTGTCC
ATATCTTCAGCTGTCTTTCCAGTGACAGATGTGACTTTGGCACCACTCATAGTGGTACCC
GGCATCCTGTGTAGTGTGGAGCCTTTCAAACGTGTAGTAGTTGGTTGATAGCTGATGGAT
GGATGGGTTCTTAAGGAAAATTCTACCACAATTTACACCACCCCCACCACCCCCGCCCCG
AAATCCCAAGTGCCTCAAAGATGAAAGCTTTAGGAATGAGTTTTCAAGCAATTCATTTCT
ATTTCACAAGTAAATTTCTATTTCACTCCCAAAACTATTTAGTGGCACTCATTCCTTTTT
TAATTTTATTTTCAAGTATTCATTTTGCGTAGAAGTTGTAAGCTTGAAATTAAAATACAG
GCATATCTTTCAAGATATTGCAGGTTTAATCCCAGACTATGACAAAGCAAGTCATGAAAC
ACTTGTTGGTTTCTCGGTGCATGTTAAAGTCATGCTTACACTGTTCGAGGGGGTATCAAA
AACTTCGTGGAAAAATGGAATGAAAAGATACTGAACTCTTTGAAATCCCCTCATCCCTTA
GTCTATTAAGTGTACAACTAACTTTTAGGAAAAAGATATTGTGAGAATTAGCAAATGTGT
CTCAAAGACATGAAATGAGCATTTGCTGTTGGGAAAATGGTGTCCATAGACTTATTTTAT
GCAGTGTTACCACAAACCTTTACTTTGTAAAAGCAAAAAAATGCTTTTAGGAGGGTTAAA
CTTCGTCTTCTGTTTTCTTTTCTTCTCAGGAGTGTGCTCCTTCCCCTCGATCTCTCATGT
ACACGCATACACATGCAAGATGTTTGCTAGAAAAACAGCTTTTGTGGGTTAGATGCTTCA
CTTTCTCAGGAAACTGAAAAAGCATCAGAGTCTCAGTACTAAATCGGCGTATGTAAACAC
AGCACTTTTCTGTAGAGCCCTTGGACAGCGTTTTCTGGATGGTTATTCTGTGTGAACTGT
TTGGAGTACCTCTAACCTCCTCTGTATAGCCCCAGACATGGCTATGAGCAGAACTCATGT
TTCGCTTGGCTGGAGATCGATTAGGAAACCATATAATAGGGTTAATATCTTTTAAAAAAA
TGCTTTTCTATATTTAATATTCATTAGTCCACTTGAAGTAGTGTTTAAGTCAGACCTGCC
CTTGAGCTTTGTTTGGTTTTAAATTGTATCCATTATAGAATATTTTAATGTTGTGAATTA
CATATATTTTGCATTGGCCACATTTTCTCACTTATGCAGAATTGCTTGGATATGTACAGA
GTAGATTGAAGCAGAATTTTCCCACGAATTTTGAAACTTTGCTTTGCATTATGTGTATAT
TATGTTGGGAAGTTGCATTTGAATATGATCAATTTTATTGAGAGTACATTTAAGAGCCTT
GCATTTCTTTTTTGAAAGCATTTTATTGGGGGCTCTTATACCATTCCATACATCAATTGT
ATCAAACATTTGTACATATGTTGCCATCATCATTTCCTAAACATTTTGTACTTGAGCATT
GGTATAAGGTCATCTTTTTTCCCCTCCATCCCATCCCTTCCCTCTAGAACCTTACATTTC
ATGCATCATCAACAAAATTGCCCATGAGCTATGTAATAGTTGTCTTTCTTGTGCCATACA
AAAGAGAAATTCATTTGGAAAAACTATATTTGGCTTTAGGATGTAAACATTGACTTGTCA
TTTCCAAACAGGGACTTGGAAGAATTCTGTGGAAGAGTGGACAACAGAAGACTGGACTGA
AGATGTAAGAGATTTAAACTTGATCAAACACATCTTTCTTATAGCGTCAGGTGGGGCATG
TGTGTTTTGGAAAAAGCCTGAGACATCTTACCTTAGCCGAGTTCTCAGACATGTTGCTTT
CTTCACAGTTTCATCTCAGAAAGAAAGTGGTATTTTGAGATTTTAAAGGGATTTGGATTT
AAAGCATCTATTTAAAAATGGTTAGGCATTAAATAGGACTGAAAGTTTTGAGTTTACCTT
TACTTTGTGTGCCTGTTAGGCAAATAACCCTGTAACCTTTGCCTGTGGGCTATCCTTGTA
GAAAGTTTTTATTAAAGGAGAGAGACTATTTTTTGGGATACAGTTGAAATTAACTTGCGC
AAGTCCATTGGGCCTCCACTCAGGTGCTCCCTCAATGCAAGAATACTTTCTTCTATTACA
TTGGCGTTCTGTGATGCTCACCTTTCCGACACAACCACTGAGGACAAAGCGGGTGAATAG
ACTACTGTGGTGAGGAGGGTTGATGGTGCGCGGGCTATCAAAAGGTATAGTGTCTGGGGT
CTTAAAGGGCTTGGAAGGTAAACTAGGCAGCCATCAAGGCTCAGAAGCAACAAAGCCCAC
ATGGGAAGAAGCACAGCAGTCTATGTGATCACGAGTGGTCGAAGGGATAAGGTATAGGGC
ATCATCAGAACAAAAAATTCTACCATAGTGATTGATGGGGGGGAGTGCGGNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACCCATTAGTAGGCCACTGGAGATCCCCT
TGCACGAGTGGGTCTCGGAGGAGACGCCTGTCAGGGAGCGATGTAGCAATGATGAAAAAT
ACAACTTTCCTCTAGTTCCTAAATGCTTCCTCCTCGCCCCCACTATCATGATCCGAATTC
TACCTTGCAAGTCTGGCTAGACCAGAGGATGTACACTGGTACAGATAGGAACTGGAAATG
CAGGGAATCCAGGGCGGATGATCCCTTCGGGACTAGTGGTGTGAGTGGCGATACTGGAAG
GGTAGAGGGAGAGTGGGTAGGAAAGAGGGAACCGATTACAAGGAACTATATGTGACCTCC
TCCCTGGGGGACGGACAACAGAAAAGTGGGTGAAGTGAGACGTCAGACAGGGCAAGATAT
GACAAAATAATAATTTATAAATTATCAAGGGCTCAGGAGGGAAGGGAGAGCGGGGAGGGA
GGGGAAAAAAGAGGACCTAATGCCGGGGGCTTGGGTGGAGAAGGGAGTGTTTTGGGAGTG
ATGAGGGCAATGGATGTGCAGGTGTGGTTTGCACAGTTGATGTATGTGTGGATTGTGATG
GGAGTTGTGTGAGCCCCTAATAAAACGATTGAAAAAAAACAAAAGCAAATTTGCGCAAGT
CATTCTAATTCCAGGTCCCACCTTTAATTCTCCCTTTTGACTAGACAGACTGTTTTGATC
TGCAGGTTTTTTGTTTAATCTACAGTGGTGGGCGGGGCGGGGTGGTGGTGTTGTTTTTAT
TAAGTGTACTACATTAGTTTCTGTGCAGTATTATATGTTTTTGGTTCAAAATAACTGTTC
TTTAGGAAAACATTGTCTACTTAGATAATATAAAAAGGAGCAATTGAACTAGCTTAATTT
CATACTCTGTACCATCTTTCTGTATGGTGTTTAAGGTTTGGACAGAAGCATATGCTTGAG
AGTTTGATCAGACATGAACCAGGAAAAATAAGGGATCAGACAAATTAGAGTTGCATAAAG
TCACATACTTGCTTCTTGCTCCTAAATGCCTATGCGGATTTGTGCTGACAGAAGCGGTTT
GGAATGAGAAATTAATTTTTAAGGACCTTAGCCAGGACACTGATCCTCAGGTCTTGGTTT
CTTCATTTGTGAAAAGGGTATCAGCAATTCCTCAAACAAATCACCATGTTAACAAGGTTG
TGGCATAGAATTATTTTTAATTTGTAAAACTGTAAAAAAAAAAAAAGACAATTGACTTAG
AAGGATGTTTTTAAAAAACTTTGTACTTATGTTATTTCACTTTTTAGTAATTATATATTT
GACTTGTAAGGGAATTAGGTAGGGTAGGTATGAGGCAACAACCCAAAACACAAACCAAGA
AAACTTCCCCAATGCCGTTCAGTTAATTATGAACTCATAATAACCCGATCTAGGGTTTAG
GAGCCTATAAATCTTCACAGGAGTAGACAGCCATCTCCTTGTGCCCCAGAAAGGTTGGTG
TGTTTGAACTGCCAACTTTGTGGTTAGTGGCTATCACCTCACCCATAGGATAAAAATAAA
TACACTCATCTGATTGCTGCTCTCTATTAACCACCAGTCCTTGAGATGGGATGTCACTTG
GCTCTCTGTTACCAGTGATGTGAGACTGGAAGAGCTAAGTGATCCTGTAAACCAGGGGAG
AGCTCGTCTAGGGAAAAAGGGGAGTCAGAGTGATCACCCTGTGGTACCGTTTAGTATTTC
AAACACGGTCATCCTGTGTATTTGACTTTTTGTTAGGATGAATTTAAAGAAAAAAGAGTA
AGGCTAAAAGCCATGCATGTCCTGGCCCCGCAGGGTCGTCAGTAGCTAGGCAGGTTGGAA
AGCACCAGTAGAAGGCAATGCTTACATGCCCGTGGTAGCGCTGTTGACATCTTGATCTTG
GCTTGGACAAGGCATCTTTCTGAGTCTGTCCGTTTTTACCTTTTTAATGACTAGTATAAT
GGCTGATCAGATGAAGTCTTACAAAAGTTTGCAAATAAGTAATATACCATACACAGTGAG
ATAATATTCTATGCAGGGCAGATGTTATACAGTATGATGTATAATTAATGAAAATAGCAC
AGTGGGTCTGTGCATCTCTTTTATATGAAATTATCAAGAAAATACGAAAATTCTTTAGGT
GACACAAAAATGATTGCTTGGTAGGGAAATTTTAAATTGTAATTTAAAATGTGATTGGTA
GGGAAATTTTAAAATGTAATTCTAAATTCCATTGATACCTTAGAATAATCACTATTCACC
TCTCCTTTACGACGATAGCCCTATTTTAAGAAAAGAGGGAATCCTACTTCCGTATGACAC
CAGGGTTAGCTCTGGTGTCAGTGGTTTGCATCTCTTTTGAACTTTATACTTAAATGACTT
TAGTTCTACTCTGCTGTTGCTTTTCATAGAATTATCCCTTGTTTCTCTTTCTTAACTCTT
AATTAATTATAGTTAATATGTTTCTTTAAGGTCTATAGGCAGTTTTAAAATACTATCTAC
AGTTGCTGCAAGCCTAACTAACATTCACTCTGTTTTAAAATAATACCATGGAAAGGGAGT
ACAATGGTCCCTTCCTTTTGAAATATCATTGGGTTGGCACTTTTTGTTTTGAAAGAAAGG
GAACACCTCTCCTCAGTCATTGCCTGGATAGTTCTGTCTCAGAAAGTCTGATTTTTAAGA
GTCTCAAAGATCTGGGAGACATTTCAGGGTGTGAAGAATAACATCTGCCTTTGAGTAGTA
CTTCTCATTAGTTTCTTGTGTTATTTTGTTAGATCAATACTTCTTAGCCTTCGAAAGGCC
GTTCCCATTTCATCAATGACTATTGAAGTTTTAACCATTTTTATTGTGACAATGAAAATG
AGTGAGTTAAAACAATATGCATGAATCTCGGAGCAGTTATGCTGTGTGAACAAAGACAAA
AAGGGATGCAACCTGGTATATAATGTTAGGAAGCACATCTGTGCTATGCAGGCCCACTGA
TGAGTGGTGGGACAGGAGGACACCTTTGGGAGTCATTGGCATGTTAAGATTGTGTTGGTA
ATTCTACTGGAGTACGTGCATGCCACAGTGTTCAATTATTTAAATATTTACTGTTTAGAC
CTGTTTTACCTCGATAAAATTATTTTTAAGCCAAATTTATAGTATAATAAATCAATATAC
ATTACTGATCAGCAAAATGTAAAAGCCATCTTGGAGGGAACAGGTTGTTTAATTTACTTT
TTAAAACTTCTTTGCTCCCTCTTGGCATTTATGGTAGCACTGGCCATGGTTTTATTAGAG
GATCTCTTTTGATATAGTGGCAAATAGAGAGTAGTTGGGCTGCGACGTGAACACTCATTG
GACATTAGTTTGACGTTGTTGTCTCCTATCAGTTACATAATGATGTGACACCTTTATTGT
AAGCTTGTCAGTCTAAAAGTTTTATCACTGGGGGAGGGGGGAGTGGGAAGGCAGAGGGAG
GAAATGAGGAGCTGATGCCAGGGACTTAAGTGGAGAGCAAATATTTTGAGAATGATGAGG
GCAACGAATGTGTTTTACACAGTTGATGTCTGTATGGATTGTGGTAAGAGTTGTATGAGC
CCCTAATAAAATGATTTTTAAAAAAGTTTTATCACCAGAAGGAAGGGGGAAAAAACATTT
TTCCTTTGTTGTCTCAGACCACTTTTTGGGTATAGTACAATTGAGCATACTGGTGGGAAA
AAATTGCCAGTATTCAATATATTTATAATTTTAGATTTAAAGTTAAAAATGGTTTTGTTT
CCCATGCAGCTTTCTGAAACAAAGGTCTTCACCGCTTCGTCTGTTCCAGCAGAGAATCAC
GTCCCCCCTGGACAAAGGTACACACCTTTTGCCACCTTCCGTTTGTGAGTCAACCATTAT
GGAAAGTTTTTTTTGCTGGGGAAAAGTATTTTGGTCCTTAAATCTGTCTTTCTTTTTCAA
TCTAAAACTAACTTTTATTTTATTCCTAACCTATCTGGTCAGCTGACAAAGCTTCAATTA
TATCAAAATTAGAACACTGACAAAATGTCTAAAACACAGGTAGTTCAATACGTGTCTATT
AGCAAGCCAGTTCATGTATGCACAGGTTTATTCTAAACAAAACGGGTTTAACCATGTGCT
TGTGATCGGGGTGGCTACAGACAAGTTCTCTCAGTAATACACTTTTCTGAATCTTGTTAG
GATACCTTCAGAAGAAGTTCCGTTTAAGCATTGGCTTTACAGGGGAGGAGGGGGCGGCCT
CACTGGTGGATTTTTGGCAGAATTCTCACCTTTCATTTGGGAGCCCTAGGTTTGGTTCCT
CGTCAGCACACTTCCACTCCCTGTCAGTTCATAGAGGCTTGCGTGATGCTAGGGTGCTGT
AAAGATTCCAGCAGATATTCCGACGGAGGTAAACTAGGAAGGAAGGCCTGACAGTCCACT
TCTGAAAAGCCTGGTCACTGTTCTTTTAAGTTTATTATAGAACATCCTTTGGCTTTTTCA
CATAGTACCATTGATTTAGATTTAAGACAAACTTCTTATGCCAGTTTTAATCTACTTGGC
TTGTGAATTACCGAACAGGAAGAAGCTTTTGGGGTAATAACATTCATAGAACATGTACAG
AACTGAGTTATTAAAGAAAATTAACCCACAGCAACTACAGCAACCACAGATACTTTTACA
TTTGATTTTAACCAACAGGTCAAGAAGCAATTTAAACACTTTTCATTATGGTTTAAAAAC
ACAATGAGCTGTGAGGTGGCTTCAAAAAAATTTCGTATAGAATGCAAAGATAGGGACTTT
CCCACACATTTTGGAGGCACTCTCGTGGAAGGGTGATGTTTCAATATAGATGGCCCCTTA
GAGAGTAAGGCACTATTGAGCCTGCCTTTCTAATCTAGTGCTAAATGAGCTGATTATATA
GGGAAACTTTTTGAAGCACCTTCTTTCTTTCTCTATAATGCTGATAGGATAATTTCCATT
GTAAAGATGATACTTTTCAGGCATCAGAGAACAACAACAACAAAAATCATATTATTGTGA
ATGAGGAGGGGTGCCGAGTGGGGACCCAAAACCCATCTATAGGCAACTGGACATCCCCTA
ACAGAGGGTCACTGGAAGGAGACGAGCCTGTCAGGGTAAAGTGTAGTAACGATGAAACAT
ACAACTTTCCTCTAGTTCTTTAATGTTTCCTCCCCCCAACTATCATGATCCCAATTCTAC
CCTACAAATCCAGCTACACCAGAGGATGTACACTGGTGCAGATAGGAACTGGAAACACAG
GGGATCCAGGGCAGATGAACCCCTCAGGACCAGTGGTGAGATTGGTGATACTGGGAAGGT
GAGGTAGAAAGGGGTAACTGATTACAAGGATCTACATGTAACTCCCTCCCGGGGGGGGCG
GACAACATAAAACTTGGTTTTATATTGGACAGTATAAGACATGACAAAATAATTTATAAA
TTATCAAGGGTTCATGAGGGAGTGGGGGGCGGGGAAGGAGGGGGAAAATGAGAAGCTGAT
ACCAAGGGCTCAAGTAGAAAGCAAACGTTTTTGAATGAGAATGTCAAAAACTGTACAAAT
GTGATTGACACAATGGATGGATGGATTGTGATAAGAGCCCCCAATAAAATTATTTTTAAA
AAGAAAGTATTTCACAATATATTTTTTAAAAAGATGTTGCTTTTTTGTAGTGGTTAGTAT
TTTTTTTTCACTTCATTAAATAATATTCTACTAATTTTCTGTGTCCCTATCTTATCTAGC
TCTTGGAAAAGATTTAAAAAAAGTACTTTTATCGCGGGCTCTGACATTGGAAAATATATT
TTTGTAGTCATGAAAATCCTAAGTAATAAAAAAACTATGGATTTGTATCCCTAGGGTAGA
CCATTAGAAGCTTTGATATTAGGATCTAAAATACTGGTTTGGGACTTCGGTCTTGGTATG
GAGACACGAGAGTGGCAATTTATAAGGAGAAGGAGTCAGGGCCGGTAACATTGCTCTGTT
TTTGAGGGAGTCATGAATGATTTGACCTCCCAGAACTGCCAGCCTGACTGGTACAGAGCG
AGAACTGCTGGGAACCAGCCCCTGGAGATTTATTAATGGAACAAATCAGCGTGGAAAAGA
GCCCTGAGCATCATGGAGTGGCTGTGGTACTAGGCAAGCTGGGGAAAAATTGGTTGTGGA
AGTTAGCAGCTCACTCACATGTCAGGTAGTCTTATCTGGAGGACCCCTTTCCCCTCTTGC
TTTCAGATCTTCTTAAATGGGAATATTGCTTTTCTGACAACATCACAAGCATTCTAGTTG
ACGTTGTGTTTGTGGGCACCTCCCCTGAGTATTTAGGTAAGAAAATTAGGTAAACTTAAG
TTTATTATGGAGTTGAATGAAAATCTCCTAGGAATATATAAGATAAATCAAAGACTTCTT
GAATGGTCTGTTCATATCTTGACTCTCATTCTCCAGAGATATACAGTCACTCTCCTTTGG
AAAGGTTAAAGAAACCCAGAATCTAAGTAATAAAAGTTGCTAAAAGAAATAAGCCAGACC
AGTGGTGTGAGTGGCGATACTGGGAGGATGGAGGGTGGGTGGGTTGGAAAGGGGAACCGA
TTACAAGGATCTACATGTGACCGCCTCCCTGGGGGACGGACACAGAAAAGTGGGTGAAGG
GAGACGTCGGACAGTGCAAGATATGACAAAATAACAATTTGTGAATTATCAAGGGTTCAT
GAAGGAGGGCGGAGCAGGGAGGGAGGGCAAAAAAATGAGCTGATGCCAGGGGCTTGTCTA
GAGAACAGATGCCTTGAATGTTGAAGGCAATGAATGTACAAATGTGCTTTACACAATTGA
TGTATGTATGGATTGTGATGAGTTGTATGAGCCCCTAATAAAACGATTTAAAAAAAGAGA
AGTAAGCCAAGCTTATTTTAGTTTACTTAATTGCTCCAATTATTTTTTTTAATTAACACA
TCTCCAACAGATTTATTTATTTTTATTGGAAAGGAATGAATTGTGAGGAAAGAAAAGCAC
GAGGCAAGGCAAAGTATGGAATAGAAAATAAATACAAATGTGAGCCGTTTTGATAATTGC
TTTATAACCACAAAGGAGTACAGAGGAGGTCCTGTACCAAACAACACAACAAAGGTCCAA
AGATGAGGTGTTCCTGAGCAAGGCTGAAGAGTCCAGTCTCTGGAGTTTGGAATGGAGGCG
GCAGTCCTTGGTTTTGGATGGATCACTGGGTGTACGGTCACAATCCAGGCTTTAACCAGA
TTTGAACAGAAGGATGGCCACTTGGCCCAGGTAGAAGTAGATGAAGTGCTTAGTTTCGTG
TGTCGCATAACTACCAAAGTTTCTGCCCACAATGCAGTGCCAAGTGGGATTGTACTTCTT
GTCAAACCCCTTCTTGATGTGGCCGCTGCAAGGGGAAGCCAGCCCCTAGCACATCATCAC
GGGTCCAGTAGGTACAATTGTACAGCAGTAATAAGTAAAGATTATAGTAAGGTCTTAGAG
AGCATGAGAGATAAAGATACTGAAATAATGGAGTCAGACACATTTCATGGTAGCACTCAG
CCCCGCTTGGTGGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCCCCCACAGGCCAGCAATGTCCTCCTCTATGTTGTATTTCTCTAGCACCATG
AGTAGCACACTCCATTGCGTCCTGTTGCATCTCCTCGACATGTCCACATTTCTGATCACA
GCCTTTCGGTCGCACATGGTTACCGTGAAGCGCGGACTAGCCGACTGCCCCAGTCCTTGG
GGGAGGGGGTTAGAGTAGCTCAAACACAGCGAAAACCCATTGCTACCCAAAGCCGTGGGA
CATCTCGCTCCGATTTTTTTAACCAGTCATCATTGTGCTATTTTGTGTGTGTGTGCTATT
TCTTTTTTGTTTTGTTTTTCTAGTTGATAATTTTTTAAAATCGTTTTATTAGGGGCTCAT
AAAACTCTTTTATCACAATCCATACATACATCAATTGTGTAAAGCATTCATTGCCCTCAT
CATTCTCAAAACTTTTGCTCTCCACATAAGCCCCTGGCATCAGCTCCTCATTTTTCCCTC
TCCCTGCTCCCCTCTCCCTCATGAACCCCTGATAATTTTTTTGTGCTATTTCTTTGGCGT
TTTCTCAGAACACTCTTTGGTCTCTTTCTCTGCAAAGTCTTGTCTCATTGACTTGGTATT
TTGTGTGCTTTATTTGTTGATTGACGCTCCCCTTCTGGCTTCGTCAAACTCTAGTGTCCC
AGGTTTCTTCTTTAAGTAACTGTTTAGCATGAATTAGTTTTTATTAATTCACTTCTGAAA
TTCATATTTTTGGTAAGATTGGCTTCTGACTGGTTTCTCGTTTGCTTTTTGTCTGCTTAG
CATTGATCTCGTAGCCTTGTTCCAGAAGCCTGCTCCGTCCAGCCAAGCCTCAGAAGCCAA
CTCCTTTGAATCTTCCCAGCAGCAGGGTTTCAGCCAAGCCCTTGTCTTCACAAATTCTCA
ACACAACAATCAGATGGCACCAGGGACTGGCAGCTCCTCTGCTGTCAGATCCTATTCTCC
TCAGAGTCTGGTAACTCACTTTGATTTTAGTACAAGACTTTAAGGAATGTTCCCACCGGC
AAATGTGTTCTAGAAATGGATTCACTTCTTATAATTATTTTCTAAACGTAAAAATTTTTA
CTGTAAATTGTCAGTCCAGAAAACAATGATGTGGCAATTTCCAAGCACATATCTGATGAT
TTCATGTGGAATCAACTACTCTGAGTTTCCTGGACAAAGATAAAAATAGCTCTTTTTTTA
TGATTGGCTGTGTTCTCTTCAGTCATGATCATTTAGTCAGATTGAAGTTATCCTTATTAT
TAATGATTGCTTGTGGGGATTTGTTTCCCTGCCTGGCACTGGGCTTAAGATGATAGAATT
TTTATGTTTTCCTAAATACAAATGTTTGCCAGTATTGGCTTACCTCTAAAATATCTAAAG
TTTGTTCTTTTCAAGTCTGCCAAGATGCTTATGTGTTTTGCATTTTTATTTCTTCTTTGC
TCTACTATAAAATACAGCTACAAAAATGCCAAACTATGTAGTAGCGGGCTCCGGAGTTTG
GGAGTATTTCCATGGAAATAGCCTCCTCAGTGCTAGGTGCCCGACTAGACTTTCTATGAG
AGTGATTAGTGAAGCATGAGAGAGCAGGCTGGCGGGAGCATGTGGGAAAATATGGCTGGA
GGCCAGTGAACTGAAGTGCTTACCCTGCTGGCGGATGTGGTGGGGAAGTGGAAGGGCTTG
AATGGACTGTGCCCCACTGGCCTGCCTAGAGCGCTCACTAGTGATTACTGTCTGGTTCAG
TTTTTCTTGTGCTTTCCCTTGCGCTCTACTCTGGGGAAACAGAATTTAAGAATTTGATGT
AATCTTTCTCCCCTGCTTGACTGAAAGACTCATTAGCTGCCCCCTAATAAAAGGAAGGAT
TGATTCAATTGGTCACCTTTTCATTGCTATCGATCTTCGACTTTGTATAGTGAGTTCGTA
TTGCTGGCTTGTAAGTTAGCATTTTTAGTGTCGCTGGTGACCTTGCATCAGATGGTGCTA
ATGATTGCAGTGGGAAAGGCCGAGGCATGATGCCATCTGTTTTGATAAGGCTTCAATAAT
CGCCCCCCTGCCACCCAAGTGTTTTCCTGAGTCATCCATGTCCTTCCCTCCATTTCCTTT
CCTTTTTCTGCGACAGTCGTGATGCAGTGTCCATGGTGGAATCTCCATTAGGCCCCTGAA
ATCATAGGTCACTTTTATAATGACCTTCAGGTGTGTTGCTTACCTCAGGACCAACACTCT
TTGAGGAACAACAACGCTTTGAGGAAGCAGAGTAAGAAGTGACTCCATTTTTTGCCAAGC
AATAGACAGGGCTCTGGGGTGAACAGTAACACCAGAGAGGTGTGTACTCCTTAGAACACC
CAAACATAATCTACCAGAGGGGCAGCATTTGCCCAGGGCTAAAGCTCAGAAGGCAAGAAA
GGGTGGGAAGGAAGGCAGAAAGGCAGTGGATATGACTGACAGGCACAGGGAGGAAACAGG
AGGCGGGCCAGTACATTTGTGAGGATAACAGCCAGTGTCATAAAGCATAATGTGTATGGA
TTGTTGATTGGAAAAAAAAACAGTTGTCCTGTAAACTTTTACCCAATTCACAAGAACTGC
GCTGAGATAAACATAATAAAAAACAAGCAAAAAAACCCCCTTAATTTTCTAGATTTGGTC
TTTTAGGAGAATGTAAAGTGTATTTGTTTTTGATGGCTTTTAAAAAGGAGCCCTGGTAGC
ACAGGGGGATTATGTGTTGGGTTGGCAACCACAAGGTCAGCAGGTGGAAACCACCCGCTT
CTCCTCGGGAGAAAGATGAGACTTTCCACTCCAGTACAGAGTTATAGTCTTGGAAACCCA
CAAGAGAGGTTCTGCTCTGCCCTACCGGGGCTGTTAGTTGGAATCGGCTTAATGGCGGTG
AGTTTGTTTTGAGTTTGGTGATGTCTAATTGTGTAGTCGATCTGCCACTGCCATAAACTT
CCCCTGGATCCTGCTTTTTGTCCTGATGGTGTAGGTAGGAGAGATGTAGCACTGTCGTTT
GTGTACTTATTTATGGAGCATACGTGGTGTTTGTACTGGTCTAAACAACTTGAAATAGGA
ACACTATCCGGGAATCTGCTCAACATCAAATACTTGTCTGTTTCCATGTCTGATTTTGGA
ATATTAGTTGTTAATTAACTTAGTGCTGTGACCAGCATGTGATCTTGCAGGGTGAGCTAG
TTCATGGTTGATATCTTTGATGACCAAACCTGTCATTTTCTTTAAAAATGACTCTTGGTC
CATAGATTAAGAACAGCGTTTGATTGTATGTGTCAGGCATGCATTTGTCATTTAATACAG
AGTATCTCTTTAGTTGAAAAAAAGTGGTATTTTGATTGTGGACTTGTGACATCAGCTTTT
TTTTTCTTTTAAAATTAATTTCTTGAAAGCATTGTAAAAATATTCTCATCAGAATTAGAA
GAGAGTGCAGTTATTGTTGCATGGTAACATTATAATGTAATATTTTCTTTTCTTTTCTTT
TTTTAAACATTTTATTAGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAACT
GTGTAAAGCGCATTTGTACATCGTTTCTCAAAACATTTTCTCTCCACTTAAACCCCCAAC
ACCAGGTCCTCATTTTCCCCCTCCCTGTAATATTTTCTTAAGTGGCTCTAGGTAAATGTG
ATACTCTGGCTCTTACAAGGGAGGAGGCACAAAAAGTCCATGGAAAAATCTCATTATCTT
CCAATTCTATTTTTTCATGAAGTTTAGAAGCCCTTTTCATAGTATTGAAAATTAATGGTG
TATTTGAAAGCTGGCGTTGGAACTTCTGTGTGGCTGAAAGCGTCTCTTTTCCTTTCCTTT
CAAAGTCGTCTGTCCTTGGTTCCGGGTTTGGAGAGCTAGCACCTTCCAAAATGGCCAACA
TCACCAGCTCCCAGATTCTGGACCAGTTGAAAACGCCAAGCTTGGGCCAGTTTACCACCC
AGAGTTCACAGCAGAATAGTACGAGTCCCCCAACAACTTCTTGGGACCTCAAGCCCACAG
CATCTCAGTCCTCAGTCCTCAGTCATTTTGGTACGTATGCCTCTTGTGTGCTGTTTCCTC
CTCAGGAGCAGAGCCTGCTGACTTGTGAATGCTAGTGGGGAGCTTTTTAGTTTAGTATAC
GTGCTGCACCATTTCTGAATTAAACTAAGTTGGTCAGCTCTTTATTGTGCACATTGCTCC
ATTCATCCATGTATCTTTCTTGGTAAGCCTTTAGGAGATGGGCAAAGGCTTGGTAGACGT
AGGCAGATGCAAGAGAGTAACATTGAGTAAATTCATAAACAGGATTTTCTGAACTCCACT
AGATTCAGATGGTGGCAGAACATGGAGTGTGGACAGCCTTTTAACCTTCACTCTCTATGT
TGCTTTCTCATTCTCAAATCCCCATATATCCACCAAGATTTGGCTAGCCAGCCTGTACTT
ACTGTGGTTTGTATTATTAAGACATCATGTGTAAGTTGAGTGTTTTCTAAACTATACTCT
TAGAGAAATTGTGGCTTGAATCCTCATTCCATAGTAGGACACACAACCACCTTGTATGAT
GGAATATCGGTGGGCTTCTGTAACCATATGGAAAGCTATCTGGGTTGGTCTGTGTCTAGA
GAGCAGAAGGAGAGGAAAATGAATTTCTCCGCTCGGTGAGATGCCTTACCCTGTTGGAGG
TCCTCAGACCACCACTAGGTTTGATGTGTTGTCTACTAAGGAAGTGCATTAGCTCGGTGC
CTAAGGGTTTTGGCGGGTCTGGTTACAGAGCCAAGGAGCACTGGTGGTGCACTGGTGTAG
TGCTTGACGACTAACTGAGAGTGGGGTGGTTTGAACCCACCAGTGTCCTCCTGGGTAACA
AGACCTGATATGGTGCTCTGCACCCATAAAGATGACAGTCCAGGAATCTGTTCTGTAGGA
CCTTCTCGAGTCAGAAGTGACTCATTGGCGCAGGGCAACAGCAGCAAAACAAGTGCTCTT
GGCCATGCACTACCCAAAATTCCAGATTCCAGAGAGAAAGCAGGCGTTCAGTTTTCATGC
TACACTGGTTGCAGAAACATTGTAGGCATCGTGAACTACTCTGAGCACTTCGGGTATTGG
AAACCTTCCCACAGTCCAGGTTCCCACCCAGGCATCCCTCAAGAGTCAACCTTGCAAGCA
GGCCTTTCTAAACGGAGCTCAGTCTCAGGCCTCCCGTGTTCTGGTTCTTTTTTGCAGATT
CACTAAGAAGTAATACATGAACATACCAGTTGCATTTTGTTTATGAAGTCTCTTTTTCTG
GTTCATGCCTCTAAAATTAAGTTAAAAAATAATTTCATTTTAGATAGAAATATATCCAAC
CCTGAACTGACAAACCACAGACCTTGAACTGGATAGGCCCCCTATTTAGGTGATGAAGTT
GAATTGGCATGCAGCCTTTCTGTATGGACTGTGAATAGTTTCACACAGCAACGACAGGCC
TTCGAAGCCTTCTGTATTTACCTTCTGCTCTCTCTGTACAGAGCAAGATTGCTGGCTCTG
TCCATGGGAACAAGACAATTTATTCAATAAATGATGGTTATAACTGGCTATTTATTTGTA
AGGTAAAGTTGGATTCCTGTCTCCCACTGGAAACCAGAGTGCCAAATGAATCAAATATTT
AAACATAACGAATCAAGAACACAGTGGGGTGGGGAGGACACGGGAAATGTTAAGTAATCT
TTGAGACAGGTATTTCTAGATTTGCGAGAAAGCACCATAACCAAACTGAAAGTCAGATCA
TCATTGAACAACATGTTTGAAAACATCATAGACAAAGGACTGCTTTTTTTTTTAACATGA
AAAAGAATTACTGAAAATAAATGAGCAGAGTTATGGACACAATAGGAAAAGACCACTAAA
GGATATGAAATAAGATGTTATTGAACGTGGATACTTTTTATGTACATTTATTCTCTATCA
TGTTCCACCAATCAGACTAAGAGAGATAAATGTTTGGTATTTGAGTGTGTTAAGGAGGTG
TGCTCCCTTATGGAAAGCAGTTTTGCAATGGTTCTGAAAGTTTACATACATTTACCTTTG
GGACCAGGAACTCTAGGAATGCTCAGGGACACTTGCACTGGAGTCAAACGCCGTCCAGAC
AGACTCGGGAGCCTGTGCAAGATTGCTGGCTCTGCTGCACTTCTGGACCTTCTCCTTCTG
ACACTGTGGACTCTGACCACTGTCCTGTAGGTCCTGTGAGTGGAAAGTACTTGGCTTTTC
CTTCTGGCAGGCCCCTGCTTACACAGATTCTGCCTTTCCCAGGTTTTACAGTGTATTCAT
GGTAGCAATGTTTTTAATACCAAAGATCGGAAAGCCTAAAAGTTTGTTAATGTGGTACTG
GTTGTGTGAAACACAGTCCATGTATGCTGGCTTGCTGTGCGGTCATAACATGAGTGCACT
AGCTCTTCATCCTATATGGATATGAAACATAGGGTTGTCTTGAAAATTAGTTGTCTTATG
AGAAATGCAAGGTGTAGGACAGTATATAGTATTATGAGGGAAATAAGCATTAAAATTTAA
AACAAGTGTGCAGACATAAGACATCTAGGCTTACCCAATCCCATTGCCACTGAGTCGATC
CTTTAGTACAAAGTAGAAGTGCTGGGTTTTCCGAGACTGCCAACTTTATGGGGGCAGACT
GGCTCATCTTTTTCCCAGGGAGTGACTGGTAGATTCGATCCATTGATCTTTCAGTTAGCT
ACCCAATGCCAGGTATCTAGGTATCCTAAGTATGTATGTCATAAAGTATGTCAGAGATAC
TTCCTTAGTCGAGGACTGTGGAGCAAGTCTCTGTGGAGCAAATCTGGAGGCTTGTGATAG
AAGGGGGAGGTTTCTCTTCATCATACACTGTCCTATATCTTGAATTTTGGACCATGACAT
ATGTTCCTATGTAAAACAAACAAAAAAAGTAATTTTTTAAATTAAGTACAGTTCTGTAAA
ACAAAGAATAATATTTCTGTTGGCGAAAGGCTAGGCATGTGTAGCAGCACCTCGGCACTG
GTCTTATCCACCTGCATGTTTTACTGTAAACTGTTTTCAATGTTGATTTTAGACACAGCC
TATTCCTTCCCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNATTGGGAAGTCTCAGCCCAAGGGTGATTTTCCATCTAGCTCAAGTTGCAGGT
TCAATCTCATAAACAGTGATGCTGTGTTTTGGTCCCTCAGGCTTGCCCGTAGGGCCCTGT
GCCTGGTGAGCACAGGTGTTTGTTTGGCTCTGCAGGAGGCCTATGGGACTGAAAATCCCT
GACCTTTCTTCCTAACACTTTGGCTCTGCTTTCAGATCCCAGCTTCTGCTGTGGAAATGC
CTGGTTCTGCAGATGTCACGGGATTGAATGTTCAGTTCGGCGCCCTGGAATTTGGATCAG
AACCCTCTCTCTCTGAATTTGGATCAGCTCCAAGCAGTGAAAATAGCAATCAAATTCCCA
TTAGTTTGTATTCAAAGTCTTTAAGGTACACAACTTTTTGATCCTCTTGCTTTGACTGAA
TTAAATGTTTTTCTTTGTTTGTTTGCAAAGCAAAACCAACATGGAGGCCAAGAAATGACT
CTTTGGAGAAATACATTCTATGGCAATAGGTTTCTACAACCCTCACCTTTCTCTGATTCC
CGAATTTTCCCATTGCCCCAGAAGGAAACTTTATAGCAATTATTAGGTCCTCTGCATTTT
CCCAGACCTTGGCAGCGAATAATTTCCTTTCTTCTTCTTGATTTGCTTATTGTGGACAAT
TTTTTTTCCTTTTTAATATCATTTTATTGGGGGCTCATACAACTCATCACAATCCATTAT
GTCAATCACATTTGTACATTTGTTGCCATCATCATTCTCAAAACATTTTCTTTCTACTTG
AGCCCTTGGTATCAGCTCCTCATTTTACTCCCTCCCTCCCCGCCACCCCTCCCTCAGGAG
CCCTTGATAATTTATATATTATTTTGTCATGTCTTACACTGTGTGGACAATTTCTATGAT
GGAAGTAGAACTCTTCACTTAGCGTAGTGTTCTCAAAGTTTACCCATGTTGTAGCATGCA
GAGTCCCCCACATGAGTGGATTTAACCAACCAATACATTTCTCACAGTTCAGCACGTGAT
TGGGTGAGGGCATGCCATTTCTGTCAGCTGGGGGGGGGGGGGGGGGGGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTCTAATTGTCTTGCCT
GTCATGTTTTATTTTTAACATAGATTTATTGGCATATAATTCACATGTACAATTTAATAG
TTCATTCATATTAAGAAGAGTTATACATTCATCACCACAATCAATTTCAGAACAGTTTCT
TCTTCCTTTTAGTTATTATTGTTAGTTCTCCATTTCCACACAACCTCCTCCCTTGCCAGG
TCCCCAGGTAATTGGTGATCCAGTTAGTGTCCATAGATTTGCCTATCCTGGATTTCATGT
ACAGAATCCAATCCAAGAAACAAAAAAACCAGCAACAATGACCAAACAAAACAAAGGGAA
ACTTTTACAAAAGAAAGAAAAACTGAACCAACTTTGAAATGGGTCAAAGGGGAGAGCATA
TGAAAAGTTGTTAAATTTTAACCTAATTACCTCTGTCATAATGGGCTTTACAGCAAGCTA
ATTCAGTCTTAATCCACGCCGGACCCTGCAATGGATTTTGGAGCCTTCTGCAGAGCAAGT
GCTCAGGACACCGTTCCCTTCTCCAGATTTGAATTGTATTATCTTTCAGGTCTTGGGTCA
CACAGGCTGGCGTGCTTCATCTCTGTGGACTTAGTTGACTCCTCACTTGGCTGACATATT
TTATTGAAGTGATTGCCAGTAAGAAGTTAACTCGGTTCTGGCTTGGGGAAGATTTGGGCG
CTGGACTTTGATATGGATGGACAGACAGGGTAGGCTCTGTTTTGAGGGATGGGGACTCTT
ATTTCAGACCCTTTAGGTCTTTACCATTAACGGTGTTTAGTTTTCCTAGGGAACAGTCTT
TAGTCTCTTTCCCACAGGGCAAAATGCTATTCTCTGAGAGCCTAATGGGAGAGAGCAACT
GGGGTTATAACATTAATTTTGTCATCATAACTTAATCCATCTATTGATATTTTGTTTCCT
TTTTATCTTTTTAAAGAAAACCACCTTTTTTTAATTAGTTGGGATTTAATACATATAACA
TCCTTCCATATTACAATCACTTCAAGTAGAATTGTACAATTGCTTTCTCAATCAGTTTCC
AACCATTTTATTTCTACATGACTCCTTGACATCGTCTCCCTTTTACCCCACCTCCACAAC
AGTACTCCCCCGTGCCCCCCACCCTCCCCAAAACCCTTATTTGCTATCCCTATAGGTTTA
TCAGTCCTGGGTTTCATATAGTGAAAAACAGAAAAGCATATAACAGCTTCAAGAGGGTGT
CCTCCATTGACATGACACCTCTGAGATACACTCTATTATGAACGAACAAAAACCAAACAA
AACAATACAAACCAAAAATACAGAAAATTCTGGAAACCAGGTCAAGTCTAAGCCTGCATC
ACGGGGGTCTACGTACAGCGCTTTAACTGTTCAGGTTAGATTTATGCAACTGATCTTCTA
TACTCCTCTCTCTCAAGTACTCTGCTTAGTGACCACTTTCCTCCCAGCCCTCAGTTTTAG
ATAGGGGTAGTTCTCTGTAGGCTTACTTACTATCCTTTTTTAAAACTGTACCCGTGACCC
AGTGTTATTTTTAGTTTCAAACCTGCAGGAGGAGCGTGCCCTGTGTTGGGAGGGGGAGGG
GGGACTGGGGAGAGCGGACTTTAAGCAAACCCTCCAACTTGGAGCTCCACCTCTACTCTT
ACTTCCAAGTCATCTGTTAGGGTAATGAGTTGCTTAGCGTAGTTCTCCCTTATAACTCGG
GCTCTGTGCTGTTTCCCGCACGGCCGGGTTTGGATTCGGCTTTCTTGTATCACTAGGGCA
GTTACCATCATTGGTATGCTTTCCAGTCTGACATGTTTGTGACTGCCACTTTTTTCAACT
ATTACTTGTCTTTCTGGGTTTGCAGTGTTTTGTTTTTTAAAGCCACGTGTTCTTTTTATT
TATTTATTCATTTCAAAAATCTATCTATCTATTTATTTATTTATTTTTTAGCATTTTATT
AGGGGCTCATACAACTGTTATCCCAATCCATACACACATCAATTGTGTAAAGCGCATTTG
TACATCATTCTCAAAACATTTTCTCTCCACTTAAACCCCCGACATTAGGTCTTCATTTTT
CCCCTCCCTTCCCGCTCCCCCGTCCCTCATGAGCCCTTGATAGTTTATAAATGGGTATTT
TGTCATATCTTGCCCTGTCCGACGTCTCCCTTCACCCACTTTTCGGTTGTCTGTCCCCCA
GGGAGGAGGTCACACACAGTTCCATGTAATCGGTTCCCTCTTTCCTACCCATTCTCCCTT
TACCCTCCCTGTTTTGCCAATCACACCACTGGTCCTGTAGGGCTCATCCGCCCTGGATTT
CCTGTATTTTCAGTTCCTATCTGTACCAGTGTATCTCCTCTGGTCTAGCCAGACTTGCAA
GATCGAATTTGAGTCATGGTAGTGGGAGCGGGGAGGAAACATTTAGGAACTAGAGGAAAG
TTGTATTTCTCATCATTGTTACATCGCACCCTGACTGGCTCATCTCCTCCCCGAGACCCC
TCTGCAAGGGGATCACGTGTTCTTGATCTATCATCCTTAGTCATAAGTCTATTCCTGTAC
TTGTCATTATAATGTGATTATTTACACTTAATTAACATTAGTAATTAAAATTCTACTGGC
ACACTAGCCAATTTAAATCTTCAGTAACTATATGTGGCTAAAATATGGCATTGTACATAT
AGAGAATATTTCCATTATTGCAGAACATTTTCTTAGTACTTATTTATGCTGTTTTCCCAG
GCTTCAATTCCCGCCTTCCTACCGTCATGCCTGCCGTTGTGCAACTCTGCGAGCACAGTG
CACCCGTCTTGCTGAGCCCACTGGGGCTGCATGGGGCCGGGCTCGCAAGGCCTTCTGATA
CTTCTCTGCTTTGGTCCAACCAGCCTTCTGTCTAGAATTTGCCAACTCCAAATAATGTGG
CCTCTGTGTCACATTAATTTGTTTTTCCATGTGTACTTTAAAATTGATTGTCAAAATGTA
ATCACATCTCCCTAAGGTCTGATGTCTGCTTTTTCCTATTGCCCCTTCCTGTTCTTTCTG
TCTGCTGCCGTTTTGAGGGAACTTCTTTGTGCGTCATGGTCTTTGCTGTTGAGGAAACTT
GATGTCCTGTGTGTATGTAGCGACAGTGAACCCTGGTCTCTATATATTTGAATCCCCTCT
CTTGATCTTAACCTTTTTGGTTATGCCTGCTTCTTTCTAGTGGTTGTCATTTGTCTATTG
TAAGTAATAGCTTGTTTAGCTTAAGGTGCATTATGATAAGTATAACACTTTGAGCAGACA
TTGTGCATGGTTTGGGCTACAGCATGGTCTCTTGTCTCTCGTAGTTTGACACTTGGAAGA
ACAGAATGTGATTTGTTTGTTTTTCTTTCTGAGCCATGTTCCCCTCATCTCAGGACAGAT
TCATGGGTGGAGGGTGGCCTTGAGCCAGGCTATCTCCTGTGTGAAATGTATGAATGTCAT
TCAACTGCTGGTTTTTTAGCCTGTACTCTCTTAGGCTCTGCCACGCTGCCTCACCTGCTC
GTCACTCTCCAGTTCAAAGGAGCTATGTTTTCAAGTAATCTCTCTCTCTCTCTCTCTCTT
TCAGAACCATTTTACTAGTGATGTAAAATATGATCGTTTCTGGAAAACATCTTAGTTTTA
CTTTTGGAAATTCTCTTGTATAAGTTTTACTCAGGAGACAGTTGTAATATGAGACCCCAA
AAAAGCGCAATAAACCTTACTAAGTTCTTTGAATACTTTCATTTTTCCAAATTTGTCTTG
GCACTTGCTGTCTCATTGCTTTCTGTGATGTAGGCCTTATGTTGTGTCTCCATTACTTCT
CTGAGTATTCATCTCTGCTTTTAAAAGAAAGTCAGCTCCTTGAAAATTATTAAGAAATTG
TTGTATTTCTCCTCCTTTTCTTAAAAAAATACAAGAGGCAGCTTGCGCTTTTGAGTATCA
TTTGTGTTTTGTGGTTTACTTACTTTCTTCTTTTCTGTTCCTTATAGACTGGACCTGGTG
GTGGCCGAGGGCAGCAGACTCTAGACAGTAAGTACATAAGCTGACAGCTGGTGTGGCCTG
CGGAGGCCAAAGAAAGCGAGCATAGCTAATGAGATGTGGAAAGACAATTGTCCAGTGCCC
AGTTCTGCAGCAATAGCGGTTTTACGTTTTTCTCCTGGTAACTGCTTCTAACCCATCATC
AGAACAGAGAGAAGTCAGATTCATTGGTAACAGGAAACCAACTCTTGTTTTTCTGACTAG
ATTCCTGGGTGACAGGTATGATTAGAAATGCCGTAGCCATAGTAAGGAGAGGTGATGGTC
TTGCAGTCATGTCCCTTAGTCTGACTGCAGCCTAAACCTAATGTGTAGTTTGGGTTTAAA
AGACACTTGGCTCAGAGGCAGTTTCTAAGATGGTGGAAAGACTTCTTAGGGGAAAATTGG
TGTACTAGTTCAGGAAAGATGTGCTCACTGCTTTCAGTATCTGAAGGGCTATTGCTGGGA
AGATAGAGACAGTGTTTGCTCTGGGCGCTAATGGAAAAAAGAGGCACCCCTGCTTCCTCC
CCCCTTCCAGCCCATTTTGTAGTGCCTCACTCGACTCCATGCTCACTGGAGGCGGTGCAG
GGGAACCTCTAAGCTGTTTCCTAGGGTTGGGCTAGCCTGTGTGTGGTAGTTTATGTTGTT
TAGATTTTCTTTCAGCAAGACAGACAGGTATCCGCTGATGGTGTTGATGGTACTCCTGGG
TTTCCCAGGGCTGCTTGGAGTGACTGCCTGGCTGGAGGCTCAAGCACAAACAGTTGCCCC
ATATTGTGTGGGTATTTCATAGGAGACCGGAAGCTGTGGGCCACCTAGAAAGCGTGGCAT
ACATTGAGATAGGTTGTCCATCCGTTTTTCTTCCATGCCGTCTTCTCTGAGAAGCTTGCT
TTTAATCTGTTAGGAACGCGAATCACAAGGGAAAGTCACTTTTGGTCTCTGAGATATGAG
GCAGGACGCCTGTGGGGTCCTCATCTGGGTCCTTTCAGAACAGGTTTAATCTCTGGAATA
CATGTTCAGTGAAAAGAAGACCCCACGAATGTGAAGTCCATTGTAAGAGCTGATTTTGTT
GTGACACGAGCAAATCAGTGGCTTCTAGAGGAGAGAACAGGTCCTAGTTGAGGGGCAGAG
GCTGATTCTCCTTAACCCGGAAAGACAGTGATGTTGTATTTCCAAGCACATAGCTGAGCT
GTATGTGTGGACAACCTAAAACTGAGTCTTTTCCATGTGAGAAGTGATTGCTTCTTTGGC
CCTTCTGAGATCAGCAGCGCTGCTTACATGCCCTGAGGTGCTTCTGGAAGCACAGACCAT
GGAGTCTCACTGTTTGCAAATCGATGCTGGCCACAGGCACATGCTCTTTTTGCAGCTTTT
AGCATGTGACTATTTCCACAGCATCCAGAACTCTGCATAGTCAACCCTCACCTGCCCTAG
GCGGTGTCAGCTGGTTTGATAAATGCAAAGACCTTTGAGTAGTCTGCCCACCAGGTCTTC
ATTATGCCTTGCCTATGCTTTGTAAGAAAAAATTTCCTTGTCTTATAATTACATATTGTT
TTTAGAGCCTCTCCCCTTTCCTGGTGCCGCTAAAAGGCATATTCCTTTGGATGATAGAAG
GCTTCTCATTAGACAGCACTTCGGCTGATGGGTATCAAGGTGTCGTTTTCCCATTCTTTG
CCCAAGCCCTGCCTGTCTCGCCGCCGAAGGGCGTTGTGATTGATGACTGCGAAGCGCTCA
TTGGTACATTTGTAGGCTTTTCTCTGGGGAATATGACTTGCAACTGAGCCTGACATGTCA
TTGGAGTCTGAGTGGATTTCAGACACTCAGCATTGGCTCTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTAGTGATCGCTTTTGTCTTCTAGCTCTCTCTCCAGCCAT
CAGAGCAGCCTCTCCTCTGCGCACGCTGCACTGCCGTCCCAGCACGTCACACGCAGTGAG
TGTCCTCAGGGCCCCGGCCCCCCCACCCGGCTCAGTGAGCTTAGAGCTCAGACACAGGCG
GGTTGGCTTTACACAGCTGACACACATGCAGGAGCTACTTGCCTGAGAGGCCTTGATCTA
GTCACGCAAGTTGAGCTACTGGTTTCCCAGGCAGTCTGGAGTGCATTTTGCTCCCCGGGT
AGGGGGCTTTCCTAAAGAAAGCGTTTCTTTGGACCTGTGTTGTCCTCGGCAGGACTGTCA
GGTGGTGGACTTACACTTAAGAATCTGCTGAGCTCTCTCTGGTCATTATGTGAGACTTTT
CTACCTAGCGGGCTAAAAACGTTGAGGTTTTATGTAAGGCATTTTAGCTTGGGCTCCACT
AAGAATCTAATTAAGTGCATGGTTCCTGGTAGTCACTCTGTGAAGGCCATTGGAAAGGGG
AAAGAGAACATACAAAGAAGTGGCCTTCCTTTGCTGTGGGCATATGCATGTACAGCTCCC
TGAGAGTCCGCCATGGCCCGAGCCAGCCAGTGTCAGTGCCTTCTCATTTGTTGGTTCTCC
TGGGCTGTAGCTCATGCCATCTCTCACCTCTGAGCCCAGAGATTTGGGAAGGCTGACACT
GAAGAAGAGAGCCTGGAAGTAGAAAGGGAAGGAGCCAGAGACTGCCGTTCAAGAAGCGAG
TCCCAGTGGTAGGAGTAAGCCGAGGTGTGACTTAGTCAAGTGCGGCTTATGGAATCGTGA
TTGGGAGCGTACGGTCAGGGTCAGGAGTAGCTGATCATGAAGAGGCAGGGGAGGGGCATG
GTGTCCAGCTGAAAGGTGCGAGAGCCTTGAGCGTCAGCACAGGTCGAAAGGAAGGTGCCT
GGAGAAAACAACCGTCCGAGCTCTTGTGAGTGTGGCTGGGTCCTCCAGCGGTGGGTGGAG
GGTGGTTCAAATGGATATTCGTGGGAGAGGGCAGGAAATTAGAGACCATTTTCTCTGATG
GGATCATGTCATTTATAGGGACACAACAGGAGGGGACCAGTCCTATCTCTTCCTTCAATA
TCTGGCTAACTTTTACTTTCTCCATTTTTCTAAGTGAAATCTCATAAATAATCCTGTATT
ATAAAACAAACATAGCTTTCTTCTAAGTAAAGTCGAGTGTGGGCACCCTCTGCCCTTGCA
ACCCATGCCCACCCACCCACCAGTGCCCTCATTGTGGCCAGTGGAGCTGTGAGCAGCCCT
TTTACCAAGCACCCTACAGCTGACTGGCCACTCCTGCAACATGGGGCTGCAGTCCAGTTT
CTCAGCAAGATATTCCAAATTGTACAGCCTGTTCTCCACAGCCAGCTGCCATCCAGCCCA
GTGAGGCCCACGCCCTGCCTGTGTGACAGAAGGGCCACCTGCTAACATAATTACACAGAC
CTGGAAACACTTCTTGTCTCTCAGCTGTTTCCCTCACCTGTTGTCTTGAATCCTCGGATG
TCATTTTTAAACCATATAGAAACATGAGCACACAAAAAANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATAATATCTATAGATGCA
GAAAAAGCATTTGACAACTGTGTTAGACAGGGTTCTCTAGAGAGATAAAACCAAATTGCT
GATAATTTAATATATTTATTTATAAAGATAATTAGATATATAACACAAGAAATGAACTGT
TAAATTATATACAGATAGAAATATAATACAAGAAATGAACAGTTAAGTTATAAAGCAGTA
CAAATGGCTCAGTGCAACTCACTCCCATGAGAGAGTTGTGAGACACTAGCAGTCTTTTCA
GACTAGTCTCCTGCCAGGTCTTCCTCTATATAGAGAGAGAGCTAGCCTATCTCAGCACAG
CAGCCAATCACAAGGCAGGTCACCAACTGTCAGCCAGGTCATCAACCACCAGTCCCCAGC
TCCAGAGATGTCTTAAAGGGACCTCAACTTACAGCGACACAGTTCACAGGCTAGGCGTCC
CACAGGTAGTGTAGCCTGTAAATTGAGGCACAGAACAAGCAAGGCAGCCACACACTGCTC
TGATGATCAAAGAGCGAGAAACAAGAAAGGCGAGGCTCACCAAGCCATTTATCTCTCTGC
CCTTCAGTTAATCCCACTTGTGTTTATCTGCCAGGCTGGCACAATAAACTATCTCAACAA
CATCCAGCACCCATTCCTAATTAAGACGCTCAGGAGGATAGGAATGGAAGGGAAGTTCCT
CAAGTTAATACAAACTATCTAAGAAAAGCCGACAGCTAATATCATAGTCAATGGAGAAAA
GACTAAATCAATCCCACTGAAAAAGGGGACTAGACAAGGATGTCCCTTGTCCCCACTTCT
ATTCAGTATGGTATTGGAAGTCCTAGCTAATGACATGACAACGGAAGGACATCAAAGGTA
TCCAACTGGGAGAAGAGGAGGTGAAATAATTGATATTTGCAGATGGCATGATTCTGTACA
TTGAAAATCCCAAAAGCGCCACAAATGGACTACTGACAGCGATAGAGGAATATGGAAGAG
TCGCAGGATACAAGATCAACAAACAGAAGTCGATTGGGTTTGCTATATACATCGGGCAAG
ACCACGGAAGAGGAGATCAGGAAGGCAGTACCATTTACAATAGCCAAGAACTAACTGAAA
TATCTAAGGGTATATTCTAACAACAACAAAAAAAAAGACCTATACAAGGAAANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAGTGGGGTCCCCATGGAGAATTCCTGAAGAGAGAGAGCT
ACCAGGCTGGCACCCATCAAGAAGCCCAGACCTGACCCCTCACTGAAAGTGGGTTTAACA
GGGAGCAGGTTGGGGGAGAAGGCCCCAGCCTGCCACATCCGCCATGAGGCAAGGCCAGGA
GGGAGGAAGAGAAAGAGAGTTGGACTGGGCCCCCACGCTGGCACAGGATGCTCAGAGGAT
GCTGTCCCTGATGGGAGCTAATGGGACACAGAGGGGACTGGGCATACAACAACAGCACGT
ACCACGCTGTCCCCTAACTTGAGCAGTCTGCGACAGAGGTCATTTCGGAGGTCATATGGT
GGGGAAGCAGAGTGGTGTGAACCCCCCAAAATGGAGTGAATCAAGAAGGGAACATACAAT
CTGGAGTAGAAAGCAACCGGTTTCACTGTTCGGGAAGAAAAGGGAGAGGGAGAGTTGGGT
GGGGGGAAGGAAGTGGTGTTAACAAACTCAGGGATAAGGGAACAACAAGTGGTCCAAAAA
ACAGTGGAGAGGGTGTAGGAGGCCTGGTAGGGCTTGAGCAAAGGTAATGTAACAAAAGAA
ATGCTAAAACCCAAATGAATGCTGAGCATGATGTGGGACAAGAGAAAAGTAAAAGGAAAT
AGAGGAAAGAACTAGGAGACAAAGGGCATTTATAGAGGTCTAAATATAGCCATGTGCATA
TGTAAATACATTTATTTATGATGAGGAAACAAATCGATGTGCATATATTTATAGGTTTAG
TACTAAGGCAGCAGATGGGCATTGAGCCTCCACTCAAGTACTCCCTCAATGCAAGAACAC
TTGTTCTATTAAACTGGCATTCCATGATGCTCACCTTTCTGACATGATCACTGAAGACAA
ATGGGTGCATAAGCAAATGTGAAGAAAGCTCAGGGTGCCCAGCTATTAAAACATATACTG
TCTGGGGTCTTAAAGGCTTGAAGATAAACAAGCAGCCATCCTGCTGAGAAGCAACCAAGT
CCACAGAGAAGAAGCACACCAGCCTCTGTGATCATGAGGTGTCAAAGGGATCAGGTTTCA
GCCATCAAAGAAGGAAAAATCATATCGTGTGCTCTCCTTCCTGATATGATTGCTAAGGAC
TAATAGGGGCATAAGCAAGTGTGAAGAAAGCTGATGGTGCCCAGCTATCAAAAGATATAG
CATCTGGGGTCTTAAAGGCTTGAAGATAAACAAGCGGCCATCTAGTTGAGAAGCAACCAA
ACCGACACAGAAGGAGCACACCAGTCTGTGTGATCACGAGGTGTCGAAGGGATCCAGGTA
TCAAGCATCAAGGAACAAAAATCGCATCATTGTGAATGAGGGGGAGTGCAGAGTGGAGAC
CCAAAGGCCATTTGTGGGCAACTGGACATCCCCTTACAGAAAGATCTCGGGGAGGAGACG
AGCTGGTCATGGGACAGTATAACAATGATGAAACATACAATTTTCCTCTAGTTCTTAAAT
GCTTCCTCCCCCCAACAATCATGATCCCAATTCTACCTTACAAATCCAGCTGGACCGGAG
AATGTACATTGGTACAGATGGGAACTGGAAACACAGGGAATACAAAGCAGATGAACCCTT
CAGGTCCAGTGGTGAGAGGGGTGATACTGGGAGGGTGGAGGGAAGGTGGGGTAGAAAGGG
GGAACTAATTACAAGGATATGCATATAACCTCCTCTATGGAGGTCGGTTAACAGAAAAGT
GGGTGAAGGAAGATGTTGGACAGTGTAAGATATGACAAAATAATAATGACTTGTAAATTA
TCAAGGGTTCATGGGGGGAAAGGGAGGGAAGGGAAGAAAAACAGGAGCCGATGCCTGGGG
CTCAAGTGGAAAGCAGATGTTTTGAGAATGACGATGGTAACAAATTTGCAAATGTGGTTA
ACACAAATGTGCACATGTGCTTGGATGTATGTATGTGTGGATTGTGATANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGAGACGTGCCCGTGTTGGAGCACCCAGTGC
GTTGTTTTCCCCACACTGTGCTATGTGAGGCTATTGCCGAGCTCGTCGTCTCTGAAGGCA
AAGCACATGGCAGTCCCTTCGCCTGTGGCCTGGCGTGGAGGCTGGTCCCCGGGTCAGAGA
GCTGTTTCCAATCTCTTCTCTGTGGTGCACCTTGCCCTACCTTGGTGTTTCGCTTTCACC
CACTTTGGCCCTTTGAGGCACCTCGTGATTGCATAGTCAGGCTGCTGACCAGGTCTCGGG
GAGCTCCTTGGGTCCTTTAGGGCTTTCTGCTGGGTGTCATCCTTCCTGTGTAGGTGGCTC
TTGTCAAGCAAGCACAGGTCTAGGCTGCACCTCGTGGGTTGGTAAGGCTGTGATGCTCGT
AAGAGGTCACCAAGTCTTAGTGCCGAAAGCCTCTCTGGCTTCTAGATCAGTGTTGCTGGT
CCGTCTAAGAAGATACTCTAGAGGACTCGGACTTGAACTGGCTGCCCGCCCGTGGCCCAG
GGTTCAGCTCACCGGGACTACTTGCATTTCCGTGAGGTAGATTGTGTTCCGTGGGCAGAT
TGTCTGGATTGACTCTGCCACTGGTTTCCTGGCCGCGTTTCAGATATGAAAGTGTACCAT
CAAGTCACAGAACCCCTTTCTCATAGTGTGGATACTCAGCCGGGTCCCGGTGGTGGGAAA
GGTCTCAGGGGTCCCAGGTGTCTGCCTTGTGTGCTTGCCTCCACTCTGGAGACTACAGGT
CCAGACAGCAGGCCATGCTTTCCTAGCACCCTCCTCCTCCTCCTCCTCCAGTTCCATGTT
TCCTGGCTTTTATCTTGCCAGCATGCCAATGTGGAGAGCACCCCTGCCCTTCAGTCCTCG
GCCACCTTCTCAACAGCAGCAACCTCCGCCTCAAGCGCCACCTCCTCAGGGGCCAGCCTC
CCAGGCAGCATGAATGCAGTGAACAGCCTCTGCCTGGGCGGGGCCGCCGTGAGTGCACCC
AGCAGCAGCGCCAGGGCTGCGCCCTTGGTCACCTCAGGTACATGCTCCAGTGGCCTGGCC
TGCTGCCCTGTGCTGCCCAGAGCAGTGTTACTCTGGCCCTGCCCTTGCTGAGTTGGGTTT
TTGTACCTATTGACCTTCTAGCCTCACAAGGAGGAAGCAAGTGAGAGGTCTGACTCTCAG
GCCGACTCAGGCAGGATCTTGGCAATCTTCAGGTTCTTTGTTCCACAGGCTCTTCTGTCT
GTTTTCTCTTGAGCTGAGAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGCTTTTTCTCTTCCCCACAAAGA
AACTTGGAGGAAGCTTGTGCATGGTGTCCCTGGGCTCCTGCCCAAGACCCCTCCTAGACA
AAATCGTTAAGTACTGCCTGCCTTAGAGGCCAGCAGCTAGACTGCTCAGCCCCCAGAATG
TGGTTGTCTGCACCCCACAGCGTCTGGGAGGGTTTGATGACGTGATGCCAGATTTTCAGG
GTAACCCACGGACCTTAGGGCTTTGTGAGGGAACAGGCGGATGGGCTTGGAAAGAAACTG
CTACGTCAAGGGTTCCACAGCCTTGGCGTCCCAGGTAGAGTGGGCCCATCCCGCTGCTCC
TCCTGCATCCACAGCCCTTGTTGCCCTTTCACTGGTGAAGTCCACTGGCCCAGCTTACGC
GACGCAGAGCCTCTCCGTTGTTCCTCGGGTCTTTGACCAGCAGCTGCCAGTCCTCTCTAC
TTGTAGGTCGCATCCTTTGCCAAGAGGCCCCGTTCAAGGTTTTCTTTACCCTGCACCATC
TTCCTCCTGGTGTTCTGCTCTGAGTCTGAGTGGAATAGATGCTCTGGGTTTTCTGCAGAT
GTGCCCAGAGGTAGGGTGCCAATGACAGTGCCAGAGCCACCCTTGCCAGGGGAGCTGGTC
TGGCTGTGAGCCGGTCCTCTTGGCCTAGGATCGAGCCGTGTTTCTCTCTGCTCAGGGCCC
AGGAGGCCTGTGTCCAAGACTGCCACTTCCCTCCTTCTGCAGAGCCCCCATGGCTTTGAT
GGGTTGTGGCTGCCACGTCTTCTCAGGGGCAGGGTGCACGGTACATGTGGCAAGCTGTTT
AGCCAGGTGAAGGGCGAGTTGCCAGTCTGTGCCAGTCTGGCGAGGCCCCTGAGTTACCCT
GACCATTTTAAAACCTTTTAGCATCCCTTCCCTGCTGACTTGTGTTCAGGTTTGTGTTGT
CCAACCCATTTCTCTCGCTGCGCTTCAGAACCTTCCTACAGGAAAATACAGCAAAACTCT
TAAGCTAGGGGCATTCAGCCTGTAGCCCTATGTAAACTGAATATGAGGCTGGTCAGCCAC
TGTCTTAGTTGGCAAAGGCGCAGGATGGCCAGTCAAACAGGTCACCGGCACAGCTCCTCA
GCCCCGCAGCCTTCTCGGCTAGTCTACTCTCTGTGAGACATTGCTGATAGAGCCTGTCTC
TCTAGATACTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCAGGCC
AGGATCTTTGGCAATCCTTCAGGGTTCCCTGTTTCCACCAGGCTTCTTCTGTTCTGGTTT
TCCTTCTGAAGCTGAGAGGGACATAGTGACCCTGAGAAGCATCTTGGGGATGTTTCTGGG
CAGCTGTGCCTGGCTGTCTAATGACAGTGCACGTTGGCTTTGGGTAGGAACTATAAACAT
CCCCCAACTTTCTCTGTCCTGTGCTGCAGAGCAGGTTGGGTCCTGTGTCCATGTTTACTG
GGTGTAGGCCACCTTGGGATGGTGGAAGCAGTGCTTTTGTCTGGACAAGGCCACTTCCCT
TCATTAGGTCTGTGCCTTTGCAGGCAAAGCGCCCCCCAACCTGCCCCAAGGGGTGCCTCC
GCTGCTGCACAACCAGTACCTCGTGGGCCCTGGAGGACTGCTGCCCGCCTACCCGGTGAG
CGCCCGGTGGAGCTCCTGGCCGGCCCCAGCCCCCCTGGCCTCAGGGGCTGGCACCTGGCA
GGACCTGGTGAGGGGGGCCTTGGGTTGGGCCGGGGGCGCCCACTCTCGGCTATTGCTCTT
CCCCCGACTCCCCTTTTCTCTTCCTCTGGCCCTTGGTACGCCTCTTCCATCTCACACCAC
CAAGGCAGGGCAGACACTGTTCCCTTAGCGCCAGATCCAGGCCCCTCTCCTGGTTCTGTC
CTATGCCCCCACACTGTTGGAGGCTCCCCAGATGGGCCTGGGTACCCCAGAGGGGTGTGG
TGTGGTTCCCAACCTGCTCTTTCTGGTCCGTGTGCAGATTTATGGCTACGACGAGCTCCA
GATGCTGCAGTCACGGCTGCCGATGGTGAGTAGGGGGGCAGGGCAGGAGCAGCCAGACTG
TTGCACATCTCCGATTCTCTCCCAGCCAGGCTCTAGGATACCCACTTTTAGTCCTCTGGT
ACCACCGCTGACATAGCTTCTTCCATTGGGTGGGTGTGACGTGGCATATAGTACCTGGGG
TTCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAAATAATCCAT
ATTCAGGTTGGTCTTTCTGAAGACTCAAGGCTGCCTAACCTGCTCACTTTGGAGAGGCAG
CCAGACCTGTGGGCTGCTCCGTGACTGGACAGTGGACACTGACCAGCACCAGTGCTCTTC
CCTTAGGTGACATCACAAAGTTTGGCCGTGAGAGACTCCGCATCCCCTGCACCCCCCACC
ACGCTAGCTCAGCCACAGCAGAGCCAACCTCAGAGCCACCACACCGCCCAGCAGCCCTTT
CTGAACCCCGCACTGCCCCCCAGCTACAGCTATACTGGCCTCCCCTACTACACCGGCGTG
CCCAGTGCCTTCCAGTACGGGCCCACCATGTTTGTGAGTATTTGCAGGGTCCCCGTCCTC
CCTTTGCTGGGCCAGAACGGTGGTCCTGGCCCACTGAGTCTCCCCGTCATTAGGGAATCT
TGGGCTTGGTGCCACCCTTCCTGTCTGATGTCGGCTCCTACACGAGTTACTCTAGTAGCA
CACAGGTCCCTTTTGCGAGTTTGCCAACTGCTTCCTGAGGCTTAAAGCAAAGGGCACCAG
ATTTGTCGCGCCTCCCCTGGTTCCTACAGGTCCCCCCTGCCTCAGCCAAACAGCATGGAG
TGAACCTCAGCACGCCTACCACGCCTTTCCAGCAGGCAGGCAGTTATGGCCAGCACAGCT
ATGGTGCAGGTGAGGGGCTACCCGCTGGGGTGGGGCCAGGCTCAGCTGGACAAGATGTGC
CTGACAGACAGCCTTCCTGCGTCTGACATGCTAGGTTATGACGAGCTGACCCAAGGGACA
GCTGCTGGAGACTACACCAAGGGGGGCTATGGCGGATCATCACAGGCACAGAACAAGTCT
GCAGGATCTGGGCCTGGCAAAGGTAGTGTCTGTCCCCTCCCCGCAAGGCTTGCAACCCAT
GGCAGCACTCGTCCCCTCCTCGTCTACTCAGAGGGCTCCTGGAGGATCGGGAGGCTGGGA
CCAGCTGCTTGCAAGAAACAAGGCTTTTCTTATCAGGAGTATCCGTGTCCTCGAGCACCA
CTGGCCTACCTGATATGACTGGTTCTGTCTACAACATGACTCAGGTGAGGAGGGCAGGTG
TATGTGGACAGGTAGATTGGTGGGAGGTCCAATCTGGCGTGGGCCTGATCTGGTCTTTAC
CCTGCAGACTTTTGACAAGCAGGGATTTCACGCAGGGACCCCTCCACCATTCACCCTGCC
CTCAGCTTTGGGCTCTACTGGGCCTCTGGCCCCTGGCACAGCCCCTGGCTATGCGCACCC
ACCGTTCTTGCACATCCTGCCCGCCCATCAGCAGCCCCACTCACAGCTCCTGCACCACCA
CCTTCCACAGGACACCCAGGTGAGTGTCCCCTTTGAACTGGAGCCAGCCTCCGCCCTGGT
CTGGGGACTCTGATCCTGCCATTACAGCCTTCCTCCTCCTCCTCCTCAGAGTGGCTCTGG
TCAGCGCAGCCAGCCCAGCTCCCTGCAGCCCAAGTCTCAAGGCTCGAAACCTGCCTATGG
CAACTCTCCGTACTGGACAAACTGAATTGTGAAGGGGGTGTGGGCTGGCTGGGGGGCTAC
CCCCAGGCAGGAGCGAACACACGGAGCTGTATCTGGGAGCCCGAAGTCTTTCTTAGAATT
CCTGAACGTGTAACTGTTGGCAGAGCATCTGTAGGGAGCCCACCTCCCAGACTCGTTGTA
CGTAATGTATTTATGTATGTATTTGTAAATGTGATCTGAGGCAGGTGGGCTGCCGGGGAG
TTAGGCCTGCTACCCTTCAAGCCCCCTCTCACTGTAGCAAAAGCAGCCCCTTCTCCTCTG
CCCTTCCTTCCTCAGTCCCTGCCCACTTGTCAGGGGAAGTCTTTGGAAGGACTGGTTTTG
GAGTGCTGGGGCCAGGTACCAATGAAGAATCACAATTTCTCTTGCACCGTTGTAAACACT
GAGGGTTTTTTGCCTATGTAAATTACTTTTCTTTCTTTTTTTTTTTTAAAAAAGAAACTG
GCTCTTTGTCAGTTGTCCTGTTCCCCTGCCAAGTTTTGACCCTGGGACGAGCAGAAAACC
TACCCTTGTCCCATGTGGCTGGGCACCTGTGTCTTCAGANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGA
GGCAGTCAATGGCCAGGGCACAGGGGCATTTTTCTTCAGGTGACCCGCTCCCTTAAGTGG
GAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1099, 42355..42432, 43606..43716, 44194..44350, 48480..48560, 56406..56460, 58837..58940, 63432..63497, 65531..65583, 70149..70216, 75180..75369, 78245..78449, 81593..81867, 82175..82344, 83128..83341, 87407..87446, 89841..89979, 90584..90638, 90640..90654, 127761..127956, 131123..131214, 131557..131604, 132676..132754, 133806..133831, 133833..134012, 134249..134348, 134434..134544, 134679..134743, 134827..135018, 135109..135204
1001..1099, 42355..42432, 43606..43716, 44194..44350, 48480..48560, 56406..56460, 58837..58940, 63432..63497, 65531..65583, 70149..70216, 75180..75369, 78245..78449, 81593..81867, 82175..82344, 83128..83341, 87407..87446, 89841..89979, 90584..90638, 90640..90654, 127761..127956, 131123..131214, 131557..131604, 132676..132754, 133806..133831, 133833..134012, 134249..134348, 134434..134544, 134679..134743, 134827..135018, 135109..135201
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved